Identification of Converging Pathways in the pathogenesis of NPM-RARA Variant Acute Promyelocytic Leukemia
by
Mariam Thomas Mathew
A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy
Department of Medical Biophysics
University of Toronto
© Copyright by Mariam Thomas Mathew 2013
ii
Identification of converging pathways in the pathogenesis of
NPM-RARA variant Acute Promyelocytic Leukemia
Mariam Thomas Mathew
Doctor of Philosophy
Department of Medical Biophysics University of Toronto
2013
Abstract
Acute Promyelocytic Leukemia is a subset of Acute Myeloid Leukemias, and is commonly
associated with the presence of chromosomal translocations leading to the expression of the
PML-RARA fusion protein. Less frequent cases of APL have been identified that express rare
variant RARA fusion proteins, such as NPM-RARA. The presence of these fusions results in
deregulated RARA signaling and response to the RARA ligand, ATRA. However, studies have
indicated that loss of retinoid signaling alone is not sufficient to result in the leukemia. The goals
of this thesis were to determine genes and pathways deregulated in variant APL that can serve as
cooperating events in APL, through candidate pathway analysis and high-throughput gene
expression profiling. Using a cell line model expressing variant fusion proteins associated with
APL, we identified the deregulation of the NF-κB signaling pathway in APL, and describe the
functional analysis of this pathway in our in vitro model. We next assessed whether promotion of
survival signals could serve as a contributing factor in the accumulation of leukemic blasts in
APL patient bone marrow. Our results indicated that PML-RARA and NPM-RARA expressing
cells showed increased survival in the presence of TNFα, compared to wild type control cells.
These data suggested a greater ability on the part of NPM-RARA cells to survive in the presence
iii
of TNFα. We also report for the first time the gene expression profiles of, and transcriptional
effects of ATRA on, cells expressing the variant fusion proteins. Finally, we determined that the
partner protein Nucleophosmin (NPM) has increased cytoplasmic localization in cells expressing
the APL fusion proteins, and interacts within complexes comprising of RARA and RXRA. We
further determined that the fusion can interfere with NPM function and cellular localization.
Taken together, these studies provide evidence for the involvement of secondary hits in APL
biology.
iv
This thesis is dedicated to both my parents,
whose courage, dedication, and love continually inspire us to reach out to the Truth
“And you shall know the truth, and the truth shall set you free.”
New Testament, John 8:32
v
Acknowledgments
I find myself incredibly fortunate to have had the opportunity to work among an extraordinary
group of people within the research laboratories of the Ontario Cancer Institute and the
University of Toronto. First, to my supervisor, Dr. Suzanne Kamel-Reid, I thank you for your
leap of faith in giving me the opportunity to work on a subject that I really enjoyed, and for the
freedom to explore and experiment with my project. The time you took to mentor and advise,
and your incredible support and encouragement in the midst of difficult circumstances, was
paramount to this success.
I am appreciative of my committee members Dr. Aaron Schimmer, and Dr. Susan Done for their
comments and critiques, for ultimately making my work stronger, and for pushing the limits of
my reasoning and understanding of my work. I would also like to acknowledge and thank the
members of my exam committee: Dr. Pierre Laneuville (McGill University), Dr. Marciano Reis,
and Dr. Gil Prive for their time spent reviewing and providing valuable feedback on the thesis.
To my labmates Yali Xuan and Mahadeo Sukhai – your friendship, and mentorship over these
years have shaped my work and personal growth. Yali, I am so grateful for your help throughout
this time; thank you for the excellent technical help with all the leukemia projects, for your
constant willingness to listen and troubleshoot no matter the issue, and also for your attempts at
teaching me spoken Mandarin! Mahadeo, thank you for your mentorship and friendship over
these years. Your advice and training has made me a better thinker, designer, and writer. Your
commitment and dedication to all the work you do, and active volunteerism is an inspiration to
all around you to look beyond the self, and create the positive change you want to see in all areas
of life.
Thank you Patricia for your mentorship, guidance, and friendship; you’ve led by example in all
areas from success as a scientist, to being an effective leader, collaborator, and a caring friend.
To all the other students and staff that I’ve crossed paths with in the lab – Maria, Rashmi, Jerry,
Miranda, Rikki, Natalie, Shilpi, and Grace – I wanted to say thanks for sharing this experience
with me, and for all the exchanges we’ve had. I am also grateful to Anita Hamadani for allowing
vi
me the opportunity to teach within the department of Pharmacology. Thanks Anita for your
friendship over the years, and for your kind spirit. I wish you all continual success and
fulfillment in every facet of life.
To the friends who once walked through the research floors at OCI, and for those who continue
to be great examples of hard-work and dedication – Ramya, Mamta, Mahadeo, Krupa, Andrea, I
wanted to say thank you for always making the time to chat, grab a coffee, listen to talks,
constantly encouraging, and keeping me grounded in reality. This journey was a whole lot more
meaningful with you all around to share in it.
To Achen, Kochamma and the extended family at STOC Toronto, your love and prayers have
been a source of strength, and light, especially in the last trying few months.
To the entire family in India, U.A.E, Singapore, and U.K – the love, understanding, and
encouragement that each of you have extended to me, gave me the strength to pursue this goal to
the very end. Thank you Ammachi, for your patience and your acceptance. To my late grand-
uncle Dr. K.C John, and my aunt Dr. Sarah Cherian – you have both been an inspiration to me
along this journey, and I feel honoured to be able to walk in your footsteps.
To Reuben, my brother – you have been a source of joy and laughter in the family, and in doing
so you’ve always brought life and fun into our lives. You have been graceful under all the
pressures life has thrown at you, and I know you will continue to rise to the farthest heights.
To my parents, there can never be enough words to express my love and gratitude to you. You
have demonstrated to us what truly matters in life, and have sacrificed much to put us first. In
doing so, you have always reflected to us His unfailing and unconditional love. For this, and for
everything along this journey that has given me purpose, meaning, and the source of life itself, I
thank God, who in His glory designed and created the universe – an infinitesimal part of which I
had the privilege of studying in this thesis.
17 December 2012
vii
Table of Contents
Acknowledgments............................................................................................................................v
Table of Contents .......................................................................................................................... vii
List of Abbreviations ................................................................................................................... xiii
List of Tables ............................................................................................................................... xvi
List of Figures .............................................................................................................................. xix
List of Appendices ...................................................................................................................... xxii
1.1 Normal Hematopoiesis.........................................................................................................2
1.1.1 Model of hematopoietic hierarchy ...........................................................................2
1.2 Malignant Hematopoiesis ....................................................................................................4
1.2.1 Acute Myelogenous Leukemia (AML) ....................................................................4
1.2.2 Tumour initiating cell biology and self-renewal ......................................................5
1.3 Self-renewal and the hematopoietic microenvironment in normal HSC, and LSC. ............6
1.3.1 Signaling networks involved in maintaining self-renewal.......................................9
1.3.2 Summary ................................................................................................................14
1.4 Acute Promyelocytic Leukemia (APL) .............................................................................15
1.4.1 APL molecular pathology ......................................................................................15
1.4.2 Retinoid signaling in Hematopoiesis .....................................................................18
1.4.3 Functions of PML and PML-RARA ......................................................................34
1.4.4 Functions of NPM and NPM-RARA .....................................................................37
1.4.5 Functions of NuMA and NuMA-RARA ...............................................................45
1.5 Secondary genetic events in APL ......................................................................................47
1.5.1 Candidate gene alterations as approaches to elucidate secondary genetic events in APL .........................................................................................................47
1.5.2 Whole genome approaches to determining secondary events ...............................50
viii
1.5.3 Use of high throughput assays to understand leukemia pathogenesis ...................52
1.5.4 ChIP-seq and ChIP-on-chip technology: Global analysis of DNA binding profiles ...................................................................................................................56
1.5.5 Summary ................................................................................................................57
1.6 Nuclear Factor kappa B (NF-κB) signaling in Leukemia ..................................................58
1.6.1 Signaling molecules in the NF-κB pathway ..........................................................61
1.6.2 TNFα-NF-κB pathway signaling switches ............................................................61
1.6.3 Oncogenic activation of NF-κB .............................................................................62
1.7 Rationale and Project Objectives .......................................................................................64
Chapter 2 Functional Deregulation of NF-κB and abnormal TNFα response in APL ..................67
2 Functional Deregulation of NF-κB and abnormal TNFα response in APL .............................68
2.1 Abstract ..............................................................................................................................68
2.2 Introduction ........................................................................................................................69
2.3 Materials and Methods .......................................................................................................71
2.3.1 Cell culture and reagents. .......................................................................................71
2.3.2 Normal and patient bone marrow samples and RNA extraction. ..........................71
2.3.3 FLT3 mutation analysis in patient samples. ..........................................................71
2.3.4 Gene Expression Analysis. ....................................................................................71
2.3.5 Methylcellulose colony forming assays. ................................................................72
2.3.6 Cell viability assays. ..............................................................................................72
2.3.7 Western blotting. ....................................................................................................72
2.3.8 Laser-scanning confocal microscopy. ....................................................................73
2.3.9 Flow cytometry. .....................................................................................................73
2.3.10 Statistical analyses. ................................................................................................73
2.4 Results ................................................................................................................................75
2.4.1 APL blasts exhibit deregulated expression of NF-κB signaling genes..................75
ix
2.4.2 Primary APL cells and cell lines U937-NPM-RARΑ and NB4 over-express NF-κB/p65. ............................................................................................................84
2.4.3 TNFα inhibits colony formation and cellular survival in U937 control, but not X-RARΑ+ cells. .....................................................................................................87
2.4.4 Enhanced NF-κB/p65 activation upon TNFα signaling in X-RARA cells. ..........90
2.4.5 TNFα induces a distinct NF-κB/p65 target gene expression profile in X-RARΑ+ cells compared to controls. ......................................................................93
2.4.6 Treatment with ATRA restores wild type TNF α cell viability response in APL. .......................................................................................................................93
2.4.7 Pharmacological inhibition of p65 restores TNFα sensitivity in NPM-RARΑ+ cells. .......................................................................................................................99
2.5 Discussion ........................................................................................................................105
2.6 Conclusions ......................................................................................................................109
Chapter 3 ......................................................................................................................................110
3 Comparative analysis of downstream genetic targets of the variant Acute Promyelocytic Leukemia fusion proteins NPM-RARA and NuMA-RARA ..................................................111
3.1 Abstract ............................................................................................................................111
3.2 Introduction ......................................................................................................................113
3.3 Materials and Methods .....................................................................................................115
3.3.1 Cell culture and reagents. .....................................................................................115
3.3.2 Western blot analysis. ..........................................................................................115
3.3.3 Cell differentiation by flow cytometry analysis...................................................115
3.3.4 Cell viability and apoptosis analysis. ...................................................................116
3.3.5 Experimental design and array hybridization. .....................................................116
3.3.6 Microarray data analysis. .....................................................................................116
3.3.7 Analysis of publicly available gene expression datasets. ....................................117
3.4 Results ..............................................................................................................................118
3.4.1 Transcriptional targets of NPM-RARA and NuMA-RARA are involved in diverse cellular functions. ....................................................................................118
x
3.4.2 Promoter sequences of X-RARA gene targets show over-representation of binding motifs for transcription factors including RELA and FOX. ...................130
3.4.3 A subset of downstream gene targets of NPM-RARA contains regulatory motifs that are directly bound by PML-RARA and PLZF-RARA. .....................136
3.4.4 Potential direct transcriptional targets of NPM-RARA are functionally involved in diverse cellular processes..................................................................137
3.4.5 Potential direct transcriptional targets of NPM-RARA contain known RARE binding sites as well as PU.1 binding sites. .........................................................137
3.4.6 Comparison of NPM- and NuMA-RARA expression profiles with PML-RARA. .................................................................................................................150
3.4.7 NPM-RARA and NuMA-RARA induced gene signatures overlap with AML LSC. .....................................................................................................................150
3.4.8 X-RARA retinoic acid responsive genes. ............................................................157
3.4.9 Gene expression based signature identifies compounds that confer expression changes that are correlated with ATRA treatment in APL cells. .........................170
3.5 Discussion ........................................................................................................................174
3.6 Conclusions ......................................................................................................................177
Chapter 4 ......................................................................................................................................178
Nucleophosmin is universally deregulated In Acute Promyelocytic Leukemia ..........................178
4 Nucleophosmin is universally deregulated in Acute Promyelocytic Leukemia .....................179
4.1 Abstract ............................................................................................................................179
4.2 Introduction ......................................................................................................................180
4.3 Materials and Methods .....................................................................................................182
4.3.1 Cell culture and treatment. ...................................................................................182
4.3.2 Western blotting. ..................................................................................................182
4.3.3 Protein half-life analysis. .....................................................................................182
4.3.4 Laser-scanning confocal microscopy. ..................................................................182
4.3.5 Markers of nucleolar activity. ..............................................................................183
4.3.6 Nucleolar organizing region morphology. ...........................................................183
xi
4.3.7 Patient Samples. ...................................................................................................183
4.3.8 Analysis of rRNA Synthesis by RT-PCR. ...........................................................184
4.3.9 Co-Immunoprecipitation. .....................................................................................184
4.3.10 Statistical analyses. ..............................................................................................184
4.4 Results ..............................................................................................................................185
4.4.1 NPM is aberrantly expressed in NPM-RARA and PML-RARA cells. ...............185
4.4.2 NPM is post-translationally stabilized in NPM-RARA+ cells. ...........................198
4.4.3 NPM-RARA+ cells have a cell growth phenotype consistent with disrupted nucleolar function. ...............................................................................................203
4.4.4 Assessment of pre-rRNA and 18S rRNA expression in APL patient samples. ...203
4.4.5 NPM and X-RARA interact with RXRA in COS X-RARAV5 cells. ...................211
4.5 Discussion ........................................................................................................................216
4.6 Conclusion .......................................................................................................................218
Chapter 5 ......................................................................................................................................219
Summary and Future directions ...................................................................................................219
5 Summary and Future Directions .............................................................................................220
5.1 Deregulation of NF-κB and abnormal TNFα response in NPM-RARA variant APL ....220
5.1.1 Summary ..............................................................................................................220
5.1.2 Future directions ..................................................................................................221
5.2 Downstream genetic targets of the acute promyelocytic leukemia fusion proteins NPM-RARA and NuMA-RARA. ....................................................................................223
5.2.1 Summary ..............................................................................................................223
5.2.2 Future directions: .................................................................................................223
5.3 Nucleophosmin (NPM) is universally deregulated in Acute Promyelocytic Leukemia ..225
5.3.1 Summary ..............................................................................................................225
5.3.2 Future directions ..................................................................................................226
xii
Appendices ...................................................................................................................................228
Appendix I: Array data tables Chapter 3 .........................................................................229
Appendix II: Characterization of in vitro cell line models of APL .................................301
References ....................................................................................................................................308
xiii
List of Abbreviations
ALCL Anaplastic Large-Cell Lymphoma AML Acute Myeloid Leukemia APL Acute Promyelocytic Leukemia ATO Arsenic Trioxide ATRA All Trans Retinoic Acid BCL2 B-cell CLL/lymphoma 2 BCOR BCL-6 Corepressor CCL2 Chemokine (C-C motif) ligand 2 CEBPA CCAAT/enhancer binding protein, Alpha ChIP-on-Chip Chromatin Immunoprecipitation – Chip ChIP-seq Chromatin Immunoprecipitation – sequencing CLP Committed Lymphoid Progenitor cmap Connectivity Map CMML Chronic Myelomonocytic Leukemia CMP Committed Myeloid Progenitor DBD DNA Binding Domain DR Direct Repeat ER Everted Repeat FAB French American British FASL Fas Ligand FIP1L1 FIP1 like 1 FLT3 fms-related tyrosine kinase 3 FLT3 ITD FLT3 Internal Tandem Duplication FOX Forkhead box G-CSF Granulocyte-Colony Stimulating Factor GFI1 Growth Factor Independent 1 GFP Green Fluorescent Protein GM-CSF Granulocyte Monocyte- Stimulating Factor GMP Granulocyte Monocyte Progenitor GO:BP Gene Ontology: Biological Process HAT Histone Acetyl Transferase hCG-NuMA-RARA Human Cathepsin G-NuMA-RARA HDAC Histone Deacetylase
HIF1α Hypoxia Inducible Factor 1, Alpha HRP Horseradish Peroxidase HSCs Hematopoietic Stem Cell IFN-γ Interferon-gamma
IκBα/NFKBIA Nuclear Factor of kappa light polypeptide gene enhancer in B-cells, inhibitor, Alpha
xiv
IKK α I Kappa B Kinase, Alpha IL-3 Interleukin-3 IL-8 Interleukin -8 IR Inverted Repeat JAK Janus Kinase JUNB Jun B proto-oncogene KEGG Kyoto Encyclopedia of Genes and Genomes K-ras Kirsten rat sarcoma viral oncogene homolog LBD Ligand Binding Domain LIC Leukemia Initiating Cell LNK Lymphocyte-specific adaptor protein LSC Leukemia Stem Cell LT-HSC Long Term repopulating - Hematopoietic Stem Cell MAP3K8 Mitogen Activated Protein Kinase Kinase Kinase 8 MDM2 Mouse Double Minute 2 MDS Myelodysplastic Syndrome MEP Myeloid Erythroid Progenitor MMP9 Matrix Metallopeptidase 9 MPPs Multi-potent progenitors MSigDB Molecular Signatures Database N-CoR/SMRT Nuclear Receptor Corepressor/Silencing Mediator for Retinoid or
Thyroid-hormone receptors NES Nuclear Export Signal NF-κB Nuclear Factor - kappa B NPM Nucleophosmin NPMc+ Nucleophosmin cytoplasmic mutant NPM-RARA Nucleophosmin - Retinoic Acid Receptor Alpha NuMA Nuclear Mitosis Apparatus NuMA-RARA Nuclear Mitosis Apparatus - Retinoic Acid Receptor Alpha p14ARF p14 Alternate Reading Frame PCA Principal Component Analysis PI3K Phosphatidylinositol 3-kinase PKA Protein Kinase A PLZF Promyelocytic Leukemia Zinc Finger PLZF-RARA Promyelocytic Leukemia Zinc Finger - Retinoic Acid Receptor
Alpha PML-RARA Promyelocytic Leukemia - Retinoic Acid Receptor, Alpha PML-RARA bcr1/2 PML-RARA transcript subtype breakpoint cluster region1/2 PML-RARA bcr3 PML-RARA transcript subtype breakpoint cluster region 3 PPAR Peroxisome Proliferator-Activated Receptor PPRE Peroxisome Proliferator Response Element PRKAR1A Protein Kinase, cAMP-dependent, regulatory, type I, Alpha
xv
PTL Parthenolide RARA Retinoic Acid Receptor, Alpha RARE Retinoic Acid Response Element RQ-PCR Real time Quantitative Polymerase Chain Reaction rRNA ribosomal RNA RXR Retinoid X Receptor SCF Stem Cell Factor SDS-PAGE Sodium Dodecyl Sulfate Polyacrilamide Gel Electrophoresis shRNA small hairpin RNA SOD1 Superoxide Dismutase 1
STAT5β Signal Transducer and Activator of Transcription 5B STAT5β-RARA Signal Transducer and Activator of Transcription 5B - Retinoic Acid
Receptor Alpha ST-HSC Short Term repopulating - Hematopoietic Stem Cell TGF-β Transforming Growth Factor – beta TNFα Tumour Necrosis Factor, Alpha TNFAIP3 Tumor Necrosis Factor, Alpha induced protein 3 TNFR TNFRSF
Tumour Necrosis Factor Receptor TNFR superfamily
VAD Vitamin A Deficient VDR Vitamin D Receptor VDRE Vitamin D Response Element WHO World Health Organization WNT Wingless-type MMTV integration site family X-RARA X-Retinoic Acid Receptor Alpha
xvi
List of Tables
Chapter 1: Introduction
Table 1.1: WHO/FAB classification of acute leukemias
Table 1.2: Evidence for the role of RXR in myelopoeisis
Table 1.3: RAR and RXR deficient models in hematopoiesis
Table 1.4: Array studies demonstrating use of gene expression studies in AML
Chapter 2: Deregulated NF-κκκκB signaling in APL
Table 2.1: Genes and primer sequences used in real time PCR assays.
Table 2.2: APL patient characteristics
Table 2.3: Gene expression comparisons between APL patients containing the bcr1/2 and bcr3 isoforms of PML-RARA.
Table 2.4: Gene expression comparisons between APL patients containing FLT3-ITD versus FLT3 wild type patients.
