+ All Categories
Home > Documents > How we got here Where we’re going. Shiloh Pitt/Jolie What is life? Allposters.com.

How we got here Where we’re going. Shiloh Pitt/Jolie What is life? Allposters.com.

Date post: 16-Jan-2016
Category:
Upload: moris-simpson
View: 214 times
Download: 0 times
Share this document with a friend
Popular Tags:
55
How we got here Where we’re going
Transcript
Page 1: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

How we got here

Where we’re going

Page 2: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Shiloh Pitt/Jolie http://www.sawf.org

What is life?

Allposters.com

Page 3: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Mendel 1866Watson & Crick 1953

• Where do organisms come from?

• How do organisms propagate?

Pasteur 1865Darwin 1859

Page 4: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Louis Pasteur1822 - 1895

Copyright © 1995-2004 Lucid Interactivehttp://www.lucidcafe.com/

Copyright,© 1996, 2001 David V. Cohn, Ph.D., University of Louisvillehttp://www.foundersofscience.net/interest1.htm#Spontaneous%20Generation

Louis Pasteur refutes the doctrine of spontaneous generation.1865

Page 5: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Pasteur 1865Darwin 1859

Mendel 1866Watson & Crick 1953

• Where do organisms come from?

• How do organisms propagate?

Page 6: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Then God said, "Let the earth put forth vegetation: plants yielding seed, and fruit trees of every kind on earth that bear fruit with the seed in it.” The earth brought forth vegetation: plants yielding seed of every kind, and trees of every kind bearing fruit. And God saw that it was good. 

And God said, "Let the waters bring forth swarms of living creatures…..So God created the great sea monsters and every living creature that moves... And God saw that it was good. 

Genesis I

Page 7: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Darwin sails on the voyage of the HMS Beagle.

© Copyright 2000-2004 AboutDarwin.comhttp://www.aboutdarwin.com/

1831 - 1836Darwin’s finches

taken from: http://www.rit.edu/~rhrsbi/GalapagosPages/DarwinFinch.htmlby Dr. Robert Rothman, Rochester Institute of Technology Erasmus Darwin

en.w

ikip

edia

.org

Page 8: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Down House

Page 9: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Alfred Russel Wallace1823 - 1913

© 1

998,

200

0-20

03 b

y C

harl

es H

. Sm

ithht

tp://

ww

w.w

ku.e

du/~

smith

ch/in

dex1

.htm

1858Alfred Russel Wallace sends Darwin a ms. entitled:

On the Tendency of Varieties to Depart Indefinitely from the Original Type

Page 10: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Charles Darwin1809 -1882

© Copyright 2000-2004 AboutDarwin.comhttp://www.aboutdarwin.com/pictures/Darwin/Darwin.html

Darwin publishes On the Origin of Species.1859

Page 11: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

• Where do organisms come from?

• How do organisms propagate?

Page 12: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

©MMIV, CBS Broadcasting Inc. (Photo: AP)

Like begets like

Reuters

Page 13: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Copyright 1996 by InterCity Oz, Inc.http://www.touregypt.net/magazine/mag07012001/magf5.htm

~ 6000 BCE Domestication of crops and animals

Page 14: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Darwin proposes the idea of "gemmules" as a mechanism of inheritance.

1875

© 2000-2004 AboutDarwin.com

http

://w

ww

.abo

utda

rwin

.com

/pic

ture

s/D

arw

in/D

arw

in.h

tml

The Greeks devise the theory of pangenesis:

~ 400 BCE

“From every part of the body are produced particles which Mix with the bodily fluids … and are carried by them to the testicles.... The offspring resembles its parent because the particles of the semen come from every part of the body. (Hippocrates, VII, 471-75).”

from: The Dictionary of the History of Ideas© 2003 the Gale Group

http://etext.lib.virginia.edu/cgi-local/DHI/dhi.cgi?id=dv2-69

Page 15: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

1889Francis Galton disproves pangenesis: transfusing blood from black rabbits into white rabbits fails to yield black offspring.Sir Francis Galton

1822-1911

http://www.mugu.com/galton/

Page 16: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Pasteur 1865Darwin 1859

Mendel 1866Watson & Crick 1953

• Where do organisms come from?

• How do organisms propagate?

Page 17: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Gregor Mendel publishes his findings on heredity in peas in Versuche über Pflanzen Hybriden. 1866

Mendel Museum of Genetics, Brno, Czech Republichttp://www.mendel-museum.org/eng/1online/garden.htm

Gregor Mendel1822-1884

Page 18: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Mendel’s work discovered1900

from: J. Felsenstein, University of Washington

William Bateson coins the term

GENETICS1902

Page 19: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

A. H. Sturtevant C.B. Bridges H.J. Muller

1915 The Mechanism of Mendelian Heredity

Chromosomes are the vehicles of heredity

Genes are on chromosomes

Genes can change (mutate)

T. H. Mogan

What are genes made of ???

