Human fibroblast-derived extracellular matrix constructs for bone tissue engineering applications

Human fibroblast-derived extracellular matrix constructs for bonetissue engineering applications

Gregory Tour, Mikael Wendel, Ion Tcacencu

Department of Dental Medicine, Karolinska Institutet, 14104 Huddinge, Sweden

Received 27 August 2012; revised 8 January 2013; accepted 14 January 2013

Published online in Wiley Online Library (wileyonlinelibrary.com). DOI: 10.1002/jbm.a.34600

Abstract: We exploited the biomimetic approach to generate

constructs composed of synthetic biphasic calcium phos-

phate ceramic and extracellular matrix (SBC-ECM) derived

from adult human dermal fibroblasts in complete xeno-free

culture conditions. The construct morphology and

composition were assessed by scanning electron microscopy,

histology, immunohistochemistry, Western blot, glycosami-

noglycan, and hydroxyproline assays. Residual DNA quantifi-

cation, endotoxin testing, and local inflammatory response

after implantation in a rat critical-sized calvarial defect were

used to access the construct biocompatibility. Moreover, in

vitro interaction of human mesenchymal stem cells (hMSCs)

with the constructs was studied. The bone marrow- and adi-

pose tissue-derived mesenchymal stem cells were character-

ized by flow cytometry and tested for osteogenic

differentiation capacity prior seeding onto SBC-ECM, fol-

lowed by alkaline phosphatase, 3-(4,5-dimethythiazol-2-yl)-

2,5-diphenyl tetrazolium bromide assay, and real-time quanti-

tative polymerase chain reaction to assess the osteogenic dif-

ferentiation of hMSCs after seeding onto the constructs at

different time intervals. The SBC-ECM constructs enhanced

osteogenic differentiation of hMSCs in vitro and exhibited

excellent handling properties and high biocompatibility in

vivo. Our results highlight the ability to generate in vitro

fibroblast-derived ECM constructs in complete xeno-free con-

ditions as a step toward clinical translation, and the potential

use of SBC-ECM in craniofacial bone tissue engineering

applications. VC 2013 Wiley Periodicals, Inc. J Biomed Mater Res Part

A: 00A:000–000, 2013.

Key Words: tissue engineering, bone regeneration, stem

cells, biomimetic materials, xeno-free culture

How to cite this article: Tour G, Wendel M, Tcacencu I. 2013. Human fibroblast-derived extracellular matrix constructs for bonetissue engineering applications. J Biomed Mater Res Part A 2013:00A:000–000.

INTRODUCTION

One of the most attractive strategies of tissue engineeringinvolves the use of three-dimensional scaffolds to supportthe growth and differentiation of mesenchymal stem cells(MSCs) to promote regeneration when implanted into injuredtissues. Most of the studies focusing on MSCs scale-up sys-tems have reported culture media supplemented with fetalbovine serum, which raises a major concern among clinicianssince it may be a source of pathogens1,2 and can be a majorobstacle in obtaining legal approvals from the national andinternational regulatory agencies. Therefore, the clinical useof MSCs requires valid xeno-free culture protocols.

The good manufacturing practice (GMP) development ofthe cell-based tissue engineering applications requiresstrictly defined logistic settings and culture conditions toensure a highly effective quality system. In this context, sev-eral clinical-grade settings have been reported to supporthigh-MSCs proliferation rates while maintaining phenotypeand multipotency.3 To date, however, no standard clinical-grade xeno-free protocol has been established for bonetissue engineering applications.

We have previously demonstrated the ability to createconstructs prepared from hydroxyapatite (HA) scaffold andrat cell-derived extracellular matrix (ECM) for bone tissueengineering applications.4–6 The aim of this study was togenerate constructs composed of bioceramic scaffold modi-fied with human fibroblast-derived ECM in completexeno-free culture conditions and assess the osteogenic prop-erties of the constructs in vitro and the biocompatibilityafter implantation into rat calvaria defects.

MATERIALS AND METHODS

Cell culture in xeno-free conditionsAdult human dermal fibroblasts (DFs) were purchased fromLonza (CloneticsTM Cat. no. CC-2511; Lot no. 0000109944).The DF (tested for HIV-1, mycoplasma, hepatitis-B, hepatitis-C, bacteria, yeast, and fungi) were expanded at a seedingdensity of 3000 cells/cm2 in sterile filtered MSC serum-freebasal medium (StemProVR MSC SFM Cat. no. A10332-01,Invitrogen), supplemented with StemProVR MSC SFM xeno-free supplement (Cat. no. A11577-01; Lot no. 824288), 200mM GlutaMAXTM-I (GibcoVR , Invitrogen), 2% human serum

Correspondence to: I. Tcacencu; e-mail: [email protected]

Contract grant sponsors: Knut and Alice Wallenberg Foundation; Swedish Research Council; Centre for Biosciences Stockholm City Council;

Karolinska Institutet and the Swedish Institute

J_ID: ZA1 Customer A_ID: JBMR-A-12-0733.R2 Cadmus Art: JBMM34600 Date: 1-March-13 Stage: Page: 1

ID: manoharj I Black Lining: [ON] I Time: 11:36 I Path: N:/3b2/JBMM/Vol00000/130031/APPFile/JW-JBMM130031

VC 2013 WILEY PERIODICALS, INC. 1

(Lonza; Cat. no. 14-402E), and antibiotic–antimycotic solu-tion (GibcoVR , Invitrogen) at 37�C and 5% CO2 with biweeklymedium change. Cell passaging was performed using Tryp-Zean animal component-free recombinant trypsin solution(Sigma-Aldrich, Product Code T 3449). Cryopreservationwas performed in Synth-a-FreezeVR protein-free cryopreser-vation medium (Catalog number R-005-50, Invitrogen).