Chapter 3: Gene expression profiling of NPM-RARA and NuMA-RARA variant APL
Table 3.1: KEGG pathways identified to be significantly over-represented within genes deregulated by NPM-RARA.
Table 3.2: KEGG pathways identified to be significantly over-represented within genes deregulated by NuMA-RARA.
Table 3.3: Commonly deregulated gene targets identified in both NPM-RARA and NuMA-RARA expressing cells relative to control U937-GFP
Table 3.4: KEGG pathways identified to be significantly over-represented within genes commonly deregulated by NPM-RARA and NuMA-RARA.
Table 3.5: Predicted transcription factors with over-represented binding motifs in genes commonly deregulated by NPM-RARA and NuMA-RARA.
Table 3.6: List of NPM-RARA deregulated genes that are also direct targets of PML-RARA identified from the Wang et al., and Martens et al. published datasets. Entries marked with an
xvii
asterisk are PML-RARA binding targets, which were reported in both of these independent published datasets.
Table 3.7: Cellular pathways represented by potential direct targets of NPM-RARA (overlap between NPM-RARA and PML-RARA direct binding sites)
Table 3.8: Transcription factor binding sites over- represented within potential direct targets of NPM-RARA (overlap between NPM-RARA and PML-RARA direct binding sites)
Table 3.9: List of NPM-RARA deregulated genes that are also direct targets of PLZF-RARA identified from the Rice et al., and Spicuglia et al. published datasets.
Table 3.10: Cellular pathways over-represented in potential NPM-RARA direct targets (overlap between NPM-RARA transcriptional targets and PLZF-RARA)
Table 3.11: Genes commonly up- and down-regulated after ATRA treatment commonly in NPM-RARA, NuMA-RARA and wild type U937-GFP cells.
Table 3.12: Promoter binding sites that are over-represented in NPM-RARA ATRA responsive gene targets.
Table 3.13: Promoter binding sites that are over-represented in ATRA responsive gene sets in NuMA-RARA
Table 3.14: Promoter binding sites that are over-represented in ATRA responsive gene targets of wild type U937-GFP control cells.
Table 3.15: Compounds identified from gene expression matching analysis using ATRA responsive gene targets in NPM-RARA.
Table A3.1: Genes deregulated greater than 2-fold in U937-NPM-RARA relative to control U937-GFP
Table A3.2: Genes differentially regulated greater than 2-fold in NuMA-RARA compared to control U937-GFP
Table A3.3: Retinoid responsive gene targets of NPM-RARA
Table A3.4: Retinoid response gene targets in NuMA-RARA
Table A3.5: Retinoid responsive gene targets in control GFP
xviii
Chapter 4: Nucleophosmin is universally deregulated In Acute Promyelocytic Leukemia
Table 4.1: Genes and primer sequences used in real time PCR assays.
Table 4.2: APL patient characteristics.
xix
List of Figures
Chapter 1: Introduction
Figure 1.1: Hematopoietic cell hierarchy.
Figure 1.2: Asymmetric versus symmetric cell division in hematopoietic stem cells.
Figure 1.3: BMI-p53 and the PI3K signaling networks regulating HSC self-renewal.
Figure 1.4: Cell extrinsic signaling mediated by the HSC niche regulating HSC self-renewal.
Figure 1.5: General structure of Acute Promyelocytic Leukemia associated fusion proteins.
Figure 1.6: Structural features of Retinoic Acid Receptors (RAR).
Figure 1.7: Structural features of Retinoid X Receptors (RXR).
Figure 1.8: RAR signaling in response to retinoic acid.
Figure 1.9: X-RARA signaling in response to retinoic acid.
Figure 1.10: NF-κB signaling pathway.
Chapter 2: Deregulated NF-κκκκB signaling in APL
Figure 2.1: Deregulation of NF-κB signaling and target genes in APL.
Figure 2.2: Western blot and confocal immunofluorescence analysis of total NF-κB protein levels.
Figure 2.3: NF-κB/p65 over-expressing NPM-RARA and PML-RARA cells have increased resistance to cell death effects of TNFα.
Figure 2.4: NF-κB/p65 signaling response after TNFα stimulation.
Figure 2.5: Expression profiles of the NF-κB/p65 gene interaction network and target genes after TNFα stimulation.
Figure 2.6: Effects of ATRA in modifying TNFα response in NPM-RARA cells.
Figure 2.7: Effects of NF-κB inhibitors (SN50 and parthenolide) on TNFα induced sensitivity to cell death in NPM-RARA and PML-RARA cells.
xx
Chapter 3: Gene expression profiling in NPM-RARA and NuMA-RARA variant APL
Figure 3.1: Distribution of probesets deregulated by X-RARA.
Figure 3.2: Gene Ontology: biological processes annotation of X-RARA deregulated genes.
Figure 3.3: Transcription factor binding sites within proximal upstream regions of commonly deregulated gene targets of NuMA-RARA and NPM-RARA cells.
Figure 3.4: Gene interaction models indicating crosstalk between retinoid signaling and FOX family of transcription factors as well as APL fusion partners.
Figure 3.5: Comparison of X-RARA gene expression profiles with published APL patient gene expression datasets.
Figure 3.6: Comparison of X-RARA gene expression profiles with published AML-LSC expression datasets.
Figure 3.7: ATRA induced gene expression changes in NPM-RARA, and NuMA-RARA in comparison with wild type U937-GFP.
Figure 3.8: Using gene expression profiling to predict chemical compounds with activity similar to that of ATRA in X-RARA cells.
Chapter 4: Deregulated NPM in APL
Figure 4.1: NPM expression in X-RARA+ cells.
Figure 4.2: NPM localization in X-RARA expressing cells.
Figure 4.3: NPM localization within nucleolar aggregates in X-RARA expressing cells.
Figure 4.4: NPM half-life in NB4-PML-RARA cells.
Figure 4.5: Localization of NPM in NPMc+ OCI-AML3 cells.
Figure 4.6: NPM protein half-life.
Figure 4.7: Localization of Npm in immature neutrophils from wild-type and transgenic mice.
Figure 4.8: Nucleolar organizing regions in X-RARA+ cells.
Figure 4.9: Measures of nucleolar function in X-RARA+ cells.
Figure 4.10: Elevated rRNA synthesis rates in APL patient blasts.
Figure 4.11: NPM co-immunoprecipitates with the retinoid receptors RXRA and RARA in the promyelocytic leukemia cell lines U937 and NB4, and COS pcDNA cells.
xxi
Figure 4.12: NPM and X-RARA co-immunoprecipitate with RXRA in COS X-RARA-V5 cells.
xxii
List of Appendices
Appendix I: Array data tables (Chapter 3)
Appendix II: Characterization of U937 cell lines expressing NuMA-RARA and NPM-RARA
1
Chapter 1
Introduction
Material contained in section 1.4 was adapted from the following publication:
Thomas, M., Sukhai, M., and Kamel-Reid, S. (2008). Many paths to one disease: the role of the
variant fusion proteins NPM-RARA and NuMA-RARA in acute promyelocytic leukemia
biology. Cell Science Reviews 4.
Material contained in sections 1.2 and 1.4 were adapted from the following publication:
Thomas, M., Sukhai, M., Kamel-Reid, S. (2012). An Emerging Role for Retinoid X Receptor A
in Malignant Hematopoiesis. Leukemia Research 36(9): 1075-81.
Material contained in sections 1.2, and 1.5 were adapted from the following publication:
Goswami, R. S*, Sukhai, M. A.*, Thomas, M.*, Reis, P. P., and Kamel-Reid, S. (2009).
Applications of microarray technology to Acute Myelogenous Leukemia. Cancer Inform 7, 13-
28. (* Equal contribution).
2
1.1 Normal Hematopoiesis
1.1.1 Model of hematopoietic hierarchy
Hematopoiesis, or blood cell formation, is the process whereby hematopoietic stem cells (HSCs)
give rise to lineage-committed progenitors and end-stage mature cells. HSCs are present at the
apex of the hematopoietic differentiation hierarchy, and have properties of multipotency and
self-renewal. Multipotency is the ability to differentiate into multiple types of cells of the blood
system, while self-renewal is the ability to give rise to identical daughter cells with the same
multipotent properties as the parent cell. Under steady-state conditions, HSCs are maintained in a
quiescent state and their numbers are tightly regulated (Jude et al., 2008). HSC’s are functionally
classified as long term repopulating (LT-HSC) or short term repopulating (ST-HSC) according to
their ability to establish life long, or transient hematopoiesis (Chumsri et al., 2007). When
stimulated to differentiate, HSCs give rise to multipotent progenitors (MPP), which then
differentiate into lineage committed progenitors, and ultimately produce all the differentiated
cells comprising the blood system (Figure 1.1) (Jude et al., 2008). HSCs initially lose the
property of self-renewal upon differentiation to progenitors, and then lose multipotency as they
become progressively committed to a particular lineage. Hematopoietic progenitors are
developmentally more restricted in their lineage commitment, and give rise to developmentally
mature blood cells, which lose the ability to proliferate and self-renew. Models of hematopoiesis
have classified ten HSC-derived blood cell lineages comprising of myeloid/erythroid cells
[megakaryocytes, erythrocytes, neutrophils, basophils, eosinophils, macrophages, dendritic cells
(DCs)], and lymphoid cells [B and T lymphocytes, and natural killer cells] (Figure 1.1).
HSCs reside in specialized bone marrow regions between the bone and the marrow space, termed
endosteal space, in a highly regulated micro-environmental niche, consisting of various cell types
that work to regulate HSC localization, self-renewal and differentiation (Orkin and
Hochedlinger, 2011). Two major categories of pathways are required for maintaining HSC
function: cell intrinsic pathways (including cell cycle regulators, PI3K pathways); and, cell
extrinsic factors (including WNT, Notch, TGF-β, and Hedgehog and others discussed in section
1.3).
3
LT-HSC
ST-HSC
MPP
CMP CLPMEP
GMP
Erythrocyte
Megakaryocyte
Platelets
Basophil
Eosinophil
Macrophage
Monocyte Neutrophil
Dendritic cell
B-cell T-cell NK-cell
Mast cell
Sel
f-re
new
alD
iffer
entia
tion
Figure 1.1: The Hematopoietic cell hierarchy. A small population of hematopoietic stem cells
give rise to all hematopoietic cells. HSCs are broadly categorized into two subsets: long-term
reconstituting HSCs (LT-HSCs) and short-term reconstituting HSCs (ST-HSCs). Properties of
self renewal and multilineage differentiation are maintained in LT-HSCs. ST-HSCs are more
limited in their ability to self-renew, but still retain the ability to differentiate into multiple
lineages. ST-HSCs differentiate to give rise to mutipotent progenitors (MPPs). Common
lymphoid progenitor (CLP), common myeloid progenitor (CMP), megakaryocyte-erythrocyte
progenitor (MEP) and granulocyte-monocyte progenitor (GMP) populations are all lineage
committed progenitors derived from MPPs. Progenitor cells lose their differentiation potential as
they continue along specific differentiation lineages, until they produce the fully mature cells
depicted at the bottom of the Figure.
[Adapted from (Wang and Wagers, 2011)]
4
1.2 Malignant Hematopoiesis
1.2.1 Acute Myelogenous Leukemia (AML)
AML is the most common form of acute leukemia in adults, comprising 80-85% of all diagnosed
cases (Kufe, 2003). AML is a heterogeneous group of hematologic malignancies, characterized
in part by inhibition of myeloid differentiation in hematopoietic progenitor cells (Estey and
Dohner, 2006). This results in the accumulation of relatively undifferentiated “blasts” exhibiting
one or more types of early myeloid differentiation within the bone marrow, leading to
replacement of normal marrow elements, and clinical manifestation of the disease. The
pathophysiology of AML is generally characterized by the acquisition of genetic changes in bone
marrow stem cells resulting in a complete or partial block in differentiation, and an expansion of
the transformed cell population. These changes involve mutations that activate proto-oncogenes,
or inactivate tumor suppressors, and by doing so alter cellular signaling pathways and/or
transcriptional regulation. Cytokines released by AML blasts also inhibit the differentiation of
normal cells (Youn et al., 2000). Clinically, patients present with fever, fatigue, and spontaneous
mucosal and cutaneous bleeding (Vinay Kumar, 2004). Infections caused by opportunistic
organisms such as fungi, Pseudomonas, and commensals are frequent (Vinay Kumar, 2004). The
most common cause of death in AML patients is bone marrow failure, resulting in anemia,
neutropenia, and thrombocytopenia (Estey and Dohner, 2006).
Leukemias were historically classified based on the French, American and British (FAB)
classification system. FAB nomenclature classifies AML into one of ten subtypes on the basis of
the bone marrow elements that the leukemic blasts most closely resemble (Kufe, 2003). The
following AML subtypes are defined by the FAB classification scheme: M0 (Minimally
Differentiated AML), M1 (Myeloid leukemia without maturation), M2 (Myeloid leukemia with
maturation), M3 (Acute Promyelocytic Leukemia), M4 (Myelomonocytic Leukemia), M4EO
(Myelomonocytic Leukemia with Eosinophilia), M5 (Monocytic Leukemia), M6
(Erythroleukemia), M7 (Megakaryocytic Leukemia), and hybrid leukemias. The more recent
World Health Organization (WHO) AML classification system defines the following four broad
classifications, established based on a combination of molecular, cytogenetic,
immunophenotypic and morphological markers: AML with recurrent genetic abnormalities
5
(includes APL), AML with multilineage dysplasia, AML and MDS therapy related, and AML
not otherwise categorized (Vardiman et al., 2002; Vardiman et al., 2009) (Table 1.1).
Table 1.1 WHO and FAB leukemia classifications
AML Classification Details
AML with Recurrent
Molecular Abnormalities
Good prognosis group (e.g., t(15;17); t(8;21); inv(16);
NPMc+
Intermediate prognosis group
Poor prognosis group (e.g., FLT3 mutation, MLL
rearrangement)
AML, MDS-Related AMLs arising in patients with prior myelodysplastic
syndrome
AML, Therapy-Related AMLs arising in patients after chemotherapy treatment for
other cancers
AML, Not Otherwise
Specified
FAB M0 – M2 (classified by degree of maturation of
leukemic blasts)
FAB M4 – M7 (classified by lineage of leukemic blasts)
1.2.2 Tumour initiating cell biology and self-renewal
Analogous to the hierarchical organization of hematopoietic stem cells, current models of
leukemia development also suggest functional heterogeneity in the leukemic cell population.
Leukemias are thought to have a mostly quiescent stem-like cell population of leukemic stem
cells (LSC) with unlimited self-renewal properties, progenitor populations with more limited
potential for self-renewal, and leukemic blasts with no self-renewal capacity (Roboz and
Guzman, 2009). Leukemias depend on the LSC, also referred to as the leukemia initiating cell
(LIC), for their continued growth and proliferation (Bonnet and Dick, 1997) (Dick, 2005; Reya
et al., 2001). Increased self-renewal is a hallmark of cancer, and is a feature that is shared by
6
normal and leukemic stem cells. Several pathways are well known to be important in HSC self-
renewal including HOX genes, WNT/β-CATENIN pathway, PTEN/AKT/FOXO, BMI1,
polycomb group proteins, NOTCH and HEDGEHOG pathways (Huntly and Gilliland, 2005),
and some of these are described in section 1.3. Not surprisingly, some of these same pathways
are also found to be deregulated in cancer, suggesting that both normal HSCs and LSCs share
pathway components and signaling mechanisms.
In order to maintain an adequate pool of stem cells, normal HSCs tightly control cell cycle entry
and maintenance of quiescence (Warr et al., 2011). PI3K is a major signaling pathway
downstream of tyrosine kinases, and is known to be constitutively activated in human AML
(Martelli et al., 2006). Leukemia-associated oncogenes may also confer self-renewal properties
to committed hematopoietic progenitors by (re)-establishing or enhancing self-renewal-
promoting transcriptional programs (Chan and Huntly, 2008). In concert with enhanced or newly
acquired self-renewal capabilities, LSCs in AML are also characterized by a block in
differentiation (Rosenbauer and Tenen, 2007). This is thought to occur through the repression of
gene expression programs associated with differentiation; e.g. mutations in master regulators and
transcription factors such as PU.1 and CEBPA, or through transcriptional repression of these
targets by leukemic fusion genes, as is the case with AML1-ETO and PML-RARA. Another
general characteristic of cancer cells, also thought to be shared by LSCs, is the relative
insensitivity to apoptosis and apoptotic stimuli. The NF-κB pathway is one example of a
transcription factor and signaling network that mediates proliferation, survival and metastasis
(see section 1.6). NF-κB is found to be constitutively active in selected AML patient samples
with increased activity in CD34+ fraction of AML, but not normal cell populations (Guzman et
al., 2001).
1.3 Self-renewal and the hematopoietic microenvironment in normal HSC, and LSC.
Self-renewal is a property of cells with long-term differentiation capability that allows them to
generate progeny with the same potential to differentiate into various cell types (Zon, 2008).
Self-renewal occurs in a cell-intrinsic manner, but is affected by extrinsic signals and the
surrounding microenvironment. The niche environment is critical in determining whether cell
division is to be symmetric or asymmetric (Figure 1.2). Symmetric cell division involves the
7
creation of either two identical parent cells or two identical daughter cells that would undergo
differentiation or are already differentiated. Asymmetric division gives rise to two daughter cells,
only one of which resembles the parent stem cell. Properties of stem cell self-renewal are not
specific to HSCs; other tissues, including the skin, mammary cells, gut, neuronal stem cells, and
muscle all have been described to contain cells that have the capacity to maintain long-term
repopulation activity (Warr et al., 2011).
8
Quiescent HSC Quiescent HSC Quiescent HSCActivated HSC Activated HSC
Symmetric cell division
Asymmetric cell division
Multi-potent progenitor
Lineage-restricted progenitor
Differentiated cells
Bone MarrowStem cell niche
Sel
f-re
new
al
Figure 1.2: Asymmetric versus symmetric cell division. Quiescent HSCs remain adhered to
the stem cell niche through cell adhesion molecules. Once activated, HSCs can undergo
asymmetric cell division where they can generate a daughter cell that completely resembles the
parent HSC through self-renewal, and a progenitor cell that is more differentiated. Following cell
division and differentiation, HSCs lose properties of self renewal and multipotency.
[Adapted from (Suda et al., 2005)]
9
1.3.1 Signaling networks involved in maintaining self-renewal
Regulation of HSC self-renewal is critical to ensure the maintenance of adequate numbers of
HSCs. Maintaining HSC numbers through self-renewal requires the activation of proliferation
pathways, and a suppression of signals leading to apoptosis, differentiation and cell death. (Akala
2006). Cellular networks involved in positively regulating self-renewal in HSCs include the cell
cycle regulation (Bmi-p53) network, and the PI3K signaling pathway (reviewed in (Warr et al.,
2011) (Figure 1.3). In addition, HSC self-renewal also involves cell extrinsic signaling and
critical signals provided by the bone marrow niche including WNT, TGFβ, Hedgehog, and
Notch. The “bone marrow niche” is a term used to describe the micro-environment surrounding
the HSC, as well as the physical interaction between HSCs and the specialized cells that support
them. Niche cells provide membrane-bound and secreted factors, cytokines, chemokines,
adhesion molecules, and their receptors which are essential for survival, quiescence, and
differentiation (Schofield, 1978; Wilson et al., 2007). Other critical extrinsic signals that have
been identified to date include SDF-1α/CXCL12, Angiopoietin-1, IL-3, FLT3-Ligand, SCF, G-
CSF, and GM-CSF (Trumpp et al., 2010). Additional factors that are expressed in the BM niche,
and are essential for HSC self-renewal include TGF-β, Wnt, Hedgehog, and Notch pathway
components (Figure 1.4).
10
BMI-1BMI-1
p16p16
RBRB
p19p19
P53P53
Cell cycle
arrest •Apoptosis
•DNA repair
•Senesence
PI3KPI3K
AKTAKT
FOXOFOXOTSC1
/2
TSC1
/2
mTORC
1
mTORC
1
•Cell cycle
•Apoptosis
•Protection
from O2
stress
•Cell growth
•Translation
•Cell cycle
progression
PMLPML
PTENPTEN
HSC
Growth Factors
Oxygen levels
Nutrients
DNA damage
Figure 1.3: BMI-p53 and the PI3K signaling networks. Both cellular networks affect HSC
self-renewal by regulating cellular survival, cell cycle, DNA repair, growth and senescence.
Molecules coloured in green are positive modulators of self-renewal in HSCs; those coloured in
red are inhibitors of self-renewal and promote quiescence or apoptosis.
