Histophilus somni IbpA DR2/Fic in Virulence and Immunoprotectionat the Natural Host Alveolar Epithelial Barrier�
Bereket Zekarias,1 Seema Mattoo,2 Carolyn Worby,2 Jason Lehmann,1Ricardo F. Rosenbusch,3 and Lynette B. Corbeil1,4*
Department of Pathology, University of California San Diego, San Diego, California 921031; Department of Pharmacology,University of California San Diego, La Jolla, California 920932; Veterinary Microbiology and Preventive Medicine, College of
Veterinary Medicine, Iowa State University, Ames, Iowa 500113; and Department of Population Health andReproduction, School of Veterinary Medicine, University of California Davis, Davis, California 956164
Received 12 November 2009/Returned for modification 8 December 2009/Accepted 15 February 2010
Newly recognized Fic family virulence proteins may be important in many bacterial pathogens. To relatecellular mechanisms to pathogenesis and immune protection, we studied the cytotoxicity of the Histophilussomni immunoglobulin-binding protein A (IbpA) direct repeat 2 Fic domain (DR2/Fic) for natural hosttarget cells. Live virulent IbpA-producing H. somni strain 2336, a cell-free culture supernatant (CCS) ofthis strain, or recombinant DR2/Fic (rDR2/Fic) caused dramatic retraction and rounding of bovinealveolar type 2 (BAT2) epithelial cells. IbpA-deficient H. somni strain 129Pt and a Fic motif His298Alamutant rDR2/Fic protein were not cytotoxic. The cellular mechanism of DR2/Fic cytotoxicity was demon-strated by incubation of BAT2 cell lysates with strain 2336 CCS or rDR2/Fic in the presence of[�-32P]ATP, which resulted in adenylylation of Rho GTPases and cytoskeletal disruption. Since IbpA isnot secreted by type III or type IV secretion systems, we determined whether DR2/Fic entered the hostcytoplasm to access its Rho GTPase targets. Although H. somni did not invade BAT2 cells, DR2/Fic wasinternalized by cells treated with H. somni, CCS, or the rDR2/Fic protein, as shown by confocal immu-nomicroscopy. Transwell bacterial migration assays showed that large numbers of strain 2336 bacteriamigrated between retracted BAT2 cells, but IbpA-deficient strain 129Pt did not cross a monolayer unlessthe monolayer was pretreated with strain 2336 CCS or rDR2/Fic protein. Antibody to rDR2/Fic orpassively protective convalescent-phase serum blocked IbpA-mediated cytotoxicity and inhibited H. somnitransmigration across BAT2 monolayers, confirming the role of DR2/Fic in pathogenesis and correspond-ing to the results for in vivo protection in previous animal studies.
New mechanisms of virulence due to Fic family proteinsmay be significant since many bacterial pathogens have Ficgene sequences in their genomes (27). Mechanisms of actionwere reported for a few of these pathogens for the first timein 2009 based on data obtained using cell lines (14, 18, 27,28), but their importance in relevant models of pathogenesisand immune protection remains to be demonstrated. Westudied the immunoglobulin-binding protein A (IbpA) DR2/Fic cytotoxin of Histophilus somni (formerly Haemophilussomnus [1]) because we previously reproduced pneumoniaand septicemia in animals with this pathogen (7, 9) anddemonstrated that immunizing animals with IbpA DR2/Ficprovided protection (7). H. somni is an economically impor-tant pathogen of cattle and other ruminants that causesrespiratory disease, septicemia, thrombotic meningoenceph-alitis, myocarditis, arthritis, and abortion (5, 11, 16, 21, 26).This organism also can be a member of the normal flora ofthe lower reproductive tract and, to a lesser extent, theupper respiratory tract (5, 12). The pathogenesis of H. somnipneumonia, the most commonly reported syndrome in H.somni infections, and the mechanisms by which the bacteria
spread into the systemic circulation from the respiratorytract are not clearly defined.
One of the virulence factors of H. somni is immunoglobulin-binding protein A (IbpA), a secreted and surface-associatedfibrillar protein consisting of 4,095 amino acid residues. Thisprotein is transported to the bacterial surface by a two-partnersecretion pathway (13, 23). All isolates of H. somni testedproduce IbpA, except for four carrier strains, including strain129Pt, which lacks the entire ibpA gene locus (4, 25). IbpA-producing strain 2336 has been shown to be virulent in abovine pneumonia model (9, 10). Convalescent-phase bovineserum which recognizes IbpA (6, 19, 29) passively protectscalves against pneumonia (8). The N-terminal region of IbpAhas several putative adhesin domains with homology to thedomains of filamentous hemagglutinin (FHA) of Bordetellapertussis (23). The C terminus of IbpA contains several repeatsequences, including two large (400-residue) direct repeats(DR1 and DR2) (6). Each direct repeat contains a conservedFic (filamentation induced by cyclic AMP [cAMP]) motif (27).This motif was originally described in Escherichia coli as astress response protein associated with filamentous bacterialgrowth in the presence of excess cAMP (15). The Fic familyproteins all contain a conserved Fic motif, HXFX(D/E)(A/G)N(K/G)R, which is involved in the virulence of several patho-gens (14, 18, 27, 28).
We recently showed that expression of the DR2 Fic motif(DR2/Fic) in HeLa cells resulted in disruption of the cellular
* Corresponding author. Mailing address: Department of Pathology,University of California San Diego, 200 W. Arbor Drive, San Diego,CA 92103-8416. Phone: (619) 543-7314. Fax: (619) 543-6614. E-mail:[email protected].