Human bone marrow-derived stem cells (BMSCs; Poie-ticsTM human mesenchymal stem cells (hMSCs), Cat. no. PT-2501; Lot no. 0F4266) and adipose-derived stem cells(ADSCs; Cat. no. PT-5006; Lot no. 7F4028) were purchasedfrom Lonza. The cells were harvested from bone marrow of33-year old male donor or liposuction aspirate of a 29-yearold female donor, respectively. The BMSC and ADSC wereexpanded at a seeding density of 6000 cells/cm2 in Poie-ticsTM MSC basal medium (Cat. no. PT-3238; Lot no.0000229448) supplemented with SingleQuotsVR (Cat. no. PT-4105; Lot no. 0000223287) comprising mesenchymal cellgrowth supplement (Cat. no. PT-4106E), L-glutamine (Cat.no. PT-4107E) and gentamicin–amphotericin B (Cat. no. PT-4504E) at 37�C and 5% CO2 with medium changed threetimes a week. Cultures were harvested for experimentationon attaining 80% confluence. Experiments were performedwith cells that had undergone a maximum of threepassages.

Biomimetic construct preparationIn this study, 400–700 lm StraumannVR BoneCeramic gran-ules (synthetic biphasic calcium phosphate ceramic (SBC);Lot no. Y8039; AM610; Z3475) were used as a scaffold ma-terial to generate the constructs. The SBC granules weretransferred into 24-well cell culture plates (GibcoVR , Invitro-gen; 50 mg/well), and incubated overnight in serum-freebasal medium (StemProVR MSC SFM Cat. no. A10332-01,Invitrogen) supplemented with all previously describedcomponents at 37�C in a humidified atmosphere of 5% CO2.DF were seeded onto preincubated granules at the densityof 2 � 105 cells/50 mg SBC/well. To enhance the ECM syn-thesis by DF, the culture media was additionally supple-mented with 100 lg/mL ascorbic acid (Sigma-Aldrich), and2/3 of the media were changed every third day. The SBC-ECM constructs were harvested on the day 21 of static cul-ture. To remove the cells, the constructs were rinsed in Dul-becco’s phosphate-buffered saline (DPBS; GibcoVR , Invitro-gen) and treated with sterile filtered 0.5% Triton X-100containing 20 mM NH4OH in DPBS for 3 min at 37�C. TheSBC-ECM constructs were washed again with DPBS anddouble-distilled H2O and stored at �80�C until the day ofexperiments.

Cellular viabilityThe viability of the DF, BMSC, and ADSC on SBC alone, plas-tic, or SBC-ECM constructs was assessed by 3-(4,5-dimethy-thiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) colori-metric assay according to manufacturer’s instructions(Roche). The MTT assay was performed at days 1 and 21 ofculture for DF, and on days 1 and 14 of osteogenic culturefor hMSCs.

Scanning electron microscopyIn vitro-generated constructs before and after decellulariza-tion were examined by SEM in an Ultra 55 field emissionscanning electron microscope (Zeiss, Oberkochen, Germany)as described previously.4

SBC-ECM morphologyAfter decellularization, the constructs were observed grosslyat room temperature and then fixed overnight in 4% buf-fered formalin at 4�C. The specimens were embedded inTissue-Tek OCT compound (Sakura Finetek Europe BV, TheNetherlands) and frozen in liquid nitrogen. Sections of thick-ness 7 lm were cut from each frozen block. The cryosec-tions were stained with hematoxylin and eosin (HE; generalmorphology) and Alcian blue [glycosaminoglycans (GAGs)].

GAG and hydroxyproline assaysThe SBC-ECM samples were incubated in 1 mg/mL protein-ase-K with 400 mM ethylenediaminetetraacetic acid (EDTA)to solubilize the ECM, or hydrolyzed with 6 N HCl for GAGor Hyp-assay, respectively, and were processed as describedpreviously.4

DNA quantificationTo assess the total DNA content within the decellularizedSBC-ECM constructs, the specimens were mechanically proc-essed in RNAse-free water with tissue homogenizer Ultra-Turrax T25 for 10 s at 9500 rpm, and sonicated for 10 minto completely loose the SBC granules. The samples werecentrifuged, and the supernatant was assessed in NanoVuePlus Spectrophotometer (GE Healthcare, UK) at 260 nm.