[Adapted from (Warr et al., 2011)]
11
Notch WNT Hh TGFββββ
Jag
ge
dJa
gg
ed
No
tchN
otch
MAMLMAML
MAMLMAML
FrZFrZLRP5
/6
LRP5
/6
B-cateninB-catenin
TCF/LEFTCF/LEF
SmoSmo
PtcPtc
GliGli
TG
Fb
RI
TG
Fb
RI
TG
FbR
IIT
GFb
RII
Smad4Smad4
Smad2Smad2
Smad3Smad3
Smad2Smad2
Smad3Smad3
Smad4Smad4
TSCETSCE
NIC
DN
ICD
NIC
D
B-cateninB-catenin
TCF/LEFTCF/LEF
B-cateninB-catenin
GliGli
Smad2Smad2
Smad3Smad3
Smad4Smad4
SuSu
GSK3BGSK3B
NumbNumb
HSC
cytoplasm
HSC Niche
Anti-
proliferative
effects
HSC
maintenance,
self-renewal
HSC
maintenance,
self-renewal
Anti-proliferative,
anti-differentiation
effects
HSC
nucleus
TNFααααSDF-
1αααα/CXCL2
IL3
FLT3-L
SCF
G-CSF
GM-CSF
Angiopoietin
-1
Self-renewal
regulation
Figure 1.4: Cell extrinsic signaling mediated by the HSC niche regulating HSC self-
renewal. The Notch, WNT, Hedgehog (Hh), and TGFβ signaling pathways regulate self-renewal
and are depicted here in detail. Other bone marrow niche induced self-renewal regulators trigger
similar signaling pathways and include TNFα, SDF-1a/CXCL2, IL3, FLT3-L, SCF, GM-CSF,
G-CSF, Angiopoietin-1. [Adapted from (Warr et al., 2011)].
12
1.3.1.1 Negative regulators of self-renewal
Cell intrinsic negative regulators of HSC maintenance and self-renewal include the cyclin
dependent kinase inhibitor, p21CIP1/WAF1 (Cheng et al., 2000), GFI1 (Hock et al., 2004), and LNK
(Buza-Vidas et al., 2006). In general, these factors work to regulate the size of the HSC
compartment by restricting entry of stem cells into the cell cycle (Cheng et al., 2000), and
restricting their proliferation (Hock et al., 2004), or negatively regulating cytokine-induced HSC
expansion (Buza-Vidas et al., 2006). Cell extrinsic factors such as transforming growth factor
(TGF)-β (Larsson et al., 2005), interferon (IFN)-γ (Yang et al., 2005), interleukin (IL)-3
(Yonemura et al., 1996) and tumor necrosis factor (TNF)-α (Bryder et al., 2001) negatively
affect HSC growth in vitro. Multiple cytokines involved in promoting growth have been
implicated in regulation of the HSC pool; however, the potential roles of these negative
regulators are not very clear. Such negative regulators of self-renewal can work by accelerating
differentiation of stem and progenitor cells (Dybedal et al., 2001), and abrogating self-renewal
and expansion of stem cells (Yonemura et al., 1996).
1.3.1.2 TNF signaling as a negative regulator of hematopoiesis
Our results in Chapter 2 describe deregulation in TNFα mediated cellular survival in acute
promyelocytic leukemia. TNFα is a pleiotropic cytokine that exerts inhibitory and stimulatory
effects on a variety of cell types. TNF receptor (TNFR) and Fas ligand-mediated signaling have
been thought to suppress hematopoiesis both in vitro and in vivo. In a recent study, TNFα was
shown to be a potent endogenous suppressor of normal HSC activity in vivo in a mouse model
(Pronk et al., 2011). TNF signals through 2 receptors – TNFR-p55, and TNFR-p75 (Aggarwal,
2003). While the p55 form contains an intracellular death domain, and is therefore associated
with apoptotic signals, the p75 form is implicated in the control of proliferation (Aggarwal,
2003). TNF receptors are activated by 2 isoforms of TNF, TNFα and TNFβ. Knock out studies
have demonstrated that mice lacking TNFRSF 1 and 2 have normal counts of steady state HSCs.
However, both receptors were important in restricting HSC expansion, as HSCs from double
knockout donor mice had a significantly increased competitive advantage in reconstituting the
hematopoietic system in the bone marrow of recipient mice. Clonal growth of bone marrow with
wild type TNFRs was inhibited in the presence of TNFα. TNFα mediated growth suppression
was not rescued by over-expression of BCL2. This indicated that suppression of growth by
13
TNFα does not involve induction of cell death via inhibition of BCL2, and suggests that
induction of apoptosis has little role in TNFα induced growth inhibition. Pronk et al. (2011) also
showed that cell cycle activation enhanced TNFα induced suppression of HSC activity. TNFα
treatment of adult wild-type steady state mice resulted in decreased bone marrow cellularity and
reduced HSC activity as assessed in a bone marrow transplant assay. These effects of TNFα on
bone marrow cellularity and HSC activity were enhanced in mice treated with 5-fluorouracil, a
compound that is known to deplete actively cycling cells, and as a result induce active
proliferation of dormant HSCs. These studies indicate that TNFα primarily exerts negative
regulatory effects on actively cycling but not quiescent HSCs.
TNFα was previously reported to also exert negative effects on the committed progenitor cell
population. (Bryder et al., 2001) used purified, long term repopulating bone marrow stem cells
from mice and demonstrated that TNFα treatment severely compromised the short- and long-
term muti-lineage reconstitution of the hematopoietic system. In addition to previous work that
shows TNFα has effects on more differentiated clonogenic progenitor cells (Jacobsen et al.,
1994), this work demonstrated that TNFα mediated suppression can also target HSCs.
Interestingly, they also demonstrated that the negative effects on self-renewal were limited to
HSCs that were actively cycling. Quiescent HSCs have low TNFR expression and do not
respond to TNFα suppression (Bryder et al., 2001).
These studies suggest that TNFα plays an important regulatory role in normal hematopoiesis by
affecting both long term and short term repopulating progenitor and stem cells. TNFα may also
play an important role in malignant hematopoiesis. Chapter 2 of this thesis describes how while
TNFα exerts negative effects on growth and survival of wild type cells, leukemic cells
expressing oncogenic fusion proteins have evolved mechanisms to evade this normal negative
regulation. Mutations and deregulation of these genes involved in positive or negative
modulation of stem cell function and maintaining properties of self-renewal can lead to
deregulated growth of normal and malignant cells and contribute to disease development.
14
1.3.2 Summary
Taken together, normal hematopoiesis is critical for the maintenance of adequate levels of blood
cell elements required for survival. This regulation of HSC proliferation and self-renewal, as
well as the tight control of hematopoietic cell lineages, is a complex process involving bone
marrow microenvironment signals, as well as cell intrinsic regulators. Deregulation of any
regulatory component within this complex web can result in aberrant hematopoiesis and in some
cases, malignant transformation or other bone marrow disorders. Disruption in the normal
homeostatic balance between mature differentiated cells and HSCs/progenitors can occur due to
deregulated proliferation of progenitors or other mature cells, or the acquisition of self-renewal
properties by cells that normally do not self-renew (Passegue and Weisman, 2005).
15
1.4 Acute Promyelocytic Leukemia (APL)
Acute promyelocytic leukemia (APL; AML FAB M3) accounts for ~10% of all AML cases
worldwide. It is characterized by accumulation of abnormal hematopoietic cells with
promyelocytic features in the bone marrow, as well as balanced chromosomal translocations
involving the retinoic acid receptor alpha (RARA) locus on chromosome 17q21 (Beck, 1991;
Grignani et al., 1994; Kalantry et al., 1997; Warrell et al., 1993) Normal hematopoiesis is
inhibited, leading to pancytopenia, and diminished immunity. APL was first described by a
Swedish author, Hillestad (Hillestad, 1957), in a report of three patients characterized by a fatal
condition with white blood cells dominated by promyelocytes and a severe bleeding tendency. In
1985, all-trans retinoic acid (ATRA) was introduced as a treatment option in APL, and since then
has been extremely successful in treating APL (Wang and Chen, 2008). ATRA-based treatment
regimens combining ATRA and chemotherapy brought rates of complete remission up to 90%-
95%, and 6-year disease free survival up to 86% (+/- 10%) in low-risk patients (Asou et al.,
2007). Since the early 1990s the introduction of arsenic trioxide (ATO) further improved clinical
outcome of refractory and relapsed patients, and also newly diagnosed cases of APL (Powell et
al., 2010).
1.4.1 APL molecular pathology
More than 99% of APL cases involve a translocation t(15;17)(q22;q21) between the
promyelocytic leukemia (PML) and RARA genes (Alcalay et al., 1991; Goddard et al., 1991;
Pandolfi et al., 1991). Other “variant” partner genes collectively called “X”, have been
characterized: PLZF (Chen et al., 1993a); NPM (Hummel et al., 1999; Redner et al., 1996);
NuMA (Wells et al., 1997; Wells et al., 1996); STAT5b (Arnould et al., 1999); PRKAR1A
(Catalano et al., 2007); FIP1L1 (Kondo et al., 2008), (Menezes et al., 2011); BCOR (Yamamoto
et al., 2010). These translocations result in the creation of a functional chimeric protein (X-
RARA), whose N-terminus is derived from the partner gene, and retains the X protein’s
oligomerization domain; and whose C-terminus is derived from RARA (Melnick and Licht,
1999) (Figure 1.5). X-RARA, therefore, can be viewed as aberrant RARA transcription factors,
containing heterologous oligomerization and protein-protein interaction domains fused to an N-
terminal truncated RARA.
16
While the vast majority of the APL literature has focused on understanding the mechanism of
action of PML-RARA, and the clinically resistant variant PLZF-RARA, functional studies using
STAT5b-RARA, NPM-RARA, NuMA-RARA, and the other recently identified fusion proteins
are lacking, specifically on the role of the “X” partner protein in disease pathogenesis. While the
clinical manifestation of the disease induced by all the RA responsive APL fusion proteins are
virtually identical, the biology of the fusions are quite distinct, as a result of distinct fusion
partner proteins. In studying and understanding these variants in relation to PML-RARA, we are
in a better position to identify those minimally required molecular events and cellular pathways
that give rise to the common disease.
17
Figure 1.5: Structural diagram representing the APL fusion proteins. The N-terminal region of X-RARA is
comprised of domains B-F of RARA and is a common feature in all fusions identified to date. The C-terminal
domains is comprised of various partners and almost always contains a protein dimerization motif that enables the
fusion to form homo-oligomers in cells. The three most recent fusions reported between 2008 and 2010 include
FIP1L1-RARA, PRKAR1A-RARA, and BCOR-RARA. Our lab cloned and characterized the NuMA-RARA fusion,
and reported a case of NPM-RARA variant APL.
18
1.4.1.1 The leukemia initiating cell in APL
Analysis and purification of leukemia initiating cells in APL has been challenging, as a result of
the poor transplantibility of human APL cells as xenografts (Bonnet and Dick, 1997; Kogan,
2009). Studies have suggested that the APL LIC may be present within the committed myeloid
progenitor population, rather than a stem cell compartment. The true nature of the APL LIC,
whether a distinct cell population or cells at a particular stage of the cell cycle, or those localized
to particular bone marrow microenvironments, is still an open question. (Nasr et al., 2008)
studied the APL LIC at a functional level, to report that the combination of ATRA and ATO
resulted in clearance of the LIC. The mechanism of clearance, whether mediated by a loss of
self-renewal or induction of apoptosis is still unclear, and is one question that remains difficult to
address until such time as when the LIC cell population can be fully characterized. This work
also indicates that retinoids can mediate self-renewal of normal HSCs in addition to their well
known functions for promoting myeloid differentiation. The newly uncovered role for retinoid
signaling can potentially explain how deregulation of this signaling pathway by RARA fusion
proteins further contributes to the APL phenotype.
1.4.2 Retinoid signaling in Hematopoiesis
All of the APL associated fusion proteins involve the retinoic acid receptor (RAR), implying that
RAR mediated signaling and its effects on the cell is an important step in the pathogenesis of the
disease. Two classes of nuclear receptors, retinoid (RAR) and rexinoid (RXR), mediate retinoid
signaling in cells. Both RAR and RXRs are encoded by three genes, giving rise to closely related
isoforms α, β, and γ (Mangelsdorf and Evans, 1995). Like other nuclear receptors, RARs consist
of six evolutionarily conserved domains A-F, including the DNA binding domain that mediates
binding to retinoic acid response elements (RARE) (Chambon, 1996). The A/B (AF1) domain is
a ligand-independent, promoter context-dependent transactivation domain (Nagpal et al., 1993).
The C domain contains the DNA binding domain, and the E domain contains the all trans
retinoic acid (ATRA) binding site, the ligand-dependent transactivation domain (AF2), the
retinoid X receptor alpha (RXRA) dimerization interface and the nuclear co-repressor and co-
activator binding sites (Nagpal et al., 1993) (Figure 1.6). RAREs are located in the promoter
elements of retinoid target genes and consist of direct repeats (DRs) (A/G)G(G/T)TCA,
19
separated by 2 or 5 nucleotides (Naar et al., 1991; Umesono et al., 1991). RAR/RXR
heterodimerization is mediated by the DNA binding and ligand binding domains of RARs and is
required for binding to RAREs (Zechel et al., 1994) (Figure 1.6).
20
Retinoid X receptors (RXRs) were identified as co-regulators, required for the efficient binding
of RARs to their response elements (Hallenbeck et al., 1992; Leid et al., 1992; Yu et al., 1991).
Structurally RXRs are very similar to RARs and retain most of the domains found in RAR,
except for the F domain (Figure 1.7). RXRs can affect multiple biological pathways because of
their unique ability to heterodimerize with different nuclear receptors, including the thyroid
hormone receptor (TR), peroxisome proliferator-activated receptor (PPAR), and vitamin D
receptor (VDR) (Berrodin et al., 1992; Bugge et al., 1992; Kliewer et al., 1992). The three RXR
isoforms (α, β, and γ) have a high degree of homology, suggesting that they have common target
sequences, and respond to common ligands (Mangelsdorf et al., 1992) The isoforms differ in
their expression patterns: RXR alpha and RXR beta can be found in almost every tissue type,
while RXR gamma is restricted to muscle and brain cells (Mangelsdorf et al., 1992).
Retinoid signaling plays an important role in the development and differentiation of a number of
tissues in the body, including the eye, the heart and circulatory systems, the central nervous
system, the urogenital and respiratory systems, the musculoskeletal system and hematopoiesis
(Mark et al., 1999); (Ross et al., 2000). Retinoid signaling has been implicated in hematopoiesis,
specifically terminal neutrophil differentiation, through a number of different lines of
investigation (Table 1.2; Table 1.3). Additional means of retinoid-mediated control of
hematopoiesis include control of retinoic acid metabolism, and non-ligand-mediated crosstalk
among hematopoietic signaling pathways. Numerous studies involving vitamin-A deficient
animal systems and in vitro culture models clearly establish a role for retinoids in controlling
signaling pathways involved in hematopoiesis (Oren et al., 2003). Active retinoid signaling starts
with cellular enzymes and RA binding proteins, which mediate the processing of dietary retinol
(vitamin A) to retinoic acid (Oren et al., 2003). The different rates of retinol metabolism in
hematopoietic cells constitute a means of regulating cellular levels of retinoic acid. This ensures
that RARA transcriptional activity is differentially regulated in hematopoietic cells in spite of
their exposure to uniform physiological concentrations of retinoids (1-10 nM) in the serum
(Collins, 2002).
21
Table 1.2: Evidence for the role of RXR in myelopoeisis
Evidence
Study
In HL-60 cells, activation of RXR signaling was shown to be required for the induction of apoptosis, and a similar link was reported in the NB4 cell line.
Mehta et al., 1996; Shiohara et al., 1999;
Nagy et al., 1995; Benoit et al., 2001
Evidence of crosstalk between the RXR and protein kinase A (PKA) signaling pathways, as activation of both RXR and PKA, using specific ligands and agonists, was found to induce cell maturation in NB4 cells
Benoit et al., 1999
Conditional knockout of RXRA in the hematopoietic compartment. Strikingly, these mice did not exhibit an abnormal hematopoietic phenotype in vivo, suggesting that RXRA is dispensable for normal adult hematopoiesis.
Ricote et al., 2006
Down-regulation of RXRA is essential for terminal neutrophil differentiation, as RXRA is highly expressed in granulocyte/monocytes progenitors, and in terminally differentiated monocytes, but not in mature granulocytes. Furthermore, the ectopic over-expression of RXRA in GM progenitors resulted in a block of neutrophil differentiation, while the expression of a dominant negative form of RXRA, lacking amino acids 1-197, did not impair neutrophil differentiation.
Taschner et al., 2007
22
Table 1.3: RAR and RXR deficient models in hematopoiesis
Experiment
Study
Vitamin A deficient (VAD) mice develop an expansion of myeloid cells with characteristics of terminally differentiated granulocytes, in the bone marrow, spleen and peripheral blood This myeloid expansion was found to be relieved with ATRA treatment, which, the authors suggested, was due the role of ATRA in granulocytic apoptosis
Kuwata et al., 2000
Mice with selective knockout of the RARA1 isoform develop normally with no defects in hematopoiesis
Li et al., 1993
Mice with disruptions in both isoforms of RARA exhibit early postnatal lethality, but no hematopoietic abnormalities
Lufkin et al., 1993
RARG homozygous knockout mice also do not have gross hematopoietic disruptions, but have defective stem cell maintenance
Lohnes et al., 1993 Purton et al.¸ 2007
RARA and RARG double knockouts die in utero, thereby restricting the study of hematopoiesis to the fetal liver in these models These mice have normal granulopoiesis as seen by the presence of mature granulocytes in the fetal liver and did not exhibit a compensatory increase in RXRB expression to offset the deficiency in RARA and RARG
Lohnes et al., 1994
Targeted loss of function mutation in the RXRA gene in the mouse germ line resulted in embryonic lethality between E13.5 and E16.5. This lethality was attributed to defects in the ventricular chamber of the heart leading to extremely thin ventricular walls
Sucov et al., 1994 Kastner et al., 1994
Mice expressing a dominant negative form of RXRB in myeloid cells were reported to have severe arrest in maturation at the promyelocyte stage of myeloid differentiation in 1 of 12 mice used in the study, while 3 other mice exhibited mild perturbations in myeloid development, suggesting a function for RXRs in myelopoiesis
Sunaga et al., 1998
23
AF-1 Transcriptional Activation
AF-1 Transcriptional Activation
DNA Binding
Hinge Region
Ligand Binding
AF-2 AD AF2 Activation Domain
Figure 1.7: Structural features of Retinoid X Receptor (RXR). RXR structural organization is
similar to that of other nuclear hormone receptors, but lacks C-terminal F domain. AF-1,
activating function-1; DBD, DNA-binding domain; LBD, ligand-binding domain; AF-2,
activating function-2; AF2-AD, AF2 activation domain.
[Adapted from (Melnick and Licht, 1999)]
24
In the absence of the RA ligand, the transcriptional activity of the RAR/RXR heterodimer is
inhibited by the binding of co-repressors, including nuclear receptor co-repressor (N-CoR),
silencing mediator for retinoid and thyroid receptors (SMRT) and histone deacetylase (HDAC)-
containing Sin3A complexes (Hu and Lazar, 2000). Binding of all-trans retinoic acid (ATRA) to
RARA creates a conformational transition in the RARA ligand binding domain (Renaud et al.,
1995). This disrupts the co-repressor interaction and promotes the sequential recruitment of co-
activator complexes, which remodel chromatin to facilitate binding of the transcriptional
machinery on the promoter. Co-activators like p300/CBP, locally modify chromatin structure
through their histone acetyl transferase (HAT) activity, which acetylates lysine residues on the
N-terminal tails of histones and weakens their interaction with DNA, allowing for the activation
of gene transcription (Wade et al., 1997).
Non-ligand mediated activation of RARs has also been recorded during different stages of
myelopoiesis (Collins, 2002). These include interactions of RARs with transcription factors like
the STAT family members and their synergism with other receptors such as the protein kinase A
(PKA) receptor (Collins, 2002). A number of hematopoietic cytokines including IL-3, GM-CSF,
and IL-1, have been reported to enhance transcriptional activity of RA receptors (Nakamaki et
al., 1994). IL-3 and GM-CSF mediate their cellular effects by activation of the JAK/STAT
pathway. Activated cytokine receptors phosphorylate STATs by their association with JAKs.
STATs then translocate to the nucleus, where they act as transcription factors (Darnell, 1997).