cytoskeleton due to adenylylation and subsequent inactivationof the Rho GTPases (27). The Fic motif in DR2 was criticalsince replacement of the conserved His residue in this motif byAla eliminated cytotoxicity (27). In that study, we transfectedhuman HeLa cells with DR2/Fic. This did not reflect a physi-ologically relevant interaction of H. somni with its natural hostcells. Therefore, we developed systems for assessing theIbpA DR2/Fic function that are relevant to natural diseaseand protective immunity. Based on the previously reportedattachment of H. somni to bovine turbinate (BT) cells (24)and the location of the organism in the alveolus duringpneumonia (3, 9), we compared the cytotoxic effects of re-combinant DR2/Fic (rDR2/Fic) in BT cells, primary bovinealveolar type 2 (BAT2) cells, and the human HeLa cell lineused previously (27). We report here that treatment of thesecells with virulent H. somni strain 2336, IbpA-enriched cell-free culture supernatant (CCS), or recombinant DR2/Fic(rDR2/Fic) caused cell rounding and retraction. BAT2 cellswere the most susceptible cells, and HeLa cells were theleast susceptible cells. Retraction was shown to be due toadenylylation of Rho GTPases that resulted in cytoskeletaldisruption in BAT2 cells. Paracellular migration of virulentH. somni across a BAT2 monolayer was observed, whichsuggested a route for invasion of the bloodstream. A carrierstrain of H. somni which lacks IbpA, 129Pt, did not causecytotoxicity or transmigrate across an alveolar epithelialmonolayer. Convalescent-phase serum or antibody to DR2/Fic neutralized toxicity and prevented migration acrossBAT2 monolayers, indicating that the IbpA DR2/Fic do-main is relevant to in vivo pathogenesis and immune pro-tection against disease in the natural host.
MATERIALS AND METHODS
Bacterial strains, growth, and culture supernatant preparation. H. somnistrain 2336, a virulent pneumonic isolate previously used to induce experimentalpneumonia in calves (8, 9), and strain 129Pt, an asymptomatic carrier strainisolated from the prepuce of a normal bull (4, 25), were grown on brain heartinfusion (BHI) (BD Diagnostics, Sparks, MD) agar containing 5% bovine bloodin Alsevers solution (Colorado Serum Co., Denver, CO) at 37°C in a candle jar.Culture supernatant was prepared from H. somni cells scraped from an 18-h BHIblood agar plate, inoculated into BHI broth supplemented with 0.1% Tris baseand 0.01% thiamine monophosphate, and grown for 6 h at 37°C with shaking at200 rpm. The inocula used for the cultures were standardized spectrophotometri-cally and confirmed by plate counting to contain approximately 5 � 107 CFU.Six-hour cultures of H. somni shed minimal detectable lipooligosaccharide intothe culture supernatant in preliminary studies (unpublished data). Each culturewas centrifuged at 5,000 � g for 15 min, and the supernatant was filtered througha 0.22-�m-pore-size filter and then concentrated 40-fold in a centrifugal filterconcentrating device (Amicon Ultra) with a 10-kDa cutoff (Millipore, Billerica,MA) by about 2 h of centrifugation at 3,000 � g. The retentate was washed twicein phosphate-buffered saline (PBS) to produce a cell-free culture supernatant(CCS). Each preparation was monitored using Western blotting against rabbitantibodies to rDR2/Fic and bovine convalescent-phase serum for the presence ofIbpA.
Recombinant DR2/Fic protein production. Expression and purification of re-combinant DR2/Fic protein and mutant DR2/Fic have been described previously(27). Briefly, the ibpA DR2/Fic-encoding region was PCR amplified using prim-ers AAATCATCTCCGCAAGAAGGA and TTTTGCCAACTCTTTTAAAAAC (ibpA GenBank accession no. CP000947, locus HSM_1489) and clonedinto glutathione S-transferase (GST)-tagged plasmid vector pET41a (Novagen,Madison, WI). Recombinant DR2/Fic expressed in E. coli BL21 cells was puri-fied by glutathione affinity chromatography (Sigma, St. Louis, MO). A mutantwith a site-directed point mutation that replaced the histidine residue at position298 in DR2/Fic (residue 3717 in the IbpA sequence) with alanine (rDR2/Fic
H/A) was constructed as previously described (27) and was purified as describedabove.
Production of polyclonal antibodies. Polyclonal antibodies against the rDR2/Fic protein were produced by immunizing two rabbits with purified recombinantGST-DR2/Fic protein emulsified with Freund’s adjuvant (Cocalico Biologicals,Reamstown, PA). Blood was collected before and after immunization for prep-aration of pre- and postimmunization sera. Convalescent-phase bovine serumwas obtained from two calves (calves E5 and E7) with experimental H. somnipneumonia induced by intrabronchial inoculation of strain 2336 (9). Serumsamples were collected before infection (preimmune serum) and 6 weeks afterinduction of pneumonia, during convalescence. The specificities of these serawere evaluated by Western blotting.
Cell culture. Primary BAT2 cells were isolated from a newborn calf lungcollected in cold Hanks’ balanced salt solution (HBSS) containing gentamicin(40 �g/ml), fungizone (5 �g/ml), and cefoperazone (35 �g/ml). Finely mincedtissue was stirred to release macrophages and then digested with 0.3% DispaseII (Boehringer, Mannheim, IN) in HBSS and centrifuged at 500 � g for 10 min,and the supernatant was decanted. The pellet containing BAT2 cells was sus-pended in the last drop of Dispase solution and gently mixed with PBS containing10% horse serum. After centrifugation at 500 � g for 5 min, the pellet wasresuspended in 10 ml Dulbecco modified Eagle medium (DMEM)-keratinocytemedium (1:1) (Invitrogen, Carlsbad, CA), tissue clumps were sedimented, andthe top layer was transferred to a tissue culture flask precoated with 0.1% gelatincontaining 20% (vol/vol) fetal bovine serum (FBS) (gelatin/FBS). Cells wereincubated at 37°C in the presence of 5% CO2 and fed fresh DMEM-keratinocytemedium supplemented with 2% FBS, 5 mM L-glutamine, 0.02% lactalbuminhydrolysate, penicillin (100 U/ml), and streptomycin (100 �g/ml) (Invitrogen)every 2 days. BAT2 cells were identified by their star-shaped appearance beforethey were flattened and by their Nile Red-stained cytoplasmic vacuoles (lamellarbodies) (20), and they were used at a maximum of 13 passages. BT cells (kindlyprovided by L. J. Gershwin, University of California Davis) were grown inDMEM-keratinocyte medium, and HeLa cells were grown in DMEM supple-mented with 10% FBS, penicillin (100 U/ml), and streptomycin (100 �g/ml) at37°C in a humidified atmosphere containing 5% CO2. Cells were grown in75-cm2 culture flasks precoated with gelatin/FBS and were harvested by briefdigestion with a 0. 05% trypsin-10 mM EDTA solution (Invitrogen). For assays,cells were seeded either into 24-well tissue culture plates (5 � 104 cells/well), into12-well culture plates containing coverslips (5 � 105 cells/well), or into 8-wellchambered glass slides (Nunc, Naperville, IL) (5 � 103 cells/well). Glass slidesand glass coverslips were precoated with10 �g/ml bovine plasma fibronectin(Invitrogen) overnight at 4°C.
