Identification and Molecular Characterization of a Class IChitinase Gene (Mhchit1) from Malus hupehensis

Ji-Yu Zhang & Zhong-Ren Guo & Shen-Chun Qu &

Zhen Zhang

Published online: 24 December 2011# Springer-Verlag 2011

Abstract Mhchit1, a class I chitinase gene from Malushupehensis, was cloned, and its expression and functionalityin young seedlings were studied. Treatment with salicylicacid, methyl jasmonate, and 1-aminocyclopropane-1-car-boxylic acid resulted in the elevation of Mhchit1 transcriptlevels in leaves, stems, and roots. Infection with Botryos-phaeria berengeriana caused an accumulation of Mhchit1transcripts, with maximum levels at 6 h post-inoculation.Mhchit1 expression was also induced by the apple aphidAphis citricota. Transgenic tobacco plants that over-expressed Mhchit1 showed enhanced resistance to Botrytiscinerea, relative to wild-type control plants, and were notsusceptible to polyethylene glycol. In addition, transcriptlevels for superoxide dismutase, ascorbate peroxidase, pol-yphenoloxidase, and phenylalanine ammonia lyase were up-regulated in the transgenic plants. These results suggestthat Mhchit1 is not only involved in the SA-signal pathwaybut also with the jasmonate/ethylene-signal pathway. Ourdata support the role of Mhchit1 in M. hupehensis as animportant part of the plant’s defense strategy through pro-motion of resistance to a number of stress abiotic and bioticfactors.

Keywords Expression pattern .M. hupehensis .Mhchit1 .

Multiple resistance stress

AbbreviationsACC 1-Aminocyclopropane-1-carboxylic acidAPX Ascorbate peroxidaseEST Expression sequence tagET EthyleneIBA Indole butyric acidJA JasmonateMeJA Methyl jasmonateMS Murashige and SkoogPAL Phenylalanine ammonia lyasePDA Potato dextrose agarPEG Polyethylene glycolPPO PolyphenoloxidasePR Pathogenesis-relatedqRT–PCR Quantitative RT–PCRSA Salicylic acidSAR Systemic acquired resistanceSOD Superoxide dismutase

Introduction

Plants face a variety of environmental stresses, includingpathogens, phytophagous pests, salinity, and drought, thatchallenge their ability to survive and reproduce. Facing ahost of biotic and abiotic stress factors, plants activatedistinct defense responses to minimize or eliminate signifi-cant impacts from the stress agents (Leon-Reyes et al.2009). Systemic acquired resistance (SAR) is an induceddefense response in plants that has been extensivelyresearched (Durrant and Dong 2004). Pathogenesis-related

Plant Mol Biol Rep (2012) 30:760–767DOI 10.1007/s11105-011-0387-1

Electronic supplementary material The online version of this article(doi:10.1007/s11105-011-0387-1) contains supplementary material,which is available to authorized users.

J.-Y. Zhang : S.-C. Qu (*) : Z. Zhang (*)College of Horticulture, Nanjing Agricultural University,Jiangsu, Nanjing 210095, Chinae-mail: qscnj@njau.edu.cne-mail: zhangzh@njau.edu.cn

J.-Y. Zhang : Z.-R. GuoInstitute of Botany,Jiangsu Province and the Chinese Academy of Sciences,Nanjing 210014, China

(PR) proteins, which are the downstream components ofSAR, have direct antimicrobial activity. Recent research intothe function of PR genes has generally focused on herba-ceous species (Li et al. 2010; Jellouli et al. 2010; Nair et al.2010; Zambounis et al. 2011); woody plants have receivedmuch less attention (Bonasera et al. 2006).

Plant chitinase, an important PR protein, plays a key rolein resistance to adverse environmental factors. Chitinasecatalyzes the hydrolysis of the β-1, 4-glycoside bonds inchitin, which is a major constituent of fungal and insect cellwalls (Kasprzewska 2003). Chitinases have been used todirectly combat the effects of invading fungi; their expres-sion enhances resistance to fungal disease. Upon detectionof a pathogen attack, endogenous SA, JA, and ET levelsincrease in plants (Thatcher et al. 2005). Chitinases areinduced by exogenous SA, JA, and ET (Kasprzewska2003; Wang et al. 2009). Chitinases are also up-regulatedby abiotic stresses including osmotic abnormalities, salt, anddrought (Tateishi et al. 2001; Wang et al. 2009).

Little attention has been paid to the role of chitinasein defense against insects and osmotic stress. In addition,few studies have investigated the role of chitinase inwoody plants, especially in fruit trees. Malus hupehensisis an apple rootstock that is tolerant to pathogens, drought,and flooding (Lu and Jia 1999). In the present study, weisolated a chitinase gene from M. hupehensis and studied itsexpression pattern and function under adverse conditions.Data from this study provide the theoretical foundation fordevelopment of new apple germplasm with multiple stressresistance.

