Date post: | 02-Jan-2016 |
Category: |
Documents |
Upload: | claire-osborn |
View: | 32 times |
Download: | 0 times |
How cells use DNA, part 2:TRANSLATION
An overview:Most commonly, what comes to mind is the process by which we take ideas expressed in one language, & make them intelligible in another language.
Often this means a change of script, from one we don’t understand to another we can read.
In the process of translation in a cell, the transcribed message of mRNA is translated to a totally different ‘language’, that of protein.
DNA & RNA are ‘written’ in very similar chemicals, but protein is ‘written’ in an entirely different ‘script’: amino acids.
For Translation we need:
• An ‘edited’ or ‘mature’ mRNA• Ribosomes• An unusual molecule, transfer or tRNA• Lots of available Amino Acids
The overall goal:
• Use the DNA message that was copied out into mRNA to produce a polypeptide or protein.
• This is the second part of the CENTRAL DOGMA
• It relies on the GENETIC CODE.
The tRNA:• Acts as a ‘taxi’ for
Amino Acids• Single stranded, but
folded upon itself into a clover-like shape.
• Able to bind to Amino Acids at one end, and to mRNA at the other.
• The mRNA binding end has an ANTICODON.
• Each Anticodon codes for a different Amino Acid.
The tRNA:
• Amino acids bind at the 3’ end of tRNA.
• This requires some ATP energy!
• The Anticodon binds to a complementary codon sequence on the mRNA.
• i.e. AUG codon = UAC anticodon
The Ribosome:
• Site of translation• Can be free in the
cytoplasm, or associated with the R.E.R., Golgi Body, or Nucleolus.
• Two Subunits Lg/Sm• Able to bind mRNA• Binds tRNA at one of
three sites: E (Exit), P (Peptidyl Aminoacyl) or A (Acetyl Aminoacyl)
The Ribosome:• The mRNA binds in the
groove between the large & small subunits.
• The first tRNA binds to the P Site.
• A second tRNA binds to the A Site.
• This brings the amino acids on each tRNA close enough to form a peptide bond.
• As the ribosome shifts down the mRNA, the first tRNA is bumped into the E site & is released.
The Amino Acids:• 20 different Amino Acids• All have the same basic
structure: central Carbon bound to a Hydrogen, an Amino Group (NH2) and Carboxyl Group (COOH)
• The fourth bond Carbon makes is to a variable group, abbreviated ‘R’
• Each Amino Acid has a unique ‘R’
• Some are nonpolar & hydrophobic (orange), rest are polar/HPhilic
• 2 are acidic, 3 are basic.
The Amino Acids:• During translation, the
Amino Acids ‘meet’ at the ribosome
• When they are brought close together (on the ribosome), the Amino Group of one reacts with the other’s Carboxyl Group.
• In a dehydration synthesis reaction, a peptide bond forms.
Initiating Translation:
• mRNA binds to the Ribosome
• tRNA’s carrying amino acids arrive, binding anticodon to codon
• Peptide bond forms between Amino Acids
Continuing the chain:
• The ribosome now shifts 1 codon, moving the first tRNA into the E Site, the second into the P site, and opening the A site for a new tRNA to bind.
Continuing the chain:
• Many ribosomes can bind to the same mRNA & translate it simultaneously, amplifying the amount of protein made.
Reading the mRNA:• Codons in the mRNA are
‘read’ in threes• Each three-base
combination represents a specific amino acid, & matches a tRNA anticodon
• Some amino acids have only one code; others have several
• Thus, the code is redundant.
Different forms of the Code:
Different forms of the Code:
Different forms of the Code:
How the code works:The DNA Sequence:
TAC AAA GCC TAG GAT ACA ATT
Is translated to the mRNA sequence:
AUG UUU CGG AUC CUA UGU UAA
Which in turn encodes the following sequence of amino acids in a polypeptide:
MET—PHE—ARG—ILE—LEU—CYS—(stop)
Wrapping things up:• There are three mRNA
codons that signal the end of a protein
• They are called STOP CODONS: UAA, UAG, UGA
• *in DNA, these are ATT, ATC, & ACT.
• When it reaches a stop codon, the ribosome releases the mRNA, & translation ends.
Try your hand at this:
mRNA Sequence:AUGCCUCGCAAAGGUUGCCACGUAUA
A
Amino Acid Sequence:
MET PRO ARG LYS GLY CYS HIS VAL Stop