Cytotoxicity assay. Cells grown to about 90% confluence in chambered slidesor on glass coverslips in 12-well culture plates were treated with live bacteria,CCS, purified rDR2/Fic protein, or the rDR2/Fic H/A mutant protein. Bacteriawere harvested from an 18-h culture on BHI blood agar, resuspended in tissueculture medium without antibiotics, and incubated for 2 h at 37°C before theywere added to the cells. Bacterial counts were estimated with a spectrophotom-eter and were confirmed by counting CFU. Cells were treated with bacteria at amultiplicity of infection (MOI) of 10:1 or 100:1 (ratio of bacteria to cells), with20� CCS (final concentration) in culture medium, or with a recombinant proteinat a concentration of 20 �g/ml of culture medium without FBS. After treatmentfor 4 h, the cells were washed twice with PBS and fixed with 4% fresh para-formaldehyde for 20 min at 4°C before they were permeabilized with 0.1% TritonX-100 for 5 min and stained with rhodamine-phalloidin (Invitrogen) for 30 minat room temperature. Nuclei were counterstained with 4�,6�-diamidino-2-phe-nylindole (DAPI), and slides were mounted in Prolong antifade reagent (Invitro-gen). The number of rounded or retracted cells and the total number of cells ina field (as determined by DAPI nuclear staining) were determined for 10 sepa-rate microscope fields by using fluorescence microscopy, and means were calcu-lated. Mitotic figures were used to distinguish normal retracted or rounded cellsdue to mitosis from the rounded or retracted phenotype due to cytotoxicity.Toxicity refers to cell rounding or retraction, not necessarily cell death. Exper-iments were repeated at least twice.
In vitro Rho GTPase adenylylation assay with BAT2 and HEK293T celllysates. Mammalian cell extracts were prepared by lysing cells in lysis buffer (50mM Tris [pH 7.5], 500 mM NaCl, 1% Triton X-100, 0.1% SDS, 10 mM MgCl2,1 mM Pefabloc, 1 mM benzimidine hydrochloride, 1 �M leupeptide, 1 �M E64)and collecting the supernatant after centrifugation at 13,000 rpm in a microcen-trifuge for 10 min. Approximately 1 �g of GST-DR2 was incubated with 30 �gof HEK293T or BAT2 cell extract in 40-�l adenylylation reaction mixturescontaining 25 mM Tris-HCl (pH 7.5), 3.0 mM MgCl2, 1 mM dithiothreitol(DTT), 0.5 mM EDTA, and 1 �Ci [�-32P]ATP for 1 h at 30°C. Reactions werestopped by adding Nupage loading buffer (Invitrogen). Extract samples contain-
VOL. 78, 2010 H. SOMNI DR2/Fic CYTOTOXICITY AND IMMUNOPROTECTION 1851
ing 30 �g protein were used for Western analyses. Reaction products were sepa-rated by SDS-polyacrylamide gel electrophoresis and visualized by Coomassie bluestaining (loading controls), autoradiography, or Western blot analysis with antibodyto RhoA (Cell Signaling Technology, Danvers, MA), Cdc42 (BD TransductionLaboratories, Lexington, KY), or Rac1 (Abcam Inc., Cambridge MA).
Inhibition of cytotoxicity by serum antibody. To determine whether antibodyneutralizes the cytotoxicity of live viable bacteria or CCS for BAT2 cells,heat-decomplemented filtered-sterilized rabbit anti-DR2/Fic serum, rabbit
preimmune serum, bovine convalescent-phase serum, or bovine preimmuneserum was added to a suspension of H. somni cells (106 CFU/ml) or 20� CCSto obtain a final serum concentration of 1:100. The mixtures containingbacteria or CCS and serum were incubated with shaking for 45 min at roomtemperature for the preparation containing bacteria or at 4°C for the prep-aration containing CCS. The mixtures were then added to the BAT2 cells.After 4 h of incubation cells were washed and fixed, and the cytotoxicity wasquantified by microscopy as described above.
FIG. 1. Cell rounding and retraction caused by H. somni, IbpA-enriched culture supernatant (CCS), and rDR2/Fic protein. (A) Micrographsof BAT2 cells treated with live H. somni virulent strain 2336 or carrier strain 129Pt, with 20� CCS, or with purified rDR2/Fic protein (20 �g/ml)for 4 h. F-actin fibers were stained by rhodamine-phalloidin. The IbpA-negative strain 129Pt does not induce retraction, but live bacteria, CCS,and rDR2/fic cause cells to retract and become round. (B) Western blot analysis of strain 2336 or 129Pt CCS reacted with rabbit antibody torDR2/Fic (Rab. anti-DR2/Fic) or bovine convalescent-phase serum (Bov. conv. serum). (C and D) Percentages of rounded and retracted BAT2,BT, and HeLa cells after treatment with (C) live H. somni 2336 (MOI, 100) or (D) 20� CCS, based on the number of affected cells out of all cellsin 10 separate microscope fields (on average, each field contained 70 cells). The data are means and standard deviations for one representativeof two independent replica experiments. Live virulent H. somni and CCS were most toxic for BAT2 cells and least toxic for HeLa cells. The amountof DR2/Fic on the surface of or shed by live bacteria or in CCS was not measured; therefore, the percentages of cytotoxicity cannot be comparedamong these treatment groups. Cell types that received the same treatment were compared. (E) Percentages of rounded and retracted cells (BAT2,BT, and HeLa cells) after treatment with rDR2/Fic or the rDR2/Fic H/A mutant, both at a concentration of 20 �g/ml. The level of cytotoxicitywas calculated and data are presented as described above for panel C. Replacement of the critical His residue with Ala in the Fic motif eliminatedtoxicity.