SDS-PAGE and Western blotSBC-ECM constructs were incubated overnight in 4 M guani-dine–HCl extraction buffer followed by treatment with 0.5M EDTA-added extraction buffer for 72 h in shaking condi-tions at 4�C. Each precipitated protein fraction of 3 lg inLaemmli buffer and b-mercaptoethanol were electropho-resed on a sodium dodecyl sulfate polyacrylamide gel elec-trophoresis (SDS-PAGE) 4–15% minigel (Bio-Rad). Proteinswere electroblotted on the nitrocellulose membrane(Hybond-ECL, GE Healthcare, UK) in trans-blot semidrytransfer cell (Bio-Rad) and blocked in 3% milk solution. Themembranes were probed with anti-Col1 1:200 (sc-8784,Santa Cruz Biotechnology), antibone sialoprotein (anti-BSP)1:2000 (AB1854, Millipore), anti-BMP2 1:200 (ab6285,Abcam, UK), anti-Col3 1:250 (ab82354, Abcam, UK), antios-teopontin antibody 1:200 (sc-10593, Santa Cruz Biotechnol-ogy), and antivascular endothelial growth factor (anti-VEGF)1:250 (sc-7269, Santa Cruz Biotechnology) followed by incu-bation with horseradish peroxidase-conjugated secondaryantibody (1:2000, DAKO, Denmark). Proteins were detectedwith ECL Plus Detection System (GE Healthcare, UK) andvisualized using ChemiDoc XRS molecular imager system(Bio-Rad).



2 TOUR, WENDEL, AND TCACENCU IN VITRO-DERIVED ECM FOR BONE TISSUE ENGINEERING APPLICATIONS

LPS testThe chromogenic limulus amebocyte lysate QCL-1000VR test(Lonza Copenhagen, Aps, Denmark) was used to assess lipo-polysaccharide (LPS; endotoxin) level in the decellularizedSBC-ECM constructs, according to protocol describedpreviously.4

Cell seeding and osteogenic differentiation assayTo induce an osteogenic phenotype, BMSC and ADSC of pas-sage 3 were plated at 5 � 103 cells/cm2 in a 24-well cul-ture plate and after reaching 90% confluence introduced toosteoinductive medium for 21 days. Osteoblastic differentia-tion was induced with hMSC Osteogenic Differentiation Bul-letKitTM (Cat. no. PT-3002) containing osteogenic differentia-tion basal medium (Cat. no. PT-3924) and osteogenicSingleQuots KitTM (Cat. no. PT-4120), all from Lonza. Miner-alization of the ECM was visualized by staining with AlizarinRed S as described previously. Prior to cell seeding for invitro assays (alkaline phosphatase (ALP) assay, MTT assay,and gene expression studies), the SBC-ECM constructs, cor-responding 50 mg SBC content each, were transferred into24-well tissue culture plates (BD, Falcon). BMSC and ADSCwere suspended in 400 lL of basal medium and seededonto the constructs at the initial density of 5 � 104 viablecells per well. After 30 min at 37�C in a humidified atmos-phere of 5% CO2, basal medium was added to each well toa final volume of 1 mL. After 1 day, the osteogenic mediumwas used to culture cells starting from this day (day 1 ofthe experiment).

Phenotypic characterization of cellsViable ADSC and BMSC were labeled with antibodies againstCD45, CD14, CD31, CD34, CD44, CD73, CD90, CD105, HLA-1, or HLA-2, washed, and analyzed on a LSRFortessaTM cellanalyzer using FACSDivaTM software (BD Biosciences, SanJose, CA) as described earlier.7

Confocal microscopyTo assess the surface topography, the cell-seeded constructswere washed with DPBS, incubated for 40 min at room tem-perature with Alexa FluorVR 594 phalloidin solution (Cat. no.A12381, Life Technologies Co.) and 40,6-diamidino-2-phenyl-indole, (DAPI; NucBlueTM Fixed Cell Stain, Life TechnologiesCo.), and excited using respective laser wavelengths usingNikon Eclipse Ti inverted microscope system (Nikon, Tokyo,Japan). Acquisition of z-stack images composed of 35 confo-cal images (4 lm step) and three-dimensional reconstruc-tions were produced with 10� and 20� objectives usingNikon NIS elements software (Nikon, Tokyo, Japan).

ALP activity assayThe cell-seeded SBC granules and SBC-ECM on days 1, 7,and 14 were washed with DPBS, lysed with 500 ll of 0.2%Triton X-100 (Sigma-Aldrich) per well and sonicated. TheALP activity was quantified and normalized to the total cellprotein content as described previousy.6

RNA isolation and cDNA synthesisCell-seeded SBC granules and SBC-ECM constructs wererinsed twice with sterile DPBS and 100 lL lysis buffer (Qia-gen) was added. Contents of the well were transferred toQIAshredder column (Qiagen) for homogenization followedby total RNA extraction and complementary DNA (cDNA)synthesis, as described previously.6

TaqMan gene expression assaysThe difference between the messenger RNA (mRNA) levelsof the key bone-related genes in MSCs was analyzed with7500 Fast Real-Time PCR System (Applied Biosystems).Genes and related specific assays are presented in Table I.The polymerase chain reactions (PCRs) were performedwith 40 ng of the target cDNA and the relative expressionwas quantified using the DDCt method as previouslydescribed.6 Target genes were normalized against endoge-nous glyceraldehyde-3-phosphate dehydrogenase (GAPDH)and calibrated to undifferentiated cells on SBC prior toosteogenic treatment.

