54
IB Chemistry III Booklet Class: Ms. Manakul Student Name: ____________________ Student Hour: _________
IB Chemistry III
Booklet
Class: Ms. Manakul
Student Name: ____________________
Student Hour: _________
Table of Contents
I. Syllabus page i
II. School Safety Drills page iv
III. Lab Safety Contract page v
IV. Unit Objectives page vii
V. Homework
Unit 11: Organic Chemistry Continued page 1
Unit 12: Biochemistry page 9
VI. Labs
Testing for an Aldehyde page 21
Polymers page 23
Plant Pigment Separation Lab page 25
VII. Appendix
VESPR Sheet page A
IUPAC Tables page B
Internal Assessment page C
Website Review Project page M
i
IB Chemistry III Syllabus
Lincoln College Preparatory Academy
Teacher: Melissa Manakul E-mail:[email protected]
Room: 207 Google Classroom: 2kxd0h0 *Any communication to me either through e-mail or website will be responded to as soon as humanly possible.
MY WEEKLY SCHEDULE:
Day Monday Tuesday Wednesday Thursday Friday
Morning In classroom by
6:50 am
In classroom by
6:50 am
In classroom by
6:50 am
In classroom by
6:50 am
In classroom by
6:50 am
Afternoon Meeting Tutoring
2:30 – 3:30 Staff Meeting
Will leave by
3:00 pm
Will leave by
3:00 pm
COURSE DESCRIPTION:
Chemistry is an experimental science that combines academic study with the acquisition of practical and investigational
skills. It is called the central science, as chemical principles underpin both the physical environment in which we live and
all biological systems. Apart from being a subject worthy of study in its own right, chemistry is a prerequisite for many
other courses in higher education, such as medicine, biological science and environmental science, and serves as a useful
preparation for employment. International baccalaureate chemistry is divided in two types of courses, higher level and
standard level. Standard level comprises of core skills and activities, while higher level takes topics into greater depth.
Each are assessed both externally and internally and have prescribed number of hours with to accomplish the curriculum.
GOALS FOR SEMSTER:
1. You will be prepared to obtain a 4 or above on the IB Chemistry Exam.
2. You will be prepared for a collegiate General Chemistry course.
3. You will be able to design and execute your own lab.
REQUIRED MATERIALS:
Booklet: This is your bible in Chemistry. Each student receives a booklet at the beginning of the semester, which includes
all unit objectives, homework, labs, and supplemental material. This is to go home every night.
Lab Book: This will be a composition notebook (college ruled or grid paper preferred) which will house all your
completed labs and activities. This will be graded throughout the year, and left in the classroom.
Laptop: This will be used to access the textbook and Google Classroom where any announcements, calendar changes,
copies of activities, additional supplemental information, and extra copies of homework. We will also use it for a
variety of activities to be done at home or in the classroom through a variety of educational websites.
SUGGESTED MATERIALS:
Binder/Folder: This will hold any paper work, including but not limited to tests, quizzes, lab reports, and activities. You
must take this home every night. Any time Tyler or my record is incorrect, it is the student’s job to report this to
Ms. Manakul with a graded copy. This is the only way a grade can be changed for full credit.
Scientific Calculator: TI-30x is a preferred calculator, however any scientific calculator will do.
TOPICS COVERED:
(1) Scientific Method & Measurement (2) Nuclear & Atomic Structure (3) Periodicity & Ionic Bonding (4) Covalent
Bonding (5) Chemical Reactions & Stoichiometry (6) Energetics (7) Kinetics (8) Equilibrium (9) Acids & Bases (10)
Electrochemistry (11) Organic Chemistry Continued (12) Biochemistry
METHOD OF INSTRUCTION:
We will be moving through material at a steady pace. We will be working through an objective in about a week. There
will be at least 1 quiz per unit and 1 test per unit. There will be around 1 to 2 major labs per unit and activities/discussions
scattered throughout the unit. Participation in labs and activities is a requirement and are done to ensure you properly
comprehend material. You will have homework most nights. All work must be completed for the next class period
unless specified otherwise.
ii
DO NOWS/EXIT TICKETS:
Do Now’s & Exit Tickets are Ms. Manakul’s way to see who does or does not get what is happening in class. Ms.
Manakul, also, believes any work that you do should be worth something. Thus, you will turn your Do Now/Exit Ticket in
to Ms. Manakul BEFORE she goes over the answer. If you answer the question correctly your Do Now/Exit Ticket sheet
will go into the class piggy bank. If you would like to save paper, and show the class that “you got this,” you may go over
the answer in Ms. Manakul’s place. If you choose this route, your name will automatically go into the class piggy bank.
Before each quiz Ms. Manakul will pull out two random Do Now/Exit Ticket Sheets and those two people will gain
automatic extra credit towards the quiz. Before a test Ms. Manakul will pull out four sheets. If you are absent, you may
see Ms. Manakul before or after school (not during school) to make up your Do Now so you do not miss out on any of the
extra credit drawing entries.
HOMEWORK:
As mentioned above, homework will be assigned at the end of class and will be due in class the following school day.
Homework is a place to better comprehend material, gain proper practice, and solidify knowledge. However, sometimes
homework is confusing or you did not learn material the first time. Should this happen you should ALWAYS ASK
QUESTIONS either with a classmate or Ms. Manakul. Because we all struggle with homework, Ms. Manakul takes
homework as a completion grade. You must have tried the problem, i.e. you do not necessarily need to complete the
problem. Be aware an IDK is not trying and will thus your homework to be considered incomplete. After the class Do
Now, Ms. Manakul will check homework and go through the homework to ensure everyone comprehends the material.
Remember if you didn’t get it the first time ALWAYS ASK QUESTIONS!
LAB WORK:
Ms. Manakul will go over each lab the day before. You are to prepare your lab book by having your lab book filled out at
home based on my rubric. To prepare you for designing your own lab, each lab is designed to be very similar to your
typed lab report. We will discuss the specifics of the designed lab when we get there. For your safety you will be wearing
lab coats, goggles, and closed toed shoes in the lab room for the majority of labs. If you wear open toed shoes during a
lab, you will wear gloves over your shoes to protect your feet. If this is to change, Ms. Manakul will verbally state it. Ms.
Manakul has high expectations for lab, thus, you will gather, set up, and put away your own lab materials. Furthermore,
YOU MUST BE SAFE at all times during a lab. Ms. Manakul will give ONLY ONE verbal warning. If she must give
another, you will be ejected from lab, and receive an automatic zero for the lab.
LATE WORK:
Ms. Manakul dislikes late work and generally cannot spare the time to regrade items. Thus, any late work will receive
30% off. This means by the 3rd class day, your work will receive an automatic zero. This is to ensure work is turned in a
timely manner, and Ms. Manakul has adequate time to grade your work.
QUIZZES/TESTS:
For every quiz/test you will be given a clean copy of the periodic table. For unit tests only, you will be allowed to have
your own hand written 3” by 5” one sided notecard with any notes you need on them. At the end of the semester you may
take a cumulative test. This will be determined by Ms. Manakul and announced in class when necessary. If you are caught
cheating or talking during a test, Ms. Manakul will take your test and give you an automatic zero. All tests and quizzes are
graded as fast as humanly possible and will be placed in Tyler at the same rate. Any changes will be announced verbally.
ABSENT:
Lesson plans for the week are posted in the classroom. A large calendar is also posted in the classroom which will label
future events as well. You can also check Google Classroom for any updates or changes. If you are absent, it is your
responsibility to make up the lecture notes on your own time. Should you need assistance, you may see Ms. Manakul
before or after school (reference My Weekly Schedule). Remember to turn in work as soon as possible. Any work
assigned during your absence will have a 2 school day grace periods. If you are absent on the day an assignment is due, it
will be due the first day you return. If you miss a lab or activity, you are to collect the data from a friend, and finish the
rest of your lab report on your own time. *If Ms. Manakul is unexpectedly absent, you are to refer to the lesson plans
posted and watch online for specific details of any work to be completed in class. If an activity or lab is scheduled for that
iii
day, it will be rescheduled. Ms. Manakul will recap all information and class activities/labs will be done with the class
when she returns.