Materials and Methods

BLAST-Based Searches and In Silico Cloning

The NCBI Blastn program (http://www.ncbi.nlm.nih.gov/blast) was used to search for the chitinase gene in GenBank,non-redundant (nr) and expression sequence tag (EST) data-bases. The NCBI partial sequence of chitinase (GeneBankaccession no. AF494397) was used as an initial query se-quence for the Malus×domestica EST. Additional iterativeBLAST searches identified other related sequences to searchfor EST fragments for gene assembly. EST fragments(GenBank accession nos. DR990719) were identified fromthe EST database and assembled using DNAMAN soft-ware (Lynnon Corp.) to obtain the chitinase full-lengthcDNA sequence.

Plant Material and Treatments

M. hupehensis in vitro seedlings were rooted in 1/2Murashige and Skoog (MS) medium supplied with 0.3 mg/L

indole butyric acid (IBA, Sigma) for the Mhchit1 expressionassay. Three-week-old M. hupehensis in vitro seedlingswere sprayed with 0.1 mM salicylic acid (SA, Sigma),0.02 mM methyl jasmonate (MeJA, Sigma), and 0.01 mM1-aminocyclopropane-1-carboxylic acid (ACC, Sigma).Plants were then observed for 2 days, with samples collectedat 4, 12, and 48 h post-treatments. Seedlings that were notsprayed served as a control. Each treatment consisted of threeseedlings. After the designated time period, the leaves, stems,and roots were harvested and frozen with liquid nitrogen.

M. hupehensis in vitro seedlings were rooted in MSmedium and allowed to develop for 3 weeks. Abaxial leafsurfaces were sprayed with freshly collected Botryosphaeriaberengeriana sporangia propagated on potato dextrose agar(PDA) medium and re-suspended in water at approximately1.0×106 spores·mL−1. Leaves were collected at differenttime points and immediately frozen in liquid nitrogen.

Two-year-old M. hupehensis seedlings from a green-house were inoculated with A. citricota for a week. Threeinfected plants and three non-infected plants were selectedto determine expression using the Mhchit1 assay. Leavesand stems were collected and frozen in liquid nitrogen.

RT–PCR Amplification for the Open Reading Frame (ORF)of Mhchit1

In previous studies, we constructed a full-length cDNAlibrary of M. hupehensis after SA treatment (Zhang et al.2010). The gene-specific primers for amplification of ORFof Mhchit1 were designed based on the assembled sequenceusing in silico cloning. The PCR reaction mixture (25 μL)contained 1 μL full-length cDNA library and 0.4 pM eachof the gene-specific primers CHF1 (5′-GTTCATGAAGTTGCAAGCTCTC-3′) and CHR1 (5′-TTAGGCAAAAGGCCTTTGATTA-3′). The PCR production was cloned intopMD19-T (TaKaRa, China) and sequenced at the ShanghaiInvitrogen Biotechnology Co. Ltd. (China).

Genomic DNA PCR Amplification of Mhchit1

Genomic DNA was extracted from leaves and treated withRNase I (TaKaRa) as described by Tong et al. (2008).Mhchit1 cloning and sequencing from the genomic DNAwas performed as described above.

Sequence Analysis

The deduced amino acid sequences were compared withthose logged in GenBank using the BLAST program. Align-ment of conceptual amino acid sequences was conductedwith the BioEdit program. We predicted the subcellularlocation of the Mhchit1 protein using PSORTb, online anal-ysis software (http://psort.ims.u-tokyo.ac.jp/form.html).

Plant Mol Biol Rep (2012) 30:760–767 761

Construction of the Plant Transformation Vectorand Agrobacterium-Mediated Transformation into Tobacco

The complete coding region of Mhchit1 was amplified byPCR using primers CHF3 (5′-ACTAGTATGAAGTTGCAAGCT-3′) and CHR3 (5′-GGTACCTTAGGCAAAAGGCCTTTGATT-3′), which are designed to contain restriction sitesSpe1 and Kpn1, respectively. The amplified code was thencloned into the pCAMBIA-S1300+ binary vector. Plasmidconstruction was confirmed by PCR and restriction enzymeassay. The plasmid was transferred to A. tumefaciensEHA105 using the CaCl2 method. Transformation of tobacco‘K326’ was completed using procedures reported by Krügelet al. (2002). Explants, which were sub-cultured every2 weeks, were placed on regeneration medium supple-mented with 30 mg/L hygromycin to select, and 200 mg/Lcarbenicillin to restrain Agrobacteria.

Confirmation of Transgenic Tobacco Plants

Plants that resisted hygromycin were transplanted in to potsand cultured in greenhouse. To ensure that samples werefree from Agrobacterium contamination, the top leaves weresampled from 3-month plants. Leaves were also grown inyeast extract paste (YEB) agar medium for 3 days. TotalRNA was isolated as described by Cai et al. (2008), treatedwith DNase I (TaKaRa) according to the manufacturer’sinstructions, and reverse-transcribed using the M-MLVRTase cDNA Synthesis Kit (TaKaRa). DNA extraction,PCR, and RT–PCR were performed as described aboveusing the primers CHF3 and CHR3. PCR amplificationproducts (10 μL) were separated by electrophoresis in1.5% agarose gels. And the resulting PCR product wascloned and sequenced.