Page 20: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Pasteur 1865Darwin 1859

Mendel 1866Watson & Crick 1953

• Where do organisms come from?

• How do organisms propagate?

Page 21: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Ernst Haeckel hypothesizes that the nucleus of a cell transmits its hereditary information.

Ernst Heinrich Haeckel 1834-1919

http://www.nceas.ucsb.edu/~alroy/lefa/Haeckel.html

1864

Robert Brown reports the widespread occurrence of nuclei in cells. 1831

 

©Copyright  Contexo.info 2002http://www.contexo.info/DNA_Basics/Nucleus.htm

Page 22: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Miescher isolates nucleic acid from nuclei of white blood cells.

© 2000 - 2003 The Center for the Advancement of Genomics (TCAG)http://www.laskerfoundation.org/news/gnn/timeline/1869a.html

Friedrich Miescher 1844-1895

1871

Page 23: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

• Chromosomes carry genetic information

AND are in the nucleus (Morgan et al.)

• The nucleus contains nucleic acid (Miescher)

1943• The nucleus transmits genetic information

(Haeckel)

Page 24: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

http://www-groups.dcs.st-and.ac.uk/~history/PictDisplay/Schrodinger.html

Erwin Schrödinger1887 - 1961

http://www.amazon.com

1944 Schrödinger asks “what is life?”

“…. I do not expect that any detailed information on this question is likely to come ……… in the near future.”

“……living matter, while not eluding the ‘laws of physics’ as established up to date,

is likely to involve ‘other laws of physics’ hitherto unknown…...”

Page 25: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Avery, McCarty and MacLeod show that

DNA is the hereditary chemical!1944

Smooth cell extract

“transforming principle”

Copyright ©2004 John W. Kimballhttp://users.rcn.com/jkimball.ma.ultranet/BiologyPages/A/Avery.html

smooth colonies(kill mice)

rough colonies(don’t kill mice)

STUDIES ON THE CHEMICAL NATURE OF THE SUBSTANCE INDUCING

TRANSFORMATION OF PNEUMOCOCCAL TYPES : INDUCTION OF TRANSFORMATION

BY A DESOXYRIBONUCLEIC ACID FRACTION ISOLATED FROM PNEUMOCOCCUS TYPE III.

Avery OT, Macleod CM, McCarty M.J Exp Med. 1944 79:137-58.

Page 26: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

• The nucleus transmits genetic information

• Chromosomes carry genetic information

AND are in the nucleus

• The nucleus contains DNA

• DNA carries genetic information

1950

Page 27: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

We have found the

secret of life!

Feb. 28, 1953

Page 28: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

April 25, 1953

Page 29: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

1962 Watson, Crick and Wilkins

win the Nobel Prize

Maurice Wilkins1916 - 2004

Rosalind Franklin1920 - 1958

Francis Crick1916 - 2004

Jim Watson1928 -

© Nature News Service / Macmillan Magazines Ltd 2003http://www.nature.com/nsu/dna50/index.html#names

Page 30: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

DNA

RNA

Protein

The Central Dogma of Molecular Biology

1950-~1970 Unravelling of how the cell decodes DNA

Page 31: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

• Where do organisms come from?

• How do organisms propagate?

Page 32: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Shiloh Pitt/Jolie http://www.sawf.org

What is life?

DNA Chemistry!