CLASS RULES:
1. Pay close attention to class, and be prepared to work hard.
2. 10/10 Rule. No passes will be given during the first 10 minutes and the last 10 minutes of class. Restroom passes
only in extreme emergencies. We have very little time and will be moving through material quickly. This means
that class time is IMPORTANT and Ms. Manakul will do her best to maximize the time we have together.
3. IF ABSENT: DON’T GET LEFT BEHIND. Remember chemistry is a class you must practice to understand,
which means missing a day can be essential to failing. Get help! See My Weekly Schedule.
4. Turn in work on time! Every day your work is late you will lose 30% that means that by the end of day 3 your
work will be an automatic zero. Ms. Manakul will give 2 extra days to make up work for every day you have an
excused absent.
5. No food or drinks will be allowed in the lab room. You may eat in the classroom as long as it does not become a
distraction. If you need to throw away large items or liquids, please toss them in trash cans in the hallways.
6. ALL electronic devices except your computer may not be used in the classroom. There will be occasions where
you may use them. Ms. Manakul will either say this or you may ask if the time is appropriate. If the time is
inappropriate the device will be taken on the second verbal warning and can be retrieved by the end of class.
7. Per district policy: Every 3 tardies = detention. Ms. Manakul considers a tardy as not being in the classroom at
the start of class.
GRADES:
A = 90.0 – 100.0 10% Homework
B = 80.0 – 89.9 15% Activities/Discussions
C = 70.0 – 79.9 20% Lab
D = 60.0 – 69.9 25% Quizzes
F = 0.0 – 59.9 30% Tests
Quarter Grades: Based on breakdown Semester Grade: Average of Quarters Year Grades: Average of Semesters
EXTRA CREDIT:
Extra credit is given throughout the school year and will be collected and graded each quarter. Students have the option to
read, analyze, and explain an approved scientific article following the extra credit rubric. Copies of the articles are located
under the Extra Credit Folder in the Google Classroom. Only one extra credit article can be done per quarter, and if one is
not done for the quarter students do not have an option to make it up later. Due dates for extra credit will be announced in
class, in Google Classroom, and will be on the calendar in the classroom.
TIPS TO SURVIVING CHEMISTRY:
1. Come to class prepared. If you bring you’re “A” game, you are more likely to get an “A” for the year.
2. Participate in class. The more you participate, the better you learn.
3. Pay attention in class. Ms. Manakul loves tell you exactly what will be on the test. If you’re listening you will
know what to expect and what to do.
4. Do the practice tests as if it was a real test. This will give you a better idea of what you need to study more and
how long you need for each problem so you can manage your time wisely.
5. Keep all your notecards. They will make it easier to study for the semester tests.
6. If you ever think something is wrong on a test, homework, notes, etc. TELL Ms. Manakul right away. We all get
confused; including Ms. Manakul and it is better to get it clarified then answer a problem wrong.
7. Keep up with any missed notes or work. Chemistry BUILDS! Missing one day of class can put you two to three
days behind your classmate, which will make you struggle more during the test.
8. Do your best on all homework and classwork. Practicing chemistry is like a mental workout. The best workouts
are the ones that require the most mental energy, so DON’T GIVE UP, even if it is tough.
9. Do your own work. Copying others’ homework or labs will only hurt you on the quizzes and tests.
10. Get your own your calculator!
iv
School Safety Drills On this page you will fill in Manakul’s Classroom procedures for all School Safety Drills.
1. Fire Safety
2. Tornado
3. Lock Down
4. Earthquake
5. Where are the maps located for emergency drills?
v
vi
vii
Unit 11: Organic Chemistry Continued
Objective Accomplishment Goal Quiz Test
Apply IUPAC rules for
naming organic compounds.
You are able to utilize IUPAC naming rules
to determine the name of any organic
compound.
Explain key organic
reactions from reactants to
products.
You know all the combinations for the three
main types of reactions.
Explain synthetic route for
organic reactions from
reactants to products.
You are able to use any combination for the
three main types of reactions to create a
route from reactant to product.
Explain stereoisomers and
its ability to bond with other
compounds, isomers, or
with itself.
You are able to picture organic models in
3D and be able to explain its effects on
which reaction a compound will undergo.
Unit 12: Biochemistry
Objective Accomplishment Goal Quiz Test
You can explain how metabolic
reactions involve a complex interplay
between different components in highly
controlled environments
You can describe the four different
types of metabolic reactions.
You will be able to describe proteins,
carbohydrates, lipids, micronutrients,
macronutrients, hormones, and nucleic
acids.
You are able to explain the creation
and use of each compound.
You can explain how most biochemical
processes are stereospecific and involve
only molecules with a certain
configuration of chiral carbon atoms.
You can explain how the shape of a
molecule affects its usage.
You can explain how our increasing
knowledge of biochemistry has led to
several environmental problems while
solving others.
You can list and explain at least two
environmental problems that have
arisen due to the production of
biochemical solution.
viii
IB Chemistry III Objective
IB Review
Unit Pretest Q1 T1 Q2 T2 Q3 T3 Q4 T4 Q5 T5 Q6 T6
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
ix
On this page you will create a line graph for each unit of your goal vs. actual scores per objective. Use test
data for best accuracy & remember to put units and labels. SUGGESTION: Use different colors.
Unit 11: Organic Chemistry
Unit 12: Biochemistry
1
Unit 11: Organic Chemistry Homework
SECTION 11.1: Fundamentals of Organic Chemistry
1. Name the following molecules:
a. CH3CH2CH2COOH d. CH3CONH(CH3)
b. CHCl2CH2CH3 e. C3H7CN
c. CH3CH2COCH3 f. CH3CH2CH2CH2COOCH2CH3
2. Give the structural formulas for the following molecules (Condensed form is accepted):
a. Hexanoic acid e. Ethyl methanoate
b. Butanal f. Hexanamide
c. Pent-1-ene g. N,N - dimethylhexanamine
d. 1-bromo-2methylbutane
3. Which of the following is an amine?
a. CH3CH2NH2 c. CH3CH2CN
b. CH3CONH2 d. C2H5CONH(CH3)
4. Which compound is a member of the same homologous series as 1-bromopropane?
a. 1-iodopropane c. 1-bromopropene
b. 1,2 – dibromopropane d. 1-bromopentane
2
5. Draw and name all the structural isomers of C3H3Cl5.
6. Which formula is that of a secondary halogenoalkane?
a. CH3CH2CH2CH2Br c. (CH3)2CHCH2Br
b. CH3CHBrCH2CH3 d. (CH3)3CBr
7. Describe the bonding in a benzene molecule and use it to explain benzene’s energetic
stability.
8. When comparing the boiling points of different classes of compound, why is it important
to choose molecules that have similar molar mass?
3
9. Explain how you would expect the solubility of alcohols in hexane to change with
increasing chain length.
SECTION 11.2: Functional group chemistry 10. Write equations for the following reactions:
a. Incomplete combustion of pentane forming CO(g)
b. Complete combustion of butane
c. Incomplete combustion of propyne forming C(s)
11. Write equations showing possible steps leading to a mixture of products in the reaction
between bromine and ethane reacting together in UV light.
12. Give the name and structure of the products of the following reactions:
d. CH3CH2CH=CH2 + H2 over Ni catalysts
4
e. CH3CH=CHCH3 + conc. H2SO4
f. CH3CH=CHCH3 + HBr
13. What would you observe during the following experiments carried out in test tubes at
room temperature?
a. Some bromine water is added to cyclohexane in a test tube covered in aluminum
foil.
b. A few drops of methylbenzene are burned on a watch glass.
c. Some bromine water is added to propane in a test tube in UV light.
14. Write equations for:
a. The complete combustion of ethanol and propanol
b. The esterification reaction between propanoic acid and butanol
5
15. Predict the product of heating the following alcohols with acidified potassium dichromate
(VI) solution, and the color change that would be observed in the reaction mixture.
c. Butan-2-ol
d. Methanol (product collected by distillation immediately)
e. 2-metylbutan-2-ol
16. Explain what is meant to nucleophilic substitution, using the reaction between NaOH and
chloroethane to illustrate your answer.
