Proc. Nati. Acad. Sci. USAVol. 85, pp. 597-601, January 1988Medical Sciences

Identification of a cDNA encoding a parathyroid hormone-likepeptide from a human tumor associated with humoralhypercalcemia of malignancy

(ectopic hormone/keratinocyte/chromosome 12)

MARGUERITE MANGIN*t, ANDREW C. WEBBt, BARBARA E. DREYER*, JAMES T. POSILLICO§, KYonI IKEDA*,ELEANOR C. WEIR*, ANDREW F. STEWART*$, NEIL H. BANDER11, LEONARD MILSTONE*¶,DAVID E. BARTON**, UTA FRANCKE**, AND ARTHUR E. BROADUS**Departments of Medicine and Dermatology and Section of Comparative Medicine, Yale University, New Haven, CT 06510; tDepartment of BiologicalSciences, Wellesley College, Wellesley, MA 02181; §Department of Medicine, Brigham and Women's Hospital, Boston, MA 02115; IDepartments ofMedicine and Dermatology, Veterans Administration Medical Center, West Haven, CT 06516; IlDepartments of Surgery and Medicine, MemorialSloan-Kettering Cancer Center and New York Hospital-Cornell Medical Center, New York, NY 10021; and **Department of Human Genetics,Yale University, New Haven, CT 06510

Communicated by Leon E. Rosenberg, September 17, 1987 (received for review August 14, 1987)

ABSTRACT Humoral hypercalcemia of malignancy is acommon paraneoplastic syndrome that appears to be mediatedin many instances by a parathyroid hormone-like peptide.Poly(A)+ RNA from a human renal carcinoma associated withthis syndrome was enriched by preparative electrophoresisand used to construct an enriched cDNA library in phageAgtlO. The library was screened with a codon-preferenceoligonucleotide synthesized on the basis of a partial N-terminalamino acid sequence from a human tumor-derived peptide,and a 2.0-kilobase cDNA was identified. The cDNA encodes a177 amino acid protein consisting of a 36 amino acid leadersequence and a 141 amino acid mature peptide. The first 13amino acids of the deduced sequence of the mature peptidedisplay strong homology to human PTH, with complete diver-gence thereafter. RNA blot-hybridization analysis revealedmultiple transcripts in mRNA from tumors associated with thehumoral syndrome and also in mRNA from normal humankeratinocytes. Southern blot analysis of genomic DNA fromhumans and rodents revealed a simple pattern compatible witha single-copy gene. The gene has been mapped to chromosome12.

The syndrome of humoral hypercalcemia of malignancy(HHM) has attracted great interest over the past decade.This interest reflects (i) the frequency of the syndrome aswell as the precision with which it has been characterized invivo (1, 2); (ii) the recognition that the active principle israrely, if ever, parathyroid hormone (PTH) or one of itsbiosynthetic precursors and therefore is likely a differentpeptide hormone (1, 3-6); and (iii) the identification of asimilar peptide as a normal secretory product of hurnankeratinocytes (7). The peptide in question has certain PTH-like actions, and its effects in several systems in vitro can beblocked by a synthetic antagonist to PTH binding (3, 5, 8).However, in terms of other of its actions, its size, and itsimmunoreactivity, it is clearly distinct from native PTH (1-3,5, 9, 10).Three laboratories have recently purified picomolar

amounts of the tumor-derived PTH-like peptide and haveobtained N-terminal sequences (9-12). These sequencesresemble the proximal N-terminal sequence of human PTH(10-12).To determine the complete structure of the peptide and

initiate studies of its expression in normal and malignant

cells, we undertook experiments to isolate a full-lengthcDNA encoding the peptide. The nucleotide and deducedamino acid sequence of cDNA clone AHHM-8 is reportedhere.tt

METHODSPreparations and Enrichment of mRNA. RNA was pre-

pared by the guanidinium thiocyanate technique (13), andpoly(A)+ RNA was selected by oligo(dT)-cellulose chroma-tography. Xenopus oocytes were injected with 50 nl ofmRNA, and medium was harvested after 36 hr for bioassay(14, 15). The cytochemical bioassay (CBA) is based on thestimulation of glucose-6-phosphate dehydrogenase activityin guinea pig renal tubular cells and is sensitive to PTH in the1-fM range; results are expressed in equivalence units (pico-gram equivalents per ml) to bovine PTH-(1-84) (15).

Preparative polyacrylamide tube gel electrophoresis wasperformed as described (14). In an initial experiment, theentire elution volume was surveyed as 13 fraction-pools (14).In a subsequent experiment using 560 pg of mRNA, individ-ual 1.0-ml fractions in the region of interest were collected,and aliquots of these were processed for mRNA content byin vitro translation and for biological activity by oocyteinjection and CBA. The data were expressed as pg eq/ml perjug of injected mRNA to allow estimation of the degree ofmRNA enrichment.