There exists significant functional crosstalk between RARs and STAT receptors, as seen by the
direct role of STAT5 (Si and Collins, 2002) in mediating IL-3 induced enhancement of RAR
activity (Johnson et al., 2002). Furthermore, a number of overlapping STAT/RAR binding sites
have been reported in the RAREs of different genes and illustrate the role of non-ligand
mediated activation of RAR transcriptional activities (Si and Collins, 2002).
25
Figure 1.8: RAR signaling in response to retinoic acid ligand. In the absence of the retinoic
acid ligand, RARA-RXRA heterodimers recruit histone transcriptional corepressors to promoter
elements containing retinoid response elements (RAREs), resulting in repression of downstream
gene targets. In the presence of physiological concentrations (10^-9M) of RA, the RARA-RXRA
heterodimer changes conformation and allows the binding of transcriptional activators and
histone acetyl transferases (HATs), and in turn activates gene transcription of target genes.
26
1.4.2.1 The Role of RXRA in Hematopoiesis
While the role of RARA in hematopoiesis is well characterized, the role of RXRs in myeloid cell
differentiation is not well understood beyond their function as obligatory heterodimerization
partners for RARs (Szanto et al., 2004). This is partially because of the complexity of the
system; different blood cell lineages express different nuclear receptors that heterodimerize with
RXRA, thus making the phenotype of RXRA deficient hematopoiesis difficult to analyze. The
other major problem is one of construction of the experimental system: The RXRA -/- mouse is
embryonic lethal at ED17.5 due to myocardial defects (Sucov et al., 1994) This is attributed to
the critical roles RXRA plays throughout the rest of the organism, though it renders it impossible
to study the role of RXRA in adult hematopoiesis. Several studies have identified a role for
RXRA in hematopoiesis (Benoit et al., 1999; Benoit et al., 2001a; Benoit et al., 2001b; Mehta et
al., 1996; Ricote et al., 2006; Shiohara et al., 1999; Taschner et al., 2007). Some studies, in
particular, are intriguing: Conditional knockout of RXRA in the hematopoietic compartment
(Ricote et al., 2006) did not lead to an abnormal hematopoietic phenotype in vivo, suggesting that
RXRA is not critical for normal adult hematopoiesis. However, down-regulation of RXRA is
essential for terminal neutrophil differentiation, as RXRA is highly expressed in
granulocyte/monocytes progenitors, and in terminally differentiated monocytes, but not in
mature granulocytes (Taschner et al., 2007). Furthermore, the ectopic over-expression of RXRA
in GM progenitors resulted in blocked neutrophil differentiation, while the expression of a
dominant negative form of RXRA did not impair neutrophil differentiation.
A number of studies have characterized the phenotype of RXRA mutant mice to elucidate the
role of rexinoid signaling during development. These studies have reported the use of both
complete knockouts as well as tissue specific, temporally regulated RXRA disruption in the
mice. Tissue specific functional knockout of RXRA was created to study RXRA effects
specifically in the ventricular chamber of the heart (Chen et al., 1998), in epidermal and hair
follicle keratinocytes (Li et al., 2001; Li et al., 2000) in thymocytes and T-lymphocytes
(Stephensen et al., 2007) and in hepatocytes (Imai et al., 2001). The mouse models used in these
studies all employ the cre-loxP strategy to generate tissue specific knockouts. We used this
system to selectively knock out RXRA in the hematopoietic compartment, using mice with exon
4 of RXRA flanked with loxP sites, also expressing cre under the Flk-1 promoter (Sukhai et al.,
2008). (Kastner et al., 1994) reported the use of RXRA null mice with a disruption in exon 4. A
27
similar report of a complete RXRA knockout using mice that lacked part of exon 3 (encoding
part of the DNA-binding domain) was also reported by (Sucov et al., 1994). Others have looked
at the role of other domains of the protein including the AF-1 (Mascrez et al., 2001), and AF-2
(Mascrez et al., 1998) using transgenic mice lacking these domains of RXRA. Compound
knockout mice exhibit a wider array of abnormalities, and are often embryonic lethal.
1.4.2.2 Retinoid signaling in APL and X-RARA effects on transcription
For a number of years, the prevailing hypothesis was that forced homo-dimerization of RARA
was responsible for the development of APL. PML-RARA is associated with nuclear complexes
that are much greater in apparent molecular weight than PML-RARA alone (Nervi et al., 1992).
Wild-type PML and RXRA were identified as some of the proteins associated with these
complexes (Nervi et al., 1992) It has been hypothesized that APL fusion proteins aberrantly
repress gene transcription and hence de-regulate genes important in myeloid differentiation,
resulting in the observed block in maturation (Melnick and Licht, 1999) (Figure 1.9). In many
cases, the differentiation block can be overcome by treatment with pharmacological doses of
ATRA (>10-7 M) (Melnick and Licht, 1999). The APL fusion proteins have altered DNA binding
properties (Chang et al., 1992) and can bind RAREs as homodimers (Perez et al., 1993) while
wild type RARA does not (Leid et al., 1992). The impaired ability of APL fusion proteins to
activate certain promoters used to be explained by their increased ability to bind corepressors
SMRT and N-CoR, thus requiring pharmacological doses of ATRA for dissociation. PML-
RARA acts as an aberrant transcriptional repressor on RA target genes by having a stronger
association with NCoR/SMRT. The mechanism responsible for the more stable recruitment of
NCoR/SMRT by PML-RARA (as opposed to wild-type RARA) is based on the presenceof a
strong self-association domain (Lin and Evans, 2000; Minucci et al., 2000). Oligomerization of
RARA through the coiled coil domain of PML is responsible for abnormal recruitment of
NCoR/SMRT (Lin and Evans, 2000; Minucci et al., 2000). In contrast with wild-type RARs,
which bind only one NCoR/SMRT molecule, it is thought that PML-RARA oligomers can
associate with multiple NCoR/SMRT complexes simultaneously (Lin and Evans, 2000; Minucci
et al., 2000). This results in increased local concentration of the HDAC complex on target gene
promoters, leading to enhanced transcriptional repression in the presence of physiological
concentrations of RA. Recent evidence also suggests that PML-RARA and PLZF-RARA can
recognize and bind to other splice variants of SMRT and NCoR that are not recognized by wild
type RARA (Mengeling et al., 2011). These data suggest that the acquired ability to interact with
28
alternative splice variants of NCoR and SMRT contributes to the oncogenicity of the APL fusion
proteins. The presence of RXRA in heterotetrameric complexes of APL fusions favored co-
repressor recruitment and binding, in stark contrast to wild type RARA-RXRA heterodimers
(Mengeling et al., 2011). In addition to release of co-repressors and stimulation of genes
responsible for myeloid differentiation, ATRA also acts to degrade the PML-RARA protein and
upregulate wild-type RARs to restore retinoid signaling.
29
Figure 1.9: X-RARA signaling in response to retinoic acid. The increased presence of co-
repressors and histone deacetylases on gene promoters results in continued target gene repression
in the presence of physiological ATRA concentrations. Higher doses of ATRA (10^-6 M) work
to dissociate co-repressor complexes and recruit co-activators to activate gene transcription from
fusion bound retinoid and non-retinoid target genes.
30
Much like PML-RARA, PLZF-RARA interacts with SMRT and N-CoR, resulting in
transcriptional repression at RAREs. Interestingly, PLZF-RARA may form repressor complexes
resistant to pharmacological concentrations of ATRA (Grignani et al., 1998; Guidez et al., 1998).
PLZF itself has the capacity to bind SMRT through its POZ domain, located in its N-terminus
and retained in the fusion protein (Hong et al., 1997); thus, PLZF-RARA homodimers can
potentially interact with four SMRT complexes (Grignani et al., 1998; Guidez et al., 1998; Hong
et al., 1997), two of which, by interacting with the N-terminal POZ domain of PLZF, cannot be
removed on ATRA treatment. Both PML-RARA and PLZF-RARA have an affinity for RA
comparable to that of wild-type RARA (Benedetti et al., 1997; Dong et al., 1996) and can bind to
RAREs as homodimers or multimeric complexes containing RXRA (Dong et al., 1996; Perez et
al., 1993). Strikingly, a cell line model expressing PLZF-RARA (the tetracycline-repressible
U937-PLZF-RARA line (Rice et al., 2009), is at least partially sensitive to ATRA treatment, an
observation that runs counter to the above model.
More recent evidence has uncovered additional details of transcriptional repression mediated by
X-RARA, which broaden the potential impact that the fusion has in the cell. PML-RARA binds a
wider range of DNA response elements in the genome than the retinoic acid response element
(RARE) (Kamashev et al., 2004). A number of these elements are required by other nuclear
hormone receptors in order to bind DNA. While RARA, as a heterodimer with RXRA, will only
bind DR2 and DR5 elements, PML-RARA has been shown to bind a range of direct repeat (DR),
everted repeat (ER) and inverted repeat (IR) sequences in vitro (Jansen et al., 1995; Kamashev et
al., 2004; Perez et al., 1993). Our group demonstrated this relaxed DNA binding specificity for
all X-RARA, specifically for the DR1 PPRE, as well as for NPM-RARA with DR3 and DR4
elements (Kamel-Reid et al., 2003); Hamadanizadeh SA, Kamel-Reid S, unpublished).
PML-RARA requires RXRA in its transcriptional complex (Kamashev et al., 2004), suggesting
that the fusion does not merely sequester RXRA away from its sites of action within the cell, but
instead forms a functional complex with it in order to have a more direct effect at the gene
expression level. PLZF-RARA/RXRA heterodimers bind to RAREs with higher affinity than
PLZF-RARA homodimers in vitro (Dong et al., 1996; Licht et al., 1996). Furthermore, PLZF-
RARA/RXRA heterodimers have the capacity to bind to non-consensus RAREs, thus suggesting
that these heterodimers contribute to APL pathogenesis through the regulation of novel gene
expression (Hauksdottir and Privalsky, 2001; So et al., 2000). STAT5b-RARA also requires
31
RXRA for strong association with HDAC complexes and transcriptional repression (Zeisig et al.,
2007). Our work further demonstrated that functional loss of RXRA resulted in an amelioration
of the NuMA-RARA-mediated leukemic phenotype in vivo (Sukhai et al., 2008). Similar results
were published for PML-RARA as well (Zhu et al., 2007).
NPM-RARA and NuMA-RARA can form heterodimeric complexes with RXRA; these
complexes are capable of binding to and repressing transcription from the RARE (Kamel-Reid et
al., 2003); Hamadanizadeh SA, Kamel-Reid S, unpublished). Like PML- and PLZF-RARA,
NPM-RARA expression enhances primitive marrow progenitor cell proliferation, while ATRA
treatment of NPM-RARA-expressing cells induces differentiation and inhibits cell growth (Du et
al., 1999).
1.4.2.3 Rexinoid signaling in APL pathogenesis
Recent studies have shed light on an increasingly important role for RXRA in APL pathogenesis.
X-RARA has the capability of forming homodimers, as reported for PML-RARA (Jansen et al.,
1995; Perez et al., 1993), PLZF-RARA (Grignani et al., 1998; Guidez et al., 1998) NPM-RARA
(Lin and Evans, 2000) and NuMA-RARA [(Dong et al., 2003); and our own work, unpublished].
In a previous study (Hummel et al., 2002), our lab showed that X-RARA can form heterodimers
with RXRA, as well as the wild-type X protein. Until very recently, this interaction was not
thought to be important in leukemogenesis. Recent reports, however, when taken together, allow
us to view the role of RXRA in APL, and more broadly, AML, from a novel perspective.
All APL fusions retain the RARA/RXRA dimerization interface found in wild-type RARA. A
physical interaction between X-RARA and RXRA is therefore expected, and indeed, observed,
for all fusions studied (Dong et al., 2004; Perez et al., 1993; Sukhai et al., 2008; Yamamoto et
al., 2010). For example, PML-RARA is associated with nuclear complexes that are much greater
in apparent molecular weight than PML-RARA alone (Nervi et al., 1992). Wild-type PML and
RXRA were identified as some of the proteins associated with these complexes (Perez et al.,
1993). Very recent analysis of genome wide binding sites of PML-RARA confirms the presence
of RXRA in 99% of PML-RARA binding sites (Martens et al., 2010). Furthermore, PLZF-
RARA can also bind to RAREs as homodimers or multimeric complexes containing RXRA
(Dong et al., 1997). Our previous studies demonstrated physical interaction between NPM- and
NuMA-RARA, and RXRA (Hummel et al., 2002). The latter finding was independently
corroborated in separate studies (Dong et al., 2003; Dong et al., 2004). This physical interaction
32
between X-RARA and RXRA was preserved after ATRA treatment, as one can follow the
mobilization of the X-RARA/RXRA complex within the cell after treatment with
pharmacological concentrations of RA (Dong et al., 2004). Studies have strongly implicated
RXRA as having a critical functional role in PML-RARA mediated transcriptional repression.
(Zeisig et al., 2007), and (Zhu et al., 2007) show that disrupting the binding between RXRA and
X-RARA by introducing mutations in RXR binding sites of PML-RARA, impairs the
development of leukemia in transgenic mice, while still being able to cause transformation in
vitro. Silencing RXRA using shRNA mediated knock-down completely abrogates the in vitro
transforming potential of the PML-RARA. These studies indicate that RXR plays an important
role in mediating PML-RARA mediated transformation.
1.4.2.4 Therapeutic potential of rexinoids
The basis of differentiation therapy is to force cells along the normal differentiation pathway
through the restoration/reactivation of signal transduction pathways that are otherwise
suppressed during tumour development. Guiding cells through the differentiation lineage will
eventually result in post-differentiation induced cell death. The APL fusion protein complex
consists of higher order hetero-oligomers with RXRA as described above. In addition to the
classically targeted RARA moiety, studies by two groups (Zeisig et al., 2007; Zhu et al., 2007)
have implicated RXRA as a potential therapeutic target. In APL blasts, RA can trigger a death
signaling cascade through the activation of IFN regulated factor-1, which is recruited to the
promoter elements of TRAIL, which along with Death Receptor 5 (DR5) and DR4, selectively
targets and kills tumour cells (Clarke et al., 2004). As a result of their lower toxicity profile
compared to retinoids, rexinoids are preferred as drug candidates (Altucci et al., 2007). A
characteristic feature of RXRs is the inability of RXR agonists to transactivate RAR-RXR
signaling when used as a single agent. This process referred to as “RXR subordination” only
allows RXR agonists to enhance the retinoid response initiated by an RAR agonist, and not to be
able to transactivate signaling from RAR-RXR heterodimers as a single agent (de Lera et al.,
2007). Altucci et al., demonstrated that corepressor complexes can be dissociated from APL
heterodimers when PKA is activated, thereby allowing rexinoids to induce transactivation of
gene expression through coactivator recruitment (Altucci et al., 2005). Benoit and colleagues
also showed that raising intracellular cAMP levels allows RXR ligands to induce differentiation
in APL cells that have developed RA resistance (Benoit et al., 1999). Despite RXR
subordination, rexinoids can act through different mechanisms to activate RXR signaling. In the
33
presence of increased cAMP levels, rexinoid signaling can induce differentiation and post
maturation cell death (Benoit et al., 1999). This is the case even in ATRA resistant AML cells,
suggesting that this mechanism of rexinoid activation is acting independently of retinoid
signaling. RXR agonists can however activate other signaling pathways, as RXR is known to
heterodimerize with other proteins including VDR and PPARγ (de Lera et al., 2007). Rexinoids
induce cell death in AML cells under reduced serum and growth factor conditions (Benoit et al.,
2001a). This signaling was shown to be mediated through rexinoid activation of permissive
RXR-PPARγ heterodimers (Indra et al., 2007; Shankaranarayanan et al., 2009). These studies
indicate that targeting rexinoid mediated pathways can result in the activation of one of two
cellular pathways: cellular differentiation, or cell death.
1.4.2.5 Targeting the oncogenic PML-RARA in APL therapy
Induction of cellular differentiation was classically thought to be the basis by which ATRA
therapy worked effectively in patients presenting with APL, as RA induces rapid differentiation
of primary blasts into terminally differentiated granulocytes (Breitman et al., 1981). Recent
observations have called for a re-evaluation of the importance of differentiation in mediating
treatment efficacy in APL. Arsenic trioxide (ATO) is a potent anti-leukemia therapy with
profound effects on APL cell clearance, even when administered as a single agent (Mathews et
al.; Mathews et al., 2006; Zhu et al., 2002). It does little to affect gene expression of PML-
RARA target genes (Shao et al., 1998; Wiese et al., 2001), but is very effective in the treatment
of relapsed APL cases. The oncogenic fusion PML-RARA exerts self-renewal and growth
properties on the leukemic cell, in addition to inducing a block in differentiation. In patients, RA
treatment alone is not effective in inducing complete remission unless combined with
chemotherapy (Warrell et al., 1993). Even though RA induces complete differentiation in most
cases of APL, only a small percentage of patients respond durably with RA when used as a
single agent (Hu et al., 1999). This suggests that the differentiation process alone does not induce
stable depletion of APL cells. In vivo, much higher concentrations of ATRA are required for
clearing APL cells, compared to smaller amounts used for inducing transcriptional activation
(Ablain and de The, 2011). Some patients only respond to liposomal ATRA formulations that
considerably increase RA levels in the blood (Tsimberidou et al., 2006). Also studies in mouse
models have shown that mutations in PML-RARA’s phosphorylation site S873, which modulates
its degradation, impaired disease remission, while differentiation induction by RA treatment
remained unaffected (Nasr et al., 2008) In the case of the RA resistant fusion PLZF-RARA, the
34
resistance was thought to result from a stronger repression of target genes by the fusion
(Grignani et al., 1998; He et al., 1998; Lin et al., 1998). Recent evidence indicates that PLZF-
RARA cells can fully differentiate upon RA treatment [(Nasr et al., 2008; Rice et al., 2009) and
our own unpublished observations]. These data suggest that the block in differentiation alone
may not be driving leukemogenesis and that only reversing this inhibition may be insufficient for
APL therapy.
In addition to blocked differentiation, PML-RARA was also shown to boost the self-renewal
properties of APL blasts (Welch et al., 2011). Although phenotypically they resemble committed
progenitors, mouse APL leukemic blasts have increased self-renewal, thereby indicating that
PML-RARA confers self-renewal properties to more differentiated progenitor cells. LICs have to
be targeted for tumour eradication, as their persistence after conventional therapy strongly
contributes to disease recurrence. APL is described as an oncogene-derived disease, where one
can expect that degradation of the oncogene would be sufficient to eradicate the disease. Both
retinoic acid and arsenic trioxide degrade PML-RARA. They are synergistic in their effects in
mouse models, as would be expected from the fact that they target the oncoprotein through two
different mechanisms. Loss of the fusion protein may also elicit spontaneous differentiation
(Ablain and de The, 2011). These observations indicate that differentiation block is not the result
of irreversible chromatin modifications induced by the APL fusions, and can be relieved by
removing the presence of the fusion.
1.4.3 Functions of PML and PML-RARA
The t(15;17) reciprocal balanced chromosomal translocation, characteristic of the vast majority
of APL cases, produces PML-RARA and RARA-PML fusion proteins. PML-RARA is the main
oncogenic APL fusion with the ability to transform hematopoietic progenitors (de The and Chen,
2010; Piazza et al., 2001). While PML-RARA mediates transcriptional repression by suppressing
retinoid signaling as discussed previously and blocks differentiation, it is also known to disrupt
PML nuclear bodies (PML-NBs) through PML-RARA interaction with wild type PML (de The
and Chen, 2010; Piazza et al., 2001). The PML moiety in PML-RARA is thought to function by
promoting the formation of fusion multimers which contribute to transformation (Minucci et al.,
2000). However, it is also known that the loss of PML expression increases the penetrance and
latency of leukemia in APL mouse models, indicating that PML mediated functional pathways
play a role in disease pathogenesis. PML expression is also lost in some solid tumours including
35
prostate adenocarcinomas, colon adenocarcinomas, breast carcinomas and lung carcinomas
(Gurrieri et al., 2004), as well as in other hematological malignancies, including 83% of diffuse
large cell lymphomas (DLCL) and 77% of follicular lymphomas (Gurrieri et al., 2004).
We will review the contribution of wild type PML, as well as PML-RARA, to cellular
transformation through deregulating pathways involved in cellular survival, apoptosis, and self-
renewal.
1.4.3.1 PML functions in cellular growth and apoptosis.
PML interacts with a wide range of protein targets, however the physiological role of many of
these interactions have not be firmly established in vivo. In the following sections, a brief
overview of PML’s biological role that implicates it in oncogenesis will be surveyed. PML’s role
as a tumour suppressor works through multiple mechanisms including the control of key factors
involved in modulating the cell death response, regulation of protein synthesis, maintenance of
genome stability, and modulating cell cycle regulation.