Gene Expression Analysis Using Quantitative RT–PCR(qRT–PCR)

Total RNA isolation from either M. hupehensis or tobacco,and DNase I treatment were completed as described above.Reverse transcription was performed on 1 μg of total RNAwith the ReverTra Ace qPCR RT Kit (TOYOBO) accordingto the manufacturer’s instructions. To ensure gene-specificamplification, normal PCR reactions were performed toamplify the targeted genes (Mhchit, NtSOD, NtPPO, NtPAL,and NtAPX) and housekeeping genes (MhTubulin and NtTu-bulin), respectively. A single PCR fragment with expectedsize was amplified from each pair primers, suggesting thatthe primers were suitable for the qRT–PCR analyses. Theresulting PCR product was cloned and sequenced respec-tively to confirm the expected fragment of genes. All sam-ples were harvested and three biological replicates weredone independently.

Control reactions to normalize qRT–PCR were completedusing Tubulin, with sequences derived from apple and to-bacco as house-keeping gene, respectively. qRT–PCR wasperformed as described by Wang et al. (2010). qRT–PCRwas carried out on the Applied Biosystems 7300 Real TimePCR System with a 20-μL reaction volume, containing 1 μL10-fold diluted cDNA, 0.3 μL (10 pM) of each primer(Table 1), 10 μL SYBR® Premix Ex Taq™ (Perfect RealTime) (TaKaRa code—DRR041A) and 8.4 μL sterile dou-ble distilled water. The PCR conditions consisted of dena-turation at 95°C for 4 min, followed by 40 cycles of 95°Cfor 20 s, 57°C for 20 s, and 72°C for 40 s. The specificity ofthe individual PCR amplification was checked using a heatdissociation curve from 55 to 95°C following the final cycleof the PCR. All samples were examined in triplicate. Therelative quantification levels of these genes to control Tubu-lin mRNAs were analyzed using 2−ΔΔCT methods (Livakand Schmittgen 2001).

Analysis of Transgenic Tobacco Plants for Resistanceto Fungi (Botrytis cinerea Pevs.)

Healthy, 1-month-old tobacco leaves were excised fromwild-type (WT) and transgenic plants. The leaves werewashed four times using sterile ddH2O. The leaves(0.5 cm diameter) were given a minimal wound betweenthe leaf veins using scalpel. Into the wound was placed 10μL of a B. cinerea spore solution (1×105 conidia/ml). Thesame volume of ddH2O was added to the incisions in controlleaves. Treated plants (including controls) were placed onwet (5 ml ddH2O) filter paper and transferred to a Petri dish(12 cm diameter). The Petri dishes were held under highhumidity conditions at 25°C until substantial differencesbetween transgenic lines and WT plants were apparent.

Analysis of Transgenic Tobacco Plants for Toleranceto Osmotic Stress

To analyze the influence ofMhchit1sis on tolerance to osmoticstress, a leaf disc (1.0 cm diameter) assay was conductedand total chlorophyll content was measured as reported bySrinivasan et al. (2009). The treatments were performed incontinuous white light at 27°C until substantial differencesbetween transgenic lines and WT plants were apparent.

Results

Cloning and Sequence Analysis of Mhchit1from M. hupehensis

The complete cDNA sequence designated as the MhChit1gene (GenBank accession no. FJ422811) has an ORF of

762 Plant Mol Biol Rep (2012) 30:760–767

951 bp; the sequence codes 316 amino, class I chitinase. Themost likely cleavage site was between the 19 and 20 aapositions (A/E) in the N-terminal sequence of Mhchit1, aspredicted by SignalP 3.0 (http://www.cbs.dtu.dk/services/SignalP/) (Supplementary Fig. 1). No intron was found inthe Mhchit1 gene based upon isolation of the correspondinggenomic DNA sequence from M. hupehensis.

Analysis of the Deduced Amino Acid Sequenceof Mhchit1

A BLAST search in GenBank showed that MhChit1 shares88%, 76%, and 74% sequence identity with class I chitinasePyrus pyrifolia (GenBank accession no. ACM45713),Glycinemax (GenBank accession no. AF202731), and Momordicacharantia (GenBank accession no. ABD66068), respectively.Multiple alignment of Mhchit1 with the representativesequences in class I, II, and IV plant chitinases (Supplemen-tary Fig. 1) identified two conserved regions in the matureMhchit1 protein: the chitin binding domain (Q21-C58) andthe catalytic domain (I81-F315). However, the C-terminalextension was deleted. In addition, the amino acid residuesincluding W43, E142, E164, Q191, T193, and N272, which areimportant for chitin-binding and chitinolytic activities inplant class I chitinases (Fukamizo 2000; Wang et al.2009), were all conserved in Mhchit1.