Bacterial attachment and invasion assay. Confluent BAT2 and BT cell mono-layers in 24-well culture plates were washed three times in DMEM and infectedwith H. somni in tissue culture medium without antibiotics using an MOI of 50.Plates were centrifuged at 500 � g for 5 min and incubated for 1.5 h at 37°C ina humidified 5% CO2 incubator. Cells were then washed gently five times withPBS to remove nonadhering bacteria. The numbers of viable cell-associatedbacteria were determined by lysing cells with 0.5% Triton X-100 for 5 min atroom temperature, diluting the preparations in PBS with vigorous pipetting,plating the preparations, and counting the CFU. Preliminary experimentsshowed that treatment of H. somni with 0.5% Triton X-100 for 5 min did notdecrease the viable cell counts (data not shown). Invasion was assessed byquantifying the intracellular bacteria using a gentamicin protection assay. Afterinfection for 1.5 h and five washes to remove nonadherent bacteria as describedabove, fresh medium containing gentamicin (100 �g/ml) was added. The cellswere then incubated for 1 h, washed three times with PBS, and lysed, anddilutions were plated to count the internalized bacterial CFU.
Confocal microscopy. BAT2 cells were grown on glass coverslips in a 12-wellculture plate to 80% to 90% confluence. Cells were treated with virulent strain2336 or IbpA-negative strain 129Pt using an MOI of 10, with 20� CCS, or withrDR2/Fic protein (20 �g/ml) for 4 h as described above for the cytotoxicity assay.This step was included to determine attachment and uptake of IbpA protein.After treatment with the IbpA-containing preparations described above, cellswere washed three times with PBS, fixed with 4% paraformaldehyde, and per-meabilized or not permeabilized with 0.1% Triton X-100 for 5 min before theywere treated with rabbit anti-DR2/Fic (1:100 in 0.5% BSA in PBS) for 2 h atroom temperature. The Triton X-100 treatment was included to permeabilize thecells to the antibody in order to detect IbpA DR2/Fic which would have beentaken up during the incubation step before fixation and Triton X-100 treatment.Cells were then washed, incubated for 2 h at room temperature with Alexa Fluor488-conjugated goat anti-rabbit antibody at a 1:500 dilution, washed again, andstained with rhodamine-phalloidin for F-actin labeling and with TOPRO-3 forlabeling of nuclei (Invitrogen). Slides were dried, mounted in Prolong antifadereagent (Invitrogen), and examined with a Leica TCS SP5 confocal microscope(Leica Microsystems, Bannockburn, IL). Alexa Fluor 488 was excited with a488-nm laser, and emission was measured at wavelengths of 515 � 30 nm;rhodamine was excited at 568 nm, and emission was measured at 600 � 40 nm;and TOPRO-3 was excited at 635 nm, and emission was measured at wavelengthsof �650 nm. A series of z-section images (0.25 �m) were collected and analyzedwith ImageJ software (http://www.rsb.info.nih.gov).
Transmigration assay. BAT2 cells were grown on polycarbonate Transwellinserts (diameter, 6.5 mm) with 3 �m-pore-size filters in a 24-well plate (Corning,Cambridge, MA). The Transwell filters were first coated with gelatin/FBS, dried,and covered with DMEM for 1 h at 37°C before BAT2 cells were added at aconcentration of 2 � 103 cells/well. Cells were grown for 5 days to obtain acomplete monolayer. Then cells were washed, and 105 CFU of H. somni strain2336 or 129Pt in 80 �l cell culture medium (without antibiotics) was added toeach Transwell insert (MOI, approximately 10). The lower chamber was filledwith 250 �l of cell culture medium. After 3 h of incubation, each Transwell insertwas removed, and the contents of the lower chamber were diluted and plated onBHI blood agar plates to determine viable bacterial counts. In order to assess theeffect of antiserum on H. somni 2336 transmigration across a BAT2 monolayer,bacteria were incubated with anti-DR2/Fic serum, convalescent-phase bovineserum, or the preimmune serum controls at a 1:100 dilution for 45 min at roomtemperature before they were transferred onto a cell monolayer. In a separateexperiment to determine whether the presence of IbpA DR2/Fic resulted inmigration of strain 129Pt, a BAT2 monolayer were pretreated for 4 h with eitherpurified rDR2/Fic protein or the mutant protein (both at a concentration of 20�g/ml), H. somni 2336 20� CCS, or cell culture medium alone before thebacteria were added.
Statistical analysis. Data were analyzed by one-way analysis of variance(ANOVA) using GraphPad Prism software (GraphPad Software, La Jolla, CA).Treatment groups were compared using Bonferroni’s multiple-comparison tests.
RESULTS
Live H. somni, CCS, and purified rDR2/Fic protein causeretraction and rounding of bovine respiratory epithelial cellsand human HeLa cells. We previously showed that H. somniand its CCS are toxic for human HeLa cells (27), but it wasclear that a model relevant for the host-specific disease wasneeded. Therefore, we developed an in vitro model using cells
from the bovine upper respiratory tract (BT cells) and pulmo-nary alveolar epithelial cells (BAT2 cells). In stark contrast tothe results obtained with HeLa cells, treatment with live viru-lent H. somni strain 2336, its CCS, or rDR2/Fic protein re-sulted in robust cell rounding and retraction of BAT2 cells(Fig. 1A). Carrier strain 129Pt did not cause rounding or re-traction (Fig. 1A), nor did its CCS (data not shown). Strain2336 CCS contained abundant high-molecular-weight proteinsthat reacted with anti-DR2/Fic or convalescent-phase serum inWestern blots (Fig. 1B), indicating that IbpA was present. CCSof strain 129Pt was negative for IbpA in the same blots. Incytotoxicity tests, the BAT2 cells were the most susceptiblecells, followed by BT cells, and the human HeLa cells were theleast susceptible cells (Fig. 1C, D, and E). A mutant rDR2/Ficprotein (rDR2/Fic H/A) with the critical His residue at posi-tion 298 in the Fic motif replaced by Ala did not cause cyto-toxicity when it was used at concentrations equivalent to thoseof rDR2/Fic (Fig. 1E). These results showed that an active Ficmotif is required for IbpA-mediated cytotoxicity and thatIbpA’s effects were strongest against bovine targets relevant toH. somni disease. Since BAT2 cells were the most susceptiblecells and were the cells most relevant to disease, these cellswere used for the rest of this study.