PML has been thought to be involved in regulation of growth suppressive signals. Studies have
implicated PML in maintaining cellular senescence and programmed cell death. PML was shown
to mediate apoptosis induced by FAS ligand (FASL) and TNFα (Guardiola-Serrano et al., 2010).
Lymphocytes lacking PML have decreased cell death in response to FasL treatment (Wang et al.,
1998). PML is also known to potentiate cell death through interferon alpha, by inducing
production of TRAIL in cancer cells (Ashkenazi, 2008; Falschlehner et al., 2009; Gurrieri et al.,
2004; Schneider-Jakob et al., 2010) .
PML’s interaction with pro-apoptotic transcription factors also plays a role in regulating cell
death. PML regulates p53 tumour suppressor degradation (through inhibition of Mdm2, which is
the E3 ubiquitin ligase for p53) (Bernardi et al., 2004; Kurki et al., 2003). PML also promotes
p53 post translational modifications including p53 acetylation (Pearson et al., 2000) and
phosphorylation (Hofmann and Will, 2003). PML regulates the PI3K pathway at multiple levels
(Ito et al., 2009) (Song et al., 2008) (Trotman et al., 2007), as well as the TGFβ pathway (Lin et
al., 2004), both of which have pro-neoplastic effects.
Studies have implicated the regulation of transcription as a key step in tumourigenesis (Ruggero
and Pandolfi, 2003). PML can interact with the eukaryotic initiation factor (eIF4E), and inhibits
36
its function in mRNA export. This affects expression of cell cycle regulators targets such as
cyclin D1, and further results in decreased proliferative capacity (Cohen et al., 2001).
1.4.3.2 PML-RARA and self-renewal
X-RARA fusion proteins block terminal differentiation and increase the self-renewal capability
of X-RARA expressing cells (Puccetti and Ruthardt, 2004). The activation of Wnt signaling is
one mechanism by which X-RARA may increase self-renewal (Muller-Tidow et al., 2004).
Gamma and beta-catenin are increased transcriptionally and this allows for Wnt signaling
activation by X-RARA. (Steinert et al., 2011) show that derivatives of the drug Sundilac down-
regulated key components of the Wnt signaling network in APL cells through down-regulation
of beta-catenin and gamma-catenin. Sundilac is known to be used as a type of non-steroidal anti-
inflammatory agent, which inhibits Wnt signaling in tumour models (Boon et al., 2004).
(Welch et al., 2011) developed a mouse model expressing PML-RARA under the control of the
endogenous mouse PML promoter, specifically in the myeloid compartment. They utilized this
model to investigate the effects of PML-RARA on hematopoiesis after the acquisition of the
oncogenic fusion protein as a somatic event in these mice. They reported that PML-RARA
increased hematopoietic self-renewal as they observed that bone marrow CFU’s from these mice
could be replated for 6 or more weeks. Also of note was the progressive accumulation of cells
expressing PML-RARA in the bone marrow, without evidence of myeloproliferation. This
suggested that PML-RARA alters self-renewal in hematopoietic precursors without altering the
bone marrow cellular feedback mechanisms that regulate the size of the myeloid compartment.
Their work also showed that PML-RARA cannot reprogram late myeloid cells to self-renew, but
instead that deregulation of self-renewal is induced in early hematopoietic cells. Taken together,
(Welch et al., 2011) demonstrated that PML-RARA affects multipotent progenitor populations,
rather than the more committed myeloid progenitors, which were thought to be the cell of origin
according to the established paradigm (Bonnet and Dick, 1997; Guibal et al., 2009; Turhan et al.,
1995; Wojiski et al., 2009). It has been suggested that the maturation defect in APL is a
cooperating event during development, or that mutations in genes specifically expressed in the
myeloid compartment contributed to the differentiation block. This is in contrast to other work
from (Wojiski et al., 2009) which used an older model of PML-RARA expressed under the
mouse cathepsin G promoter, where PML-RARA was able to confer self-renewal properties to
committed progenitors or leukemic promyelocytes. The discrepancies in the two studies most
37
likely stem from differences inherent in the two mouse models. These studies support a role for
PML-RARA in promoting self-renewal and show this to be an important step in the pathogenesis
of APL.
1.4.3.3 PML-RARA and apoptosis
(Tao et al., 2011) showed that the wild type PML binds to Fas, which is a potent death receptor.
Disabling mutations in Fas have been reported in a minority of cancers. Deregulated expression
of mediators of Fas death signaling has also been described in various cancers including lung and
colon (Pitti et al., 1998). Defective Fas signaling has been implicated in resistance to therapy, as
intact signals are required for effective function of many genotoxic therapies including radiation
(Muller et al., 1998). PML-RARA was found to suppress Fas-mediated signaling and apoptosis.
Both PML and PML-RARA were identified to directly interact with Fas in APL cell lines and
primary blasts (Tao et al., 2011). PML-RARA after binding to Fas interferes with Fas mediated
apoptosis by recruiting cFLIP and forming an inhibitory complex. cFLIP recruitment blocks the
initiation of Fas mediated apoptotic signaling by inhibiting the binding and activation of pro-
caspases to the complex. PML-RARA also is known to block both p53- dependent and p53
independent pathways of cell death (Wang et al., 1998) and is thought to be mediated through
PML-RARA effects on transcriptional repression (Guo et al., 2000). We investigated PML-
RARA and the variant fusions ability to interfere with the TNFα and NF-κB mediated survival
signaling in an effort to understand the role of the fusions in promoting cellular survival (Chapter
2).
1.4.4 Functions of NPM and NPM-RARA
1.4.4.1 NPM: Structure and expression
Nucleophosmin (NPM, B23, NO38, numatrin) is an abundant nucleolar phosphoprotein, ~37
kDa in size present in the granular region of the nucleolus (Kang et al., 1975). Two isoforms of
NPM have been reported – a longer 294-amino-acid variant, prevalent in all tissues and localized
to the nucleolus (Chan et al., 1989); and a shorter 259-amino-acid isoform, differing at the C-
terminus, present in both nucleoplasm and cytoplasm (Colombo et al., 2006; Dalenc et al., 2002).
Several functional domains have been identified in NPM: An N-terminal hydrophobic segment
(involved in oligomerization and chaperone activities); and two acidic sections (essential for
histone binding). The central portion between the acidic segments and the C-terminal region are
38
involved in nucleic-acid binding and ribonuclease activity (Hingorani et al., 2000). Two
tryptophan residues (288 and 290) are necessary for NPM nucleolar localization (Nishimura et
al., 2002). The NPMc cytoplasmic mutant, found in ~40% of normal karyotype AML, carries a
frameshift mutation in exon 12 that disrupts this nucleolar localization signal (Falini et al.,
2005).
NPM also contains nuclear localization (Hingorani et al., 2000) (NLS; Hingorani 2000) and
nuclear export signals (NES; (Wang et al., 2005). The wide range of protein interacting domains
within NPM enables it to bind a number of partners in different compartments within the cell,
including transcription factors (IRF1, NF-κB), nucleolar proteins (nucleolin, fibrillarin), histones
(H3, H4), proteins associated with proliferation (DNA polymerase-α), and mitosis (NuMA,
NEK2A). NPM undergoes dynamic changes over the course of the cell cycle. NPM expression
peaks at S or G2 phases of the cell cycle and is at minimal levels in G0 (Feuerstein et al., 1988a;
Feuerstein et al., 1988b; Feuerstein et al., 1988c). This might be related to the fact that NPM
specifically stimulates the activity of DNA polymerase α (Takemura et al., 1994) or may simply
be a reflection of the metabolic demand of the cell. During G2 and M phase, NPM is heavily
phosphorylated by CDC2 (Peter et al., 1990). The fact that NPM is intimately involved in events
taking place at the G2/M regulatory point also underlines the strong relation between NPM and
cellular proliferation.
NPM is thought to have roles in cellular transformation, growth and proliferation. NPM is
commonly over-expressed in a variety of tumours including gastric, colon, ovarian and prostate
carcinomas (Bernard et al., 2003; Nozawa et al., 1996; Skaar et al., 1998; Subong et al., 1999;
Tsui et al., 2004), and is involved in chromosomal translocations, or deleted in various tumours
and hematological malignancies including APL (Redner et al., 1996), Anaplastic Large Cell
Lymphoma (ALCL) (Morris et al., 1994) Myelodysplastic syndrome (MDS) (Yoneda-Kato et
al., 1996) and AML (Mendes-da-Silva et al., 2000; Olney et al., 2002). Close to 40% of acute
myeloid leukemia patients also harbour mutations in NPM, making it one of the most frequently
mutated genes in AML (Falini et al., 2005).
1.4.4.2 NPM in hematological malignancies
Unlike the other RARA partner genes, NPM is also fused to genes other than RARA in
hematologic malignancies, as in the t(2;5)(p23;q35) translocation found in Ki-1+ anaplastic large
39
cell lymphoma (Morris et al., 1994). Here, NPM is linked to ALK, a gene encoding a membrane
spanning tyrosine kinase (Morris et al., 1994; Nakamura et al., 1997) which is normally not
expressed in lymphoid tissue. (Downing et al., 1995; Morris et al., 1994; Nakamura et al., 1997).
As a result, the ubiquitously expressed NPM drives the expression of an aberrant fusion tyrosine
kinase (Bischof et al., 1997; Shiota et al., 1994). Moreover, the NPM portion of NPM-ALK has
been shown to be essential for its role in oncogenesis (Bischof et al., 1997). Cases of
myelodysplastic syndrome and a subset of AML have also been shown to be associated with a
t(3;5)(q25;q35) translocation that fuses NPM to myelodysplasia/myeloid leukemia factor (MLF-
1) (Yoneda-Kato et al., 1996), although little is known about this fusion protein.
NPM mutations have also been found to be associated with ~40% of AMLs with normal
karyotype. These mutations lie within exon 12 of NPM, thus introducing a nuclear export signal
and rendering the protein cytoplasmic (NPMc). Mutational status of NPM is now an important
diagnostic and prognostic marker in AML with a normal karyotype, along with FLT3 status.
NPM mutations in AML occur in an age-dependent fashion and are stable over disease evolution
(Chou et al., 2006). NPM mutation status can therefore be used as a marker of disease remission.
The copy number of mutant NPM predicted relapse in AML It has emerged as an important
prognostic indicator in NPM mutant AML. Patients achieving greatest reduction in mutant NPM
copy number were associated with better outcome (Gorello et al., 2006). NPMc mutations are
infrequent in chronic myeloid disorders, but were found in 3 CMML patients progressing to
AML (Caudill et al., 2006). Furthermore, haploinsufficiency of NPM (e.g., through
chromosomal rearrangement) may play a role in some AML and in MDS (Berger et al., 2006).
NPMc+ AML also bears a distinct gene expression signature, separate from other AMLs,
characterized by upregulation of genes involved in regulation of the stem cell compartment
(Alcalay et al., 2005).
1.4.4.3 Oncogenic roles of NPM
NPM over-expression results in increased growth and proliferation. Normal NPM expression
levels are tightly correlated with proliferation. Highly proliferative cells show increased
expression of NPM compared to quiescent cells (Dergunova et al., 2002). NPM’s role in
proliferation is through various mechanisms including the following: NPM is a target gene of the
proto-oncogene Myc (Boon et al., 2001; Zeller et al., 2001); NPM is correlated with stimulation
of DNA polymerase activity (Takemura et al., 1999); also, cells deficient in NPM1 exhibit
40
impaired proliferation and induction of apoptosis when the nuclear-cytoplasmic shuttling of
NPM is inhibited (Brady et al., 2004; Grisendi and Pandolfi, 2005)
NPM expression is increased in proliferating and malignant cells (Borer et al., 1989), (Chan et
al., 1989) including leukemic blasts. This may influence protein synthesis through NPM’s roles
in ribosome biogenesis, although this is not well-defined within the literature. Our data indicates
that increased NPM protein levels are associated with increased ribosomal RNA levels in APL.
Interestingly, under hypoxic conditions, HIF1α is an activator of NPM expression (Li et al.,
2004) . This may be due to an increased requirement for ribosomal precursors (Derenzini et al.,
1995; Kondo et al., 1997). Down-regulation of NPM delayed entry into mitosis (Jiang and Yung,
1999) suggesting that NPM may have an active role in growth control. In support of this concept,
NPM binds to the tumor suppressor IRF-1, inhibiting its anti-proliferative effects (Kondo et al.,
1997). Finally, NPM is implicated in initiating the DNA damage response, as it binds to
damaged chromatin during initiation of this process (Lee et al., 2005). Interestingly, Npm-/- mice
are embryonic lethal (ED11.5), due to defects in hematopoiesis and organ development. Npm-/-
cells have significant mitotic and centrosomal defects, chromosome copy number alterations, and
cannot properly respond to genotoxic signals. Npm+/- mice are viable at birth, but develop a
myelodysplastic syndrome (Grisendi et al., 2005). Thus, there may be a strong requirement for
NPM in proper cellular function, and in hematopoietic development. Over-expression of NPM
enhances the proliferative potential of hematopoietic stem cells (HSC), and promotes self-
renewal of long-term repopulating HSCs. Over-expression of NPM also promotes survival after
DNA damage, oxidative stress and hematopoietic injury (Li et al., 2006a).
1.4.4.4 NPM as a tumour suppressor
Translocations involving NPM1 or mutations in NPM are commonly found in leukemias, and
lead to the loss of one functional copy of NPM. Phenotyping of mice with NPM knockouts has
indicated that NPM is required for genome stability. NPM interaction with ARF is essential for
its contribution to growth suppressive effects. NPM associates with Arf in the nucleolus. ARF
inhibits MDM2, resulting in p53 activation and therefore suppression of cell proliferation.
Therefore loss of NPM can also promote tumourigenesis.
Increased expression of NPM leads to accumulation of ARF by preventing its turnover and
increasing its stability. Arf is responsible for triggering cell cycle arrest and apoptotic programs
41
in response to oncogenic stimuli. ARF also negatively regulates ribosomal RNA processing.
ARF inhibits MDM2, which is a negative regulator of p53, by relocalizing it to the nucleolus
(Weber et al., 1999). ARF mutants that are unable to associate with NPM have decreased protein
stability and function (Kuo et al., 2004). Loss of NPM function can promote tumourigenesis
through destabilizing and inactivating ARF, and as a result deregulating cell proliferation
through p53-dependent and independent mechanisms (Sherr, 2001). It has been proposed that
when NPM is over-expressed, it sequesters ARF in the nucleolus (Korgaonkar et al., 2005). It
remains unknown if ARF bound to NPM can interact with MDM2. If this is possible then it has
been suggested that NPM’s ability to stabilize ARF would be tumour suppressive.
NPM and ARF regulation has also been studied in NPMc+ AML. All NPM1 alleles that are
mutated encode proteins with an added nuclear export signal motif (Nakagawa et al., 2005), and
lose at least one of the 2 tryptophan residues at positions 288 and 290 – these are thought to be
important for nucleolar localization of NPM (Falini et al., 2005). NPMc+ also can interact with
ARF and results in its cytoplasmic relocalization. This reduces SUMOylation of MDM2, and
reduces ARF dependent p53 activation. Also, wild type NPM is also delocalized to the
cytoplasm, which affects its ability to inhibit ARF turnover. Cells with NPMc+ mutation may be
characterized by inactivation of the ARF tumour suppressor pathway. Analysing its effects on
the cells and function of mutant NPM, it is clear that this gene belongs to the class of proteins
with both tumour suppressive and oncogenic functions.
1.4.4.5 NPM in ribosome biogenesis
Ribosome biogenesis is an integral part of cellular growth. Approximately half of the cellular
energy reserve is directed towards ribosome biogenesis (Moss, 2004). Since the early 1960s the
nucleolus was recognized as the site for ribosomal DNA transcription and ribosome biogenesis
(Birnstiel et al., 1963), (Ritossa and Spiegelman, 1965). The nucleolus is comprised of three
distinct regions based on ultrastructural morphology: fibrillar centers, dense fibrillar
compartment, and granular zone. Transcription of rDNA occurs in the regions between the
fibrillar centers and dense fibrillar components, while the transcribed rRNA is processed in the
dense fibrillar component. The granular regions further process the rRNA and assemble them
into specific ribosomal subunits (Hernandez-Verdun and Roussel, 2003). NPM has been
implicated in the processing and assembly of ribosomes. The specific localization of the long
isoform of NPM (B23.1) to the granular region of the nucleolus correlates with its function in
42
transcribing ribosomal DNA (Murano et al., 2008), and processing pre-rRNA (Savkur and
Olson, 1998). Decreased NPM expression has been shown to inhibit processing of pre-rRNA.
Increased NPM expression can disrupt ribosomal rRNA synthesis by leading to sustained
ribosome activation and increased protein synthesis, both of which are found in cancer cells
(Roussel and Hernandez-Verdun, 1994). Cancer cells have been reported to have enlarged
nucleoli, which lends support to the fact that sustained ribosome activity supports aberrant cell
growth.
The ARF tumour suppressor is another protein that localizes to the nucleolus, where it integrates
growth signals to suppress cellular growth and proliferation. ARF also binds and affects the
function of NPM (Bertwistle et al., 2004; Brady et al., 2004; Itahana et al., 2003) . Arf knock out
mice have significant changes in nucleolar morphology, and displayed increased ribosomal
biogenesis (Apicelli et al., 2008). Interestingly, this increase in ribosome biogenesis that was
associated with the loss of Arf was found to be reversible upon removal of NPM. This indicates
that increased amounts of free cellular NPM (not tethered to Arf) can promote ribosome
biogenesis. This study demonstrates that the NPM-ARF interaction is functionally important in
controlling ribosome biogenesis and protein synthesis rates within cells.
1.4.4.6 NPM in survival and apoptosis.
Over-expression of NPM promotes cell survival through inhibition of pro-apoptotic pathways –
IRF1 DNA binding is inhibited; NPM binds and inhibits function of eukaryotic initiation factor 2
kinase PKR; DNA fragmentation activity of caspase activated DNAse (CAD) in neural cells is
inhibited; and, p53 activation is inhibited by interaction in response to apoptotic stimuli. All of
this works to suppress the pro-apoptotic machinery within the cells.
Over-expression of NPM in tumor cells is also associated with increased cell growth and
proliferation, and inhibition of differentiation and apoptosis (Grisendi et al., 2005). Knocking
down NPM expression induces cell death (Itahana et al., 2003; Ye, 2005). NPM is up-regulated
in normal cells upon exposure to different types of apoptotic stimuli, leading to a survival
response (Grisendi et al., 2005). Under conditions of cellular stress, NPM translocates from the
nucleolus to the cytoplasm and/or nucleoplasm. Stimuli capable of inducing this response
include cytotoxic drugs and intercalating agents such as daunorubicin (Milligan 2006), inhibitors
of RNA polymerase I and II, and UV irradiation (Bor et al., 1992; Chan, 1992; Chan et al., 1987;
Kurki et al., 2004; Yung et al., 1990). NPM translocation may impair apoptosis by inhibiting
43
caspases and nucleases or by regulating tumor suppressors such as ARF and p53 (Ye, 2005),
(Korgaonkar et al., 2005). NPM mediates the anti-apoptotic activity of nerve growth factor
(NGF) by acting as a receptor for nuclear phosphatidylinositol (3, 4, 5)-triphosphate (PIP3) in
NGF-treated PC12 cells. The nuclear NPM-PIP3 complex inhibits the DNA fragmentation
activity of caspase-activated DNAse (CAD) (Ahn et al., 2005; Grisendi et al., 2006), and
contributes to the survival activity of NGF. Overall, deregulated NPM may promote
tumourigenesis (Ahn et al., 2005), partially by its anti-apoptotic functions.
NPM functions have also been linked to cell proliferation in response to mitogenic stimuli and
cell cycle progression. Indirectly, NPM can function as anti-apoptotic protein – malignant cells
with NPM over-expression can have suppressed activity of IRF1, which is a transcription factor
and tumour suppressor, involved in DNA damage induced apoptosis (Kondo et al., 1997). NPM
was also found to suppress apoptosis through the inhibition of the double stranded RNA
dependant protein kinase (PKR), which is a factor that induces apoptosis in response to various
stimuli (Pang et al., 2003). Hematopoietic cells with NPM over-expression can exhibit defective
PKR activity as over-expressed NPM directly interacts with it, which can result in abnormal
proliferation and survival.
