Molecular Genetics Lab to the Neurology Clinic

Goals

• Increase understanding of the neuropathology and clinical presentation of HD

• Review basic genetics

• Understand principles of management of HD patients

• Discuss HD research endeavors

Historical Aspects

1872 George Huntington, MD, described a neurological disorder that later came to bear his name

“….The hereditary chorea, as I shall call it, is confined to certain and fortunately few families and has been transmitted to them, an heirloom from generations away back in the dim past….”

“….There are three marked peculiarities of this disease: 1 hereditary nature; 2. tendency to insanity and suicide; 3. manifesting itself as a grave disease in adult life.”

Historical Aspects of HD

• 1955 Amerigo Negrette arrived as local physician in fishing village outside of Maracaibo, Venezuela shocked to see many of the villagers staggering around as if drunk with an illness known locally as El Mal de San Vito, or St. Vito’s Dance. Dr. Negrette realized that this was the same disease described by Huntington (Huntington’s Chorea).

• 1972 Physicians and scientists from around the world assembled in Ohio to discuss the rare disorder on the 100th anniversary of Dr. Huntington’s original paper. A movie of the Venezuelan village filled with HD patients was shown, the largest known population.

Nancy Wexler, PhD

• Hereditary Disease Foundation

• Led scientists and physicians to Maracaibo, Venezuela since 1981 to study families with HD; collected blood/DNA samples from 4,000 individuals across 8 generations

• USA-Venezuela Collaborative Huntington’s Project developed

• HD gene marker was discovered in 1983 at MGH (Gusella et al.) and ultimately the gene itself discovered 1993 by the Huntington’s Disease Collaborative Research Group.

Gross anatomy and pathology

Neuropathology of HD

• HD involves atrophy and cell death of the basal ganglia, the complex subcortical structures involved in control of motor movement, cognition and sensory pathways.

• Specifically, progressive and marked degeneration of caudate and putamen (striatum).

•

Neuropathology

• There are different types of neurons and neurotransmitters in striatum, and balanced interaction between dopamine, acetylcholine, and GABA play vital role in regulating motor movements..

• Striatal gamma aminobutyric acid (GABA-ergic) medium spiny neurons are most vulnerable to cell death in HD..

• GABA normally has inhibitory effect on thalamus and tells cortex to ‘brake’ movement.

Neuropathology

• Selective loss of these specialized cells results in decreased inhibition (i.e., increased activity) of the thalamus.

• Thalamus increases output to certain regions of the cerebral cortex. This may lead to the disorganized, excessive (hyperkinetic) movement patterns of chorea.

• As disease progresses, damage to other pathways and dopamine receptors cause decreased stimulation to cortex and thus rigid bradykinetic features.

Degeneration of Basal Ganglia

MOLECULAR BIOLOGY

Genetics Review

• Instructions providing all information necessary for living organism to grow and function reside in the nucleus of cells.  

• These instructions come in form of a complex molecule called DNA (Deoxyribonucleic Acid).

Examples of Triplet (or Trinucleotide) Repeat Diseases

Central dogma of biologyCentral dogma of biology

DNADNA RNARNA PROTEINPROTEINtranslation

replication

transcription

FUNCTIONALFUNCTIONAL(NATIVE)(NATIVE)PROTEINPROTEIN

FUNCTIONALFUNCTIONAL(NATIVE)(NATIVE)PROTEINPROTEIN

folding,assembly,targeting

degradation (turnover)amino acids,

peptides

cellularproteins

cellularproteins

regulation of conformation/

function

cellularproteins

Cellular processes involvingCellular processes involvingnon-native proteins: non-native proteins: folding and assemblyfolding and assembly

• proteins are synthesized on the ribosome and must fold/assemble to become native

- proteins are synthesized as unfolded polypeptide chains - folding occurs co-translationally