Construction and Screening of cDNA Library. The Agtl0library was prepared from 2 ,ug of the enriched mRNA usinga modification of the RNase H-DNA polymerase I technique(16, 17). The cDNA was size-selected [>600 base pairs (bp)]on a Bio-Gel A-50 column before insertion into the vector(17). The primary library contained 600,000 clones, with anaverage insert size of 1500 bp. Poly(A)+ RNA from thebreast carcinoma (9) was not used because yields were poor.The extreme degeneracy of the amino acids representing

residues 6-18 of the purified peptide (9, 12) was approachedby using a combination of optimum human codon choices(18) and four inosine residues (19). The complementary38-base oligonucleotide (3' GTC-GAI-GAI-GTA-CTG-ACC-

Abbreviations: PTH, parathyroid hormone; HHM, humoral hyper-calcemia of malignancy; CBA, cytochemical bioassay.tTo whom reprint requests should be addressed at: Fitkin I,Department of Internal Medicine, Yale University, 333 Cedar St.,New Haven, CT 06510.ttThis sequence is being deposited in the EMBL/GenBank database (Bolt, Beranek, and Newman Laboratories, Cambridge, MA,and Eur. Mol. Biol. Lab., Heidelberg) (accession no. J03580).

597

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Aug

ust 2

6, 2

021

598 Medical Sciences: Mangin et al.

Sm..I1.

Sm Sm SmEcQ Bg| B |S

-100 bp

D Eco..I

II 1~~~~~~~~~~~~~~~~~~~-36 +1 +141Met Ala End

FIG. 1. Physical map of cDNA clone AHHM-8. The coding region of the mature peptide is solid; the precursor region is hatched. Theinitiating methionine, the first amino acid of the mature peptide, and the end of the peptide are indicated below the map. Restriction sites areshown above the map (B, BamHI; Bg, Bgl II; D, Dra I; Eco, EcoRI; P, Pvu II; R, Rsa I; S, Sac I; Sm, Sma I).

CCI-TTT-AGI-TAG-GTC-CTG-GA 5') was synthesized bythe phosphoramidite method and assumed tryptophan atposition 11; this residue was subsequently corrected tolysine (12). In the hybrid-arrest experiment, line SKRC-1mRNA (1 ug/,ul) was incubated with and without the oligo-nucleotide (10 pmol/,ul) prior to oocyte injection (20). Ap-proximately 100,000 phages were plated and screened onnitrocellulose filters by hybridizing overnight at 45°C withthe kinase-treated oligonucleotide (3-5 x 106 cpm per ml ofhybridization solution) (21).

Biological Confirmation and Sequencing of the cDNAClone. Hybrid selection (22) was carried out with 20 ug ofsingle-stranded DNA from phage M13 representing eachstrand of the cDNA. Separate filters were hybridized with 25,ug of mRNA from line SKRC-1, processed to a final volumeof 1.5 ,ul, and injected (50 nl/oocyte). The insert was alsosubcloned into pGEM-blue (Promega Biotech) in both ori-entations, and capped sense and antisense transcripts wereproduced with phage T7 RNA polynmerase (23) and injectedat a concentration of 0.1 ,g/l.The cDNA and restriction fragments were subcloned into

M13 mplO and mpll and sequenced by the chain-termina-tion method (24, 25). Both strands were sequenced over theirfull length.RNA and DNA Blot Analysis and Chromosome Assignment.

Poly(A)+ RNA (10 ,ug) was separated on a 1% agarose-formaldehyde gel, transferred to a nitrocellulose filter, andhybridized overnight with 32P-labeled insert (40 x 106 cpmin 10 ml of hybridization solution) prepared with randomprimers (26). The final wash was with 0.075 M NaCl/0.0075M sodium citrate, pH 7/0.1% NaDodSO4 at 48°C. GenomicDNA (10 ,g) from human and three rodent species wasdigested with various restriction enzymes, fractionated byelectrophoresis on 1% agarose gels, transferred to nitrocel-lulose filters, and probed with 32P-labeled insert (26, 27).Chromosome assignment was performed by analysis ofsomatic cell hybrids using DNA from 17 Chinese hamster-human hybrid cell lines (27, 28). These hybrids were derivedfront six different fusions, and one contains a chromosome12 with a terminal deletion of the long arm (28). In situhybridization of the 3H-labeled probe to human metaphasechromosomes was performed as described (27, 28).