Expression of the Mhchit1 Gene Inducedby SA, MeJA, and ACC in Leaves, Stems and Rootsof M. hupehensis

Treatment with SA and ACC triggered an increase in thetranscript level of the Mhchit1 gene at various time intervalsin leaves (Fig. 1a), stems (Fig. 1b), and roots (Fig. 1c).MeJA treatment in roots has a strong effect on Mhchit1expression (Fig. 1c), but not in leaves (Fig. 1a) and stems(Fig. 1b). The degree of elevation of the transcript levelvaried substantially with both time and tissue. In leaves after4, 12, and 48 h, the transcript levels rose 2.3×, 5.0×, and

20.2×, respectively, upon treatment with SA, relative tothe control treatment. When leaves were treated withMeJA, transcript levels rose 2.1×, 4.2×, and 2.0× afterthe same time periods, respectively. Increases of 2.5×,5.4×, and 70.0× were observed in leaves following ACCtreatment after 4, 12, and 48 h. Expression trends instems were similar to what was observed in leaves. Thetranscript level varied were 3.5×, 5.6×, and 12.9× withSA; 2.6×, 4.4×, and 2.3× with MeJA; and 3.1×, 8.4×,and 51.5× with ACC, relative to the control, after 4, 12,and 48 h, respectively. In roots, when compared tomeasurements at time 0 of the experiment, the accumu-lation of Mhchit1 gene transcripts was 5.3×, 1.3×, and 1.2×with SA; 2.3×, 3.1×, and 6.7× with MeJA; and 5.7×, 17.6×,and 2.7× with ACC, 4, 12, and 48 h post-treatment,respectively.

Induction of the Mhchit1 Gene with the Fungus B.berengeriana and Aphid A. citricota

Infection by the fungus B. berengeriana induced a substan-tial accumulation of Mhchit1 transcripts (Fig. 1d). Levelsrose at 3 h post-inoculation (hpi), remained at the highestlevel at 6 hpi, and then decreased. The leaves and stems ofM. hupehensis were infected by A. citricota. Mhchit1 tran-script levels rose in response to the presence of the aphid. A1.9× increase (relative to non-infected plants) was measuredin the leaves and a 2.4× increase was recorded in the stemsof M. hupehensis (Fig. 1e).

Confirmation of the Mhchit1 Gene in Transgenic TobaccoPlants

Intense PCR products of 951 bp that were obtained fromhygromycin-resistant transgenic lines were not detected inthe WT plants. Not surprisingly, RT–PCR revealed thatMhchit1 was expressed in the transgenic plants but not inWT plants (Fig. 2a).

Table 1 primers used for qRT-PCR assay in this paper

Gene names Sense primer 5′–3′ Antisense primer 5′–3′ GenBank accession no. Size (bp)

Mhtubulin GCCGAAGAACTGACGAGAATC AGGATGCTACAGCCGATGAG GU317944 192

Mhchit1 CGTGGAGCCCATCTAGTGAAG CCCTATCATCCTGACCCTTGC FJ422811 110

NtPPO TGGAGGATATTGGGTTGGAAGATG ACACACTGCGTTCAGATAATTTGG Y12501 159

NtAPX GCTCTCCTCTCTGATCCTGCTTTC CACTCCCAACTCTTCCTCCTATCG U15933 159

NtSOD CCATTACCGACAAGCAGATTCCTC CAACCCTTCCACCAGCATTTCC EU123521 141

NtPAL CCAGGTGAAGAATGTGACAAAGTG TCTAACAGATTGGAAGAGGAGCAC X78269 112

Nttubulin AGATGTTCCGTCGTGTCAGTG TGCTTCCTCTTCATCCTCATATCC EF051136 200

Plant Mol Biol Rep (2012) 30:760–767 763

Stress-Related Gene Expression Analysis Using qRT–PCR

Compared to the WT plant, transgenic tobacco plants hadhigher levels of transcripts of the gene for the SOD, PPO,

PAL, and APX in the absence of pathogen infection orabiotic stresses (Fig. 2b).

Enhanced Resistance to B. cinerea in the Mhchit1Over-Expressing Tobacco Plants

On WT plant leaves, necrotic lesions and chlorosis lesionswere visible in inoculation and non-inoculation locations5 days after infection with B. cinerea. This response indi-cates mobilization of the fungal spores, probably via the leafveins (Fig. 3, WT a). In contrast, necrotic lesions and chlo-rosis lesions were not present at the site of inoculation on thetransgenic tobacco plant leaves (Fig. 3, T1 a and T2 a).Infected transgenic plant leaves appeared the same as thoseof the uninfected WT (Fig. 3, WT b) and transgenic plantleaves (Fig. 3, T1 b and T2 b).