Page 33: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

DNA

RNA

Protein

1980 - ~2000 Identify all the parts

Page 34: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

1980 Fred Sanger & Wally Gilbert awarded the Nobel Prize in Chemistry

1977 Fred Sanger & Wally Gilbert

Describe methods for determiningthe sequence of nucleotides in DNA

http://www.nobel.se/chemistry/laureates/1980/

CTGGAAGAGGTATGTGCGCCGTTTCTGTTATCACAGTGTGCAATCCCATTACCGCATATCAGTTATAACAATAGTAATGGTAGCGCCATTAAAAATATTGTCGGTTCTGCAACTATCGCCCAATACCCTACTCTTCCGGAGGAAAATGTCAACAATATCAGTGTTAAATATGTTTCTCCTGGCTCAGTAGGGCCTTCACCTGTGCCATTGAAATCAGGAGCAAGTTTCAGTGATCTAGTCAAGCTGTTATCTAACCGTCCACCCTCTCGTAACTCTCCAGTGACAATACCAAGAAGCACACCTTCGCATCGCTCAGTCACGCCTTTTCTAGGGCAACAGCAACAGCTGCAATCATTAGTGCCACTGACCCCGTCTGCTTTGTTTGGTGGCGCCAATTTTAATCAAAGTGGGAATATTGCTGATAGCTCATTGTCCTTCACTTTCACTAACAGTAGCAACGGTCCGAACCTCATAACAACTCAAACAAATTCTCAAGCGCTTTCACAACCAATTGCCTCCTCTAACGTTCATGATAACTTCATGAATAATGAAATCACGGCTAGTAAAATTGATGATGGTAATAATTCAAAACCACTGTCACCTGGTTGGACGGACCAAACTGCGTATAACGCGTTTGGAATCACTACAGGGATGTTTAATACCACTACAATGGATGATGTATATAACTATCTATTCGATGATGAAGATACCCCACCAAACCCAAAAAAAATATGTGCAAAAAAATGCTTGATGATTTGTAATGAGATTGAGGAGGTTTCGAGACAGGCACCAAAGTTTTTACAAATGGAT

Page 35: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Feb. 15, 2001

Page 36: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

6000 19,00014,000

Not so many genes!

20,500

Page 37: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

How we got here

Page 38: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

How we got here

Where we’re going

Page 39: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

6000 19,00014,000

Determine function!

20,500

2001 - ???

Page 40: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

total scientists working on yeast: ~6000

How many yeast workers?

~ 1Persons / gene:

~ 1 / 7(perhaps a large sampling error…….)

fraction of yeast workers attending meeting:

~ 850attendees at yeast meeting:

Lourdes Peña-Castillo & Tim HughesGenetics 176:7

first authors, 2003-2007: 9447

Page 41: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

# of

gen

es “k

now

n”

time

Progress finding yeast protein function

Yeast Protein Database www.proteome.com

4679 proteins “known” Oct. 14, 2003

Page 42: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

# of

gen

es “k

now

n”

timeYeast Protein Database www.proteome.com

6000 proteins “known” April 1, 2007

“Solving” yeast 11.4 days

Page 43: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

• Only 38 genes with no information available

• Only 566 lack any annotations in any of the three major branches of Gene Ontology

biological processmolecular functioncellular component

Saccharomyces Genome Database (Mike Cherry et al., Stanford)

As of March 20, 2007

Lourdes Peña-Castillo and Tim Hughes (2007) Genetics 176:7

Page 44: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

YPD http://biobase-international.com/

Page 45: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

There are still 1253 uncharacterized yeast genes

—21% of all genes—

Saccharomyces Genome Database (Mike Cherry et al., Stanford)

As of March 20, 2007

Lourdes Peña-Castillo and Tim Hughes (2007) Genetics 176:7

Page 46: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

April 1, 2007

6000

1253 uncharacterized genes

Date

Progress finding yeast protein function“v

erif

ied”

gen

es

Lourdes Peña-Castillo and Tim Hughes (2007) Genetics 176:7

Jan ‘08Apr ‘05 Oct ‘10 Apr ‘16 Dec ‘18 Sep ‘21

Page 47: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

April 1, 2007

6000

Date

“ver

ifie

d” g

enes

Lourdes Peña-Castillo and Tim Hughes (2007) Genetics 176:7

Jan ‘08Apr ‘05 Oct ‘10 Apr ‘16 Dec ‘18 Sep ‘21

6000 proteins “known” 63 days April 1, 2020

“Solving” yeast

Page 48: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

gene 1 gene 2 gene 3

gene 5998 gene 5999 gene 6000

X

X

Each gene “knocked out”

gene 1 gene 2 gene 3X

Page 49: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

gene 1Each gene

overexpressedpromoter

gene 2promoter

gene 6000promoter

Page 50: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

protein 1various epitopes

tnx activation domainfluorescent proteins

protein 2various epitopes

tnx activation domainfluorescent proteins

protein 6000various epitopes

tnx activation domainfluorescent proteins

Each proteintagged withmany things

Page 51: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Protein localization imagesNucleus Nuclear periphery Endoplasmic reticulum

Bud neck Mitochondrion Lipid particle

Huh et al. et Weissman et O'Shea (2003) Global analysis of protein localization in budding yeast. Nature 425:686-91

Page 52: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Mike Tyers & Matthias Mann Nature 422: 196 2003

Page 53: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

Genomics = Resources

Golden Age of Molecular Biology

>

Page 54: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

The “post-genomic era”• comprehensive understanding of organisms

• diagnosing and predicting human disease

• repairing human disease

Page 55: How we got here Where we’re going. Shiloh Pitt/Jolie  What is life? Allposters.com.

6000 19,00014,000

The Encyclopedia of Life

20,500


Recommended