RESULTSIdentification of cDNA Clone. We have described (4) a

series ofhuman renal carcinoma lines that either do or do notinduce HHM when implanted in athymic mice as a functionof the PTH-like secretory phenotype of the lines in vitro.Poly(A)+ RNA prepared from four lines that secrete thisactivity was surveyed by oocyte injection and CBA, identi-fying one line (SKRC-1) that was considerably enriched(CBA, 186 pg eq/ml) vis-a-vis the other three lines (11-78 pgeq/ml). Poly(A) + RNA from this line was purified 24-fold bypreparative polyacrylamide electrophoresis (from 25.6 to 617pg eq/ml per ug of mRNA injected), and 2 ,g of thisenriched mRNA was used to construct a cDNA library inAgtlO.A codon-preference complementary 38-base oligonucleo-

tide (18, 19) was prepared to amino acids 6-18 of a peptide

purified from a human breast carcinoma (9, 12). Since thepeptide sequence and cDNA library were derived fromdifferent tumor sources, it was considered important toverify experimentally the utility of the probe. The preincuba-tion of an excess of the oligonucleotide with line SKRC-1mRNA prior to injection into oocytes inhibited mRNA-dependent activity by >99% (from 82 to 0.2 pg eq/ml).The probe was used to screen 100,000 plaques by filter

hybridization, and two strongly positive clones were identi-fied and purified by sequential low-density plating. Thesetwo clones, termed AHHM4 and AHHM-8, contained in-serts of 1.3 and 2.0 kilobases (kb), respectively. The largestcDNA (AHHM-8) was analyzed in detail (Fig. 1). Theidentity of this clone was established in three ways. First,the N-terminal sequence of the peptide was contained in thepredicted amino acid sequence of AHHM-8 (Figs. 2 and 3).Second, the insert was subcloned into M13, and both strands

-1046-1031-960-889-818-747-676-605-534-463-392-321-250-179

CCGTTTTTGTTCTTCTAAGCAAAAGATCTCCCTCTCTCTAGCCGATGCTCCCCACTCAGTTCATCCCGGGAATGGGCCAGGGAGGAAGGTTCTCATGCATCGCCCCGAGCTGCCAGGCGAGCTTCGGGCTCCTTAAATTCACAGGCCAACAGCCCGCGTCCTCTCCGCGCAGGCTCCCGGTTGCCCGCGGTCCCCGGCCCAGCTCCTTGGGCTCCTCCTCGTCGGTCCGCCCCTGGTGGTCTTGGCGCCCGCTCGTCCAGCTCGGCGCGCCGGGGACCGGCGGCTGCCCGGGGCAGTCCGCACGCCCTCGGGGATCTCGGCTCCGCGGATCCGCCGGCGCCGGCAGGAGCCGGCCGGGGCCTGGAGGGAGCAAGCGGATGGCGCCCACGCCCCCGGGAGGGGGATGGCGCGACAGGGCCCGGGCTCCGGGGTGGGGCTCGGGCAGAGCTCCTGACAGCTCCGGGGCTCGGCAGCGCGGGAGGGGGGAGCTCGCGCGGTCGCCGCTCATTCCCGGCTCGGGGCTCCCCTCCACTCGCTCGGGCGGCGCGGGGGCCCGTTCGGGCCGCCCGTCGGCGGCCCCGCCCCCCGCGCGCCCGCCGCCGAGCCCGCCTGCGCCCTCGCTCGCCCCGCGCGCGTTCCTAGGGCGCCACCTCTTTGCGACTAGCTCACTTCTCCGGCAGGTTTGCCTCGGAGCGTGTGAACATTCCTCCGCTCGGTTTTCAACTCGCCTCCAACCTGCGCCGCCCGGCCAGCATGTCTCCCCGCCCGTGAAGCGGGCTGCCGCCTCCGTGCCGCTCCGGCTGCCACTAACGACCCGCCCTCGCCGCCACCTGGCCCTCCTGATCGACGACACACGCACTTGAAACTTGTTCTCAGGGTGTGTGGAATCAACTTTCCGGGAAGCAACCAGCCCACCAGAGGAGGTCCCGAGCGCGAGCGGAGACG

-108 ATG CAG CGG AGA CTG GTT CAG CAG TGG AGC GTC GCG GTG TTC CTG CTG AGC TAC-36 Met Gln Arg Arg Leu Val Gln Gln Trp Ser Val Ala Val Phe Leu Leu Ser Tyr

-54 GCG GTG CCC TCC TGC GGG CGC TCG GTG GAG GGT CTC AGC CGC CGC CTC AAA AGA-18 Ala Val Pro Ser Cys Gly Arg Ser Val Glu Gly Leu Ser Arg Arg Leu Lys Arg

1 GCT GTG TCT GAA CAT CAGC CTC CAT GAC AAG GGG AAG TCC ATC CAA GAT TTA1 Ala Val Ser Glu His Gln Leu Leu His Asp Lys Gly Lys Ser Ile Gln Asp Leu

55 CGG CGA CGA TTC TTC CTT CAC CAT CTG ATC GCA GAA ATC CAC ACA GCT GAA ATC19 Arg Arg Arg Phe Phe Leu His His Leu Ile Ala Glu Ile His Thr Ala Glu Ile