Tolerance to Osmotic Stress

Differences in the appearance of transgenic and controlplants subjected to osmotic stress were clearly visible2 weeks after treatment. The leaf discs from the transgenic

Fig. 2 Confirmation of transgenic tobacco plants and the expressionanalysis of stress-related genes. a Confirmation of transgenic tobaccoplants; A PCR detection, B RT–PCR detection. M molecular sizemarker, H2O blank control, P positive control (plasmid DNA), WTnon-transgenic tobacco plant, T1–T2 transgenic tobacco plants. bStress-related gene expression in transgenic tobacco plants usingqRT–PCR with non-transgenic tobacco plant as control. NtTubulintranscript levels were used to normalize the samples. Means andstandard deviations were obtained from triplicate assays

Fig. 1 Expression patternsof Mhchit1 using qRT–PCR.Expression of the Mhchit1 genein leaves (a), stems (b), androots (c) after treatment with SA,MeJA, and ACC, and leaves,stems, or roots withouttreatment were taken as control,respectively. d Expressionpatterns of Mhchit1 in leavesof M. hupehensis inoculatedwith B. berengeriana usingnon-treatment as a control.e Expression of Mhchit1 geneinfected with A. citricota in M.hupehensis in stems and leaveswith (+) or without (−) appleaphid infection, and stemswithout treatment was taken ascontrol. MhTubulin transcriptlevels were used to normalizethe samples. Means and standarddeviations were obtained fromtriplicate assays. Hpt hourspost-treatment, Hpi hourspost-inoculation

764 Plant Mol Biol Rep (2012) 30:760–767

plants showed less chlorosis with increasing concentrationsof PEG (Fig. 4a); WT plants were severely bleached(Fig. 4a). Direct measurement of chlorophyll concentrationin the treated and untreated leaf discs showed that the loss ofpigment was less in the transgenic tobacco plants, relative tothe control plants (Fig. 4b).

Discussion

Many genes have been demonstrated to respond to environ-mental stresses (Jellouli et al. 2010; Bao et al. 2011; Li et al.2011; Xu et al. 2011). In this study, we cloned and charac-terized the chitinase gene Mhchit1, which might play animportant role in resistance to pathogenesis, apple aphids,and osmotic stresses. Pfam prediction results showed thatMhchit1 belongs to glycoside hydrolase family 19. Plantenzymes in this family play an important plant defense roleagainst fungal and insect pathogens by decomposing theirchitin-containing cell wall. Previous studies showed that

class I chitinase have a short C-terminal extension whichis absent in class II and IV chitinase. When the C-terminalextension is present, as in class I chitinase, the matureprotein is typically found in cell vacuoles. Tobacco class Ichitinase without the C-terminal extension was mainlylocated in extracellular spaces and the cellular medium(Neuaus et al. 1994).

Defense-related responses of the plant depend on acomplex network of signal transduction pathways. SA,JA, and ET are probably the most studied and clearlycharacterized signaling factors related to plant defensereactions (Reymond and Farmer 1998; Meng et al.2010). Fany et al. (2007) indicated that SA and JA couldinduce accumulation of the gene transcript, suggesting thatMpChi-1 may be involved in SA- and JA-regulated defenseresponses. Application of exogenous SA has long beenknown to stimulate expression of PR genes and to induceresistance to plant diseases (Fany et al. 2007; Ward et al.1991). In this study, the results showed that SA, MeJA, andACC were effective in inducing MhChit1 mRNA. Our datastrongly indicated that SA, JA, and ET are the primaryregulators of Mhchit1 expression when the plant is mobiliz-ing resources to resist diseases.

Chitinase plays a defensive role against plant insects(Alagar et al. 2010; Lawrence and Novak 2006; Wang etal. 2005). Our study showed thatMhchit1 was induced by A.citricota in leaves and stems. Previous studies assumed thathigh chitinase activity in resistant plants might interfere withdevelopment, feeding, and growth in immature, juvenileinsects (Sampson and Gooday 1998). Data gathered in thisstudy suggest that up-regulated Mhchit1 may very well beinvolved in defenses against insect pests in M. hupehensis.

Previous studies showed that chitinase expression maycharacterize a prophylactic or inducible mechanism for pro-tection against microbial invasion (Gomez et al. 2002;Whitmer et al. 2003). In this study, MhChit1 was inducedby infection with the B. berengeriana pathogen. Its

Fig. 4 a Effect of different concentrations of polyethylene glycol(PEG6000) on leaf discs of T1 and T2. b Total chlorophyll concentra-tion in the leaf discs after PEG treatment. The mean ± SE are plotted;experiments were completed in triplicate

Fig. 3 Comparison of resistanceagainst B. cinerea betweentransgenic and WT plants,5 days after infection. Region aindicates inoculation with10 μLof B. cinerea; region b indicatesaddition of 10 μL of sterile,distilled water as a control. Theexperiment was repeated threetimes independently