44
1.4.4.7 NPM-RARA in APL
The t(5;17) chromosomal translocation results in the formation of the NPM-RARA
fusion protein. Phenotypically, NPM-RARA expressing blasts are very similar to the
more commonly occurring PML-RARA expressing APL. These leukemic blasts are also
sensitive to differentiation induced by ATRA. One case of NPM-RARA associated APL
which showed evidence of disease relapse also responded favourably multiple times with
ATO based therapy (Chen et al., 2010).
Alternative splicing results in the creation of two isoforms of the NPM-RARA fusion
protein: NPMs-RARA containing 110 amino acids of NPM; and NPMl-RARA
containing an additional 43 amino acids (Nicci et al., 2005; Redner et al., 2000). Redner
et al. first described this fusion in APL (Redner et al., 1996); our group has since then
reported another case of this fusion, followed by other studies. Subsequent case reports
describing NPM-RARA expressing APL, including our report only describe the presence
of the shorter NPM-RARA transcript (Grimwade et al., 2000; Hummel et al., 1999; Xu et
al., 2001).(Redner et al., 2000) demonstrate that both forms of NPM-RARA interact with
RAREs as homodimers or heterodimers with RXRA. Similar to PML-RARA, NPM-
RARA also binds corepressors and coactivators that respond to retinoic acid. Studies
from our lab have shown that NPM-RARA, in addition to repressing wild type retinoid
signaling can also mediate its effects in APL by interfering with other signaling
pathways. One such pathway is the peroxisome proliferator-activated receptor gamma
(PPARγ) signaling pathway. The ability of NPM-RARA to alter PPARγ signaling was
tested using the PPARγ specific agonist Troglitazone. While control cells exhibited no
death response to Troglitazone, the presence of NPM-RARA sensitized the pro-
monocytic U937 line and resulted in inhibition of cell growth and induction of apoptosis
(Kamel-Reid et al., 2003). Furthermore, NPM-RARA was also shown to bind the PPRE
as a heterodimer with RXRA, and thereby block normal PPARγ signaling induced by
Troglitazone.
45
1.4.5 Functions of NuMA and NuMA-RARA
1.4.5.1 NuMA structure, and roles in the cell
NuMA is a large (~240 kDa), nuclear phosphoprotein first observed in a human/hamster
somatic cell hybrid where it strongly associated with the mitotic spindle (Lydersen and
Pettijohn, 1980). Using the changes in the subcellular localization patterns of NuMA
during various stages of the cell cycle, several groups have identified its diverse role
within cells. In interphase cells NuMA is localized in diffuse and speckled nuclear
patterns (Kallajoki et al., 1991; Compton et al., 1992) and is associated with the nuclear
matrix (Zeng et al., 1994). During metaphase, NuMA accumulates in a crescent-shaped
pattern that parallels that of the spindle poles (Tang et al., 1994) and then is released in
late telophase for transportation to the nuclei of daughter cells (Compton et al., 1992; Hsu
and Yeh, 1996; Kallajoki et al., 1991; Wiese et al., 2001). Drosophila Mud is an
orthologue of NuMA and Lin-5 (Siller et al., 2006), and coordinates spindle orientation
and promotes asymmetric cell division. Mud is required for neuroblasts to align with the
polarity axis during development; loss of Mud leads to symmetric cell division, mis-
specification of cell fate, and tumor-like proliferation of cells (Bowman et al., 2006). It is
reasonable to hypothesize that NuMA may likewise play a role in asymmetric cell
division during development and differentiation in the mouse and human. Such a role
offers intriguing possibilities in terms of the ability of the NuMA-RARA fusion protein
to block differentiation during neutrophil development, and to foster self-renewal in a
leukemia initiating cell. Interestingly, NuMA is differentially overexpressed in leukemic
cells and is significantly associated with complex karyotypic abnormalities (Ota et al.,
2003). Overexpression of NuMA in mouse myeloid cell cultures leads to aneuploidy, cell
cycle arrest and apoptosis (Ota et al., 2003).
1.4.5.2 NuMA-RARA in APL
Like most patients that have PML-RARA positive APL, the 6 month old infant in whom
NuMA-RARA was first identified also responded fully to treatment with ATRA (Wells et
al., 1997) . NuMA-RARA is therefore another ATRA sensitive variant of APL. Since the
identification and characterization of the t(11;17)(q13;q21) NuMA-RARA fusion, our
46
laboratory has described a transgenic mouse model (hCG-NuMA-RARA) of APL. Mice
carrying the NuMA-RARA transgene developed a myeloproliferative disease like
myeloid leukemia with promyelocytic features, with a phenotype similar to the original
patient (Sukhai et al., 2004). The disease development and latency is inversely correlated
with NuMA-RARA fusion copy number in mice (Sukhai et al., 2011).
X-RARA have the capability of forming homodimers, as reported for PML-
RARA (Jansen et al., 1995); (Perez et al., 1993), PLZF-RARA (Grignani et al., 1998);
(Guidez et al., 1998), NPM-RARA (Lin and Evans, 2000), and NuMA-RARA (Dong et
al., 2003); and our own work, unpublished), X-RARA also have the ability to form
heterodimers with RXRA, and the wild-type X protein (Hummel et al., 2002). In order to
further examine the role of RXRA in NuMA-RARA pathogenesis, we created a
functional knockout of RXRA within the transgenic NuMA-RARA mouse model. The
resulting mice expressed the oncogenic fusion protein and a functionally inert version of
RXRA that lacked the DNA binding domain. Upon characterizing this model, we
demonstrated that functional loss of RXRA resulted in an amelioration of the NuMA-
RARA-mediated leukemic phenotype in vivo (Sukhai et al., 2008). This also suggested
that the RXR molecule is an important part of the NuMA-RARA complex on the DNA
and is required for the development of leukemia.
In addition to impairing retinoid/rexinoid signaling in APL, other work has also described
NuMA-RARA and its effects in other cellular signaling networks. The effect of NuMA-
RARA on the transcriptional activity of the oncogene STAT3 has been elucidated (Dong
and Tweardy, 2002). Similar to PML-RARA, PLZF-RARA and STAT5b-RARA,
NuMA-RARA has the ability to enhance the transcriptional activity of STAT3. These
results are the first indication that APL fusion proteins may disrupt additional signaling
pathways within the cell that are not directly related to RAR or RXR signaling.
47
1.5 Secondary genetic events in APL
Several transgenic mouse models of APL have been developed over the years, and
extensive work in this area has been done to identify the in vivo role of various fusion
proteins in APL biology. Transgenic mice expressing NPM-RARA (Cheng et al., 1999),
(Rego et al., 2006), PML-RARA (Grisolano et al., 1997), (Welch et al., 2011), PLZF-
RARA (He et al., 1998), (Cheng et al., 1999), and NuMA-RARA (Sukhai et al., 2011;
Sukhai et al., 2008; Sukhai et al., 2004) have been generated to express the specific
fusion protein in the myeloid/promyelocytic compartment of mouse bone marrow.
Various improvements to the APL model have been made, the most recent one being the
introduction of PML-RARA knocked-in to the mouse PML promoter in order to more
closely resemble the background of the human APL cell, and mimic the acquisition of the
fusion as a somatic event leading to the transformation of the cells. A common feature of
all models thus far is the long latency to leukemia development, thus strongly suggesting
the presence of secondary genetic events that cooperate with the fusion to give rise to
leukemia. Analysis of human APL patient blasts, as well as leukemic mice to identify
additional mutations and gene/pathway deregulation has been traditionally used in order
to identify relevant secondary events. More recent efforts have also focused on high
throughput gene expression arrays and whole genome sequencing to determine
deregulated or mutated genes and pathways that can contribute to disease development.
The following sections describe these candidate gene and whole genome based
approaches and their findings.
1.5.1 Candidate gene alterations as approaches to elucidate secondary genetic events in APL
Analysis of transgenic and knock-in models of APL expressing PML-RARA show
leukemia development only after a long latency, indicating that while PML-RARA is
necessary, it is not sufficient to induce a leukemia (Pollock et al., 2001), (Grisolano et al.,
1997; Westervelt et al., 2003). Candidate gene studies have targeted genes and pathways
for analysis as potential cooperating events, based either on their appearance in APL
patient cells (e.g. FLT3, K-ras), or their characteristic as biologically relevant pathways
48
in transformation and leukemogenesis e.g. BCL2 and PIM2 (apoptosis), and DNMT3A1
(epigenetic modifiers).
Mutations that lead to the constitutive activation of K-Ras or FLT3 shorten the latency
and increase the penetrance of leukemia development in PML-RARA (Chan et al., 2006;
Sohal et al., 2003). These mutations are also found in APL patients (Callens et al., 2005;
Kiyoi et al., 1997), (Longo et al., 1993). Kelly et al. (2002) showed that introduction of
FLT3 ITD in bone marrow from PML-RARA mice resulted in a short latency disease like
APL that resembles that which the single transgenic PML-RARA mice develop after a
long latency. FLT3 is mutated in about 40% of human APL, and FLT3 ITD induces
myeloproliferative disease in a mouse model (Kelly et al., 2002). While not sufficient to
induce AML in mouse models, Kelly and colleagues demonstrated that FLT3-ITD
cooperates with PML-RARA to induce an APL-like disease. Chan et al. 2006 report the
cooperation between oncogenic K-Ras and PML-RARA in APL development in mice.
Oncogenic K-Ras mutations are observed in 4-10% of APL patients; in PML-RARA
transgenic mice, mutant K-Ras was thought to trigger proliferative and cell survival
signals that cooperate with the fusion in causing an APL-like phenotype with increased
penetrance and decreased latency.
In addition to these activating mutations, alterations in epigenetic modifications may also
result in enhancing PML-RARA induced leukemia. DNA methylation, histone
methylation, and histone acetylation have recently been associated with APL target genes
(Martens et al., 2010). Further, a recent study by Subramanyam et al., (2011) looked at
the contribution of epigenetic modifiers such as DNMT3, which also physically interact
with PML-RARA as part of a complex within the nucleus. PML-RARA recruits DNA
methyltransferases (DNMTs) to target promoters and this causes methylation of CpG
islands and repression of transcription in APL cells (Di Croce et al., 2002).
(Subramanyam et al., 2011) tested the ability of Dnmt3a1 to cooperate with the PML-
RARA fusion to induce APL. They found that over-expression of Dnmt3a1 shortened
survival of transgenic PML-RARA mice. Bone marrow transplant assays demonstrated
that mice recipient of bone marrow over-expressing PML-RARA and Dnmt3a1
developed leukemia with shorter latencies than PML-RARA donor mice. This indicated
49
that over-expression of Dnmt3a cooperates with PML-RARA in enhancing the
development of leukemia.
PIM2 belongs to a family of serine threonine kinases that are expressed in the
hematopoietic system (White, 2003). PIM2 functions to phosphorylate BAD and reverse
its apoptotic effects, and thereby has anti-apoptotic effects on the cell (Yan et al., 2003),
(Fox et al., 2003). PIM2 is a transcriptional target of FLT3-ITD, which is an alteration
that occurs in 30% of APL patients and induces transformation both in vitro and in vivo.
STAT5 activates transcription of PIM2 after signaling through FLT3-ITD (Mizuki et al.,
2003). While Pim2 overexpression alone does not result in hematological malignancies, it
was found to cooperate with other partially transforming FLT3 mutants to promote
transformation (Agrawal et al., 2008). PIM2 kinase is upregulated in AML blasts and
primary APL cells, in comparison to normal CD34+ cells. PML-RARA expressing bone
marrow cells infected with PIM2 retrovirus and transplanted into lethally irradiated
recipients, resulted in an APL like disease in ~64% of mice, while none of the control
transplanted mice showed evidence of disease. Cells from these primary recipients caused
a leukemia when harvested and introduced into secondary and tertiary transplant mice.
(Agrawal-Singh et al., 2011) also note that expansion of Pim2 PML-RARA cells did not
occur until a short period prior to the development of leukemia, suggesting that Pim2
over-expression does not induce a rapid polyclonal expansion of leukemic cells.
It is also known that the fusion confers increased resistance to apoptosis in myeloid cell
lines (Fu et al., 1995; Grignani et al., 1993), and enhances survival in primary myeloid
cells in response to pro-apoptotic stimuli (Wang et al., 1998). These observations led
groups to investigate candidate proteins in pathways controlling cellular apoptosis, as
drivers of leukemia and cooperating events in APL. Accordingly, BCL2, which functions
to inhibit caspases and thereby negatively regulate apoptosis was investigated in the
context of promoting leukemogenesis in the PML-RARA mouse model background.
Kogan and colleagues (2001) observed that simultaneous expression of Bcl2 and PML-
RARA lead to a marked accumulation of myeloid cells in mice, and accelerated the
development of acute leukemia in the PML-RARA mouse model.
50
1.5.2 Whole genome approaches to determining secondary events
Candidate gene based approaches to determine secondary genetic events are limited in
their comprehensiveness, and their ability to use an unbiased approach to identify
biologically relevant, and functionally important drivers of APL pathogenesis. Genetic
changes that accompany progression of leukemia can be characterized directly using
cytogenetics, and or DNA sequencing (Ding et al., 2012; Ley et al., 2010), or indirectly
by studying the gene expression profiles of leukemic cells (Golub et al., 1999). This
approach has been useful in distinguishing between different types of leukemia, and
developing markers of specific mutations, however it is more challenging to identify
mutations that contribute to disease initiation and progression, and leukemic cells are
usually detected post transformation (Walter et al., 2004). Mouse models offer a more
effective system whereby a single genetic event (e.g. chromosomal translocation) can be
engineered into cells, and followed to detect disease progression and the associated
changes. (Wartman et al., 2011) used a whole genome sequencing based approach to
investigate functionally relevant and recurrent somatic gene mutations that occur in the
mCtsg-PML-RARA knock in mouse model of APL. Their analysis identified a recurrent
point mutation in Jak1 (Jak1 V657F) and a deletion in histone demethylase (Kdm6a).
They had further shown that the Jak1 variant can cooperate with PML-RARA to induce a
rapidly fatal APL like disease in the mouse. Importantly, this mutation in Jak1 is identical
to the recently described mutation in the JAK1 pseudokinase domain (V658F) in human
APL and adult ALL (Flex et al., 2008), (Jeong et al., 2008), (Mullighan and Downing,
2009).
Whole genome transcript expression analysis is more commonly used to identify global
changes in gene expression that are associated with the APL fusion proteins. Cellular
pathways that are identified to be over-represented within gene sets deregulated by the
APL fusions, are thought to be involved in disease pathogenesis, and have the potential to
drive leukemia development. Array analysis of gene targets of PML-RARA and PLZF-
RARA was performed to compare the set of downstream deregulated targets of these two
fusions on gene expression (Park et al., 2003). In this analysis, deregulated expression of
a number of genes identified to be involved in tumor necrosis factor (TNF) α signaling
51
was observed. Another group reported the effect of ATRA on gene expression in ATRA-
sensitive and –resistant NB4 cells also involved induction of TNF-response genes in
response to retinoic acid treatment (Witcher et al., 2003; Witcher et al., 2004). A
combined analysis of PML-RARA, PLZF-RARA and AML1-ETO, also in U937 cells
indicated that pathways involved in stem cell maintenance and in the regulation of DNA
repair were commonly altered by these fusions (Casorelli et al., 2006). These
observations suggested that AML fusions induced a state in leukemic blasts that
promoted their self-renewal capabilities.
The WNT/β-Catenin signaling pathway was another commonly deregulated network of
genes identified from array analysis of the three AML fusions (Muller-Tidow et al.,
2004). Wnt signaling is involved in cellular proliferation, cell-to-cell signaling, and is
implicated in the self-renewal of stem cells, suggesting that AML fusions may induce
abnormal cellular proliferation in part through deregulated WNT signaling. AML-
associated translocation products (including PML-RARA) increase the expression of γ-
Catenin by activating its promoter region. Increased expression of γ-Catenin results in
increased replating efficiency of HSC (Zheng et al., 2004).
Array analysis was performed in the mCG-PML-RARA transgenic line after treatment
with external irradiation, in order to measure the accumulation of genetic changes after
DNA damage (Walter et al., 2004). Further analysis demonstrated a network of
deregulated myeloid transcription, postulated to contribute to leukemogenesis in mice
These studies demonstrated that individual PML-RARA+ mice had variable gene
expression profiles, suggesting that no single, unifying cooperating downstream gene
expression change may be required for leukemogenesis in these mice.
It still remains to be seen what genetic changes drive leukemogenesis after acquisition of
the chromosomal translocation. While studies to date are limited in their ability to detect
these driver changes, emerging sequencing technologies and improved mouse models can
be used to address these issues and better understand the pathogenesis of APL.
52
1.5.3 Use of high throughput assays to understand leukemia pathogenesis
Whole genome based analysis allows for comprehensive interrogation of the mechanisms
of disease development and disease biology. We have used whole genome transcriptome
profiling to characterize the effects of the variant fusion proteins on cellular gene
expression and transcriptional regulation, described in Chapter 3. Gene expression array
technology has been put to a number of uses in order to more fully elucidate AML
biology. Broadly, array analysis has been applied to the classification of AML subtypes;
diagnosis and prognosis of AML; development and understanding of AML therapies; and
elucidating the mechanisms of AML pathogenesis. Selected cases demonstrating the use
of array technology in each of these areas of AML biology are described in Table 1.4
below.
A number of factors determine the ability to classify samples, and discover novel
subtypes within a heterogeneous disease using gene expression profiling studies. Both the
size of the study group, as well as demographic variations influence expression results. In
addition, technical factors such as the use of different array platforms between studies,
sample preparation and array hybridization techniques play an integral part to the final
expression output. Further differences in bioinformatics approaches and filtering methods
between studies factor into the outcomes of the study. In most cases, these factors do not
drastically affect disease subtypes with a distinctive expression signature, but will likely
affect classification of sample sets containing more subtle expression changes.
In addition to subtype identification, gene expression profiling studies have also been
frequently used to determine prognostic signatures in AML using overall survival and
other outcome measures as the end point. Additionally, gene expression profiling studies
have proved useful in understanding the downstream genetic targets of oncogenes, or
identifying novel changes that are causative for disease development.
53
Table 1.4: A summary of selected microarray studies describing disease classification, prognosis, biology, and therapeutic response mechanisms in AML.
Study Type Major findings Sample types Study Reference
AML classification; AML prognostic groups
Identified molecular signature defining 16 AML patient groups and prognostic information
285 AML patients (Valk et al., 2004)
AML classification; AML prognostic groups
Identified prognostically relevant subgroups in AML with normal karyotype
119 AML patients (Bullinger et al., 2004)
AML classification; AML diagnosis
Predicted clinically relevant subgroups of leukemia with high accuracy.
892 AML, CLL, ALL samples
(Haferlach et al., 2005b)
AML classification; AML biology
Specific changes in miRNA expression levels can distinguish selected AML subtypes
52 AML patients (Li et al., 2008)
AML classification; AML outcome prediction
Identified miRNA expression associated with selected AML subtypes
122 AML patients (Garzon et al., 2008b)
AML classification Gene expression profiling accurately predicts AML subtypes characterized by expression of translocated transcription factor products.
461 AML patients (Verhaak et al., 2009)
Leukemia subtype prediction
Use of gene expression profiling to classify 18 distinct subcategories of leukemia with high accuracy
3334 ALL, AML, CLL, CML, MDS patients
(Haferlach et al., 2010)
AML biology Identified a miRNA signature that distinguishes NPMc+ AML from NPM1 non-mutated cases.