Rho GTPases are the molecular targets of IbpA DR2/Fic inBAT2 cells. Previously, we showed that the IbpA DR1 andDR2/Fic domains adenylylate Rho GTPases and disrupt theirdownstream signaling cascades in human HEK293T epithelialcell extracts (27). Therefore, here we determined whether RhoGTPases were targets for IbpA DR2/Fic-mediated adenylyla-tion in BAT2 cells. Like control HEK293T cells, rDR2/Fic2adenylylated endogenous proteins migrated at the size of RhoGTPases (Table 1) when they were incubated with cell lysatesof BAT2 cells, as determined by autoradiography and Westernblot analysis for RhoA (Fig. 2A) or for Rac1 and Cdc42 (Fig.2B). Similar results were obtained when both cell lysates weretreated with CCS from H. somni 2336 but not when they weretreated with CCS from IbpA-deficient strain 129Pt (Fig. 2C).Since bovine and human Rho GTPases are 100% identical at theamino acid level (Table 1) and, as previously shown (27), bothrDR2/Fic and H. somni strain 2336 CCS adenylylate purifiedhuman GST-RhoA, -Rac, and -Cdc42 in vitro, data shown in Fig.2 confirm Fic-mediated adenylylation of bovine Rho GTPases.Interestingly, H. somni 2336 CCS and rDR2 displayed muchhigher intensities of radiolabeled Rho GTPases in BAT2 cellextracts than in HEK293T cell extracts, which correlates withthe much higher concentrations of RhoA, Rac1, and Cdc42 inBAT2 cells than in HEK239T cells, as determined by Westernblotting (Fig. 2A, B, and C).
TABLE 1. Homology of predicted amino acid sequences of humanand bovine Rho GTPase family proteins
Antibody neutralizes cytotoxicity. Convalescent-phase serumpassively protects against bovine pneumonia, and immuni-zation with rDR2 protein protects mice against septicemia,so we tested the abilities of bovine convalescent-phase se-rum and rabbit antibody to rDR2/Fic to neutralize cytotox-icity in vitro. Live H. somni strain 2336 and its CCS weretreated with the antisera for 45 min prior to treatment ofBAT2 cells. Both antisera reacted with high-molecular-weight IbpA from strain 2336 in Western blots (Fig. 1B).The rabbit anti-DR2/Fic and convalescent-phase bovinesera significantly decreased the cytotoxicity of live bacteriaor CCS for BAT2 cells compared with the correspondingpreimmune sera (P � 0.05) (Fig. 3A and 3B).
H. somni adheres to but does not invade BAT2 cells. Since H.somni is found in alveoli during experimental and spontaneouspneumonia (3, 9), attaches to BT cells in vitro (24), and causessepticemia (5, 11), we investigated the possibility that H. somniattaches to BT and/or BAT2 cells and then invades the cells in
FIG. 2. In vitro adenylylation of Rho GTPases by rDR2/Fic protein.(A) rDR2/Fic treatment of BAT2 and HEK293T cell lysates in thepresence of [�-32P]ATP. The transfer of [32P]AMP as visualized byautoradiography was much greater in the BAT2 cell extracts than inthe HEK293T cell extracts, although Coomassie blue staining (loadingcontrol) indicated that the protein concentrations for BAT2 andHEK293T cell lysates were similar. Western analysis with anti-humanRhoA was carried out to determine the molecular mass and migrationof endogenous RhoA in BAT2 and HEK293T cell lysates. (B) Westernanalysis of the same extracts with anti-Rac1 and anti-Cdc42. Note themuch higher concentration of Rho GTPases in the BAT2 cell lysatethan in the HEK293T lysate. (C) Treatment of BAT2 and HEK293Tcell lysates with virulent H. somni 2336 or IbpA-deficient strain129Pt CCS. A radiolabeled band corresponding to adenylylatedRho GTPases was produced only by strain 2336-treated samples. Asobserved for rDR2/Fic treatment, the level of radiolabeling was muchhigher in BAT2 cell extracts than in HEK293T cell extracts.
FIG. 3. Antibody-mediated neutralization of cytotoxicity due tolive H. somni or CCS. (A) H. somni-infected BAT2 cells. (B) CCS-treated BAT2 cells. Rabbit anti-DR2/Fic (Rab. anti-DR2/Fic) andbovine convalescent-phase (Bov. conv.) sera significantly reduce cyto-toxicity compared with the corresponding preimmune serum-treatedcells (Rab. pre. and Bov. pre.). An asterisk indicates that the value issignificantly different from the values for preimmune serum controls(P � 0.05). The data are from one experiment, and similar data wereobtained in a second experiment.
order to cross the epithelial barrier. After 1.5 h of incuba-tion with cells and washing, large numbers of H. somnibacteria were found to attach to both BT and BAT2 cells(Fig. 4). However, H. somni did not invade the cells in thegentamicin protection assay (Fig. 4). This raises two ques-tions. First, does IbpA get into cells to access Rho GTPases?Second, how does H. somni cross the alveolar epithelialbarrier to cause septicemia?
IbpA DR2/Fic attaches to BAT2 cells and is internalized.Confocal immunomicroscopy was used to determine whetherthe IbpA DR2/Fic protein binds to cell surfaces and whether itis internalized in BAT2 cells. Confocal images of BAT2 controlcells, which were not treated with H. somni or CCS but werepermeabilized and labeled with antibody to rDR2/Fic, showedno green immunofluorescence or retraction (Fig. 5A). Cellsinfected with the IbpA-negative strain 129Pt also showed noimmunofluorescence or retraction (Fig. 5B). However, in cellsinfected with H. somni 2336 and immunolabeled for DR2/Ficantigen, DR2/Fic was detected on retracting cell surfaces innonpermeabilized cells (Fig. 5C). Much more DR2/Fic antigenwas located in the cytoplasm in the z sections of retracting cellstreated with H. somni, CCS, or rDR2/Fic protein and perme-abilized with Triton X-100 before they were stained with theprimary rabbit anti-rDR2/Fic antibody (Fig. 5D, E, and F,respectively). Control cells treated with rGST protein alonewere not stained, whether they were permeabilized or notpermeabilized (data not shown). These studies showed thatIbpA DR2/Fic attaches to the cell surface and is internalized inBAT2 cells. This model provides a means to investigate themechanism of IbpA internalization in relevant host cells.