Animal surgeryThe experiment was approved by the Research EthicsCommittee of Karolinska University Huddinge Hospital inaccordance with the policy on human care and use of labo-ratory animals. A total of 12 adult Sprague-Dawley malerats (� 350 g) were randomly and equally divided into twogroups based on the treatment they received: (1) SBC-ECMconstructs (50 mg SBC with ECM) and (2) SBC alone (50mg SBC). The critical-size calvarial defect model was used.8

Briefly, after detachment of the periosteum, an 8-mm fullthickness circular defect was created on the left parietalregion using a trephine drill with a sterile saline irrigation.The defect area was evenly covered with the preparedimplants using periosteum elevator or dental spatula andforceps. The incisions were closed with single sutures intwo layers including the periosteum.

Tissue preparation, histology, and histomorphometricanalysisAll rats were euthanized by CO2 inhalation at 12 weeks af-ter surgery. The calvaria bone was surgically retrieved andhistologically processed. The samples were fixed in 4%

TABLE I. List of TaqMan Gene Expression Assays

Symbol Gene Name Assay ID Context Sequence

GAPDH Glyceraldehyde-3-phosphate dehydrogenase Hs99999905_m1 GGGCGCCTGGTCACCAGGGCTGCTTALP Alkaline phosphatase, liver/bone/kidney Hs00758162_m1 ACTACCTATTGGGTCTCTTCGAGCCRunx2 Runt-related transcription factor 2 Hs00231692_m1 ACCCAGAAGGCACAGACAGAAGCTTOC Bone gamma-carboxyglutamate (gla) protein Hs00609452_g1 AAAGGTGCAGCCTTTGTGTCCAAGC



ORIGINAL ARTICLE

JOURNAL OF BIOMEDICAL MATERIALS RESEARCH A | MONTH 2013 VOL 00A, ISSUE 00 3

neutral-buffered formaldehyde overnight at 4�C then decal-cified in 12.5% EDTA and embedded in paraffin; 5-lm serialsections were prepared parallel to the sagittal line andstained with HE for the assessment of the general morphol-ogy and new bone formation or Wright-Giemsa for theassessment of vascularization and inflammatory reaction.Two central sections from each specimen were analyzedusing an image-analysis software (Adobe Photoshop CS2,Adobe Systems Incorporated, San Jose, CA, and ImageJ,National Institutes of Health) by counting the pixels or usinga grid-system approach. The amount of the newly formedbone was expressed as the percentage of total newly formedbone area (NFB) to total possible area (defect area without

HA scaffold) for new bone ingrowth ¼ NFB/(total defectarea � scaffold area) � 100%. The vascularization wasexpressed as percentage per total defect area or averagevessel number, including vessel size profile.

ImmunostainingsThe calvaria tissue sections were immunostained againstCD68 (ED1; mouse monoclonal antibody, 1:500, Cat. no.MCA341GA, Serotec, UK) according to the previouslydescribed protocol.5 Two tissue sections from each calvarialspecimen were used to measure in a blinded manner theimmunostained cell distribution profiles represented inpixels per square mm using image-analysis software (Adobe

FIGURE 1. Adult human dermal fibroblasts (DFs) prior to seeding (A); MTT assay of DF after 24 h and 21 days of culture on SBC granules or

plastic (top, right), *p < 0.05; SEM image of the synthetic SBC granules alone (B); representative SEM images of the constructs topography

before (C), and after decellularization (D and E); ECM fibers cover the surface of the granules (E). Bars ¼ 100 lm (A and C), 200 lm (B and D),

and 20 lm (E). [Color figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]




Photoshop CS2, Adobe Systems Incorporated, and ImageJ,National Institutes of Health).

The MSCs on plastic or SBC-ECM at days 1, 7, and 14were immunostained against human osteocalcin (OC; 1:50,Cat. no. CA-70482.16, rabbit polyclonal, Cambio, UK) orhuman alpha-smooth muscle actin (10 lg/mL, Cat. no.MAB1420, mouse monoclonal, R&D Systems, Europe). Thecorresponding secondary antibodies (1:50, goat anti-rabbitfluorescein isothiocyanate conjugated, Ca. no. F0382, Sigma-Aldrich, or 6 lg/mL, goat anti-mouse Alexa FluorVR 488, Ca.no. A11001, Life Technologies Co.) with Alexa FluorVR 594phalloidin solution (Cat. no. A12381, Life Technologies Co.)

and DAPI (NucBlueTM Fixed Cell Stain, Life TechnologiesCo.) were used for fluorescent microscopy.

Statistical analysisThe histomorphometric data were statistically analyzed byMann–Whitney U test using the Statistica 10 softwarepackage (StatSoft). A two-tailed unpaired t-test was usedelsewhere for multiple comparisons of the ALP and geneexpression assays data. The statistical significance level wasdefined at p < 0.05. The corresponding graphical representa-tion was generated using Microsoft Office Excel (Microsoft).