109 AGA GCT ACC TCG GAG GTG TCC CCT AAC TCC AAG CCC TCT CCC AAC ACA AAG AAC37 Arg Ala Thr Ser Glu Val Ser Pro Asn Ser Lys Pro Ser Pro Asn Thr Lys Asn

16355

21773

CAC CCC GTC CGA TTT GGG TCT GAT GAT GAG GGC AGA TAC CTA ACT CAG GAA ACTHis Pro Val Arg Phe Gly Ser Asp Asp Glu Gly Arg Tyr Leu Thr Gln Glu Thr

AAC AAG GTG GAG ACG TAC AAA GAG CAG CCG CTC AAG ACA CCT GGG AAG AAA AAGAsn Lys Val Glu Thr Tyr Lys Glu Gln Pro Leu Lys Thr Pro Gly Lys Lys Lys

271 AAA GGC AAG CCC GGG AAA CGC AAG GAG CAG GAA AAG AAA AAA CGG CGA ACT CGC91 Lys Gly Lys Pro Gly Lys Arg Lys Glu Gln Glu Lys Lys Lys Arg Arg Thr Arg

325 TCT GCC TGG TTA GAC TCT GGA GTG ACT GGG AGT GGG CTA GAA GGG GAC CAC CTG109 Ser Ala Trp Leu Asp Ser Gly Val Thr Gly Ser Gly Leu Glu Gly Asp His Leu

379 TCT GAC ACC TCC ACA ACG TCG CTG GAG CTC GAT TCA CGG AGG CAT TGAAATTTTCA127 Ser Asp Thr Ser Thr Thr Ser Leu Glu Leu Asp Ser Arg Arg His End

435 GGAGAGACCTTCCAAGGACATATTGCAGGATTCTGTAATAGTGAACATATGGAAAGTATTAGAAATATTTA506 TTGTCTGTAAATACTGTAAATGCATTGGAATAAAACTGTCTCCCCCATTGCTCTATGAAACTGCACATTGG577 TCATTGTGAATATTTTTTTTTTTGccAAGGCTAATCCAATTATTATTATCACATTTACCATAATTTATTTT648 GTCCATTGATGTATTTATTTTGTAAATGTATCTTGGTGCTGCTGAATTTCTATATTTTTTGTAACATAATG719 CACTTTAGATATACATATCAAGTATGTTGATAAATGACACAATGAAGTGTCTCTATTTTGTGGTTGATTTT790 AATGAATGCCTAAATATAATTATCCAAATTGATTTTCCTTTGTGCATGTAAAAATAACAGTATTTTAAATT861 TGTAAAGAATGTCTAATAAAATATAATCTAATTAC( A)60

FIG. 2. Nucleotide and deduced amino acid sequence of cDNAclone AHHM-8. The numbering is shown as + or - relative to thesequence of the mature peptide; the region of homology to PTH isunderlined in the amino acid sequence, and the region correspond-ing to the probe is overlined in the nucleotide sequence. The probewas 82% homologous to the cDNA. There are multiple ATGs in the5' flanking region followed by open reading frames, and the poly-adenylylation signal AATAAA is located 15 bp upstream of thepoly(A) tail.

Proc. Natl. Acad Sci. USA 85 (1988)

Dow

nloa

ded

by g

uest

on

Aug

ust 2

6, 2

021

Proc. Natl. Acad. Sci. USA 85 (1988) 599

-1 +1 10

Lys Arg Ser Val Ser Glu Ile Gin Leu Met His Asn Leu Gly LysPTH: AAG AGA TCT GTG AGT GAA ATA CAG CTT ATG CAT ACC CTG GGA AAA

** *** ** *** * *** *** ** * *** * * ** **

Peptide: AAA AGA GCT GTG TCT GAA CAT CAG CTC CTC CAT GAC AAG GGG AAGLys Arg Ala Val Ser Glu His Gin Leu Leu His Asp Lys Gly Lys

FIG. 3. Region of homology between human PTH and the tumor-derived, PTH-like peptide. Shared nucleotides are indicated by an asterisk,and shared amino acids are underlined in the peptide sequence. The first amino acid in rat and bovine PTH is alanine encoded by GCT (29).

were used to hybrid-select mRNA from line SKRC-1 foroocyte injection and bioassay, the noncoding strand gener-ating a strong signal (74 pg eq/ml) and the coding strandgenerating a negligible signal (4 pg eq/ml). Third, the insertwas subcloned into a pGEM vector in both orientations, andcapped sense and antisense RNA were produced with T7RNA polymerase. Oocyte injection with the sense RNA (5ng per oocyte) produced a marked stimulation of the CBA(88 pg eq/ml), whereas negligible activity (2.4 pg eq/ml) wasdetected in media from antisense RNA-injected oocytes.