Plant Mol Biol Rep (2012) 30:760–767 765

heterogeneous expression in transgenic tobacco plantscaused resistance to B. cinerea, supporting the fungal-defense role of Mhchit1. It is not questionable that plantchitinases hydrolyze fungal cell wall chitin and generateelicitor from chitin and larger molecules such as polysac-charides or glycoprotein (Kasprzewska 2003). Previousstudies show that several other transgenic plants withchitinase gene were reported to have significantly in-creased resistance to fungal diseases. Transgenic grape-vine with class I rice chitinase gene rcc2 showed a slightresistance against Elisinoe ampeina that induces anthracnose(Yamamoto et al. 2000). Takahashi et al. (2005) introducedthe rice chitinase gene rcc2 into Italian ryegrass, and trans-genic plants showed enhanced resistance to crown rustdisease caused by the fungal pathogen Puccinia coronata.The transgenic taro (Colocasia esculenta) over-expressing arice chitinase gene exhibited increased tolerance to the fun-gal pathogen Sclerotium rolfsii (He et al. 2008). Pak et al.(2009) reported that OgChitIVa may repress fungal infectionby chitin degradation or may induce elicitors by degradingfungal chitin and so activate the defense response such asPR-1 and PR-2 gene expression. In this study, ectopic ex-pression of Mhchit1 gene somehow changed the gene ex-pression profile and induced SOD, APX, PPO, and PALgene expression in tobacco. Mhchit1 heterogeneous expres-sion in transgenic tobacco plants caused resistance to B.cinerea. Mhchit1 may repress fungal infection by chitindegradation or may induce the defense response such asSOD, APX, PPO, and PAL gene expression.

Chitinase expression was up-regulated in plants by abi-otic stress; its heterogeneous expression in transgenic plantssignificantly increases the tolerance of those plants to thesestresses (Hong and Hwang 2006; Tateishi et al. 2001).Based on previous research, transgenic tobacco plantsover-expressing Mhchit1 show some degree of tolerance toPEG. This observation was corroborated by the leaf discassay with 2-month-old plants exposed to PEG. The trans-genic plants with elevated expression levels of Mhchit1demonstrated much lower pigment loss and much higherchlorophyll concentrations, when compared to the WTplants. SOD and APX are critically important enzymes forreactive oxygen species (ROS) that scavenge in plants understress conditions (Apel and Hirt 2004; Mitter 2002; Qiu etal. 2011). SOD catalyzes the dismutation of superoxide tohydrogen peroxide (H2O2), followed by H2O2 detoxificationby APX (Apel and Hirt 2004). Transgenic tobacco plantsthat over-expressed a pepper APX showed enhanced diseaseresistance and oxidative stress tolerance (Mitter 2002).Transgenic plants over-expressing both APX and SODrevealed enhanced abiotic stress tolerance (Sharma andKumar 2005). PAL is a key enzyme in the phenylpropanoidbiosynthetic pathway and is probably involved in thebiosynthesis of SA (Lee et al. 2007). Durner et al (1998)

reported that PAL, acting as a defense gene, is activated by avariety of stress factors. PPOs, which catalyze the oxidationof phenols to quinines, play a key role in a plant’s defenseagainst pests and pathogens (Constabel et al. 1995). In thisstudy, transgenic tobacco over-expressing Mhchit1 hadhigher levels of transcripts of the gene for the SOD, PPO,PAL, and APX in the absence of pathogen infection orabiotic stresses. In light of these historical data, therefore,the observed enhancement of transgenic tobacco plant re-sistance to osmotic stresses upon up-regulation of SOD,APX, PPO, and PAL transcripts is not unexpected.

Our study showed that Mhchit1 is associated with boththe SA- and JA/ET-signal pathways. Expression of Mhchit1promotes a high level of resistance to insects, fungal patho-gens, and osmotic stress. The presence of this gene, there-fore, may be highly advantageous for many plant species,including commercial varieties where maximum yield ofsalable product is the goal. Future research efforts willinclude transfer of the Mhchit1 gene into Fuji (variety)apples to further study its function in woody plants.

Acknowledgments This work was supported by grants from theChina Ministry of Science and Technology “863” program#2011AA100204 and the Priority Academic Program Developmentof Jiangsu Higher Education Institutions (PAPD).

References

Alagar M, Suresh S, Saravanakumar D, Samiyappan R (2010)Feeding-induced changes in defence enzymes and PR proteinsand their implications in host resistance to Nilaparvata lugens. JAppl Entomol 134:123–131

Apel K, Hirt H (2004) Reactive oxygen species: metabolism, oxidativestress, and signal transduction. Ann Rev Plant Biol 55:373–379

Bao Y, Zhao R, Li F, Tang W, Han L (2011) Simultaneous expressionof Spinacia oleracea chloroplast choline monooxygenase (CMO)and betaine aldehyde dehydrogenase (BADH) genes contribute todwarfism in transgenic Lolium perenne. Plant Mol Biol Rep29:379–388

Bonasera JM, Kim JF, Beer SV (2006) PR genes of apple: identifica-tion and expression in response to elicitors and inoculation withErwinia amylovora. BMC Plant Biol 6:23

Cai BH, Zhang JY, Gao ZH, Qu SC, Tong ZG, Mi L, Qiao YS, ZhangZ (2008) An improved method for isolation of total RNA from theleaves of Fragaria spp. Jiangsu J Agric Sci 24:875–877