- folding (and assembly) to the native state requires the complete

polypeptide chain

folding

assembly

Cellular processes involvingCellular processes involvingnon-native proteins: non-native proteins: refoldingrefolding

cellular stress

Nativeprotein

non-native(unfolded)

protein

heat/cold

proteotoxicchemicals

intracellularchanges

aggregatedprotein

various cellularproteins

Cellular processes involvingCellular processes involvingnon-native proteins: non-native proteins: degradationdegradation

unfolding proteolysis

Protein destinedfor degradation

peptides

antigenpresentation

proteolysis

aminoacids

* * *

*steps involve varioussteps involve variouscellular machineriescellular machineries

Cellular processes involvingCellular processes involvingnon-native proteins: non-native proteins: quality controlquality control

refolding

non-nativeprotein unfolding

degradationrefolding

Nativeprotein

Nativeprotein

peptides,aminoacids

Huntingtin Protein

• Cytoplasmic protein found in almost all tissues of the body and brain

• Normal function is not well understood, yet implicated in cell membrane recycling and neuroprotection.

• Huntingtin protein thought to play important role in early development in mice models (where knockout of huntingtin gene are embryonic lethal).

• Effects of HD suggest that huntingtin protein regularly interacts with other proteins found only in brain, and that altered form of huntingtin protein leads to nerve cell death in brain.

How much CAG expansion is too much?

• People with 6 to about 35 copies of CAG have a normally functioning form of the huntingtin protein.

• Expansion of 40 or more CAG repeats is often full penetrance and the person will develop HD.

• For people who have 36 to 39 copies of CAG, the outcome is less clear. Some will develop the symptoms of Huntington's disease and some will not.

Categories of CAG Repeat Sizes

…CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG…

26 27 35 36 39 40

Unaffected “Mutable” Unaffected“Reduced Penetrance” Affected

Repeat may be unstable when larger than 26 repeats

Genotype-Phenotype Correlations

• There is a negative correlation between number of CAG repeats and age of onset.

• Individuals with adult onset HD usually have 35-55 CAG repeats.

• Patients with very late onset tend to have repeats in 36-38 low abnormal range.

• Anticipation, a phenomenon in which increasing disease severity and earlier onset is observed in successive generations, can occur in HD and most often through paternal transmission (instability of CAG repeat during spermatogenesis).

• Individuals with CAG repeats 60+ often present with Juvenile HD.

H

h

h h

Hh

hh hh Off

spri

ng

HhMaleHh

Femalehh

eggs

sperm

AllelesH = Huntingtonh = Normal

Genotypes-PhenotypesHH - HuntingtonHh - Huntingtonhh - normal

Each child would have a 50% chance of having Huntington Disease

Imaging

Brain Imaging studies in HD: Striatal degeneration and atrophy

• Caudate and putamen hypometabolism and volume loss begins before symptom onset.

• Some evidence of patchy cortical thinning more prominent over posterior cortical regions and proceeded to anterior cortical regions with disease progression, and more prominent in left striatum.

• Atrophy to thalamic subnuclei projecting to prefrontal areas, substantia nigra, nuclei of hypothalamus, small regions of hippocampus, Purkinje cells of cerebellum.

Clinical Features

Clinical Features of Huntington’s Disease

• Progressive neurodegenerative disorder characterized by atrophy of basal ganglia causing triad of cognitive, motor and psychiatric impairments. There is no cure for HD.

• Inherited autosomal dominant disorder with 50% chance of inheriting mutant gene from affected parent.

• In western European and USA prevalence higher at about 7-10 per 100, 000) affected with >150,000 at risk. Lower in Asian and African populations.

Clinical Features

• Typically adult onset disorder with mean age onset 35-44 years (range 2 to 80 years).

• <20% first display symptoms of the disease after age 50 and have a slower progression.

• <10% cases are juvenile HD with onset before age 20 years.

• Median survival after onset is 15-18 years (range 5-25 years) with average age at death 54 years.

Motor Abnormalities: Early/Mid HD

• Chorea = Abnormal, often rapid, involuntary, unpredictable movements hallmark of the disease onset present in most adult cases.

• Chorea appears as subtle to prominent uncontrolled jerking movements of the limbs, trunk, face and oral motor structures.

• Motor impersistence, the inability to maintain voluntary muscle contraction at constant level.

• Motor speed and coordination, fine motor control, postural stability/balance and gait progressively worsen.