Sequence and Homology to PTH. The cDNA contains a531-bp open reading frame flanked by 938- and 472-base 5'and 3' untranslated regions and a 60-base poly(A) tail (Figs.1 and 2). The sequence displays typical features of a eukary-otic mRNA.The open reading frame encodes a protein of 177 amino

acids, consisting of a 36 amino acid leader sequence and a141 amino acid mature peptide with a calculated molecularmass of 16,043 Da (Fig. 2). The calculated molecular mass ofthe mature peptide is in good agreement with the size of thepeptide (-17 kDa) purified from the human breast carci-noma, and there is also a close correspondence between thededuced and experimentally determined amino acid compo-sitions (9). The deduced sequence contains 29 (21%) basicresidues, in keeping with the pI of >8.7 of the purifiedpeptide (9). There are no methionine or cysteine residuesand no potential sites of N-glycosylation. Comparisons withthe EMBL/GenBank DNA librariestt and National Biomed-ical Research Foundation protein data bank§§ revealed nosignificant homologies with any known protein other thanPTH (below) in either nucleotide or amino acid sequence.The strong homology between the tumor-derived peptide

and human PTH in the region of amino acids -2 through+ 13 is shown in Fig. 3. The similarity in this region is 67%at both the amino acid and nucleotide levels (29-31). Eight ofthe first 13 amino acids of the two peptides are identical. Inaddition, the first amino acid in the tumor-derived peptide isalanine, the amino acid found in rat and bovine PTH (29).The tribasic run at positions 19-21 of the tumor-derivedpeptide occurs somewhat earlier than a similar tribasicregion in PTH (at positions 25-27); this region is thought tobe important to the receptor binding of PTH (31).RNA Blot Analysis. When probed with the clone-8 insert,

mRNAs from four tumors associated with HHM producedstrong signals, and in each case the hybridization patternwas complex (Fig. 4, lanes 1-4). Line SKRC-1 containedtwo major hybridizing species of about 1.6 and 2.1 kb andthree larger less abundant species (Fig. 4, lane 4). The fivetranscripts in this line were estimated to represent a total of0.005-0.01% of the RNA loaded. The other three tumor-derived RNAs each demonstrated three to five hybridizingtranscripts. Poly(A)+ RNA prepared from three "negative"renal carcinomas failed to hybridize with the probe (Fig. 4,lanes 5-7). The keratinocyte RNA contained three hybrid-izing transcripts that were roughly equal in intensity and that

appeared to comigrate with the three transcripts of similarsize in line SKRC-1 RNA (Fig. 4, lane 8).DNA Blot Analysis and Chromosome Assignment. Genomic

Southern blotting analysis of mammalian DNAs with theAHHM-8 insert revealed a simple pattern compatible with agene of low complexity. The insert detected a single stronglyhybridizing EcoRI fragment in DNA from human, rat,mouse, and Chinese hamster cell lines, with the signal in therodent DNAs being about one-third the intensity of that inthe human DNA (Fig. 5A).Assignment of the gene for the PTH-like peptide to human

chromosome 12 was made by analysis of EcoRI- or HindIIl-digested DNA from 17 rodent-human hybrid cell lines (27,28). A single 14-kb EcoRI fragment, or HindIII fragments of4.0 and 3.5 kb, were present in all hybrids containing humanchromosome 12 (Fig. SB, lanes 8 and 9) and absent in allother hybrids (Fig. SB, lane 7). The sequences were presentin a hybrid that carried a partial deletion of the distal longarm of chromosome 12 (Fig. 5B, lane 9).

After in situ hybridization of tritiated inserts to normalhuman metaphase chromosomes, 40 cells of >200 scoredhad label on one or both chromosomes 12. The graindistribution pattern depicted in Fig. 6 indicates localizationof the sequence on the proximal short arm (region p11.2 -p12.11).

2 3 4 5 6 7 8

9.5 -7.5-

44-

2.4-m

14-v

-28 S

- 18S

FIG. 4. Blot-hybridization analysis ofmRNA prepared from fourcarcinomas associated with HHM (lanes 1-4), three "negative"renal carcinomas (lanes 5-7), and normal human keratinocytes (lane8). The mRNAs were prepared from the breast carcinoma fromwhich the peptide sequence was obtained (9, 12) (lane 1); a humansquamous carcinoma (YSC-B) that induces hypercalcemia in theathymic mouse (lane 2); renal carcinoma line SKRC-52 (4) (lane 3);renal carcinoma line SKRC-1 (lane 4); renal carcinoma lines SKRC-29 (lane 5), SKRC-42 (lane 6), and C (lane 7) that do not secretePTH-like activity and that also do not induce hypercalcemia whenimplanted in athymic mice (4); and normal human keratinocytes(lane 8). There was a good correlation between the intensities of thesignals and the biological activities of the mRNA preparations (CBAvalues of 600, 78, and 186 pg eq/ml for the mRNAs shown in lanes2-4, respectively, each injected at 100 ng per oocyte). The markersto the left correspond to the RNA ladder from Bethesda ResearchLaboratories, and the locations of 28S and 18S rRNA are shown tothe right. Weak cross-hybridization with 28S rRNA is apparent inlanes 4, 7, and 8.