IbpA DR2/Fic induces paracellular migration of H. somniacross BAT2 cell monolayers. The data that we have obtainedso far indicate that H. somni does not gain access to the blood-
stream by invasion through BAT2 cells, so we determinedwhether H. somni crosses the alveolar epithelial barrier be-tween retracted cells by paracellular migration to cause septi-cemia. Large numbers of virulent H. somni strain 2336 cellswere recovered from the lower chambers of Transwell platesafter 3 h of incubation (about 50% of the inoculum), whethercells were pretreated with medium or cells were pretreatedwith preimmune serum (Fig. 6A). However, transmigrationwas significantly inhibited by the presence of antibody torDR2/Fic or passively protective convalescent-phase serum(P � 0.01) (Fig. 6A). Almost none of the IbpA-deficient strain129Pt cells were recovered from the lower compartment unlessthe BAT2 monolayers were pretreated with the rDR2/Fic pro-tein or the CCS of strain 2336 for 4 h to induce cell retractionbefore addition of the bacteria (Fig. 6B). Pretreatment withthe rDR2/Fic H/A mutant (with inactive Fic) did not signifi-cantly increase transmigration compared with the untreatedcontrol (P � 0.05). Both the antibody neutralization of strain2336 transmigration and the facilitation of strain 129Pt trans-migration by pretreatment with rDR2/Fic or strain 2336 CCSimplicate DR2/Fic-induced BAT2 cell retraction in paracellu-lar invasion through the alveolar epithelial barrier, as shown ina simplified model of H. somni migration between both alve-olar epithelial cells and endothelial cells to cause septicemia(Fig. 7).
DISCUSSION
This study showed that IbpA-producing H. somni strain 2336,IbpA-enriched culture supernatant of this strain, and the rDR2/Fic protein are cytotoxic for relevant host BT cells and BAT2 cellsbut have only a minimal toxic effect on the human cervical carci-noma HeLa cell line, consistent with the strict ruminant hostspecificity of H. somni (5, 11). The greater sensitivity of BAT2cells than of BT cells is consistent with the severe pulmonarydisease but mild upper respiratory disease caused by bovine H.somni infection (5, 11). The previously reported detection of H.somni or the IbpA antigen primarily in the pulmonary alveoli ofanimals with pneumonia also is consistent with the high level ofsusceptibility of BAT2 cells (3, 9). Recently, we demonstrated thatthe IbpA DR2/Fic cytotoxicity in human cell lines is due to inac-tivation of the Rho GTPases by adenylylation, which results indisruption of the cytoskeletal network (27). Here we show thatIbpA DR2/Fic adenylylates the Rho GTPases of BAT2 cells aswell. The higher intensity of adenylylation in BAT2 cells than inHEK239T cells correlates with the higher concentration of RhoGTPases in BAT2 cells. Perhaps the severe retraction and round-ing of BAT2 cells are related to the high concentration of RhoGTPases. Adenylylation of host Rho GTPases by bacterially se-creted Fic family virulence proteins is a new frontier in microbialpathogenesis, as reported in the last year (14, 18, 27, 28). Twosuch Fic-containing virulence proteins, VopS of Vibrio parahae-molyticus and AnkX of Legionella pneumophila, have been shownto access the cellular cytoplasm by type III and type IV secretionsystems, respectively (17, 28). However, IbpA is secreted to thebacterial surface by a two-partner secretion system (23), so it isnot clear how IbpA gains access to the host cell cytoplasm toinhibit Rho GTPase signaling. Our experiments show that IbpAdoes not reach the cytoplasm by invasion of the bovine epithelialcells by H. somni. Rather, IbpA released from the bacterial sur-
FIG. 4. H. somni attachment to and invasion of BAT2 and BT cells.Numbers of cell-associated or attached bacteria were determined afterincubation for 1.5 h, washing, and lysing of the cells with 0.5% TritonX-100. Similarly, the numbers of intracellular bacteria were deter-mined after treatment with gentamicin (100 �g/ml) for 1 h before lysis.In both cases viable bacterial counts were determined to quantitateattached and internalized bacteria. The data are the means � standarddeviations for six wells for one of three representative experiments.The results show that H. somni attaches to but does not invade eithertype of cells.
VOL. 78, 2010 H. SOMNI DR2/Fic CYTOTOXICITY AND IMMUNOPROTECTION 1855
face is internalized by cells, as determined by detection of DR2/Fic antigen inside cells by confocal immunomicroscopy aftertreatment of cells with live bacteria, CCS, or rDR2/Fic protein.