FIGURE 2. The macroscopic view of the constructs prior to implantation (A); �5 (B); and �40 magnification (C). Representative light microscopy

images of the decellularized SBC-ECM constructs reveal ECM network (ECM marked with black arrows, fragments of bioceramic scaffold marked

with asterisks), hematoxylin eosin (D) and Alcian blue staining (E). Western blot analysis of the constructs (top, right) with corresponding molec-

ular weights of identified proteins. Bars ¼ 5 mm (A), 200 lm (C), and 50 lm (D and E). [Color figure can be viewed in the online issue, which is

available at wileyonlinelibrary.com.]



ORIGINAL ARTICLE


RESULTS

DF growth and ECM production in complete xeno-freeconditionsThe SEM confirmed that SBC granules had the size of 400–700 lm in diameter and a porous structure [Fig. 1(B)]. DFdisplayed good attachment and spreading on the micropar-ticles, maintaining their typical flat polygonal morphology,and displaying several filopodia stretched out onto the gran-ules [Fig. 1(C)]. MTT assay demonstrated that SBC couldsupport viability and metabolic activity of the normalhuman DF in low (2%) serum concentration (Fig. 1). Theviability rate significantly increased over the cultivationperiod and exceeded that of the cells grown on plastic for21 days. DF actively secreted ECM, entrapping SBC granules,and resulting in a compact membrane-like structure [Figs.1(D,E) and 2(A)].

SBC-ECM morphology and protein contentFollowing decellularization with Triton-X at the end of thecultivation period, the SBC granules were covered with thecontinuous dense fibrillar matrix [Fig. 2(B,C)]. The HE stain-ing proved the presence of the evenly distributed ECM indirect contact with the SBC granules [Fig. 2(D)]. The matrixwas positively stained with Alcian blue [Fig. 2(E)], indicatingthe presence of GAG.

The GAG and total collagen content in DF-generatedECM was 0.36 6 0.08 and 0.72 6 0.07 lg/mg, respectively.The residual DNA content was detected at levels lower than0.5 ng of DNA/mg construct dry weight, as assessed byspectrophotometry. The LPS level was 2.84 6 0.9 mEU/mL(endotoxin units), which corresponded to the total of 0.146 0.05 mEU/animal. Western blot analysis detected thepresence of collagen type 1, BSP, bone morphogenetic

FIGURE 3. hMSCs morphology on plastic and flow cytometry analysis; bone marrow (A) and adipose tissue-derived (B) cells.




FIGURE 4. Mineralization assay (A), hMSCs cultured for 3 weeks in osteogenic or basal (control) media, Alizarin Red S staining. hMSCs meta-

bolic activity (MTT assay) on SBC-ECM, SBC alone, or plastic (B). ALP activity of BMSC (C) and ADSC (D) on different substrates in osteogenic

(osteo) or control (ctrl) media, normalized to the total cell protein amount; *p < 0.05. Immunofluorescent detection of osteocalcin (green) in

hMSC cultures on SBC-ECM following osteogenic stimulation (E). Confocal microscopy of the MSC-seeded construct with three-dimensional ren-

dering of z-stack images obtained after 14 days in vitro culture (F and G); conjugated with DAPI (blue) and phalloidin (red). Bar ¼ 100 lm. [Color

figure can be viewed in the online issue, which is available at wileyonlinelibrary.com.]



ORIGINAL ARTICLE


protein-2, osteopontin as well as weaker signals for VEGFand collagen type 3 (Fig. 2; top right).

Biomimetic constructs enhance osteoblasticdifferentiation of hMSCsBMSC and ADSC maintained typical spindle-shaped fibro-blast-like morphology and high viability rate throughoutpassages [Fig. 3(A,B)]. Flow cytometry phenotyping of undif-ferentiated hMSCs revealed positivity for typical mesenchy-mal markers HLA-I, CD90, CD29, CD73, CD44, CD105, and

negativity for HLA-II, representative lymphoid (CD3 andCD45) and endothelial markers (CD31).

Upon osteogenic stimulation of the hMSCs seeded onplastic, mineral depositions were visible as early as day 12and continued to increase by day 21 in culture [Fig. 4(A)].The metabolic activity of ADSC and BMSC was significantlyincreased on SBC-ECM substrates compared to SBC alone af-ter 24 h in culture [Fig. 4(B)], with higher values observedfor BMSC on all substrates at day 14. No significant differ-ence in ALP activity of BMSC and ADSC was found between

FIGURE 5. Profiles of the bone-related genes expressed in BMSC and ADSC at different time intervals after seeding onto SBC alone, SBC-ECM

or plastic in osteogenic (ocm) or control (ctrl) media, as measured by RT-qPCR. The data represent the mean fold difference in expression of a

total of n ¼ 3 replicates per time point for each experimental condition normalized to GAPDH mRNA expression and calibrated to cells grown

on SBC alone, day 1 (undifferentiated cells prior to osteogenic treatment), *p < 0.05. [Color figure can be viewed in the online issue, which is





the two substrates at day 7. However, ALP activity graduallyincreased during culture, exhibiting significantly higher val-ues in ADSC on SBC-ECM after 14 days in osteogenic cul-ture, when compared with ADSC grown on SBC alone. TheBMSC had the highest ALP values on day 14 in both sub-strate groups. As expected, treatment without osteogenicsupplement resulted in lower ALP values throughout theentire cultivation period [Fig. 4(C,D)]. The OC was detectedfollowing treatment with osteogenic medium both in BMSCand ADSC seeded on SBC-ECM [Fig. 4(E)].