#EMBL/GenBank Genetic Sequence Database (1987) (Bolt, Bera-nek, and Newman Laboratories, Cambridge, MA), Tape Releases11 and 51, respectively.

§§Protein Identification Resource (1985) Protein Sequence Database(Natl. Biomed. Res. Found., Washington, DC), Release 12.

Medical Sciences: Mangin et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 2

6, 2

021

600 Medical Sciences: Mangin et al.

1 2 3 4 5 6 7 8 9.:........ ..

.:

kb-

14-_ * a _ ~~~~~-5.2ti-pw * my. -4.612_;

_ ^~~~._-4.0-3~~-.5

A B

FIG. 5. Southern blot analysis of genomic HHM-related se-

quences. DNA from rat (lane 1), mouse (lane 2), Chinese hamster

(lanes 3 and 5), human (lanes 4 and 6), or Chinese hamster-human

hybrids (lanes 7-9) was digested with EcoRI (A) or HindIII (B) and

analyzed by Southern blot hybridization. (B) Assignment of the gene

for the PTH-like peptide to human chromosome 12. The hybrid in

lane 9 contains a chromosome 12 with a terminal deletion of the long

arm (12pter-q22) and is positive for the human 4.0- and 3.5-kb

fragments (28). A 5.2-kb human HindIII fragment could not be

distinguished from a similarly sized Chinese hamster fragment.

Additional weakly hybridizing fragments were seen in digests of

human DNA lane 4) but could not be scored in the hybrid cell

lines.

DISCUSSION

Malignancy-associated hypercalcemia has been recognized

for >60 years. Two general mechanisms appear to be

responsible for this syndrome: (i) local osteolytic hypercal-

cemia, mediated by tumor cells in direct contact with bone,

and (it) HHM, mediated by a circulating factor(s) elaborated

by malignant cells remote from bone (32, 33). PTH and/or its

precursors, vitamin D-like sterols, andprostaglandins of the

E series have been proposed as mediators of the humoral

syndrome, but none of these agents appears to be responsi-

ble for more than rare, isolated examples of HHM (32, 33).

The syndrome is presently regarded as heterogeneous and

may be mediated by several different tumor products (32, 33)

Data from the present decade indicate that HHM is

common and that the responsible mediator in many in-

13.313.213.112.312.212.111.2

11.1

11

12

13.1

13.3 l

14

15

21.121.2

21.3

22

23

24.1

24.224.3124.3224.33

12

HHM

II-I I I I v~~~~~~~5 10

FIG. 6. Distribution of autoradiographic silver grains over hu-

man chromosome 12 after in situ hybridization with the tritiated

insert. The scale at the bottom refers to the number of grains

associated with specific chromosome bands and subbands.

stances has certain PTH-like actions but is not native PTH(1-6, 8-12). Three groups have recently isolated tumor-derived PTH-like peptides and have reported partial N-terminal sequences that resemble that of human PTH (9-12).The identification of the cDNA reported herein confirms andextends these findings.The region of homology to PTH identified in the sequence

of the tumor-derived peptide encompasses the first 13 aminoacids of N-terminal sequence, long known to represent a keybiologically active domain in the PTH molecule (31). Thissequence similarity presumably accounts for the PTH-likeeffects of the peptide, which have been observed in vivo (1,2) and in vitro (3, 5, 8). In many of the PTH-sensitivesystems in vitro, the actions of the tumor-derived peptidehave been shown to be inhibited by a competitive antagonistto PTH binding but not by a variety of region-specificantisera toPTH (3, 5,8). These findings would also appear tobe explicable on the basis of the sequence similarities anddissimilarities of the two peptides.More distal, nonhomologous sequences of the PTH-like

peptide must be responsible for its distinctive biologicalactions vis-a-vis those of native PTH. These actions includeup to a 10-fold higher specific activity than PTH in bone-derived and fibroblast systems in vitro (34-36), an apparentlyreduced ability to stimulate la-hydroxylase activity in vivo(1), and a pattern of "uncoupled" bone resorption that differsfrom that seen in response to PTH excess (2). These obser-vations have been taken as evidence that the PTH-likepeptide interacts preferentially with certain PTH receptorsand/or that it has its own class of receptors (34-36). Normalcells and tissues other than the keratinocyte have thus far notbeen examined for expression of the peptide; the keratinocytewas initially studied because of the striking incidence ofsquamous cell tumors among patients with HHM (7).The region of homology between the peptides extends