17. Discuss why benzene, which is highly unsaturated, tends to undergo substitution
reactions rather than addition reactions.
SECTION 11.3: Types of Organic Reactions
18. Give the structural formulas of three isomers of C4H9Br which can be classified as
primary, secondary, or tertiary.
6
19. Identify which of these isomers will react with aqueous sodium hydroxide almost
exclusively by an SN1 mechanism. Explain the symbols in the term SN1.
20. Using the formula RBr to represent a bromoalkane, write an equation for the rate-
determining step of the reaction.
21. Which compound reacts most readily by a SN1 mechanism
a. (CH3)3CCl c. (CH3)3
b. CH3CH2CH2CH2Cl d. CH3CH2CH2CH2Cl
22. Suggest explanations for the following:
a. Iodo- and bromo- compounds are more useful than chloro-compounds as
intermediates in synthesis pathways.
b. Two compounds X and Y have the same molecular formula C4H9Cl. When each
compound is reacted with dilute alkali and AgNO3 (aq) is added, a white
precipitate that darkens on exposure to air forms rapidly with X, but slowly with
Y.
23. Explain carefully why alkenes undergo electrophilic addition reactions. Outline the
mechanism of the reaction between 2-ene and bromine and name the product.
7
24. Predict the major product of the reaction between but-1-ene and hydrogen bromide.
Explain the basis of your prediction.
25. By considering the polarity within the molecule ICl, determine how it would react with
propene. Draw the structure and name the main product.
26. State the reactants used in converting benzene to nitrobenzene. Explain how they enable
the nitration reaction to occur.
27. Explain how the following reduction reactions are carried out in the laboratory.
a. Propanoic acid to propanol
b. Nitrobenzene to phenylamine
c. Ethanal to ethanol
8
SECTION 11.4: Synthetic routes (HL)
28. Describe how ethyl ethanoate can be made from a single alcohol.
29. You are required to convert the compound 1-chlorobutane into butanoic acid. Describe
the steps you would use giving reagents conditions, and equations for each stage.
SECTION 11.5: Stereoisomerism (HL)
30. Which compound can exist as optical isomers?
a. CH3CHBrCH3
b. CH2ClCH(OH)CH2Cl
c. CH3CHBrCOOH
d. CH3CCl2CH2OH
31. Write the structure of the first alkane in the homologous series to show optical
isomerism.
32. Draw and name the geometric isomers of:
a. Pent-2-ene
b. 2,3 – dichlorobut-2-ene
9
Unit 12: Biochemistry Homework
SECTION B1: Introduction to Biochemistry
1. Write an equation for the hydrolysis of the molecule C18H32O16 (a trisaccharide) into its
monomers, which are all isomeric with glucose.
2. State the features of molecules that are able to form condensation polymers, and describe
what happens during the polymerization reaction.
3. State whether the following metabolic processes are anabolic or catabolic.
a. Protein synthesis c. anaerobic respiration
b. Oxidation of fatty acids d. DNA replication
4. Outline the conditions required for photosynthesis to take place, and explain why it can
be described as a redox process.
5. State and explain the difference in energy yield between aerobic and anaerobic
respiration.
10
SECTION B2&B7: Proteins and Enzymes
6. Using the three-letter word symbols for amino acids, show all the possible tripeptides that
can form from the three amino acids tyrosine, valine, and histidine.
7. Deduce the number of different peptides that could form from the four amino acids,
tyrosine, valine, histidine, and proline.
8. Consult section 33 of the IB data booklet to consider the following amino acids: leucine,
glutamic acid, threonine, lysine, and serine. Which of these amino acids:
a. Is most likely to be found in the interior of a globular protein?
b. Contains a secondary alcohol group?
c. Will negatively charged at pH 5.0?
d. Will be positively charged at pH 7.0?
11
9. Explain the difference in structure and properties of fibrous and globular proteins.
10. Hydrogen bonds occur in the secondary and tertiary structures of proteins. Describe the
different origins of these.
11. State four characteristics of enzymes.
12. Sketch a graph of the rate of an enzyme reaction against temperature and explain its
shape.
13. Draw a graph of the rate of an enzyme reaction against substrate concentration. Include
lines for the presence of a competitive AND non-competitive inhibitor.
12
14. State the effect of a competitive inhibitor on the values of
a. Vmax
b. Km
15. When carrying out paper chromatography on a sample of hydrolysed protein, explain
why it is important to avoid handling the paper. Make a reference to section 33 in the IB
Data Booklet to answer the next two questions.
16. Explain why gel electrophoresis the amino acids isoleucine migrates towards the anode at
high pH and towards the cathode at low pH.
17. You are attempting to separate a mixture of glutamic acid and histidine by gel
electrophoresis. Give a suggested pH for an appropriate buffer solution to use, and say in
which direction each amino acids would migrate.
13
18. Given 100 cm3 of 0.05 mol dm-3 methanoic acid, HCOOH, what volume of 0.05 mol
dm-3 NaOH would you need to add to prepare a buffer of pH 4.34? (Assume Ka of
HCOOH = 1.77 x 10-4).
19. Explain the use of protein strands in preparing a calibration cure for the calculation of
protein concentration.
SECTION B.3: Lipids
20. A sample of fat contain 0.02 moles of fatty acid was found to react with 10.16 g of
iodine. Determine the number of carbon-carbon double bonds present in the fatty acid.
14
21. The following table shows the melting point for a number of common fatty acids found in
dietary fats and oils.
a. Which of the fatty acids are solids at room temperature of 25°C?
b. Describe and explain the trend in melting points in the first four fatty acids listed.
c. Describe and explain the pattern in melting points of the last three acids
mentioned.
22. Explain the different chemical basis of the two types of rancidity which can occur in
lipids.
15
SECTION B.4: Carbohydrates
23. State the empirical formula for all monosaccharides.
24. State and explain the difference in solubility of monosaccharides and poly saccharides.
25. The disaccharide lactose is made from monomers shown below.
Deduce the structural and molecular formula of lactose and the name the bond between
the sugars.
16
SECTION B.5: Vitamins
26. Make reference to section 35 in the IB Data Booklet.
a. Identify two functional groups common to all three vitamins shown.
b. Identify one vitamin that is water soluble and one vitamin that is fat soluble.
Explain the differences in solubility in terms of their structural and intermolecular
forces.
27. Suggest ways in which vitamin deficiency diseases can be alleviated.
SECTION B.8: Nucleic Acids
28. Outline how nucleotides are linked together to form polynucleotides, explaining the
nature of the bonds involved.
29. Describe the forces that stabilize the DNA molecule.
17
30. One strand of DNA contains the following base sequence.
AATCGCATATAATTCGCTAGC
a. What is the base sequence in the other strand in the double helix?
b. What is the sequence of bases in the RNA synthesized using the first strand as a
template?
c. How many amino acids are coded for this section of RNA?
31. State three perceived benefits and three potential concerns of the use of genetically
modified foods.
SECTION B.9: Pigments (HL)
32. With respect to hemoglobin and cytochromes, explain the difference between being
oxidized and being oxygenated.
18
33. The absorbance spectra of anthocyanins are very sensitive to changes in pH. Identify the
wavelength λmax which corresponds to the maximum absorbance and suggest the color of
the pigment at the different pH’s shown.
34. Explain the following observations in terms of molecular structure of the pigments
involved.
a. When carrots are boiled, little coloration of the water occurs; when they are fried,
the oil changes color to orange.
b. When red cabbage is boiled, the water turns purple-red. When vinegar is added
the color changes to bright red.
19
35. Three compounds are separated using thin-layer chromatography on a silica gel
stationary phase.
Calculate the R1 values and comment on the relative polarity of the components.
36. Explain the difference in shapes of the oxygen dissociation curves of the hemoglobin ad
myoglobin in terms of their protein structures.
SECTION B.10: Stereochemistry in Biomolecules (HL)
37. Explain why partial hydrogenation of fats is associated with a problem that does not arise
from the complete hydrogenation of fats.
38. Cellulose and starch are both polymers of glucose, but they have very different
properties. Explain this by making reference to their structural units.