Real time quantitative PCR (RT-qPCR) revealed thatosteoblast-related genes such as ALP, Runx2, and OC wasupregulated reaching the highest levels at day 14 (Fig. 5).ALP and Runx2 levels for hMSCs on SBC alone were higheron day 7 followed by increased expression in both cell typeson SBC-ECM on day 14. Notably, Runx2 values on SBC-ECMwere significantly higher when compared with cells culturedon plastic in the absence of osteogenic supplements.

SBC-ECM exhibits high biocompatibilityIn general, the calvarial bone defects were filled with theSBC granules spread among fibrous connective tissue com-prising inflammatory cells, fibroblasts, and blood vessels[Fig. 6(A)]. Some granules were integrated with the islets ofthe newly formed bone that was mainly restricted to the

dural side and areas close to the host bone margins. Nodefects showed a complete bone regeneration. No statisti-cally significant difference was found among defects treatedwith SBC-ECM constructs and SBC alone with regard to theamount of the newly formed bone (Fig. 6).

A large number of CD68-positive cells, including foreignbody giant cells, was present in all defects at 12 weeks aftersurgery. However, no statistically significant difference wasobserved in CD68-positive cell amount between the twogroups [Fig. 6(B)]. Vascularization profile at 12 weeksshowed no significant difference in vessel density, size, ornumber (Fig. 7).

DISCUSSION

The European Union regulation on advanced therapy medic-inal products dictates that the procedures must be in com-pliance with the quality requirements and performed underGMP conditions (Implementing Directive 2004/23/EC,2002/98/EC, 2006/17/EC). Many have aimed at implement-ing the refined in vitro protocols for the constructproduction3,9 and MSCs expansion for tissue engineeringprocedures10 by providing more rigorous control of qualityparameters and, therefore, a more adequate compliance toGMP-grade methodology. Here we have opted for the com-plete xeno-free culture conditions throughout the entire

FIGURE 6. Representative histology of the rat calvarial critical size defects treated with SBC or SBC-ECM at 12 weeks postoperatively (A). HB:

host bone, NFB: newly formed bone; defect margins indicated by arrows and SBC granules are marked with asterisks (*); hematoxylin eosin;

bar ¼ 100 lm. Immunostained section representing morphology of CD68-positive cells (black arrowheads) at 12 weeks (B), bar ¼ 200 lm; the

multinucleated foreign body giant cells delineating the SBC granule (close-up 1); and macrophage infiltration at the periosteal aspect of the

defect (close-up 2); bars ¼ 50 lm. The profiles of the CD68 distribution area (pixels/mm2) and newly formed bone (%); box-plots represents me-

dian, upper and lower quartiles, and minimum and maximum values (n ¼ 6 animals each, p > 0.05); Mann–Whitney U test. [Color figure can be

viewed in the online issue, which is available at wileyonlinelibrary.com.]



ORIGINAL ARTICLE


in vitro production process, including cell passage and cryo-preservation, in order to fully eliminate the side effectsrelated to the use of fetal bovine serum or similar com-monly used supplements of animal origin. Furthermore, wehypothesized that SBC modified by the ECM produced bynormal human DFs could provide a three-dimensional envi-ronment and possesses necessary stimuli for enhancedosteogenic differentiation of BMSC and ADSC. The ECM hasbeen shown to act as growth factor reservoir11,12 and effec-

tively induce bone repair.13 In adition, it may provide manyactive binding sites for the domains of target growth factorreceptors.14 To produce the three-dimensional matrix withentrapped bioceramic granules, DF were cultured at highdensity with media supplemented with acorbic acid and lowconcentration (2%) allogeneic human serum. The GAG andtotal collagen content in DF-generated ECM was comparableto that of the previously generated in our former studyusing rat-derived fibroblasts.4 Moreover, Western blot

FIGURE 7. Vascularization profile of the calvaria defect at 12 weeks postoperatively. Representative morphology of the SBC and SBC-ECM-

treated defects; overview image and close-ups (A and B, respectively), Wright-Giemsa staining. HB: host bone, NFB: newly formed bone; SBC

granules marked with asterisks (*); vessel lumen indicated by black arrowheads. Box-plots represent median, upper and lower quartiles, and

minimum and maximum values (n ¼ 6 animals each); p > 0.05, Mann–Whitney U test. [Color figure can be viewed in the online issue, which is





analysis of the SBC-ECM reavealed the presence of severalbone matrix-related proteins (Fig. 2).