85 AML patients (Garzon et al., 2008a)
54
AML prognosis and outcome prediction
Identified novel groups of AML with differences in prognosis and response to therapy
170 AML patients (Wilson et al., 2006)
AML prognosis and outcome prediction
Identified an 86-probeset prognostic signature that correlates with overall survival in cytogenetically normal AML
143 CN- AML patients
(Metzeler et al., 2008)
AML stem cell biology Identified similarities in gene expression profiles of CD34+ CD38- LSC fractions in AML and normal HSCs
5 AML patients (Gal et al., 2006)
AML stem cell biology Compared expression profiles of normal HSC with LSC in AML to determine differentially expressed molecular pathways
16 AML patients (Majeti et al., 2009)
AML stem cell biology Identified human LSC gene expression signature in AML 61 AML patients (Saito et al., 2010)
AML stem cell biology; AML prognosis
Identified an LSC- specific gene signature, and associated high expression of these genes with inferior outcomes in AML
1047 AML patients
(Gentles et al., 2010)
AML stem cell biology; AML prognosis
Identified molecular signature defining functional AML LSC, and its use in predicting patient survival
16 AML patients (Eppert et al., 2011)
APL biology APL mouse models have distinct gene expression signatures influenced by genetic changes that contribute to the disease progression
Mouse APL models
(Walter et al., 2004)
APL biology Distinct gene expression signatures in M3 and M3 variant APLs. 35 APL patients; 155 other AML patients
(Haferlach et al., 2005a)
55
APL biology Identified deregulated genes and pathways contributing to disease progression in APL mouse models
APL mouse models
(Yuan et al., 2007)
APL sub-classification; APL biology
Identified differentially expressed genes in APL samples with presence of Flt3 ITDs
18 APL patients (Marasca et al., 2006)
APL expression signature Identified gene expression signatures specific to APL and distinct from other AML subtypes
15 APL patients; 62 other AML patients.
(Payton et al., 2009)
Therapeutic sensitivity prediction
Identified gene expression changes correlated with response to chemotherapy, and predictive of chemosensitivity
76 AML patients (Okutsu et al., 2002)
Therapeutic mechanisms gene expression profiles of cells after 12-72 hrs of ATRA induced differentiation
NB4 cell line (Yang et al., 2003)
Therapeutic mechanisms Genes modulated by valproic acid in AML OCI/AML-2 cell line
(Trus et al., 2005)
Therapeutic mechanisms Gene expression signature determining resistance or sensitivity to differentiation agents in in vitro cell lines
KG-1, KG-1a, Kasumi-1, THP-1, HL-60, NB4 cell lines
(Tagliafico et al., 2006)
Therapeutic mechanisms Expression differences in miRNAs during ATRA induced differentiation
3 APL patients; NB4 and HL-60 cell lines
(Garzon et al., 2007)
56
1.5.4 ChIP-seq and ChIP-on-chip technology: Global analysis of DNA binding profiles
Chromatin immunoprecipitation on a chip (ChIP-on-chip) is a technique that utilizes chromatin
immunoprecipitation and microarray analysis to identify protein-DNA interactions in living
cells. ChIP-seq is an emerging technology whereby DNA that is pulled down from the
immunoprecipitation experiment is identified using next generation high throughput DNA
sequencing technology. These studies are useful to researchers studying AML-associated
transcription factors, such as AML1-ETO and X-RARA, as they enable analysis of the sequences
directly bound by these proteins on the DNA. Thus, regulatory regions, and hence, genes, that
are directly transcriptionally modulated by these proteins can be identified.
Recent evidence, employing chromatin immunoprecipitation followed by array analysis (ChIP-
chip) assessing direct gene targets of PML-RARA, confirm that the fusion induces a repressive
mark on its target promoters, including the recruitment of HDAC1 and aberrant methylation of
histones (Hoemme et al., 2008). Interestingly Wang et al. (2010) showed that more than half of
PML-RARA targeted promoter regions also contained PU.1 motifs (Wang et al., 2010). The
fusions therefore deregulated PU.1 mediated transactivation of target genes (Wang et al., 2010).
The presence of RXRA in the PML-RARA oncogenic complex has also been confirmed by
ChIP-seq and ChIP-on-chip studies that show the colocalization of RXRA to promoter elements
occupied by PML-RARA (Martens et al., 2010; Wang et al., 2010). Both studies showed that the
majority of PML-RARA binding sites do not contain canonical RAREs, but instead contain other
binding elements and motifs. Rice et al. (2009) extended these finding to PLZF-RARA, where
they observe that only a minor fraction of gene promoters that were bound by PLZF-RARA
contained classical RARE sequences (Rice et al., 2009). Their dataset also revealed the presence
of promoter regions targeted by other nuclear hormone receptors among those regions occupied
by the fusion, raising the possibility that the fusion can bind and deregulate expression of other
signaling pathways (Rice et al., 2009). More recently, Spicuglia et al., (2011) conducted similar
ChIP-on-chip studies to identify sites specifically bound by PLZF-RARA, while distinguishing
between genomic regions bound by PLZF-RARA and wild type PLZF.
57
1.5.5 Summary
Gene expression analysis and other high throughput technologies to profile genetic material have
increasingly been used over the past few years in an attempt to sub-classify disease, more
accurately predict prognosis, and understand the mechanisms underlying disease pathogenesis
and response to treatment. In addition to mRNA profiling, microRNA profiling has also
identified distinct expression profiles associated with hematological malignancies (Garzon et al.,
2008b; Jongen-Lavrencic et al., 2008; Mi et al., 2007). Changes in microRNA levels can cause
gene deregulation of a wider range of mRNA target genes. A combined analysis of deregulated
mRNA target genes along with microRNA profiles can yield insights into defects in pathways
contributing to leukemogenesis. Currently high throughput sequencing technologies are
emerging as tools to identify changes in expression alongside mutation discovery (Ley et al.,
2010; Ley et al., 2003). The ultimate goal with this technology, as in several cases described
already, is in identifying driver mutations and changes that are functionally important for the
initiation and progression of the disease. These changes appear alongside a range of passenger
mutations that are functionally unimportant and result from the inherent genetic instability
associated with cancer cells. The challenge with this approach is in distinguishing between the
two types of changes, both of which are picked up by the technology at the same time. In
addition to genetic changes, new studies have underscored the importance of epigenetic
modification in the progression of cancers. Several genome-wide platforms have been developed
to identify changes in these mechanisms, and when used in concert with gene expression studies,
are expected to yield much information about the genomic landscape of the cancer cell. Taken
together, the integration of the vast amount of data generated from complementary techniques
allows for profiling different aspects of the cancer cell, and is what ultimately will produce
significant functional understanding of disease pathways, and therapeutic targets that can lead to
more effective therapies.
58
1.6 Nuclear Factor kappa B (NF-κB) signaling in Leukemia
NF-κB was discovered in 1986 by Baltimore and colleagues as a factor present in the nucleus of
B cells that binds enhancer regions of kappa light chains of immunoglobulins (Sen and
Baltimore, 1986), and that also targets a number of genes including growth factors, angiogenesis,
cell adhesion and anti-apoptotic factors. NF-κB is now known to be ubiquitously expressed and
translocates after activation by external stimuli to the nucleus where it is activated to regulate the
expression of over 200 genes. While NF-κB activation is required for normal immune system
function, when activated inappropriately, it can mediate inflammation and tumourigenesis. NF-
κB is a term used to collectively describe a class of dimeric transcription factors that consists of
rel domain containing proteins including Rel A (p65), Rel B, c-Rel, p50 (NF-κB 1) and p52 (NF-
κB). NF-κB is kept in the inactive state within the cytoplasm by a family of ankyrin-domain
containing proteins IκBα, IκBβ, IκBγ, IκBαε, bcl-3, p106 and p100. Cytoplasmic NF-κB is a
heterotrimer of p50, p65 and IκBα. The phosphorylation and ubiquitination-mediated
degradation of IκBα allows for the p50-p65 heterodimer to translocate to the nucleus and bind
specific 10 bp consensus sites (GGGPuNNPyPyCC).
NF-κB can be activated by a wide range of stimuli including DNA damage, mitogens, growth
factors, cytokine and immune receptor activation (Karin and Delhase, 2000). Three major
pathways mediate NF-κB signaling: the canonical, non-cannonical, and DNA damage induced
pathways (Schmitz et al., 2004). Induction of a particular NF-κB signaling pathway results in the
cleavage and production of NF-κB dimers which are capable of DNA binding; the NF-κB dimers
are then regulated so as to control the duration and the amplitude of the active NF-κB signal
(Schmitz et al., 2001). Different stimuli activate distinct signal transduction pathways with
specific scaffolding and signaling components. The majority of signaling pathways converge on
the activation of IKK complex, which then results in NF-κB activation (Figure 1.10).
Members of the TNF-superfamily transduce signals through the NF-κB network. At the cellular
level, TNF-superfamily members promote apoptosis, proliferation, survival or differentiation,
depending on the cell type and the signaling pathway that is activated. In the vast majority of
cells, TNFR1 (p55) mediates TNF signaling. However in the lymphocyte system TNF-R2 also
plays a major role. Ligand binding to the receptor allows for a conformational change, or allows
59
the formation of higher order receptor complexes which activate signaling. Binding of TNFα to
TNFR1 triggers receptor trimerization, which is followed by the release of the inhibitory protein,
Silencer of Death Domain (SODD). TRADD then acts as a scaffold protein which is recognized
by the receptor and recruits FADD (Hsu cell 1997), (Boldin et al., 1996), TRAF2 (Hsu et al.,
1996) and RIP (Ting et al., 1996), which then signals to downstream components to activate
caspases (Boldin et al., 1996) and also activate the AP1 and NF-κB transcription factors. These
factors control the expression of proteins that regulate vast numbers of cellular processes
including proliferation, cell death, and inflammation.
60
TNFα
IκκκκBαααα
IκκκκBααααphosphorylation
degradation
p65
p65
IKKαααα IKKββββ
IKKγγγγ
p50
Cytoplasm
Nucleus
(NF-κκκκB)
Figure 1.10: Simplified NF-κκκκB pathway demonstrating activation of the NF-κκκκB dimer.
TNFα binding and activation of TNFR results in activation of the IKK complex to phosphorylate
the NF-κB inhibitor IκBα. IκBα is targeted for degradation and allows NF-κB/p65 and p50
heterodimers to translocate into the nucleus to activate transcription of target genes.
61
1.6.1 Signaling molecules in the NF-κB pathway
The IKK complex consists of two catalytic subunits, IKK α and IKKβ, and a non-catalytic
subunit IKKγ (NEMO) (Zandi et al., 1997). NEMO forms oligomers which are necessary for
assembling and recruiting the IKK complex to upstream activators (Tegethoff et al., 2003),(Li
and Verma, 2002). TNFα stimulation causes phosphorylation of IKKβ and the poly-
ubiquitination of NEMO (Tang et al., 2003). This activated IKK complex phosphorylates IκBα,
degrades it and releases NF-κB.
TNF receptor interacting protein (RIP) is a serine threonine kinase that is recruited to TNFR1
when cells are stimulated with TNFα (Kelliher et al., 1998; Ting et al., 1996). It consists of a N-
terminal kinase domain, an intermediate domain and a C-terminal death domain. The death
domain is required for association with TRADD signaling components and the intermediate
domain allows for interaction with NEMO and other downstream components (Zhang immunity
2000). RIP therefore functions as an adaptor molecule in this pathway. Evidence indicates that
TNFR associated protein (TRAF2) works by recruiting IKK complexes to the TNFR1 signaling
complex (Devin et al., 2000), (Devin et al., 2001) This triggers the binding of RIP with NEMO
and further activation of IKK complex (Zhang immunity 2000).
Phosphorylation is an important post translational modification in the TNFα-NFκB pathway.
Phosphorylation of IκBα by the IKK complex is highly regulated and is required for nuclear
localization of NF-κB. Phosphorylation occurs at two conserved residues on the N terminus Ser
32 and Ser 36 which leads to recognition by a ubiquitin ligase complex called SCFTrCP
resulting in polyubiquitination and degradation of IκBα through the 26S proteosome (Karin and
Delhase, 2000). IKKβ is also regulated through phosphorylation at the N-terminus which causes
a conformational change that activates the kinase function of the protein (Johnson et al., 1996).
1.6.2 TNFα-NF-κB pathway signaling switches
IκBα provides a negative feedback regulation mechanism for NF-κB by controlling NF-κB
activation through cytoplasmic sequestration (Sun et al., 1993). IκBα is itself a target gene of
NF-κB and when activated NF-κB rapidly induces its expression. Newly expressed IκBα binds
62
NF-κB and switches off its activation through this negative feedback loop (Hoffmann et al.,
2002).
TNFα induced protein 3 (TNFAIP3) is a cytoplasmic protein that inhibits NF-κB (Opipari et al.,
1990). TNFAIP3 expression is rapidly induced upon TNFα stimulation through NF-κB (Dixit et
al., 1990; Lee et al., 2000).TNFAIP3 can also interact with NEMO (Zhang immunity 2000),
(Mauro et al., 2006) and TRAF2 (Song et al., 1996). The TRAF2/A20 interaction blocks
recruitment of RIP, TRADD to TNFR complex (He and Ting, 2002). TNFAIP3 is hypothesized
to downregulate NF-κB signaling by removing K63 linked polyubiquitin proteins such as
TRAF2/RIP. RIP was identified as a target for TNFAIP3 (Wertz et al., 2004).
The role of phosphatases in the TNFα-NF-κB pathway remains poorly understood. Distinct
protein phosphatases 2 A (PP2A) are associated with IKK/NF-κB/TRAF2 complexes as
determined from RNAi screen studies. Dephosphorylating these complexes downregulates NF-
κB activity (Li et al., 2006b). Multiple signaling networks are involved in a tightly regulated
controlled manner to activate IKK complexes after TNFα stimulation. TNFα binding to TNFR1
recruits TRADD, TRAF2, RIP, and TAK1 to lipid rafts which may be important in post
translational modifications including ubiquitination. TRAF2 and RIP work to activate IKK by
phosphorylating IKKβ and ubiquitination of NEMO. NF-κB activation and downstream
signaling is tightly regulated through IκBα and TNFAIP3. Phosphatases including PP2A may be
activated to prevent the persistent activation of NF-κB.
1.6.3 Oncogenic activation of NF-κB
As NF-κB plays a crucial role in signaling downstream of several receptors and in response to
LPS, inflammatory cytokines, and growth factors, cancer cells have utilized this signaling
network for the initiation and progression of tumourigenesis (Karin, 2006). A subset of AML
patients demonstrate increased activation of NF-κB. Increased NF-κB activity has been
associated with increased survival and proliferative ability. Inhibition of NF-κB in AML stem
cells ex vivo decreased engraftment in immunodeficient mice (Strair et al., 2008). About half of
AML patients tested in one study, had nuclear translocated and activated forms of p65 and p50
(Bueso-Ramos et al., 2004).
63
In chronic myeloid leukemia (CML), the expression of the oncogenic BCR-ABL fusion results in
increased nuclear translocation of NF-κB. The exact role of this increased transactivation of NF-
κB is not well understood, as it is not required for cellular survival (Kirchner et al., 2003).
Patients with diffuse, large cell, B-cell lymphoma (DLBCL) have increased expression of NF-κB
target genes, and these were associated with poor prognosis (Compagno et al., 2009). Cell line
studies using samples from mantle cell lymphoma patients demonstrated constitutive activation
of NF-κB that is correlated with growth and survival in these cases. In addition, some studies
have indicated that over-expression of NF-κB is associated with chemo-resistance, and that
successful treatment regimen included NF-κB pathway inhibitors in combination with
chemotherapeutic agents.
Therapeutic agents that block NF-κB translocation activation by inhibiting proteosome mediated
IKK degradation are being developed to target this pathway. These agents are preferred over
small molecule inhibitors that target NF-κB to prevent its translocation to the nucleus, or to
prevent its dimerization. A large variety of other methods that target NF-κB are also being
considered for development including compounds that regulate NF-κB protein expression and
DNA binding, compounds that interfere with IKK complex formation (e.g. NEMO binding
peptides); compounds that inhibit IKKβ activation; proteosome inhibitors; and inhibitors of NF-
κB transcriptional activity.
64
1.7 Rationale and Project Objectives
Studies to date indicate that loss of retinoid signaling impairs granulopoiesis, but is not sufficient
to cause a leukemic phenotype (Sternsdorf et al., 2006). X-RARA must therefore modulate
additional signaling pathways, in addition to retinoid signaling, during APL pathogenesis. This
hypothesis is supported by several lines of evidence. Among these are the following: (1) PML-
RARA, acting as an oligomer with RXRA, binds a wider range of response elements in vitro
than RARA (Kamashev et al., 2004). (2) Previous data from our lab demonstrate that NPM-
RARA and NuMA-RARA bind to, and repress transcription from, vitamin D3 response elements
(VDREs) and peroxisome proliferator activated response elements (PPREs) (Kamel-Reid et al.,
2003). (3) Modulation of Wnt, and cAMP signaling pathways by PML-RARA and PLZF-RARA
further define the relevance of additional signaling pathways in APL pathogenesis (Muller-
Tidow et al., 2004; Witcher et al., 2003). We predict significant overlap among the cellular
biology of the APL fusion proteins; it is important to note that these commonly deregulated
pathways are most likely to be relevant in understanding the disease and its response to therapy.
By virtue of having controlled cell culture-based systems expressing the variant fusions NPM-
and NuMA-RARA, as well as PML-RARA, we can simultaneously compare the effects of these
fusions on gene regulatory networks and cellular pathways, thereby allowing us to identify those
targets that are globally deregulated in APL.
Our studies described in Chapter 2 and Chapter 3 of this thesis aim to evaluate these cooperating
pathways using two approaches: 1) a candidate pathway approach, to determine the role of NF-
κB mediated cellular survival signaling in APL; and, 2) a whole transcriptome screening
approach to determine genes and pathways that are differentially regulated in APL.
Deregulated cell death and disrupted cellular survival are key factors in maintaining the leukemic
population. NPM-RARA is known to bind and transcriptionally silence genes regulated by
PPARγ (Kamel-Reid et al., 2003). As disrupting PPARγ signaling has been reported to affect
NF-κB mediated cellular survival, we hypothesized that this also occurred in NPM-RARA APL.
In our candidate pathway approach to evaluating cooperating pathways in APL, we explored the
status of the NF-κB mediated survival signaling in APL cells, and report that the fusions
deregulate this signaling pathway.
65
Overall hypothesis: NPM-RARA will deregulate genes and cellular pathways that converge on
cellular growth, proliferation and survival signaling.
Specific Aim 1: Investigate the Nuclear Factor-kappa B (NF-κB) mediated survival signaling
pathway in APL cells.
Hypothesis: Deregulated expression of NF-κB signaling proteins in APL cell line models will
confer enhanced survival in response to TNF signaling.
We also took an unbiased, systems-based, approach toward the identification of novel
cooperating pathways in APL, by undertaking whole genome expression profiling of U937 cell
line models over-expressing the variant fusion proteins NPM-RARA and NuMA-RARA. In
these studies, we were interested both in the identities of the genes deregulated by the two
fusions, as well as the identities of the signalling pathways and cellular processes these genes
were a part of.
Specific Aim 2: Determine the gene expression profiles of NPM- and NuMA-RARA expressing
U937 cells, and to characterize ATRA response at the level of global gene expression changes in
APL.
Hypotheses: NPM-RARA and NuMA-RARA will regulate a common set of genes representing
pathways and functions which cooperate in APL pathogenesis. A subset of transcriptional targets
of the variant fusions will overlap with known DNA binding targets of PML-RARA and
constitute critical direct targets in APL.
As the fusions share their C-terminal RARA motifs, it is commonly thought that the pathways
that are under the control of multiple fusions are mostly the result of aberrant interactions of the
common RARA domains, or the result of transcriptional deregulation by the aberrant X-RARA.
It is possible, however, that the deregulation of the “X” partner protein can also contribute to
oncogenesis, and identification of these commonly regulated X pathways are a necessary piece
of the puzzle that leads to transformation and leukemic progression. Wild type NPM has several
significant roles in cells including regulation of cell growth and proliferation, cell death
responses and tumour suppressive functions. Interestingly approximately 40% of AML patients
66
have mutations within NPM that causes the delocalization of nucleolar NPM. Previous work in
the lab identified NPM deregulation and aberrant cellular localization in transgenic hCG-NuMA-
RARA mice as well as cell lines expressing APL fusion proteins. We reasoned that the presence
of the oncogenic NPM-RARA fusion protein in variant APL would also disrupt wild type NPM
functions in this system and therefore contribute to the disease phenotype seen in APL. In this
thesis, we explore the functional effects of NPM deregulation on the APL cell by assessing NPM
deregulation in primary APL patient blasts, and the effects of its deregulation in regulating
cellular growth, cell volume and nucleolar morphology.
Specific Aim 3: Investigate the deregulation of Nucleophosmin (NPM) and its role in APL.
Hypothesis: NPM is deregulated in APL and is associated with increased growth and altered
nucleolar function in cells expressing X-RARA.
67
Chapter 2 Functional Deregulation of NF-κB and abnormal TNFα response
in APL
Mariam Thomas, Mahadeo A. Sukhai, Mark D. Minden, Suzanne Kamel-Reid.