20
39. What is meant by photochemical isomerization in the visual cycle?
SECTION B.6: Biochemistry and the Environment
40. State three types of association found in host-guest super-molecules.
41. Explain what is meant by bio-magnification and why it is such a problem.
42. State three examples of the use of enzymes in helping to ameliorate environmental
problems.
21
Testing for an Aldehyde Lab
Background:
Tollens' reagent is a chemical reagent used to determine the presence of an aldehyde or alpha-
hydroxyl ketone functional groups. The reagent consists of a solution of silver nitrate and
ammonia. It was named after its discoverer, the German chemist Bernhard Tollens. A positive
test with Tollens' reagent is indicated by the precipitation of elemental silver, often producing a
characteristic "silver mirror" on the inner surface of the reaction vessel.
Objective:
You will be able to distinguish an aldehyde from an alcohol or a ketone using Tollens’
reagent.
Methods:
In this lab you be creating your own base line in how to determine if a compound is an
alcohol, ketone, or an aldehyde. To do this you will need to create a Tollens’ reagent. To do this,
you will need to add 1 drop of 1 M sodium hydroxide to 2mL of 5% silver nitrate in a test tube.
Add 6M aqueous ammonia drop by drop, gently agitating the tube after each addition, until the
brownish precipitate dissolves.
Once you have your Tollens’ reagent, place ten drops of your reagent into three clean,
labeled test tubes. To test tube 1, add 2 drops of glucose solution. To test tube 2, add 2 drops of
propanone. To test tube 3, add 2 drops of ethanol. Gently agitate each test tube to mix the
contents. If no reaction occurs in any test tube, place each test tube separate warm water baths
for a few minutes. Do not let the test tubes sit in the warm water bath for too long, as it can cause
the Tollens’ reagent to decompose quickly. To clean each test tube add dilute acid to each and
then flush down the drain with lots of water.
Safety:
Tollens’ reagent decomposes quickly when left to standing for too long, and can yield an
explosive mixture. Neutralize it with dilute acid, and flush with plenty of water. Avoid skin
contact with these chemicals. For this reason full lab gear (closed toed shoes, lab coat, and
goggles) is to be worn at all times. Should the chemical come into contact with skin, rinse with
water immediately, and alert Ms. Manakul for further instructions. To ensure no amount of
Tollens’ reagent is left in the lab room, be sure to clean your station with soap and water.
Environmental Safety:
After the neutralization of Tollens’ reagent, the amount would cause inconsequential problems to
the environment.
Data Collection:
Create a table to record your observations of each test tube after the tubes have been left
undisturbed for five minutes.
Data Processing:
1. Write the equation for any chemical reaction you observe.
22
Challenge Questions:
1. If you observed a chemical reaction in one or more of the test tubes, what practical uses
might the reaction have?
2. When a carbonyl group is attached to a hydroxyl group, what is its effect on the organic
compound?
Conclusion/Evaluation:
1. Write a conclusion and evaluation for this lab.
23
Polymers Lab
Background:
A polymer (/ˈpɒlᵻmər/; Greek poly-, "many" + -mer, "parts") is a large molecule, or
macromolecule, composed of many repeated subunits. Because of their broad range of
properties, both synthetic and natural polymers play an essential and ubiquitous role in everyday
life. Polymers range from familiar synthetic plastics such as polystyrene to natural biopolymers
such as DNA and proteins that are fundamental to biological structure and function. Polymers,
both natural and synthetic, are created via polymerization of many small molecules, known as
monomers. Their consequently large molecular mass relative to small molecule compounds
produces unique physical properties, including toughness, viscoelasticity, and a tendency to form
glasses and semi-crystalline structures rather than crystals. The simplest theoretical models for
polymers are ideal chains.
Guar gum, also called guaran, is a galactomannan. It is primarily the ground endosperm
of guar beans. The guar seeds are dehusked, milled and screened to obtain the guar gum. It is
typically produced as a free-flowing, off-white powder. The guar bean is principally grown in
India, Pakistan, U.S., Australia and Africa. India produces 2.5 - 3.5 million tons of guar annually,
making it the largest producer with about 80% of world production, while Pakistan produced
250,000 tons of guar in 2013. Guar gums are preferred as thickeners for Enhanced Oil Recovery
(EOR), guar gum and its derivatives account for most of the gelled fracturing fluids. Guar is
more water-soluble than other gums, and it is also a better emulsifier, because it has more
galactose branch points. Guar gum shows high low-shear viscosity, but it is strongly shear-
thinning. Being non-ionic, it is not affected by ionic strength or pH but will degrade at low pH at
moderate temperature (pH 3 at 50 °C). Guar's derivatives demonstrate stability in high
temperature and pH environments. Guar use allows for achieving exceptionally high viscosities,
which improves the ability of the fracturing liquid to transport proppant. Guar hydrates fairly
rapidly in cold water to give highly viscous pseudo-plastic solutions of, generally, greater low-
shear viscosity than other hydrocolloids. The colloidal solids present in guar make fluids more
efficient by creating less filter cake. Proppant pack conductivity is maintained by utilizing a fluid
that has excellent fluid loss control, such as the colloidal solids present in guar gum.
Guar has up to eight times the thickening power of starch. Derivatization of guar gum
leads to subtle changes in properties, such as, decreased hydrogen bonding, increased solubility
in water-alcohol mixture, and improved electrolyte compatibility. These changes in properties
result in increased use in different fields, like textile printing, explosives, and oil-water fracturing
applications.
Objective:
You will be able to distinguish the cross-linking that occur in the creation of polymers
and examine their properties.
Methods:
In this lab you will make a small amount of polymer plastic. In a 3 ½ oz plastic cup add
distilled water until the cup is half full. Add 2-3 drops of food coloring to the water. The color
chosen will be the color of the polymer. Using a soda straw as a measuring scoop to obtain
approximately 2 cm of powdered guar gum. Do not use your moth to draw up the guar gum into
the straw. Gently sprinkle the guar gum powder into the water while stirring with a wooden stir
24
rod. Add the guar gum powder slowly to prevent it from clumping. Stir the mixture well. While
stirring, add one full pipet (about 4 mL) of borax solution. Continue to stir until a change occurs.
Safety:
The polymer created in this lab tends to mold quickly, and should be thrown away after being
created. While the cross-linked polymers are non-toxic, borax is a toxic substance when ingested.
To insure safety, hands should be washed thoroughly after the use of the borax and handling of
the polymer.
Environmental Safety:
Polymers are generally stable organic compounds, but can break down over time. The final
product depends on the starting reagents; however, the particular polymer made in this lab will
decompose into natural organic compounds, which will not harm the environment.
Data Collection:
Create a table to record your observations of the production of the polymer.
Data Processing:
1. Is the polymer created a liquid or a solid? What special characteristics does it have?
2. Guar gum is a carbohydrate, a polymer with many repeating alcohol functional groups (–
OH). Draw a zigzag line to represent a crude polymer chain. Add –OH groups along the
chain to represent the alcohol functional groups.
3. Borate ions combine with alcohol to form water and borate complexes of the alcohol are
shown below. Write a similar equation that replaces all the –OH groups on the borate
with –OR groups.
+ R – OH + H2O
4. Fi two polymer chains each contain two nearby –OH groups, borate will cross-link the
polymer chains by forming a complex with two alcohols on each chain. Draw a structure
similar to the one you drew for question 3, but replace your four R groups with two
polymer chains.
Challenge Questions:
1. If you were to make synthesis this polymer again, how could you increase the amount of
polymer while keeping cost down? The price per material is listed below.
2. Borax can complex with other carbohydrate polymers. Describe the similar properties
and difference in properties that would occur if you used cornstarch instead of guar gum
powder.
Conclusion/Evaluation:
1. Write a conclusion and evaluation for this lab.
25
Plant Pigment Separation Lab
Background:
Paper chromatography is a useful technique in the separation and identification of
different plant pigments. In this technique, the mixture containing the pigments to be separated is
first applied as a spot or a line to the paper about 1.5 cm from the bottom edge of the paper. The
paper is then placed in a container with the tip of the paper touching the solvent. Solvent is
absorbed by the paper and moves up the paper by capillary action. As the solvent crosses the area
containing plant pigment extract, the pigments dissolve in and move with the solvent. The
solvent carries the dissolved pigments as it moves up the paper. The pigments are carried along
at different rates because they are not equally soluble. Therefore, the less soluble pigments will
move slower up the paper than the more soluble pigments. This is known as developing a
chromatogram.