The deposited ECM represented a small part of the con-struct weight. However, the ECM has had a strong impact,making the construct more osteogenic. Furthermore, theLPS level in the produced SBC-ECM constructs was verylow, and thus can be considered as nonpyrogenic, accordingto the United States and European Pharmacopoeias.15 Thelow pyrogenicity of the SBC-ECM scaffolds may allow thereconstruction of even more extended bone defects, whereseveral grams of the SBC-ECM would be required. In addi-tion, the SBC-ECM constructs were easier to handle andexhibited better hemostatic properties than SBC alone,favoring clinical application in periodontal surgery and bonetissue engineering in the maxillofacial area.

The biphasic calcium phosphate bioceramic was chosenas scaffold based on its ability to degrade in vivo within aphysiologically optimized time frame, in contrast to essen-tially nonresorbable HA or relatively fast degradable b-tri-calcium phosphate.16 SBC is a clinical-grade scaffold thathas previously shown to exhibit osteoconductive propertysimilar to inorganic bovine bone17 and could enhance newbone formation in periodontal settings.18 However, itinduced limited amount of new bone when implanted aloneand was reported to have little effect on osteoblastic differ-entiation of BMSC and PDLC when cultured in vitro.19

In our study, the major part of the calvarial defect wasfilled with the SBC granules at 12 weeks after implantationtherefore limiting the space for the new bone formation.Longer term studies are necessary for better evaluation ofthe SBC-ECM osteogenic properties. Moreover, the replace-ment of the SBC with a faster degradable bioceramic mightbe also considered.

The multipotent capacity of the MSCs, the relatively sim-ple way of isolation, high ex vivo expansion potential, andimmunomodulatory properties make them attractivecandidates for cell therapy in skeletal tissue repair.20 Manyreports have demonstrated a limited ability of ADSC to dif-ferentiate along the osteogenic lineage, compared withBMSC.21,22 In contrast, De Ugarte et al.23 found no signifi-cant difference between BMSCs and ADSCs with regard totheir osteogenic capacities. In our study we observed evi-dences of BMSC and ADSC osteoblast-like differentiationwhen seeded onto SBC-ECM constructs. Anyhow, the ADSCdemonstrated a slightly superior osteoblast-like commit-ment compared to BMSC.

The local tissue reaction following biomaterial implanta-tion often dictates the success of the treatment andcomprises acute and chronic inflammation, granulation tis-sue development, and foreign body reaction wheremacrophages and foreign body giant cells are present at thebiomaterial–tissue interface.24 For assessment of biocompat-ibility, we implanted the construct or SBC alone in the calva-rial defects of nonimmunocomrpomized rats and analyzedthe distribution area of CD68þ cells (monocyte/macrophagepopulation) and the vascularization profile at the site of im-plantation. We found that the treatment with SBC-ECM con-structs triggered a moderate foreign body reaction, similar

to SBC alone treatment, indicating very little risk for localor systemic adverse effects.

Our histological findings suggest that larger animal mod-els would be required for the proper assessment of boneforming capacity of the SBC-ECM constructs due to therelatively larger size of SBC granules compared to the ratcalvaria thickness.

CONCLUSIONS

As an important step toward clinical translation, we havebeen able to implement a xeno-free methodology for theproduction of bone tissue-engineered constructs. Theresulted constructs can promote osteogenic differentiationof hMSCs in vitro, and display high biocompatibility in vivo.Altogether, the SBC-ECM construct can be considered apromising candidate for craniofacial bone tissue engineeringapplications.

ACKNOWLEDGMENTS

We would like to thank Guido Moll for assistance with flowcytometry analysis and Johannes Haag for providing help withconfocal microscopy performed at the Live Cell Imaging Unit,Department of Biosciences and Nutrition, KarolinskaInstitutet.

REFERENCES1. Santos F, Andrade PZ, Abecasis MM, Gimble JM, Chase LG,

Campbell AM, Boucher S, Vemuri MC, Silva CL, Cabral JM.

Toward a clinical-grade expansion of mesenchymal stem cells

from human sources: A microcarrier-based culture system under

xeno-free conditions. Tissue Eng Part C Methods 2011;17(12):

1201–1210.

2. Tonti GA, Mannello F. From bone marrow to therapeutic applica-

tions: Different behaviour and genetic/epigenetic stability during

mesenchymal stem cell expansion in autologous and foetal

bovine sera? Int J Dev Biol 2008;52(8):1023–1032.

3. Salvade A, Belotti D, Donzelli E, D’Amico G, Gaipa G, Renoldi G,

Carini F, Baldoni M, Pogliani EM, Tredici G, Biondi A, Biagi E.

GMP-grade preparation of biomimetic scaffolds with osteo-differ-

entiated autologous mesenchymal stromal cells for the treatment

of alveolar bone resorption in periodontal disease. Cytotherapy

2007;9(5):427–438.

4. Tour G, Wendel M, Tcacencu I. Cell-derived matrix enhances

osteogenic properties of hydroxyapatite. Tissue Eng Part A 2011;

17(1–2):127–137.

5. Tour G, Wendel M, Tcacencu I. Bone marrow stromal cells

enhance the osteogenic properties of hydroxyapatite scaffolds by

modulating the foreign body reaction. J Tissue Eng Regen Med

2012. DOI: 10.1002/term.1574.

6. Tour G, Wendel M, Moll G, Tcacencu I. Bone repair using peri-

odontal ligament progenitor cell-seeded constructs. J Dent Res

2012;91(8):789–794.