upstream to include amino acids -1 and -2. In PTH, thesedibasic residues represent an endoproteolytic cleavage siteand are at the C terminus of a six amino acid "pro"sequence, which is interrupted by the second intron in thePTH gene (29-31). Although homology between the twoproteins is not apparent further upstream than amino acid-2, four of the six amino acid residues in the -1 to -6region of both molecules are basic, suggesting the possibilitythat thePTH-like peptide may also be processed via preproand pro precursors.The PTH gene has been assigned to the short arm of

chromosome 11 (37). Human chromosomes 11 and 12 arethought to have arisen by an ancient tetraploidization eventfrom a single common ancestral chromosome (38). The shortarm of both chromosomes carry related functional genes:genes for lactate dehydrogenases A (LDHA) onlip and B(LDHB) on 12 p, and Harvey ras protooncogene onlip andKirsten ras protooncogene on12p. Thus, our localizationfindings suggest an evolutionary relationship between thegenes for PTH and thePTH-like peptide.The combined RNA and DNA blotting analyses indicate

that the multiple transcripts observed in RNA blots are morelikely to be the result of alternative processing than theproducts of related genes. This putative processing alsoappears to occur in nontransformed cells (i.e., the keratin-ocyte). Preliminary characterization of clone HHM-4 revealsthat it contains a foreshortened 5' untranslated region but isotherwise identical to HHM-8 until the distal portion of thecoding region, at which point HHM-4 diverges to encode alonger peptide with a different C terminus (M.M. andA.E.B., unpublished data).

In the aggregate, ourdataindicate that the PTH-likepeptide is a normal peptide "hormone" that is overex-pressed eutopically or ectopically by certain tumors associ-ated with HHM. The normal function of the peptide in

Proc. Natl. Acad. Sci. USA 85 (1988)

Dow

nloa

ded

by g

uest

on

Aug

ust 2

6, 2

021

Proc. Natl. Acad. Sci. USA 85 (1988) 601

keratinocytes and/or other tissues, the reason(s) for itsexpression in certain malignant cells and not others, and theevolutionary relationship between its gene and that forparathyroid hormone remain to be determined.

After submission ofthis manuscript, Suva et al. (39) reportedthe isolation of a cDNA encoding an identical peptide.

We thank A. Caplan and J. Daigle for technical assistance; P.Strumpf for preparation of the manuscript; M. Atkinson, E. Benz,W. Bornstein, W. Gerald, J. Kraus, C. Tschudi, and E. Ullu forassistance and advice; and H. Kronenberg for providing a clone forhuman PTH, which was used in piloting the hybrid selectiontechnique. This work was supported by National Institutes ofHealth Grants GM 26105 (to U.F.) and AR 30102 (to A.E.B.), by theVeterans Administration (to A.F.S.), and by a James HudsonBrown-Alexander B. Coxe fellowship from the Yale School ofMedicine (to K.I.).

1. Stewart, A. F., Horst, R., Deftos, L. J., Cadman, E. C.,Lang, R. & Broadus, A. E. (1980) N. Engl. J. Med. 303,1377-1383.

2. Stewart, A. F., Vignery, A., Silverglate, A., Ravin, N. D.,LiVolsi, V., Broadus, A. E. & Baron, R. (1982) J. Clin.Endocrinol. Metab. 55, 219-227.

3. Strewler, G. J., Williams, R. D. & Nissenson, R. A. (1983) J.Clin. Invest. 71, 769-774.

4. Weir, E. C., Insogna, K. L., Brownstein, D. G., Bander,N. H. & Broadus, A. E. J. Clin. Invest., in press.

5. Stewart, A. F., Insogna, K. L., Goltzman, D. & Broadus,A. E. (1983) Proc. Natl. Acad. Sci. USA 80, 1454-1458.

6. Simpson, E. L., Mundy, G. R., D'Souza, S. M., Ibbotson,K. J., Bockman, R. & Jacobs, J. W. (1983) N. Engl. J. Med.309, 325-330.

7. Merendino, J. J., Insogna, K. L., Milstone, L. M., Broadus,A. E. & Stewart, A. F. (1986) Science 231, 338-390.

8. Rodan, S. B., Insogna, K. L., Vignery, A. M.-C., Stewart,A. F., Broadus, A. E., D'Souza, S. M., Bertolini, D. R.,Mundy, G. R. & Rodan, G. A. (1983) J. Clin. Invest. 72,1511-1515.

9. Burtis, W. J., Wu, T., Bunch, C., Wysolmerski, J. J., Insogna,K. L., Weir, E. C., Broadus, A. E. & Stewart, A. F. (1987) J.Biol. Chem. 262, 7151-7156.

10. Moseley, J. M., Kubota, M., Diefenbach-Jagger, H., Wetten-hall, R. E. H., Kemp, B. E., Suva, L. J., Rodda, C. P., Ebel-ing, P. R., Hudson, P. J., Zajac, J. D. & Martin, T. J. (1987)Proc. Natl. Acad. Sci. USA 84, 5048-5052.