• Abnormal oculomotor function including initiating ocular saccades, slow scanning, and problems in gaze fixation.

Motor Abnormalities: Later Disease

• Dystonia = Prolonged co-contractions of antagonistic muscle groups causing slow, sustained movements and abnormal postures

• Bradykinesia and rigidity often increases causing inability to move or care for oneself.

• Ocular motor disturbances may be seen in as much as 75% of individuals.

• Subgroup of adult-onset HD patients with more predominant dystonia and rigidity, and paucity of chorea throughout course of disease sometimes referred to ‘rigid-akinetic’ subtype.

Motor Speech Impairments: Hyperkinetic Dysarthria of Speech

(Darley, Aronson, Brown 1969; Duffy 1995)

• Oral mechanism exam often reveals normal structure, symmetry of face, lips, tongue, jaw, palate.

• Speech tasks such as conversation, oral reading, vowel prolongation, are very useful to detect articulatory breakdown, rate and prosody changes, phonatory-respiratory discoordination

• Choreiform movements characterized by quick, unpatterned involuntary head/neck, jaw, face, tongue, palate, pharyngeal, laryngeal, and/or thoracic and abdominal movements at rest and during movement

• Dystonia or slower waxing/waning movements or postures of of above speech mechanism substrates

Primary Hyperkinetic Dysarthria in HD

• Articulation: Imprecise consonants, distortions and irregular breakdowns

• Phonation-Respiration: Sudden forced inhalation/exhalation, voice stoppages, transient breathiness or strained-harsh (especially if dystonia presentation) voice quality, excess pitch or loudness variation

• Resonance: Intermittent hypernasality

• Prosody: Prolonged phonemes, variable rate and stress patterns, inappropriate silences, short phrases

Dysphagia: Common and Progressive(Kagel and Leopold 1992)

• Hyperextension of head and trunk

• Lingual chorea and decreased ability to orally control bolus

• Rigidity of neck and/or mandible in bradykinetic subgroup

• Absent or inefficient chewing

• Intraoral retention and segmented bolus transfer

• Premature loss of control and bolus spillage into pharynx

• Swallow timing and coordination deficits

Swallowing impairments

• Delayed swallow onset with advanced disease

• Decreased pharyngeal contraction and clearance

• Laryngeal penetration and aspiration

• Unpredictable inhalation/ respiratory-swallow discoordination

• Frequent belching (especially those with chorea)

• Impaired cognition strongly impacts, ? Intra-oral sensory deficits

• ‘Tachyphagia’ or behavioral impulsivity very common increasing risks for choking and airway obstruction

Nutrition:

• Weight loss common in HD patients with chorea and this often in context of increased appetite and eating (and increasing swallowing problems).

• Studies formally evaluating metabolism and energy expenditure reveal that 24-hour resting energy expenditure up to 14% higher in HD patients with chorea than in controls matched for age, sex and body mass.

• Loose correlation higher body weight with slower progression of adult disease.

• Our Neurologists recommend that HD patients be 10% above ideal body weight.

Cognitive Impairments

• Visuospatial (scanning and perceptual skills)

• Executive Function: cognitive planning and sequencing, spatial working memory, cognitive flexibility and shifting set

• Memory: slowed learning rates, impaired delayed free recall which improves significantly with cued recall/recognition, preserved retention rates

• Language: Word finding deficits, decreased phrase length and syntactic complexity, decreased comprehension of complex information

• Cognitive-communication impairments vary in onset and severity in early-mid disease and progresses to dementia in advanced HD

Psychiatric Symptoms

• Can occur in any stage of disease and do not follow clear progression (or relation to CAG repeat)

• May be present before motor symptoms and mistaken for other primary psychiatric illnesses (such as schizophrenia, bipolar)

• Dysfunction of frontostriatal pathways implicated in psychiatric symptoms

Psychiatric Manifestations

• Depression

• Apathy

• Irritability/Outbursts

• Anxiety

• Impulsivity

• Obsessive-compulsive disorder (26-52%)

• Aggressive Behavior

• Disinhibition

• Psychosis (3-12%)

• Suicide (5.7 to 13% higher than general population)

Juvenile HD (Westphal variant)

• Defined as onset of symptoms before age 20, accounts for <10% cases.