Paper chromatography is useful for identifying unknown compounds - often used in
crime scene investigations to match ink, lipstick, or colored fibers. There are many examples of
chromatography at youtube.com. This set-up shows two different pen inks.
The distance traveled by a particular compound can be used to identify the compound. The ratio
of the distance traveled by a compound to that of the solvent front is known as the Rf value;
unknown compounds may be identified by comparing their Rf's to the Rf's of known standards.
Rf equation:
Rf = distance traveled by compound
distance traveled by solvent
Objective:
To identify plant pigments by separation and isolation of the pigments using thin layer
paper chromatography.
Methods:
1. Cut a strip of coffee filter (or filter paper). Draw a horizontal line with a pencil (not pen)
about half an inch from the bottom. Place a spinach leaf on the line and roll a penny over
it so that you get a line of green pigment on the filter. Using a different part of the leaf,
roll the penny again over the same line. Repeat this process until the line is fairly dark.
2. Put about an inch of isopropanol (acetone, fingernail polish remover will work) in a
cup/beaker.
3. Tape the top of the coffee filter strip to a pencil and balance the pencil across the top of
the cup/beaker. See the image below for the set-up.
4. It is very important that the bottom of the filter strip is in the isopropanol, but the green
spot is not in the liquid. If the isopropanol touches the spot directly, the pigment will just
dissolve away.
5. Set the cup/beaker aside. The isopropanol will move up the filter paper slowly and
deposit the pigment components along the way.
6. When complete, let filter paper dry. All used acetone should be placed down the drain
with lots of water, and cups/beakers placed away for reuse.
26
Safety:
Acetone is a common chemical, but can be considered a skin irritant. If you get any on
your skin, rinse with water. Spinach can stain clothes, skin, and any other organic material. Make
sure not to allow your clothing or skin to come into much contact with the ground up spinach
leaves.
Environmental Safety:
Many of the chemicals are common place chemicals. All extra acetone should be rinsed
down the drain with lots of water as to not cause the water ways to become too acidic. Likewise,
extra spinach will be composted for environmental reuse.
Data collection:
Band Color Plant Pigment Distance (mm) Rf (use formula)
Yellow to Yellow-Orange Carotene
Yellow Xanthophyll
Bright Green to Blue Green Chlorophyll a
Yellow Green to Olive Green Chlorophyll b
Data Processing:
Show all calculations for Rf values.
Challenge Questions:
1. Explain how a crime lab could use paper chromatography to determine if lipstick found at
a crime scene matched the lipstick of a suspect.
2. Give another example where paper chromatography could be utilized to aid detectives or
forensic scientists.
Conclusion/Evaluation:
Write your own conclusion and evaluation for this lab.
Appendix
A
VESPR Theory
Species Type Geometry Shape Bond Angle Example
A2 Linear Linear 180° H2
AX2 Linear Linear 180° CO2
AX3 Planar
Triangular
Planar
Triangular 120° BF3
AX2E1 Planar
Triangular V-Shape 104.5° SO2
AX4 Tetrahedral Tetrahedral 109.5° CH4
AX3E1 Tetrahedral Pyramidal 109.5° NH3
AX2E2 Tetrahedral V-Shape 104.5 H2O
AX5 Triangular
Bipyramidal
Triangular
Bipyramidal
90°, 120°,
180° PCl5
AX4E1 Triangular
Bipyramidal See Saw
90°,
120°¸180° SF4
AX3E2 Triangular
Bipyramidal T-Shape 90°, 180° ClF3
A3E3 or
AX2E3
Triangular
Bypiramidal Linear 180° I3
-
AX6 Octahedral Octahedral 90°, 180° SF6
AX5E1 Octahedral Square
Pyramidal 90°, 180° BrF5
AX4E2 Octahedral Square Planar 90°, 180° XeF4
B
IUPAC Tables
Number of carbon atoms in longest chain Stem in IUPAC name 1 Meth-
2 Eth-
3 Prop-
4 But-
5 Pent-
6 Hex-
Homologous
Series
Functional Group Suffix in IUPAC
Name
Carboxylic acid R-COOH -oic acid
Ester* R-COOR -oate
Amide* R-CONH2 -amide
Nitrile R-C=N -itrile
Aldehyde R-CHO -al
Ketone R-C=O -one
Alcohol R-OH -ol
Amine* R-NH2 -amine
Alkane R-C-C-R -ane
Alkene R-C=C-R -ene
Side chain/ substituent
group
Prefix in IUPAC
name
Example of Compound
-CH3 Methyl CH3CH(CH3)CH3 2-methylpropane
-C2H5 Ethyl CH(C2H5)3 3-ethylpentane
-C3H7 Propyl CH(C3H7)3 4-propylheptane
-F, -Cl, -Br, I- Fluoro, Chloro,
Bromo, Iodo
CCl4 tetrachloromethane
-NO2 Nitro CH2(NO2)COOH 2-nitroethanoic
acid
C
Internal Assessment
What is an Internal Assessment?
In IB, you will be designing a lab, which means you create and execute it. Essentially you
will do a scientific lab with a chemistry based theme. The lab is based on what you
want to learn or discover. Think about what is currently occurring in your life or society
in general. Then create a lab to help answer your question. To help you determine your
topic, utilize the Examples of Possible Chemistry IA Topics to narrow your focus. Keep
in mind topics should related to chemistry, not be complicated or too simple, and doable
in a safe chemistry lab. Based on your topic you should choose your independent and
dependent variable. Your lab will then be based on how you manipulate your independent
variable to see how it affects your dependent variable.
What is a SMART lab?
SMART means Simple, Measureable, Attainable, Realistic, and Timely. This means that
your lab shouldn’t be complicated. You are to choose a simple independent variable
which to manipulate. Furthermore, you should pick a lab which can be done within the
confines of a chemistry lab and within the time frame you are given. Most often you will
only have 3-5 class periods in the lab room. Thus, if a lab requires collecting data over
hours of time it is not a lab to choose. Moreover, each lab should include qualitative and
quantitative data. Qualitative should be a description of the observations that you see
during the lab. The quantitative data includes measurements. This also means your lab
should include UNCERTAINTY & TRIALS.
Definitions:
Independent variable – variable which you will change (should have three changes at
minimum.
Dependent variable – variable which you will be measuring the outcome (what you
expect to see)
Constant variable – any other variable which must stay the same
Prediction – an educated guess for the outcome of your lab
EXAMPLES OF POSSIBLE CHEMISTRY INTERNAL ASSESSMENT (IA) INVESTIGATIONS
TRADITIONAL OR HANDS-ON
Removing tarnish from silver objects (redox reactions) Aspirin: Syntheses using less common approaches like microwaves, purification by
melting point and TLC, kinetics of the hydrolysis of aspirin to salicylic acid under various conditions
Synthesis of the Sweetener Dulcin from the Analgesic Tylenol (allows using titration) Studying nucleophilic substitution reactions (using TLC-quantitation may be achieved by
using simple flatbed scanner) Production of hydrogen peroxide using a photosensitizer such as riboflavin and redox
reactions
D
Thermal denaturation of proteins using UV light thermodynamics and kinetics of 'Heater Meals" Investigating the kinetics of the bleaching of a dye using a colorimeter probe
Solidification techniques and materials distribution constant of iodine between aqueous and non-aqueous systems (which could
be expanded to calculate ∆G) Investigating gases in water overheated in a microwave
investigating EDTA contents in shower cleaners Investigating the dependence of overvoltage on the composition of a metal surface at
which hydrogen discharge occurs, bubbles' lifetime' and IMF
Low rank coal swelling with different solvents
Pharmaceuticals from plants
Investigating fluorescence using turmeric, B complex vitamins, minerals, household items.