11. Nissenson, R. A., Leung, S., Diep, D., Williams, R. D. &Strewler, G. J. (1987) J. Clin. Invest., in press.

12. Stewart, A. F., Wu, T., Goumas, D., Burtis, W. J. & Broadus,A. E. (1987) Biochem. Biophys. Res. Commun. 146, 672-678.

13. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J. & Rutter,W. J. (1979) Biochemistry 18, 5294-5299.

14. Broadus, A. E., Goltzman, D., Webb, A. C. & Kronenberg,

H. M. (1985) Endocrinology 117, 1661-1666.15. Peng, T., Garner, S. C., Hirsch, P. F. & Posillico, J. T. (1986)

J. Bone Min Res. 1, 351-357.16. Gubler, U. & Hoffman, B. J. (1983) Gene 25, 263-269.17. Huynh, T. V., Young, R. A. & Davis, R. W. (1985) in DNA

Cloning, A Practical Approach, ed. Glover, D. M. (IRL,Washington, DC), pp. 49-78.

18. R. Lathe (1985) J. Mol. Biol. 183, 1-12.19. Ohtsuka, E., Matsuki, S., Ikehara, M., Takahashi, Y. &

Matsubara, K. (1985) J. Biol. Chem. 260, 2605-2608.20. Kawasaki, E. S. (1985) Nucleic Acids Res. 13, 4991-5004.21. Ullrich, A., Berman, C. H., Dull, T. J., Gray, A. & Lee, J. M.

(1984) EMBO J. 3, 361-364.22. Horwich, A. L., Kraus, J. P., Williams, K., Kalousek, F.,

Konigsberg, W. & Rosenberg, L. E. (1983) Proc. Natl. Acad.Sci. USA 80, 4258-4262.

23. Drummond, D. R., Armstrong, J. & Colman, A. (1985) Nu-cleic Acids Res. 13, 7375-7394.

24. Messing, J. (1983) Methods Enzymol. 101, 20-78.25. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl.

Acad. Sci. USA 74, 5463-5467.26. Feinberg, A. P. & Vogelstein, B. (1983) Anal. Biochem. 132,

6-13.27. Barton, D. E., Yang-Feng, T. L. & Francke, U. (1986) Hum.

Genet. 72, 221-224.28. Matsubara, Y., Kraus, J. P., Yang-Feng, T. L., Francke, U.,

Rosenberg, L. E. & Tanaka, K. (1986) Proc. Natl. Acad. Sci.USA 83, 6543-6547.

29. Heinrich, G., Kronenberg, H. M., Potts, J. T., Jr., & Ha-bener, J. F. (1984) J. Biol. Chem. 259, 3320-3329.

30. Vasicek, T. J., McDevitt, B. E., Freeman, M. W., Fennick,B. J., Hendy, G. N., Potts, J. T., Jr., Rich, A. & Kronenberg,H. M. (1983) Proc. Natl. Acad. Sci. USA 80, 2127-2131.

31. Habener, J. F., Rosenblatt, M. & Potts, J. T., Jr. (1984)Physiol. Rev. 64, 985-1053.

32. Rodman, J. S. & Sherwood, L. M. (1978) in Metabolic BoneDisease, eds. Avioli, L. V. & Krane, S. M. (Academic, NewYork), Vol. 2, pp. 577-631.

33. Mundy, G. R., Ibbotson, K. J. & D'Souza, S. M. (1985) J.Clin. Invest. 76, 391-394.

34. Nissenson, R. A., Strewler, G. J., Williams, R. D. & Leung,S. C. (1985) Cancer Res. 45, 5358-5363.

35. Stewart, A. F., Wu, T., Burtis, W. J., Weir, E. C., Broadus,A. E. & Insogna, K. L. (1987) J. Bone Min. Res. 2, 37-43.

36. Wu, T. L., Insogna, K. L., Hough, L. M., Milstone, L. &Stewart, A. F. (1987) J. Clin. Endocrinol. Metab. 65, 105-109.

37. Mannens, M., Slater, R. M., Heyting, C., Geurts van Kessel,A., Goedde-Salz, E., Frants, R. R., Van Ommen, G. J. B. &Pearson, P. L. (1987) Hum. Genet. 75, 180-187.

38. Comings, D. E. (1972) Nature (London) 238, 455-457.39. Suva, L. J., Winslow, G. A., Wettenhall, R. E. H., Ham-

monds, R. G., Moseley, J. M., Diefenbach-Jagger, H., Rodda,C. P., Kemp, B. E., Rodriguez, H., Chen, E. Y., Hudson,P. J., Martin, T. J. & Wood, W. I. (1987) Science 237, 893-896.

Medical Sciences: Mangin et al.

Dow

nloa

ded

by g

uest

on

Aug

ust 2

6, 2

021