• Prominent features are marked bradykinesia, rigidity, ocular motor disturbances tremor and cerebellar symptoms (Purkinje cells death) present. Chorea less dominant.

• Behavioral & psychiatric disturbances, impaired global cognitive function, oral motor dysfunction, language delay and seizures.

Treatment, Recent approaches

To Be Continued…..

Genetic Testing for HD Gene Mutation

• Guidelines for genetic testing have been developed by the Huntington’s Disease Society of America (HDSA), the Huntington’s Disease Society of Canada, and the International Huntington Association, in conjunction with the World Federation of Neurology Research Group on Huntington’s Chorea.

• HDSA Centers of Excellence: 21 specialty clinics at medical centers throughout USA where medical care, counseling, genetic testing, and clinical trials offered.

• Test to determine gene status is done using a blood sample from individual at risk and highly accurate.

HD Testing Guidelines:

Step 1: Pretest Genetic Counseling

Step 2: Neurological Examination

Step 3: Psychological Screening

Step 4: Post-Test Follow-up

Indications for Genetic Testing

• Adult PresymptomaticTesting: An individual at 50% risk of HD from affected parent and not showing signs of disease. Not currently recommended on anyone <18 yrs of age.

• Confirmation/Symptomatic Testing: For individuals exhibiting signs of disease wanting to know their gene status, or MD confirmation of disease process.

• Prenatal Testing: Allows the prospective parent who has the HD allele or is at risk to discover the genetic status of fetus. Prenatal procedures currently available are amniocentesis and chorionic villus sampling (CVS). Preimplantation Genetic Diagnosis: Allows parents at risk for passing HD gene to determine prior to IVF/embryo implantation if embryos possess HD allele.

Management

• Evaluation at initial diagnosis to establish extent of disease including thorough medical and neurological exam, collection of detailed family and patient history.

• Unified Huntington’s Disease Rating Scale (1996, Huntington’s Study Group) used to provide reliable and consistent assessment of clinical features and progression of HD.

-Motor section: oculomotor, dysarthria, chorea, dystonia, gait, postural stability-Cognitive section: verbal fluency, symbol Digit, Stroop color, Stroop reading,

Stroop interference- Functional Capacity Scale, Independence Scale

• Long-term follow-up with multidisciplinary team including Neurologist, Social Work, Geneticist , Psychiatrist, Speech Pathologist, Nutritionist, PT, OT.

Treatment: Supportive

PHARMACOLOGIC• Choreic movements may be partially suppressed by

neuroleptics (Tetrabenazine, Respirdal, Seroquel, Zyprexa, Haldol) or benzodiapines (Valium, Ativan, Klonopin).

• Anti-parkinsonian agents may ameliorate rigidity, however, L-dopa compounds (Sinemet) can increase chorea.

• Psychiatric disturbances such as depression, aggression, OCD, psychotic symptoms respond well to psychotropic drugs (SSRIs Prozac, Paxil, Celexa) or anti-epileptic medications (Valproic acid).

Therapy Services:Degenerative Disease Model

• Supportive treatment with attention to psychosocial issues and community and home care services.

• SLP: speech intelligibility and functional communication strategies, cognitive-behavioral strategies, swallowing, caregiver education and training

• PT: balance/gait, joint range, muscle strength & aerobic capacity, dystonia management, adaptive equipment for safety.

• OT for to maximize functional independence with ADLs, adaptive feeding equipment.