The lack of invasion of bovine alveolar epithelial cells by H.somni also raised the question of how this organism reachesthe bloodstream to cause septicemia. Experiments with BAT2monolayers in Transwells indicated that H. somni passes be-tween retracted BAT2 cells to cross the epithelial barrier byparacellular migration. A similar paracellular route may beused to cross the endothelial cells beneath the alveolar epithe-lial cells. Indeed, Behling-Kelly et al. (2) showed that H. somni
increased the permeability of a bovine brain microvascularendothelial monolayer. It is likely that H. somni crosses thepulmonary microvascular endothelium in a similar fashion tocause septicemia, followed by myocarditis, where large num-bers of the organism are found on the endothelial cells (16).Antibody to rDR2/Fic and convalescent-phase serum fromcalves with experimental H. somni pneumonia neutralizedIbpA DR2/Fic cytotoxicity. This confirms that the Fic domainhas a role in cell rounding and retraction. Antibody neutral-ization of in vitro cytotoxicity due to rDR2/Fic also is consistentwith the previously demonstrated immunoprotection of ani-
FIG. 5. Confocal immunomicroscopy of BAT2 cells treated with H. somni, CCS, or rDR2/Fic protein, localizing DR2 antigen on the cell surfaceor in the cytoplasm. Cells were treated with H. somni, CCS, or rDR2/Fic protein and fixed before they were either permeabilized with Triton X-100or not permeabilized, and then they were immunostained with anti-DR2/Fic serum in order to detect internalized and surface-associated antigen,respectively. Blue, TOPRO-3-stained nuclei, green, DR2 antigen labeled with Alexa Fluor 448; red, F actin stained with rhodamine-phalloidin.(A) Control BAT2 cells used to examine nonspecific antibody binding to normal nonretracted uninfected and untreated cells. (B) H. somni129Pt-infected cells that were permeabilized. No DR2/Fic antigen was detected in the BAT2 cell cytoplasm. (C) H. somni 2336 infected cells thatwere not permeabilized. Green fluorescence shows that there was DR2/Fic antigen on the retracted cell surface. (D) H. somni 2336-infected cellsthat were permeabilized with Triton X-100. The green fluorescence shows internalized DR2/Fic antigen in a retracted cell. (E) CCS-treated cellsthat were permeabilized with Triton X-100. The green fluorescence shows internalized DR2/Fic antigen in retracted cells. (F) rDR2/Ficprotein-treated cells that were permeabilized with Triton X-100. The green fluorescence shows internalized DR2/Fic antigen in retracted cells.
mals against H. somni in active immunization studies withrDR2/Fic (7) and in passive immunization studies with thesame convalescent-phase serum (8), which recognizes IbpA(29). The DR2/Fic antiserum and the bovine convalescent-phase serum also blocked bacterial transmigration across aBAT2 monolayer, suggesting that the protection against pneu-monia and subsequent septicemia may be due to prevention ofbacterial entry into the subepithelium at early stages of infec-tion in the lungs. The neutralization of both cytotoxicity andparacellular migration by antibody in this relevant bovine res-piratory alveolar barrier model along with the in vivo protec-tion is convincing evidence that IbpA DR2/Fic is involved inboth the virulence of H. somni and immunoprotection in thenatural host.
In conclusion, IbpA DR2/Fic is cytotoxic for natural hostepithelial target cells, and the relevant BAT2 cells are the mostsusceptible cells. IbpA adenylylates and inactivates BAT2 RhoGTPases, causing cell rounding and retraction due to collapseof the cellular cytoskeleton. The retraction of alveolar epithe-lial cells allows H. somni to cross the respiratory alveolar epi-
thelial barrier by paracellular migration to reach the microvas-culature. Neutralization by antisera recognizing IbpA DR2/Ficlikely accounts for immunoprotection in vivo and confirms therole of IbpA DR2/Fic in pathogenesis.
ACKNOWLEDGMENTS
This work was supported by USDA NRI grant 2005-35204-6257.We thank J. E. Dixon for critical reading of the manuscript, L. J.
Gershwin for kind provision of BT cells, and J. C. Mendez for technicalassistance. We have no competing interests.
REFERENCES
1. Angen, O., P. Ahrens, P. Kuhnert, H. Christensen, and R. Mutters. 2003.Proposal of Histophilus somni gen. nov., sp. nov. for the three species incer-tae sedis ‘Haemophilus somnus,’ ‘Haemophilus agni’ and ‘Histophilus ovis.’Int. J. Syst. Evol. Microbiol. 53:1449–1456.
2. Behling-Kelly, E., D. McClenahan, K. S. Kim, and C. J. Czuprynski. 2007.Viable “Haemophilus somnus” induces myosin light-chain kinase-dependentdecrease in brain endothelial cell monolayer resistance. Infect. Immun. 75:4572–4581.
3. Bryson, D. G., H. J. Ball, M. McAliskey, W. McConnell, and S. J. McCul-lough. 1990. Pathological, immunocytochemical and microbiological findingsin calf pneumonias associated with Haemophilus somnus infection. J. Comp.Pathol. 103:433–445.
4. Cole, S. P., D. G. Guiney, and L. B. Corbeil. 1992. Two linked genes for outermembrane proteins are absent in four non-disease strains of Haemophilussomnus. Mol. Microbiol. 6:1895–1902.
5. Corbeil, L. B. 2007. Histophilus somni host-parasite relationships. Anim.Health Res. Rev. 8:151–160.
6. Corbeil, L. B., F. D. Bastida-Corcuera, and T. J. Beveridge. 1997. Haemophi-lus somnus immunoglobulin binding proteins and surface fibrils. Infect. Im-mun. 65:4250–4257.
7. Geertsema, R. S., C. Worby, R. P. Kruger, Y. Tagawa, R. Russo, D. S.Herdman, K. Lo, R. A. Kimball, J. Dixon, and L. B. Corbeil. 2008. Protectionof mice against H. somni septicemia by vaccination with recombinant immu-noglobulin binding protein subunits. Vaccine 26:4506–4512.
8. Gogolewski, R. P., S. A. Kania, T. J. Inzana, P. R. Widders, H. D. Liggitt, andL. B. Corbeil. 1987. Protective ability and specificity of convalescent serumfrom calves with Haemophilus somnus pneumonia. Infect. Immun. 55:1403–1411.
9. Gogolewski, R. P., C. W. Leathers, H. D. Liggitt, and L. B. Corbeil. 1987.Experimental Haemophilus somnus pneumonia in calves and immunoperox-idase localization of bacteria. Vet. Pathol. 24:250–256.
10. Gogolewski, R. P., D. C. Schaefer, S. K. Wasson, R. R. Corbeil, and L. B.Corbeil. 1989. Pulmonary persistence of Haemophilus somnus in the pres-ence of specific antibody. J. Clin. Microbiol. 27:1767–1774.
11. Harris, F. W., and E. D. Janzen. 1989. The Haemophilus somnus diseasecomplex (hemophilosis): a review. Can. Vet. J. 30:816–822.