Constabel CP, Bergey DR, Ryan C (1995) Systemin activates synthesisof wound-inducible tomato leaf polyphenol oxidase via the octa-decanoid defense signaling pathway. Proc Natl Acad Sci USA92:407–411

Durner J, Wendehenne D, Klessig DF (1998) Defense gene inductionin tobacco by nitric oxide, cyclic GMP, and cyclic ADP-ribose.Proc Natl Acad Sci USA 95:10328–10333

Durrant WE, Dong X (2004) Systemic acquired resistance. AnnualRev Phytopathol 42:185–209

Fany J, Wang H, Feng D, Liu B, Liu H, Wang J (2007) Molecularcharacterization of plantain class I chitinase gene and its expres-sion in response to infection by Gloeosporium musarum Cke andMassee and other abiotic stimuli. China J Biochem 142:561–570

766 Plant Mol Biol Rep (2012) 30:760–767

Fukamizo T (2000) Chitinolytic enzymes: catalysis, substrate binding,and their application. Curr Protein Pept Sci 1:105–1024

Gomez L, Allona I, Casado R, Aragoncillo C (2002) Seed chitinasesreview. Seed Sci Res 12:217–230

He X, Miyasaka SC, Fitch MMM, Moore PH, Zhu YJ (2008) Agro-bacterium tumefaciens-mediated transformation of taro (Coloca-sia esculenta (L.) Schott) with a rice chitinase gene for improvedtolerance to a fungal pathogen Sclerotium rolfsii. Plant Cell Rep27:903–909

Hong JK, Hwang BK (2006) Promoter activation of pepper class IIbasic chitinase gene, CAChi2, and enhanced bacterial diseaseresistance and osmotic stress tolerance in the CAChi2-overexpressing Arabidopsis. Planta 223:433–448

Jellouli N, Ben Jouira H, Daldoul S, Chenennaoui S, Ghorbel A, BenSalem A, Gargouri A (2010) Proteomic and transcriptomic anal-ysis of grapevine PR10 expression during salt stress and func-tional characterization in yeast. Plant Mol Biol Rep 28(1):1–8

Kasprzewska A (2003) Plant chitinases—regulation and function. CellMol Biol Lett 8:809–824

Krügel T, Lim M, Gase K, Halitschke R, Baldwin IT (2002) Agro-bacterium-mediated transformation of Nicotiana attenuata, amodel ecological expression system. Chemoecology 12:177–183

Lawrence SD, Novak NG (2006) Expression of poplar chitinase intomato leads to inhibition of development in Colorado potatobeetle. Biotechnol Lett 28:593–599

Lee SH, Ahsan N, Lee KW, Kim DH, Lee DG, Kwak SS, Kwon SY,Kim TH, Lee BH (2007) Simultaneous overexpression of bothCu/Zn superoxide dismutase and ascorbate peroxidase in trans-genic tall fescue plants confers increased tolerance to a wide rangeof abiotic stresses. J Plant Physiol 164:1626–1638

Leon-Reyes A, Spoel SH, lvira E, De Lange S, Abe H, Kobayashi M,Tsuda S, Millenaar FF, Welschen RAM, Ritsema T, Pieterse CMJ(2009) Ethylene modulates the role of nonexpressor ofpathogenesis-related genes1 in cross talk between salicylate andjasmonate signaling. Plant Physiol 149:1797–1809

Li DM, Staehelin C, Wang WT, Peng SL (2010) Molecular cloning andcharacterization of a chitinase-homologous gene from Mikaniamicrantha infected by Cuscuta campestris. Plant Mol Biol Rep28(1):90–101

Li W, Wang D, Jin T, Chang Q, Yin D, Xu S, Liu B, Liu L (2011) Thevacuolar Na+/H+antiporter gene SsNHX1 from the halophyteSalsola soda confers salt tolerance in transgenic alfalfa (Medicagosativa L.). Plant Mol Biol Rep 29:278–290

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expressiondata using real-time quantitative PCR and the 2−DDCt method.Methods 25:402–408

Lu QN, Jia DX (1999) China fruit records: apple volume, 1st edn.China’s Agricultural Science & Technology Press, Beijing

Meng X, Li F, Liu C, Zhang C, Wu Z, Chen Y (2010) Isolation andcharacterization of an ERF transcription factor gene from cotton(Gossypium barbadense L.). Plant Mol Biol Rep 28:176–183

Mitter R (2002) Oxidative stress, antioxidants and stress tolerance.Trends Plant Sci 7:405–410

Nair RA, Kiran AG, Sivakumar KC, Thomas G (2010) Molecularcharacterization of an oomycete-responsive PR-5 protein genefrom Zingiber zerumbet. Plant Mol Biol Rep 28(1):128–135

Neuaus JM, Pietrzak M, Boller T (1994) Mutation analysis of the C-terminal vacuolar targeting peptide of tobacco chitinase: lowspecificity of the sorting system, and gradual transition betweenintracellular retention and secretion into the extracellular space.Plant J 5:45–54