Iodine numbers of palm oil as compared to other cooking oils. An expansion of the determination of manganese in a paper clip. Effectiveness of different salts on road snow removal. In-depth kinetics investigation into a specific investigation. Transition metal ions (effects of metals, ligands, oxidation states on the colour of the ion) Natural indicators (sources, stability, Ka values, end point range) Extraction of oil from spices (using different sources of spices, different storage
conditions) Effectiveness of different water purification methods on dissolved ions. Melting points of group 2 metals and the different types of crystal lattice. The amount of nitrogen in fertilizers (reacting with excess NaOH and titrating with
standard HCl) Thermodynamic data for ionic compounds (Ksp, can be calculated by gravimetric
determination, The enthalpy of solution) The use of different fruits to chelate heavy metals (eg cadmium) from polluted water
sources. The effect of temperature on vitamin C content in red pepper juice. Determination of residual chlorine concentration vs distance from water treatment plant The determination of the activation energy in a reaction by examining the relationship
between temperature and the rate constant of said reaction. The effect of cooking method on Vitamin C content Henna as an effective indicator Free caffeine in coffee vs various teas Effect of roasting on caffeine content of coffee
Ca content of lentils Change of [Fe] in avocados as they ripen
The effect of increased carbon dioxide on the acidification of salt water
Energy content of foods / compared to printed values on the packaging
The effect of temperature on the pH of ascorbic acid solutions
E
SPREADSHEETS
producing artificial seawater using spreadsheets for calculations
studying carbonate system equilibria in aquariums using Excel for calculations Calculating pI of proteins Study kinetics of a reaction with software such as ChemKinetics, Using Excel or Modellus.
DATABASES
NIST or any of the many excellent databases available in the web could be used to investigate trends in C-H, N-H, and O-H Bond dissociation enthalpies
Comparing experimental data related to structure of compounds with values predicted by software such as MOPAC, WebMO or GAMESS
Investigating intermolecular forces using software such as SAPT
Investigating the effect of isotopes on vibrational spectra comparing experimental results with those predicted by programmes such as Spartan Student, Molden or Tinker
Analyzing environmental topics from databases such as those from EPA, European Environment Agency, United Nations Environment Programme, Database of Environmental Education Related Organizations Among Asian Countries or NETROnline
Environmental issues offer endless possibilities. Comparing structures of drugs to their various properties - there are many large
databases to access - i.e. drugbank.ca , https://www.ebi.ac.uk/chembldb/ List of 64 free chemistry databases: http://depth-first.com/articles/2011/10/12/sixty-
four-free-chemistry-databases/ Exploring the relationship between the molecular mass/number of hydroxyl groups within a
chemical compound and its solubility in water.
SIMULATIONS
Investigate the Influence of surrounding chemical environment on NMR spectra using WinDNMR and relate these structures to chemical reactions or establish changes in terms of modifications in temperature. The information can then be exported to spreadsheets for further analysis.
Simulation investigations might determine data in a straight-forward way (like playing a computer game) but then the student should use this simulation for processing data, or comparing with experimental results either personally collected or from data bases taking one step beyond the simulation, to find something new.
Students need insight and initiative when using simulations to reach expected depth. Simulations on their own do not meet requirements of the criteria. Student write their own program to simulate a process/reaction/relationship.
Laboratory Report Check List
Report Style:
______ 1. Title of the report (centered & bolded): should be along the lines of the “Affect of IV
on DV.” Titles are supposed to give the reader a quick understanding of what was
conducted in the experiment. (DO NOT GIVE ME A TITLE PAGE!)
F
______ 2. Every section is labeled & bolded: Research Question, Introduction, Background
Information, Prediction, Methods, Methods Modifications, Safety, Data Collection,
Data Processing, Conclusion, Evaluation, and Bibliography.
______ 3. Page numbers are at the bottom right corner of each page.
______ 4. The entire lab is written in Times New Roman font, size 12, and SINGLE SPACED.
Research Question:
______ 5. Should be an actual question indicating what you want to learn from your experiment.
Introduction:
______ 6. Gives reader a quick synopsis of the why you are doing this lab and what information
you hope to gain from this lab. *NEEDS TO BE ½ PAGE LONG.
Background Information:
______ 7. Background information may be given about the topic being covered. This should
include all the research you have done for this lab. The research should support your
prediction, and should discuss all the variables that could affect the dependent
variable. All research used should be cited using MLA format. *NEEDS TO BE AT
LEAST 1 ½ PAGES LONG.
______ 8. Independent Variable (IV): is a variable that you will change. Should include an
explanation of what will be changed about IV. (Needs to be more than a statement of
the variable).
______ 9. Dependent Variable (DV): is the variable affected by the change (what you plan to
measure). Should be quantifiable and have specific units labeled. (Needs to be more
than a statement of the variable).
______ 10. Constant Variables: the variables which will be held constant throughout the
experiment. Should list at least two.
Prediction:
______ 11. This is your hypothesis to explain what you expect the outcome to be.
Methods:
______ 12. Materials list: detailed list of materials needed. When using solutions, include
concentration in molarity.
G
______ 13. Numbered list of short steps to conduct an experiment (each step should be
descriptive and concise, to ensure even an elementary school student reading the lab
could redo your experiment) *See example
______ 14. A picture or drawing of your lab set up is very helpful in describing how you did
your experiment (this step is NOT necessary but can aid in making sure your lab
method is detailed enough to be repeated/understood by an elementary school student).
Safety:
______ 15. Your safety section should be in paragraph format describing any precautionary steps
that must be taken during the experiment (should include general lab safety and
specific safety towards this lab, such as, chemical disposal and chemical safety).
______ 16. Environmental safety – how have you accounted for any environmental issues caused
from doing the lab?
Methods Modification:
______ 17. Any modification you had to make while conducting your lab, which was not
originally shown to Ms. Manakul during your meeting with her, should be included in
this section. This section should be in paragraph style outlining any changes AND why
it was necessary for you to make these changes.
Data Collection:
______ 18. Data Tables: all relevant data should be in tables. Should include proper labels, units
of measurement, title for each table, and standard deviation.
______ 19. Qualitative data: should be a paragraph which summarizes your observations during
the experiment.
Data Processing:
______ 20. Calculations: should be at least 1 example of any calculation done within the
experiment this includes but not limited to: uncertainty, averages, etc.
______ 21. Graphs: need to be best fit for your data. Graph should also include, labels on each
axis, units of measurement on each axis, major hash marks, title, key, trend line, trend
line equation, and R2 value.
Conclusion:
______ 22. Should be at least 1 page long single spaced.
H
______ 23. Conclusion: restate purpose of the lab, explain what occurred, use data to explain if
prediction was incorrect or correct.
______ 24. Answer your Research Question: Use your results to help support your claim.
Evaluation:
______ 25. Should be at least 1 page long single spaced.
______ 26. Systematic/Random Errors: list of weakness or limitations about the experiment and
include an explanation how each limitation impacted the data you collected.
______ 27. What can be gained from this experiment? Give at least 2 realistic future work
examples that could be done based off your lab. Fixing an error is not considered
future work.
______ 28. Word Count: number of words in your lab report (do not include bibliography)
Bibliography
______ 29. Include all used sources in MLA format. Make sure all your references you use are
appropriate, Wikipedia is not considered an appropriate source.
Example of a Good Method Section
Methods:
Specific Materials:
Pink Calorimeter
2.0 M HCl
Celsius Thermometer
Mg metal
Specific Procedures:
1. Obtain and mass a pink calorimeter
a. A calorimeter is used because it is a good insulating device and will prevent heat
from escaping.
2. Fill the calorimeter with 15 mL of 2.0 M HCl
a. This maximum capacity of the calorimeter is 20 mL, so less solution must be
used.
3. Measure the temperature of the HCl with a thermometer
a. The initial temperature is needed to determine the change in temperature. Because
the HCl has been sitting at room temperature, the initial temperature in all trials
should be the same.
4. Measure out less than 0.3 g of Mg
a. 0.3 grams of Mg is used because to make sure it is the limiting reactant. Since
only 15 mL of HCl fit into the calorimeter and 2.0 M is the only HCl available,
only 0.030 mol of HCl will exist in the reaction mixture. This would require 0.015
mol or 0.3 grams of Mg to completely react. However, because it is easier to
measure the mass of Mg than the mass of HCl in solution, and it is necessary to
I
ensure that the at least one of the reactants is completely used in the reaction, less
than the exact stoichiometric amount of Mg will be used.