12. Humphrey, J. D., P. B. Little, L. R. Stephens, D. A. Barnum, P. A. Doig, andJ. Thorsen. 1982. Prevalence and distribution of Haemophilus somnus in themale bovine reproductive tract. Am. J. Vet. Res. 43:791–795.
FIG. 6. Migration of H. somni across BAT2 cell monolayers inTranswells. (A) Large numbers of virulent H. somni strain 2336 cellscrossed the BAT2 monolayer, and pretreatment of the bacteria withrabbit antibody to rDR2/Fic (Rab. anti-DR2/Fic) or with bovine con-valescent-phase (Bov. conv.) serum significantly (asterisk) decreasedtransmigration compared to wells treated with medium or the corre-sponding preimmune sera (Rab. pre. and Bov. pre.) (P � 0.01).(B) IbpA-negative H. somni strain 129Pt did not transmigrate across aBAT2 cell monolayer (control treated with medium). Pretreatment ofmonolayers with either rDR2/Fic protein or CCS of strain 2336 re-sulted in a significant (asterisk) increase in 129Pt transmigration com-pared to the medium control group (P � 0.01). The mutant rDR2/FicH/A protein, with the critical His residue replaced by Ala, did notsignificantly increase transmigration of strain 129Pt. The data aremeans � standard deviations for six wells in one experiment. Similarresults were obtained in a second experiment.
FIG. 7. Model of H. somni crossing of the bovine alveolar barrierdue to IbpA DR2/Fic cytotoxicity. Live H. somni and shed IbpA (or-ange dots) cause retraction of alveolar epithelial cells due to IbpADR2/Fic-mediated inactivation of the cellular Rho GTPases. Bacteriapass between retracted alveolar cells. Other workers have shown thatH. somni causes endothelial cell retraction (2) and apoptosis (22).Crossing both alveolar epithelial and endothelial barriers would resultin entry into the circulation and septicemia. Our studies showed thatbovine convalescent-phase serum, which protects against pneumoniain vivo (8), and antibody to IbpA DR2/Fic prevent transmigrationacross alveolar epithelial cell monolayers, which is consistent with invivo protection.
VOL. 78, 2010 H. SOMNI DR2/Fic CYTOTOXICITY AND IMMUNOPROTECTION 1857
13. Jacob-Dubuisson, F., C. Locht, and R. Antoine. 2001. Two-partner secretionin Gram-negative bacteria: a thrifty, specific pathway for large virulenceproteins. Mol. Microbiol. 40:306–313.
14. Kinch, L. N., M. L. Yarbrough, K. Orth, and N. V. Grishin. 2009. Fido, anovel AMPylation domain common to fic, doc, and AvrB. PLoS One4:e5818.
15. Komano, T., R. Utsumi, and M. Kawamukai. 1991. Functional analysis of thefic gene involved in regulation of cell division. Res. Microbiol. 142:269–277.
16. O’Toole, D., T. Allen, R. Hunter, and L. B. Corbeil. 2009. Diagnostic exer-cise: myocarditis due to Histophilus somni in feedlot and backgroundedcattle. Vet. Pathol. 46:1015–1017.
17. Pan, X., A. Luhrmann, A. Satoh, M. A. Laskowski-Arce, and C. R. Roy. 2008.Ankyrin repeat proteins comprise a diverse family of bacterial type IVeffectors. Science 320:1651–1654.
18. Roy, C. R., and S. Mukherjee. 2009. Bacterial FIC proteins AMP up infec-tion. Sci. Signal 2:pe14.
19. Sanders, J. D., F. D. Bastida-Corcuera, K. F. Arnold, A. C. Wunderlich, andL. B. Corbeil. 2003. Genetic manipulation of immunoglobulin binding pro-teins of Haemophilus somnus. Microb. Pathog. 34:131–139.
20. Sorokin, S. P. 1966. A morphologic and cytochemical study on the greatalveolar cell. J. Histochem. Cytochem. 14:884–897.
21. Stephens, L. R., P. B. Little, B. N. Wilkie, and D. A. Barnum. 1981. Infectiousthromboembolic meningoencephalitis in cattle: a review. J. Am. Vet. Med.Assoc. 178:378–384.
22. Sylte, M. J., L. B. Corbeil, T. J. Inzana, and C. J. Czuprynski. 2001. Hae-mophilus somnus induces apoptosis in bovine endothelial cells in vitro. In-fect. Immun. 69:1650–1660.
23. Tagawa, Y., J. D. Sanders, I. Uchida, F. D. Bastida-Corcuera, K. Ka-washima, and L. B. Corbeil. 2005. Genetic and functional analysis of Hae-mophilus somnus high molecular weight-immunoglobulin binding proteins.Microb. Pathog. 39:159–170.
24. Ward, G. E., J. R. Nivard, and S. K. Maheswaran. 1984. Morphologicfeatures, structure, and adherence to bovine turbinate cells of three Hae-mophilus somnus variants. Am. J. Vet. Res. 45:336–338.
25. Widders, P. R., L. A. Dorrance, M. Yarnall, and L. B. Corbeil. 1989. Immu-noglobulin-binding activity among pathogenic and carrier isolates of Hae-mophilus somnus. Infect. Immun. 57:639–642.
26. Widders, P. R., L. G. Paisley, R. P. Gogolewski, J. F. Evermann, J. W. Smith,and L. B. Corbeil. 1986. Experimental abortion and the systemic immuneresponse to “Haemophilus somnus” in cattle. Infect. Immun. 54:555–560.
27. Worby, C. A., S. Mattoo, R. P. Kruger, L. B. Corbeil, A. Koller, J. C. Mendez,B. Zekarias, C. Lazar, and J. E. Dixon. 2009. The fic domain: regulation ofcell signaling by adenylylation. Mol. Cell 34:93–103.
28. Yarbrough, M. L., Y. Li, L. N. Kinch, N. V. Grishin, H. L. Ball, and K. Orth.2009. AMPylation of Rho GTPases by Vibrio VopS disrupts effector bindingand downstream signaling. Science 323:269–272.
29. Yarnall, M., and L. B. Corbeil. 1989. Antibody response to Haemophilussomnus Fc receptor. J. Clin. Microbiol. 27:111–117.