Pak JH, Chung ES, Shin SH, Jeon EH, Kim MJ, Lee HY, Jeung JU,Hyung NI, Lee HL, Chung YS (2009) Enhanced fungal resistancein Arabidopsis expressing wild rice PR-3(OgChitIVa) encodingchitinase class IV. Plant Biotechnol Rep 3:147–155

Qiu W, Liu M, Qiao G, Jiang J, Xie L, Zhuo R (2011) An isopentyltransferase gene driven by the stress-inducible rd29A promoterimproves salinity stress tolerance in transgenic tobacco. Plant MolBiol Rep. doi:10.1007/s11105-011-0337-y

Reymond P, Farmer EE (1998) Jasmonate and salicylate as global signalsfor defense gene expression. Curr Opin Plant Biol 1:404–411

Sampson MN, Gooday GW (1998) Involvement of chitinases of Ba-cillus thuringiensis during pathogenesis in insects. Microbiology144:2189–2194

Sharma P, Kumar S (2005) Differential display-mediated identificationof three drought-responsive expressed sequence tags in tea[Camellia sinensis (L.) O. Kuntze]. J Biosci 30:231–235

Srinivasan T, Raja Rajesh Kumar K, Meur G, Kirti PB (2009) Heter-ologous expression of Arabidopsis NPR1 (AtNPR1) enhancesoxidative stress tolerance in transgenic tobacco plants. BiotechnolLett 31:1343–1351

Takahashi W, Fujimori M, Miura Y, Komatsu T, Nishizawa Y, Hibi T,Takamizo T (2005) Increased resistance to crown rust disease intransgenic Italian ryegrass (Lolium multiflorum Lam.) expressingthe rice chitinase gene. Plant Cell Rep 23:811–818

Tateishi Y, Umemura Y, Esaka M (2001) A basic class I chitinaseexpressing in winged bean is up-regulated by osmotic stress.Biosci Biotechnol Biochem 65:1663–1668

Thatcher LF, Anderson JP, Singh KB (2005) Plant defense re-sponse: what have we learnt from Arabidopsis. Funct PlantBiol 32:1–19

Tong ZG, Wang FR, Zhang Z, Zhao JB, Zhang KC, Yan GH, Zhou Y,Jiang LJ (2008) A method for DNA extraction from mature leaf offruit trees. J Fruit Sci 25:122–125

Wang J, Chen Z, Du J, Sun Y, Liang A (2005) Novel insect resistancein Brassica napus developed by transformation of chitinase andscorpion toxin genes. Plant Cell Rep 24:549–555

Wang J, Tian N, Huang X, Chen LY, Schläppi M, Xu ZQ (2009) Thetall fescue turf grass class I chitinase gene FaChit1 Is activated byfungal elicitors, dehydration, ethylene, and mechanical wounding.Plant Mol Biol Rep 27:305–314

Wang QJ, Xu KY, Tong ZG, Wang SH, Gao ZH, Zhang JY, Zong CW,Qiao YS, Zhang Z (2010) Characterization of a new dehydrationresponsive element binding factor in central arctic cowberry. PlantCell Tiss Organ Cult 101:211–219

Ward ER, Uknes SJ, Williams SC, Dincher SS, Wiederhold DL,Alexander DC, Ahl-Goy P, Metraux JP, Ryals A (1991) Coordi-nated gene activity in response to agents that induce systemicacquired resistance. Plant Cell 3:1085–1094

Whitmer X, Nonogaki H, Beers EP, Bradford KJ, Welbaum GE (2003)Characterization of chitinase activity and gene expression inmuskmelon seeds. Seed Sci Res 13:167–178

Xu C, Zheng L, Gao C, Wang C, Liu G, Jiang J, Wang Y (2011)Overexpression of a vacuolar H+−ATPase c subunit gene medi-ates physiological changes leading to enhanced salt tolerance intransgenic tobacco. Plant Mol Biol Rep 29:424–430

Yamamoto T, Iketani H, Ieki H, Nishizawa Y, Notsuka K, Hayashi T,Matsuta N (2000) Transgenic grapevine plants expressing a ricechitinase with enhanced resistance to fungal pathogens. Plant CellRep 19:639–646

Zambounis AG, Kalamaki KS, Tani EE, Paplomatas EG, Tsaftaris AS(2011) Expression analysis of defense-related genes in cotton(Gossypium hirsutum) after Fusarium oxysporum f. sp. vasinfec-tum infection and following chemical elicitation using a salicylicacid analog and methyl jasmonate. Plant Mol Biol Rep.doi:10.1007/s11105-011-0335-0

Zhang JY, Qu SC, Dong C, Gao ZH, Qiao YS, Zhang Z (2010) Utilityand construction of full-length cDNA library ofMalus hupehensispost-introduced with salicylic acid. Acta Bot Boreal-Occid Sin8:1527–1533

Plant Mol Biol Rep (2012) 30:760–767 767