5. Pour the Mg into the HCl
6. Insert the thermometer and stir. Record the highest temperature reached.
a. At any temperature before the highest temperature the reaction has not reached
completion. It is important that the reaction mixture be stirred to allow the
reaction to complete as quickly as possible so that a minimum amount of heat is
lost to the surroundings.
7. Reweigh the calorimeter that includes the products
a. This allows a more precise mass of Mg to be determined since some the Mg will
probably stick to the weighing boat.
b. However, this method could also cause error if gas is produced or the reaction
gets too hot and bubbles over.
8. Repeat steps 2-7 4 more trials
a. Increased trials, increase the accuracy of the result
Method Modification
When measuring the temperature of the calorimeter, it was found to lose some heat to the
surroundings. Clay was added to the hold which held the thermometer to help eliminate this
problem.
Error Analysis in Chemistry
A large part of work in studying Chemistry is based on scientific evidence, accumulated through
laboratory work. Inherent in all such work are certain assumptions and errors. An essential part
of interpreting scientific data is therefore an ability to consider the extent to which a certain
result may be compromised by the specific errors present. Broadly the types of error which arise
in chemistry experiments are:
Systematic errors (determinate)
● These errors are due to identifiable causes. ● They are likely to give results which are consistently too high or consistently too low ● Sources of systematic errors can usually be identified (e.g. solubility of a gas when
collected over water) ● Systematic errors can in principle be eliminated or at least ameliorated by modifications
to the experiment
Random errors (indeterminate)
● These errors generally arise from the limit of accuracy of the apparatus. ● They arise from fluctuations that cause about half the measurements to be too high and
about half to be too low ● Sources of random errors cannot always be identified. Possible sources:
a. Observational e.g. reading burette, judging a color change
b. Environmental e.g. convection currents
● Random errors can generally not be ameliorated ● Random errors can be quantified
J
The random error is equivalent to the uncertainty in measurement. This is usually given by the
manufacturer of the equipment and expressed as +/- a certain value. If this information is not
available, a good guideline is:
a. For analogue equipment the uncertainty = +/- half the smallest scale division
b. For digital equipment the uncertainty = +/- the smallest measure (the least count)
Note when the uncertainty is recorded, it should be the same number of decimal places as the
measured value. For example, a balance reading to 53.457 g +/- 0.001.
Propagation of uncertainties
The overall uncertainty arising in an experiment is determined by the manner in which the data
values and their associated uncertainness are processed. This is known as propagation of
uncertainties through the calculation.
The principle is that the overall uncertainty is the sum of the absolute uncertainties.
When values are being added or subtracted, the uncertainties associated with them must be added
together:
e.g. initial temperature = 20.1°C +/- 0.1
final temperature = 27.9°C +/- 0.1
temperature change = 27.9 – 20.1°C = 7.8°C +/- 0.2
In experiments where values are being multiplied or divided, and/or when there are several
measurements made – each with its own uncertainty, the absolute uncertainties must be
expressed as percentage uncertainties. These can then be added together, and finally converted
back into absolute uncertainties.
e.g. mass reading = 5.456 g +/- 0.001
% uncertainty = 0.001/5.456 x 100 = 0.0183 %
Temperature reading = 27.8°C +/- 0.2
% uncertainty = 0.2/27.8 x 100 = 0.7%
⇨ Total uncertainty = sum of % uncertainties = 0.0183 + 0.7 = 72%
So if the answer is 55.8 J, then the total uncertainty = 0.72/100 x 55.8 = 0.40 J
⇨ Final answer = 55.8 J +/- 0.4
Experimental error
The difference between experimental and theoretical results
% error = 𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑒 𝑒𝑒𝑒𝑒𝑒𝑒𝑒−𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑒 𝑒𝑒𝑒𝑒𝑒𝑒𝑒
𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑒𝑒 𝑒𝑒𝑒𝑒𝑒𝑒𝑒 𝑒 100
When the final uncertainty arising from random errors is calculated, this can be compared with
the experimental error as described above. If the experimental error is larger than the total
uncertainty, then random error alone cannot explain the discrepancy and systematic errors must
be involved.
K
Internal Assessment Rubric
Personal Engagement: Level of Interest – creativity, independent thinking, initiative in designing, implantation
or presentation of investigation Mark Description
0 The student’s report does not reach a standard described by the descriptors below.
1
The evidence of personal engagement with the exploration is limited with little independent thinking, initiative or insight
The justification given for choosing the research question and/or the topic under the investigation does not demonstrate
personal significance, interest or curiosity.
There is little evidence of personal input and initiative in the designing implementation or presentation of the
investigation.
2
The evidence of personal engagement with the exploration is clear with significant independent thinking, initiative or
insight.
The justification given for choosing the research question and/or the topic under investigation demonstrates personal
significance, interest or curiosity.
There is evidence of personal input and initiative in the designing, implementation or presentation of the investigation.
Exploration: Level of work – scientific context, clear and focused research question, and uses concepts and
techniques appropriately in conjunction to safety, environmental, and ethical considerations Mark Description
0 The student’s report does not reach a standard described by the descriptors below.
1-2
The topic of the investigation is identified and a research question of some relevance is stated but it is not focused
The background information proved for the investigation is superficial or of limited relevance and does not aid the
understanding of the context of the investigation
The methodology of the investigation is only appropriate to address the research question to a very limited extent since
it takes into consideration few of the significant factors that may influence the relevance, reliability and sufficiency of the
collected data.
The report shows evidence of limited awareness of the significant safety, ethical, or environmental issues that are
relevant to the methodology of the investigation.
3-4
The topic of investigation is identified and a relevant but not fully focused research question is described
The background information provided for the investigation is mainly appropriate and relevant and aids the
understanding of the context of the investigation.
The methodology of the investigation is mainly appropriate to address the research question but has limitations since it
takes into consideration only some of the significant factors that may influence the relevance, reliability and sufficiency
of the collected data.
5-6
The topic of the investigation is identified and a relevant and fully focused research question is clearly described.
The background information provided for the investigation is entirely appropriate and relevant and enhances the
understanding
The report shows evidence of full awareness of the significant safety, ethical or environmental issues that are relevant
to the methodology of the investigation.
Analysis: Level of Evidence – selected, recorded, processes and interpreted the data in ways relevant to
research question and can support conclusion Mark Description
0 The student’s report does not reach a standard described by the descriptors below.
1-2
The report includes insufficient relevant raw data to support a valid conclusion to the research question.
Some basic data processing is carried out but is either too inaccurate or too insufficient to lead to a valid conclusion.
The report shows evidence of little consideration of the impact of measurement uncertainty on the analysis.
The processed data is incorrectly or insufficiently interpreted so that the conclusion is invalid or very incomplete
3-4
The report includes relevant but incomplete quantitative and qualitative raw data that could support a simple or partially
valid conclusion to the research question
Appropriate and sufficient data processing is carried out that could lead to a broadly valid conclusion but there are
significant inaccuracies and inconsistencies in the processing
The report shows evidence of some consideration of the impact of measurement uncertainty on the analysis
The processed data is interpreted so that a broadly valid but incomplete or limited conclusion to the research question
can be deduced
5-6 The report includes sufficient relevant quantitative and qualitative raw data that could support a detailed and valid
conclusion to the research question.
L
Appropriate and sufficient data processing is carried out with the accuracy required to enable a conclusion to the
research question to be drawn that is fully consistent with the experimental data.
The report shows evidence of full and appropriate consideration of impact of measurement uncertainty on the analysis
The processed data is correctly interpreted so that a completely valid and detailed conclusion to the research question
can be deduced
Evaluation: Level of Evaluation – evidence supporting evaluation with regards to scientific content Mark Description
0 The student’s report does not reach a standard described by the descriptors below.
1-2
A conclusion is outlined which is not relevant to the research question or is not supported by the data presented.
The conclusion makes superficial comparison to the accepted scientific context.
Strengths and weaknesses of the investigation, such as limitations of data and sources of error, are outlined but are
restricted to an account of the practical or procedural issues faced.