Research: Huntington Study Group (HSG)

At-Risk & Observational Research Studies-Repository of data including blood/biological samples, genetic testing, UHDRS evaluations, family information, and brain imaging on presymptomatic, symptomatic, and some gene negative subjects

– PHAROS: Prospective Huntington at Risk – PREDICT-HD: Neurobiological Predictors of HD– COHORT: Cooperative Huntington’s Observational Research Trial

Experimental Clinical Compounds Transgenic Mouse Models of HD allow scientists to study processes

that cause neurons to die in HD, and assess drug therapies that may slow disease progression

Human Clinical Trials: Huntington Study Group

• Compounds must cross blood-brain barrier

• Research focus on finding potential blood or brain imaging biomarkers of HD to measure effectiveness of treatments

• Drugs in human clinical trials include Creatine, Coenzyme Q-10, omega-3 fatty acid Ethyl-EPA, Minocycline, Phenylbutyrate, Riluzole which have shown potential neuroprotective benefits in mouse models

Creatine and HD

• Creatine is a critical element in cellular energy production and modulation. It is the substrate of the creatine kinase system which helps prolong cellular life and protect against cell injury and death.

• Hersh et al. Neurology 2006, Randomized, double-blind, placebo-controlled study in 64 subjects with HD, 8 g/day of creatine administered x 16 weeks was well tolerated and safe. Serum and brain creatine concentrations increased in the creatine-treated group and returned to baseline after washout.

• BIOMARKER: Serum 8-hydroxy-2'-deoxyguanosine (8OH2'dG) levels, an indicator of oxidative injury to DNA, were markedly elevated in HD and reduced by creatine treatment.

• Dose escalation study revealed 30g/day creatine as optimal dose for sustained suppression of 80H2’dG to normal levels and sustained reduction in brain atrophy on MRI morphometry.

Proposed Creatine Study: Creatine Safety, Tolerability, & Efficacy In Huntington’s Disease (CREST-E)

Randomized, double-blinded, placebo controlled trial of 30 grams of creatine/day x 36 months in early symptomatic patients with HD proposed to test hypothesis that creatine will slow progressive

functional decline in HD.

Research Team at MGH

• Normal Huntingtin Function

• Mitochondria and Energy Metabolism (understand if huntingtin interacts directly with mitochondria and how does expanded glutamine impact)

• Folding, Aggregation and Clearance of Mutant Huntingtin (understand role of huntingtin protein misfolding, aggregation and how to stop or reverse)

HD Research Teams

• Huntingtin Proteolysis and Posttranslational Modification (preventing breakup/cleavage of mutant huntingtin that may cause neuronal dysfunction)

• Transcription (understand how mutant huntingtin disrupts normal gene activation and disrupts normal cell function)

Pro

tein

La

bo

rato

ry,

Un

ive

rsit

y o

f C

op

en

ha

ge

n

A neuron in yellow that contains the disease-associated version of the huntingtin protein, seen as the orange-red structure in the center of the cell. (Steven Finkbeiner, Nature, October 13, 2004, Vol. 431, No. 7010, pp. 805-810. )

HD brain and age-matched control brain

An area in the brain cortex (yellow) of people who are carrying a mutant Htt gene but have not yet developed Huntington's symptoms has lower activity during a cognitive task than it does in noncarriers.

DNA- Blueprint of life

• DNA comes in compact form of a twisted ladder shape molecule called a double helix.

• Composed of a string of nucleotides. The 4 units are adenine (A), thymine (T), cytosine (C), and guanine (G).

• Sequence of these bases provides the chemical information or “instructions” for inheritance.

HD = Huntingtin protein with expanded CAG (glutamine) tract

Genes

• “Functional” regions of DNA that contain specific instructions are called genes.

• Example would be regions of DNA that code for making proteins.

• Our bodies contain thousands of different proteins. Proteins have many different jobs: they help the cell maintain structure, produce energy, and communicate with other cells.

• Huntingtin protein is found throughout our body.

Protein must be folded normally to function. Mutant expansion of CAG causes an unusual huntingtin protein which clumps together in the cell and causes neuronal cell death (in the brain only)

Genetic Mechanism of HD: Unstable Trinucleotide repeat

• The gene responsible for causing HD is located on chromosome 4. The gene regulates the production of huntingtin protein.

• Huntingtin protein contains within it the amino acid glutamine. DNA sequence C-A-G (cytosine-adenine-guanine) codes for glutamine. In people with HD, however, there is an excess number of glutamine.

• People with HD have too many copies of C-A-G in the DNA that codes for huntingtin protein. That is why HD is often referred to as a trinucleotide repeat disorder