7. Moll G, Jitschin R, von Bahr L, Rasmusson-Duprez I, Sundberg B,

Lonnies L, Elgue G, Nilsson-Ekdahl K, Mougiakakos D, Lambris

JD, Rind�en O, Le Blanc K, Nilsson B. Mesenchymal stromal cells

engage complement and complement receptor bearing innate

effector cells to modulate immune responses. PLoS One 2011;

6(7):e21703.

8. Tcacencu I, Wendel M. Collagen–hydroxyapatite composite

enhances regeneration of calvaria bone defects in young rats but

postpones the regeneration of calvaria bone in aged rats. J Mater

Sci Mater Med 2008;19(5):2015–2021.

9. Salvade A, Della Mina P, Gaddi D, Gatto F, Villa A, Bigoni M, Per-

seghin P, Serafini M, Zatti G, Biondi A, Biagi E. Characterization

of platelet lysate cultured mesenchymal stromal cells and their

potential use in tissue-engineered osteogenic devices for the



ORIGINAL ARTICLE


treatment of bone defects. Tissue Eng Part C Methods 2010;16(2):

201–214.

10. Lange C, Cakiroglu F, Spiess AN, Cappallo-Obermann H, Dier-

lamm J, Zander AR. Accelerated and safe expansion of human

mesenchymal stromal cells in animal serum-free medium for

transplantation and regenerative medicine. J Cell Physiol 2007;

213(1):18–26.

11. Badylak SF, Freytes DO, Gilbert TW. Extracellular matrix as a bio-

logical scaffold material: Structure and function. Acta Biomater

2009;5(1):1–13.

12. Badylak SF. The extracellular matrix as a scaffold for tissue recon-

struction. Semin Cell Dev Biol 2002;13(5):377–383.

13. Lutolf MP, Weber FE, Schmoekel HG, Schense JC, Kohler T, Mul-

ler R, Hubbell JA. Repair of bone defects using synthetic mimetics

of collagenous extracellular matrices. Nat Biotechnol 2003;21(5):

513–518.

14. Reilly GC, Engler AJ. Intrinsic extracellular matrix properties regu-

late stem cell differentiation. J Biomech 2010;43(1):55–62.

15. Magalhaes PO, Lopes AM, Mazzola PG, Rangel-Yagui C, Penna

TC, Pessoa A Jr. Methods of endotoxin removal from biological

preparations: A review. J Pharm Pharm Sci 2007;10(3):388–404.

16. LeGeros RZ. Properties of osteoconductive biomaterials: Calcium

phosphates. Clin Orthop Relat Res 2002(395):81–98.

17. Cordaro L, Bosshardt DD, Palattella P, Rao W, Serino G, Chia-

pasco M. Maxillary sinus grafting with Bio-Oss or Straumann

bone ceramic: Histomorphometric results from a randomized con-

trolled multicenter clinical trial. Clin Oral Implants Res 2008;19(8):

796–803.

18. Zafiropoulos GG, Hoffmann O, Kasaj A, Willershausen B, Weiss

O, Van Dyke TE. Treatment of intrabony defects using guided

tissue regeneration and autogenous spongiosa alone or com-

bined with hydroxyapatite/beta-tricalcium phosphate bone sub-

stitute or bovine-derived xenograft. J Periodontol 2007;78(11):

2216–2225.

19. Mrozik KM, Gronthos S, Menicanin D, Marino V, Bartold PM.

Effect of coating Straumann(R) bone ceramic with emdogain on

mesenchymal stromal cell hard tissue formation. Clin Oral Inves-

tig 2012;16(3):867–878.

20. Mosna F, Sensebe L, Krampera M. Human bone marrow and adi-

pose tissue mesenchymal stem cells: A user’s guide. Stem Cells

Dev 2010;19(10):1449–1470.

21. Im GI, Shin YW, Lee KB. Do adipose tissue-derived mesenchymal

stem cells have the same osteogenic and chondrogenic potential

as bone marrow-derived cells? Osteoarthritis Cartilage 2005;

13(10):845–853.

22. Hayashi O, Katsube Y, Hirose M, Ohgushi H, Ito H. Comparison of

osteogenic ability of rat mesenchymal stem cells from bone mar-

row, periosteum, and adipose tissue. Calcif Tissue Int 2008;82(3):

238–247.

23. De Ugarte DA, Morizono K, Elbarbary A, Alfonso Z, Zuk PA, Zhu M,

Dragoo JL, Ashjian P, Thomas B, Benhaim P, Chen I, Fraser J,

Hedrick MH. Comparison of multi-lineage cells from human adi-

pose tissue and bone marrow. Cells Tissues Organs 2003;174(3):

101–109.

24. Anderson JM, Rodriguez A, Chang DT. Foreign body reaction to

biomaterials. Semin Immunol 2008;20(2):86–100.




Date post:	05-Dec-2016
Category:	Documents
Upload:	ion
View:	216 times
Download:	3 times

Human fibroblast-derived extracellular matrix constructs for bone tissue engineering applications

Documents