The student has outlined very few realistic and relevant suggestions for the improvement and extension of the
investigation.
3-4
A conclusion is described which is relevant to the research question and supported by the data presented.
A conclusion is described which makes some relevant comparison to the accepted scientific context.
Strengths and weaknesses of the investigation, such as limitations of the data and sources of error, are described and
provide evidence of some awareness of the methodological issues* involved in establishing the conclusion.
The student has described some realistic and relevant suggestions for the improvement and extension of the
investigation.
5-6
A conclusion is described and justified which is relevant to the research question and supported by the data presented.
A conclusion is correctly described and justified through relevant comparison to the accepted scientific context.
Strengths and weaknesses of the investigation, such as limitations of the data and sources of error, are discussed and
provide evidence of a clear understanding of the methodological issues* involved in establishing the conclusion.
The student has discussed realistic and relevant suggestions for the improvement and extension of the investigation.
Communication: Level of Presentation – investigation is presented and reported in a way that supports
effective communication in its focus, process, and outcomes Mark Description
0 The student’s report does not reach a standard described by the descriptors below.
1-2
The presentation of the investigation is unclear, making it difficult to understand the focus, process, and outcomes.
The report is not well structured and is unclear: The necessary information on focus, process, and outcomes is missing
or is presented in an incoherent or disorganized way.
The understanding of the focus, process, and outcome of the investigation is obscured by the presence of inappropriate
or irrelevant information.
There are many errors in the use of subject specific terminology and conventions*
3-4
The presentation of the investigation is clear. Any errors do not hamper the understanding of the focus, process, and
outcomes.
The report I well-structured and clear: the necessary information on focus, process and outcomes is present and
presented in a coherent way.
The report is relevant and concise thereby facilitating a ready understanding of the focus, process and outcomes of the
investigation.
The use of subject specific terminology and convections is appropriate and correct. Any errors do not hamper
understanding.
Moderator’s
Award
Moderator’s Comment
Structure and clarity
Relevance and Conciseness
Chemistry Terminology and Conventions
*e.g. incorrect/missing labelling of graphs, tables, images; use of units, decimal places. For issues of referencing and citations refer to the academic honesty section.
M
Website Review Project Project overview
You will create a website on weebly.com, where you are to create a comprehensive
review about each topic in IB Chemistry as we review through each topic. This will allow you to
help review your knowledge about every chemistry unit, while constructing your own “mind
map” of understanding on what you need to know for the IB Chemistry Test. The website should
be considered as an online note card for the IB Chemistry Test. Each student will present their
website to the class, so everyone can have access to the review material before the IB Chemistry
Test in May.
The Process:
During the next few months, we will work through each unit of chemistry either by going over
review notes and practice problems. You will be given homework to aid in the retention process.
As well as, in class tutoring will be given to all students throughout the process. Each week will
have the following breakdown:
Monday – Wednesday: Review Unit Topic
Thursday: Cumulative Quiz/Test
Friday: Test Review/Tutoring Time/Work Time
*This schedule is subject to change due to unforeseen circumstances.
Part I: The website
Every student will create their own Weebly site that has information about each topic in
chemistry. (See rubric for assistance) The structure of the website is at the student’s discretion.
On the pages, should be a comprehensive summary of each topic including:
1. Have a list of information necessary for the IB Chemistry Test per topic (should be a
minimum of 10). See pointed learning objectives given to guide this section.
2. Worked example of each equation per topic (see below). NOTE: these can be either a
picture, video, or typed on your website
3. 1 picture per unit with an explanation about each picture (should explain why this picture
helps a student understand the topic, and CANNOT be part of your worked equation
examples)
4. 1 video per unit which will help a student comprehend the topic (CANNOT be part of
your worked equation examples). The video is designed to further the knowledge of the
topic, not how to solve questions about the topic. (These can be linked/embedded onto
the website)
5. A google form all MULTIPLE CHOICE QUIZ should be embedded on the website. The
quiz should be functional with an ANSWER KEY, and have at least two questions per
topic. Ms. Manakul will take the quiz and view the results to check the quiz. (This will
give student and classmates a chance to try their hand at preparing for the IB Test. It is
suggested that questions be similar to what will be seen on the IB Test in May. See old
homework and practice quiz/tests for help)
Students will be given 5 minutes to present their website.
N
Helpful notes about website building: 1. The website does not always record/remember the information you put on the page unless
you hit “publish”
2. Fewer pages can be easier to manage.
3. You can embed pictures, google forms, links, and videos to the site
4. Make sure you check that all pieces are on the website.
Part II: Cumulative Quiz/Test Each week, a cumulative quiz or test will be given about the reviewed material, i.e. week 3 will
have a quiz about topic 1 and 2. The week there is a quiz, it will be a no calculator only multiple
choice quiz. This will simulate Paper 1. The week there is a test, it will be short answer only test
(calculator allowed). This will simulate Paper 2 and 3.
IB Chemistry Topics/Necessary examples:
1. Atom
a. Rutherford’s Experiment
b. Cathode Ray
c. Quantum Mechanical Model
2. Periodic Table
a. E = hv
b. c = λv
3. Ionic Bonding
4. Covalent Bonding
a. Hybridization
5. Stoichiometry
a. PV = nRT
6. Chemical Reactions
7. Energetics (Heat)
a. q = mCΔT
b. Hess’ Law
c. ΔHbond = ∑ΔHbreak - ∑ΔHmake
d. ΔH = ∑ΔHproducts -
∑ΔHreactants
8. Entropy
a. ΔS = ∑Sproducts - ∑Sreactants
9. Spontaneity
a. ΔG = ∑ΔGproducts -
∑ΔGreactants
b. ΔG = ΔH - TΔS
10. Kinetics (Rate of Reaction)
a. t½ = 0.693/k
b. rate = k[A]m[B]n
c. 1/[At] – 1/[Ao] = kt
d. k = Ae-(Ea/RT)
e. ln (k1/k2) = Ea/R (1/T1 –
1/T2)
11. Equilibrium
a. Kc
b. ICE Table
12. Acids & Bases
a. Ka
b. Kb
c. Kw
d. pH = -log[H+] = -log[H3O+]
e. pH = pKa + log ([A-]/[HA])
f. ICE Table
13. Redox
a. Voltaic Cell
b. Electrolytic Cell
14. Organic Chemistry
a. Substitution of an alkane
b. Addition reaction
c. SN1/SN2
d. E1/E2
e. Condensation-Addition
Reaction
f. Primary alcohol to aldehyde
g. Primary alcohol to a
carboxylic acid
h. Secondary alcohol to ketone
15. Biochemistry
a. Calculate iodine number
b. log (I0/I) = εlc
O
Student Name: _____________________________________________________
Review Project Rubric
Scale Presentation
Information
Visual
Component
Worked
Examples Google Quiz
Overall
Presentation
100
Information
masters
requirements
Pictures are
appropriate
with
explanations.
Videos aid in
project.
Every worked
example is
appropriate and
worked out
correctly for all
topics
Google quiz
has a question
for every topic
and has correct
answers for
each question
Presentation is
very
informative,
interesting, and
engaging.
75
Information
covers
requirements
but has fewer
than 10 errors
Pictures and
videos are
given, but not
all pictures
have
explanations.
Every worked
example is
appropriate and
worked out
correctly 80%
of time for all
topics
Google quiz
has a question
for every topic,
but has 80% of
correct answers
Made Ms.
Manakul or
classmate yawn
1 – 3 times
50
Information
covers only
80% of topics
or has more
than 10 errors
Only 80% of
visual
component
given
Worked
example given
for only 80% of
topics
Google quiz
has a question
for 80% of
topics
Made Ms.
Manakul or
classmate yawn
3 or more times
25
Information
covers 50% of
topics or has
50% of
information
given
incorrectly
Only 50% of
visual
component
given
Worked
example given
for only 50% of
topics.
Google quiz
has a question
for 50% of
topics
Made one or
more
classmates fall
asleep
0
No
information is
given
No visual
component
given
No worked
examples given
No google quiz
given
Made Ms.
Manakul fall
asleep or no
presentation
given
*Points may be taken away if you are not respectful when others are presenting their
information.