Co-Author contributions:
MDM and SKR reviewed and retrived clinical data of all APL patient samples outlined in Table
2.2. MAS and SKR reviewed study design, and data interpretation and analysis.
68
2 Functional Deregulation of NF-κB and abnormal TNFα response in APL
2.1 Abstract
Cell survival and progenitor self-renewal are important features of leukemia development, and
have not been well characterized in APLs containing variant fusion proteins. In this report we
present evidence that implicates the NPM-RARA variant fusion protein in the deregulation of the
NF-κB/p65 cell survival pathway in APL. We previously determined that NPM-RARA
modulates cell survival and apoptosis in response to the PPARγ agonist Troglitazone. In an effort
to further characterize this response and understand the role of survival signaling in APL, we
analyzed the NF-κB signaling network in both NPM-RARA and PML-RARA cells. A subset of
NF-κB/p65 target and signaling genes were deregulated in APL cell lines and 23 primary APL
patient samples. These data indicated that defects in NF-κB-mediated gene expression can
contribute to APL pathogenesis. Induction with TNFα caused sustained activation of NF-κB in
cells expressing NPM-RARΑ. Furthermore, in the presence of TNFα, NPM-RARΑ and PML-
RARA expressing cells formed significantly more colonies, in a dose-dependent manner,
compared to control cells. Pharmacological inhibition of NF-κB restored wild type TNFα
response in NPM-RARA cells. Our data provide evidence of functional deregulation of the NF-
κB-mediated signaling pathway and the TNFα response in cells expressing the APL fusion
proteins NPM-RARA and PML-RARA.
69
2.2 Introduction
Acute Promyelocytic Leukemia (APL) accounts for approximately 10% of acute myelogenous
leukemia (AML) cases worldwide (Bennett et al., 1976). APL is characterized by impaired
granulocytic differentiation, leading to the accumulation of promyelocytes in the bone marrow
and peripheral blood of patients (Bennett et al., 1976); association with chromosomal
translocations involving the retinoic acid receptor alpha (RARΑ) gene locus; and a unique
sensitivity to treatment with All-trans retinoic acid (ATRA) (Flynn et al., 1983). Currently, APL
is considered a model disease for the study of abnormal hematopoeisis and aberrant transcription
in leukemia, and the use of differentiating agents, such as ATRA, in cancer treatment. More than
99% of APL cases involve a balanced chromosomal translocation fusing the promyelocytic
leukemia (PML) gene with RARΑ (Alcalay et al., 1991; de The et al., 1990). To date, seven other
rare RARΑ translocation partners have been identified (Arnould et al., 1999; Catalano et al.,
2007; Chen et al., 1993b; Hummel et al., 1999; Kondo et al., 2008; Macedo Silva et al., 2005;
Menezes et al.; Redner et al., 1996; Wells et al., 1997; Wells et al., 1996; Yamamoto et al.). Of
these, nucleophosmin (NPM) (Hummel et al., 1999; Redner et al., 1996) and nuclear mitotic
apparatus (NuMA) (Wells et al., 1996) (Wells et al., 1997) were cloned and characterized in our
laboratory as well as that of others (NPM, Redner et al., 1996).
Thus far, NPM-RARA has been identified in 6 cases of APL worldwide, making it the second
most frequent ATRA responsive variant translocation in this disease (Okazuka et al., 2007).
After identifying and characterizing one of the first cases of NPM-RARA positive APL, our
group has shown that NPM-RARA binds promoter elements other than classical Retinoic Acid
Response Elements (RAREs), including Peroxisome Proliferator-Activated Receptor response
elements (PPREs), and deregulates the Vitamin D3 receptor and PPARγ signaling pathways
(Kamel-Reid et al., 2003). Interestingly, treatment with the PPARγ agonist Troglitazone,
sensitized NPM-RARA-expressing cells to apoptosis (Kamel-Reid et al., 2003). As disruption to
PPARγ signaling has been reported to affect cellular survival and NF-κB signaling, we sought to
further characterize NPM-RARA and PML-RARA’s roles in modulating cell survival and
apoptosis through a key pathway involved in cellular survival response, NF-κB/p65, and report
here that NF-κB/p65 signaling is deregulated in NPM-RARA positive APL.
70
Nuclear Factor Kappa B (NF-κB) is a critical regulator of cellular processes, including immune
response, oncogenesis, and cell death. Deregulation of NF-κB is evident in numerous diseases
(Baldwin, 1996; Karin et al., 2002) and it is constitutively active in AML patient blasts (Guzman
et al., 2001). Blocking NF-κB activity triggers apoptosis in primary human AML blasts (Frelin et
al., 2005). NF-κB regulates transcription of genes involved in cell survival (cIAPs, BCL-XL),
proliferation (IL-2, GM-CSF), cell cycle (Cyclin D1, MYC), and metastasis (MMP-9, uPA). NF-
κB is retained in its inactive cytoplasmic state as dimers bound to the inhibitory subunits of the
IκB family. In the presence of a wide range of stimuli (Pahl, 1999), IκB is phosphorylated, poly-
ubiquitinated, and subsequently degraded by the proteosome (Karin, 1999), thereby releasing and
activating NF-κB. Activated NF-κB translocates to the nucleus, where it positively regulates
transcription of its target genes. Alterations in survival signaling can result in differences in the
survival ability of APL blasts in the bone marrow environment and potentially affect response to
therapy. In this report, we show that NF-κB is over-expressed in PML-RARA and NPM-RARA
positive APL cell lines, and in APL patients; that an NF-κB signaling network gene signature is
deregulated in APL; and, that APL cells have increased survival in response to TNFα. These
studies suggest that NPM- and PML-RARΑ induce a state of hyper-stimulated NF-κB signaling
in APL cells.
71
2.3 Materials and Methods
2.3.1 Cell culture and reagents.
NB4 cells expressing PML-RARA and U937 derived cells were cultured in RPMI media
containing 10% FBS and supplemented with 2 mM L-glu, and 50,000U streptomycin/penicillin.
U937 cells were retrovirally transduced to express a V5 tagged NPM-RARA construct as
reported previously (Kamel-Reid et al., 2003). TNFα was obtained from Sigma, and
reconstituted with 0.2 micron filtered, distilled, deionized water to a stock concentration of 0.1
mg/ml. The SN50 cell-permeable inhibitor peptide (Calbiochem), and the SN50M cell-
permeable inactive peptide (Calbiochem) were diluted in water to a stock concentration of
1mg/ml. Parthenolide (20mM stock concentration in DMSO) was a kind gift from Dr. Aaron
Schimmer (UHN, Toronto).
2.3.2 Normal and patient bone marrow samples and RNA extraction.
Bone marrow from healthy donors and anonymized APL patients seen at the University Health
Network were extracted using TRIzol reagent, followed by clean-up using the Qiagen RNA
extraction columns. RNA samples were dissolved in Sigma water. RNA quality was assessed
using A260:A280 readings and quantified by NanoDrop (Thermo Scientific). All patient material
was approved for use in this study by the University Health Netowrk’s Research Ethics Board
(REB #10-0175-TE).
2.3.3 FLT3 mutation analysis in patient samples.
FLT3 ITD mutation was assessed using multiplexed RT-PCR methods using primers specific
for the FLT3 gene on chromosome 13q12. cDNA samples were amplified using FLT3 primers
and fragments were analyzed as described previously (Medeiros et al., 2007).
2.3.4 Gene Expression Analysis.
0.5 µg of total RNA was subjected to reverse transcription and RQ-PCR analysis using SYBR
Green I reaction chemistry. Experiments were performed in duplicate for each sample in the
same reaction plate and repeated when a coefficient of variation >5% was observed. Primer
sequences for genes used in the analysis are detailed in Table 2.1. Data were quantified and
72
analyzed using the ∆∆Ct method (Livak and Schmittgen, 2001). β2-microglobulin (β2M) was
used as the internal control. The reference was taken as the mean value of the normal bone
marrow samples. Raw fold change values were log-transformed and imported to Partek
Genomics Suite (Partek Inc.). Principal Components Analysis (PCA) was performed on Partek to
visualize the expression data based on population characteristics.
2.3.5 Methylcellulose colony forming assays.
Cells were counted using a hemocytometer, treated with TNFα (0-100ng/ml) and plated at a
density of 200 cells in 3ml of semi-solid media MethoCult® H4230 for human cells, without
cytokines (Stem Cell Technologies). Colonies were defined as clusters of greater than 50 cells,
and were counted after 7 days in culture.
2.3.6 Cell viability assays.
Cells were plated in 96-well plates and incubated for 1 hour prior to treatment with the
appropriate agent (TNFα, SN50, SN50M, Parthenolide, ATRA, singly and in combination).
Plates were incubated for a period of 24-96 hours prior to addition of [3-(4,5-dimethylthiazol-2-
yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium, inner salt; MTS] (CellTiter
96 Aqueous MTS reagent, Promega) and reading absorbance of each well at 490 nm using the
spectrophotometer (SpectraMax M5). The mean absorbance and standard deviation were
calculated and data are presented as mean absorbance values normalized to the untreated
condition.
We used the excess over Bliss additivism (EOBA) scoring method (Borisy et al, 2003) to
determine additivism and synergism of action between two compounds. According to this model,
the combinatorial effect [C] of treatment with two agents [A] and [B] is expressed as C=A+B –
A.B. Each effect is expressed as a fractional inhibition between 1 and 0. Negative combinatorial
effects represent antagonistic interactions; positive values represent synergistic interactions, and
combinatorial effect values close to 0 represent additive effects of drug combination.
2.3.7 Western blotting.
Proteins were separated by size using 5% SDS-PAGE, transferred to PVDF membranes,
incubated with 1:1000 dilutions of rabbit anti-NF-κB/p65 (Abcam), mouse anti-IκBα, rabbit
73
anti-IKKα, rabbit anti-IKKβ, and phospho-antibodies against each of these proteins (Cell
Signaling) and detected using anti-mouse- or anti-rabbit-conjugated HRP (GE healthcare).
Bound secondary antibody was visualized by chemiluminescence (ECL, GE healthcare).
2.3.8 Laser-scanning confocal microscopy.
Cytospin preparations of cells were prepared according to standard techniques, and
immunostained with rabbit monoclonal NF-κB/p65 antibody (Abcam). Rhodamine- conjugated
anti-rabbit IgG (Novus Biologicals) were used as fluorescent secondary antibodies. Slides were
analyzed using a Zeiss LSM510 Laser Scanning Confocal Microscope, integrated camera and
software (Zeiss, Germany). A 63x/1.2NA water immersion objective lens was used at room
temperature, and protein localization determined by scoring > 200 cells in 5 fields of view/slide.
2.3.9 Flow cytometry.
Cells were washed twice and resuspended in 25 µL PBS, and incubated for 30 min at 4oC with 5
µL PE-anti human-CD11b (BD biosciences). Samples were then washed, and resuspended in
PBS and analyzed on the FACSCalibur flow cytometer (Becton Dickenson).
2.3.10 Statistical analyses.
Statistical analyses were performed using Microsoft Excel 2003 and data visualized using
GraphPad Prism version 5. Two-population comparisons were performed by two-tailed t-test;
multi-population comparisons were made by ANOVA. Statistical significance was defined as p<
0.05.
74
Table 2.1: List of primer sequences used in real time PCR assays.
Gene Forward primer Reverse primer
β−Actin ATCGTCCACCGCAAATGCTTCTA AGCCATGCCAATCTCATCTTGTT
SOD1 GAAGGTGTGGGGAAGCATTA ACATTGCCCAAGTCTCCAAC
NFKBIA CCAGGGCTATTCTCCCTACC GCTCGTCCTCTGTGAACTCC
STAT5A CTGAACAACTGCTGCGTGAT GTGGACGATGACAACCACAG
JUNB TGGAACAGCCCTTCTACCAC GAAGAGGCGAGCTTGAGAGA
MAP3K8 CCAACGCTTGAATATGGCTGA CTGCTCCTTCGAAAATGGCA
CCL2 ACCAGCAGCAAGTGTCCCAAA TTGCTTGTCCAGGTGGTCCAT
IL8 TCTGGACCCCAAGGAAAAC CATCTGGCAACCCTACAACA
VEGFa CAAGATCCGCAGACGTGTAA TCTGTCGATGGTGATGGTGT
MMP9 CCTCGAACTTTGACAGCGACA AGGAATGATCTAAGCCCAGCG
TNFAIP3 GCACAATGGCTGAACAAGTC CCCGAAACTGAGGACAAAAC
AZU1 AGCTGCTTCCAAAGCCAGAA CAGCATCAGGTCGTTCAGGTT
TRIB2 CCCTCGTAACCAGGAGACA AAAGCACCAGAGGCCATAGA
75
2.4 Results
2.4.1 APL blasts exhibit deregulated expression of NF-κB signaling genes.
In order to evaluate the transcriptional profile of the NF-κB signaling network in APL, RNA was
extracted from 23 diagnostic APL patient bone marrow samples and 11 normal marrow samples
(Table 2.2) and subjected to real time quantitative RT-PCR assessing expression of 11 NF-κB
gene targets and downstream signaling components (Figure 2.1A-B; Table 2.3), identified
through gene expression array analysis of the U937-NPM-RARA cell line (c.f. Chapter 3). We
determined that 8/11 genes, including STAT5A, MAP3K8, NFKBIA, CCL2, IL8, MMP9, JUNB
and TNFAIP3 were significantly differentially regulated (p<0.05, by one-way ANOVA) in
diagnostic APL samples compared to normal bone marrow, and had expression profiles that
could distinguish between APL and normal bone marrow in Principle Components Analysis
(Figure 2.1A-B).
Fms-like tyrosine kinase receptor 3 (FLT3) alterations including internal tandem duplications
(ITDs) are found in approximately 30% of APL patients and are associated with more severe
clinical features (Callens et al., 2005). In order to evaluate whether FLT3 mutation states are
associated with greater NF-κB transcriptional deregulation, we undertook a separate gene
expression analysis on mutated and non-mutated APL samples. FLT3 mutation analysis
conducted on a subset of our APL samples (17/23) indicated the presence of FLT3 internal
tandem duplications (ITDs) in 4/16 (25%) samples tested. However, FLT3 mutation status did
not correlate with significant changes in gene expression profiles (Table 2.4).
Furthermore, we also tested whether NF-κB network gene expression levels correlated with
PML-RARA breakpoints. APL patients expressing either the BCR1/2, or the BCR3 specific form
of PML-RARA were analyzed, but revealed no statistically significant correlations with
expression levels of the NF-κB gene set (Table 2.5).
Having observed deregulated expression in patient samples at diagnosis, we next asked whether
expression profiles revereted to normal in the same patients after treatment. Comparing 7 pairs of
diagnostic and post-treatment samples, indicated that expression levels of STAT5A, AZU1,
CCL2, SOD1, MMP9, and IL-8 significantly changed in diagnostic compared to treated samples.
76
In many cases, a clear reversion of gene expression patterns to normal levels was noted in the
post-treatment samples, demonstrating that these genes were responsive to ATRA therapy
(Figure 2.1C-D).
77
Table 2.2: APL patient characteristics. The PML-RARA breakpoint, as well as mutations present in FLT3 are noted for each APL patient sample. Entries marked “ND” were not profiled and therefore not available for reporting.
Patient ID PML-RARA
breakpoint FLT3 ITD FLT3 TKD
APL#1 BCR 1 or 2 Negative Negative APL#2 BCR 1 or 2 Intermediate Positive Negative APL#3 BCR 1 or 2 Negative Negative APL#4 BCR 1 or 2 Negative Negative APL#5 BCR 1 or 2 Negative Negative APL#6 BCR 1 or 2 Intermediate Positive Negative APL#7 BCR 1 or 2 Negative Negative APL#8 BCR 1 Negative Negative APL#9 BCR 1 Negative Negative APL#10 BCR 1 Negative Negative APL#11 BCR 3 Intermediate Positive Negative APL#12 BCR 3 Negative Negative APL#13 BCR 3 Negative Negative APL#14 BCR 3 Negative Negative APL#15 BCR 3 Negative Negative APL#16 BCR 3 Intermediate Positive Negative APL#17 BCR 3 ND ND APL#18 BCR 1 ND ND APL#19 BCR 1 ND ND APL#20 BCR 1 or 2 ND ND APL#21 BCR 3 ND ND APL#22 BCR 1 or 2 ND ND APL#23 BCR 1 or 2 ND ND
78
Table 2.3: Gene expression analysis of APL and Normal bone marrow indicating ranges, median fold change values, and significance analysis in comparison with a pooled normal sample as the reference.
APL (n=23)
Normal bone marrow (n=11)
Min Max Median Min Max Median p-value (APL vs Normal)
MAP3K8 0.41 5.67 2.34 0.40 3.48 1.25 0.0139089 CCL2 0.01 1.05 0.04 0.14 5.80 0.69 1.78E-06
IL8 0.00 0.64 0.05 0.03 3.98 0.76 4.62E-06
VEGFA 0.12 7.32 1.46 0.56 1.78 0.92 0.070113
MMP9 0.02 5.20 0.12 0.40 2.10 0.94 0.00091237
JUN 0.28 10.21 1.19 0.32 2.81 0.78 0.0993925
TNFAIP3 0.13 3.21 0.30 0.18 1.48 1.05 0.0318646
AZU1 0.10 4.28 1.54 0.35 2.16 1.08 0.170153
TRIB2 0.09 4.81 0.94 0.14 1.30 0.85 0.967747
NFKBIA 0.08 2.07 0.25 0.09 3.64 0.84 0.00117005
SOD1 0.20 2.52 0.62 0.33 2.37 0.55 0.85369
STAT5A 0.28 13.34 2.09 0.31 3.63 0.74 0.00190686
79
Table 2.4: Gene expression profiles comparing APL samples containing FLT3 ITD versus samples that are wild type for FLT3. FLT3 ITD APL
(n=4) FLT3 WT APL
(n=12) Normal bone marrow
(n=11)
min max median min max median min max median p-value (FLT3 ITD vs. FLT3 WT)
MAP3K8 0.413 3.763 1.898 0.554 5.665 2.523 0.397 3.480 1.250 0.433 CCL2 0.011 0.071 0.028 0.007 1.048 0.050 0.139 5.804 0.687 0.041 IL8 0.011 0.636 0.027 0.001 0.379 0.058 0.031 3.976 0.757 0.682 VEGFA 0.119 4.457 1.202 0.322 7.316 1.608 0.560 1.776 0.919 0.433 MMP9 0.031 5.201 0.068 0.018 2.337 0.118 0.402 2.105 0.943 0.555 JUN 0.490 1.801 1.518 0.277 10.214 1.111 0.322 2.807 0.776 0.173 TNFAIP3 0.127 1.019 0.194 0.126 3.212 0.329 0.180 1.477 1.047 0.421 AZU1 0.387 2.232 0.582 0.105 4.285 1.968 0.346 2.161 1.079 0.069 TRIB2 0.179 1.753 0.409 0.088 4.812 0.972 0.137 1.300 0.850 0.187 NFKBIA 0.115 0.293 0.182 0.083 2.072 0.271 0.086 3.637 0.838 0.058 SOD1 0.402 1.012 0.422 0.204 2.522 0.757 0.330 2.367 0.552 0.085 STAT5A 0.747 3.654 1.655 0.278 13.342 2.667 0.307 3.629 0.739 0.073
80
Table 2.5: Comparison of gene expression profiles of APL samples containing the BCR1/2 and BCR3 isoforms of PML-RARA.
BCR1 or 2 APL (n=15)
BCR 3APL (n=8)
Normal bone marrow (n=11)
Min Max Median Min Max Median Min Max Median p-value (BCR1/2 vs. BCR3)
MAP3K8 0.55 5.67 2.52 0.41 4.24 1.50 0.40 3.48 1.25 0.953 CCL2 0.01 0.72 0.03 0.01 1.05 0.05 0.14 5.80 0.69 0.083 IL8 0.00 0.29 0.04 0.02 0.64 0.06 0.03 3.98 0.76 0.844 VEGFA 0.32 5.14 1.61 0.12 7.32 1.20 0.56 1.78 0.92 0.065 MMP9 0.02 0.69 0.07 0.03 5.20 0.28 0.40 2.10 0.94 0.004 JUN 0.38 8.28 1.52 0.28 10.21 0.80 0.32 2.81 0.78 0.383 TNFAIP3 0.13 0.78 0.28 0.13 3.21 0.36 0.18 1.48 1.05 0.962 AZU1 0.10 3.66 1.53 0.39 4.28 1.97 0.35 2.16 1.08 0.585 TRIB2 0.09 3.70 0.92 0.17 4.81 0.97 0.14 1.30 0.85 0.345 NFKBIA 0.08 1.15 0.25 0.12 2.07 0.29 0.09 3.64 0.84 0.664 SOD1 0.20 2.52 0.76 0.40 1.64 0.57 0.33 2.37 0.55 0.940 STAT5A 0.28 13.34 2.12 0.75 6.04 2.06 0.31 3.63 0.74 0.417
81
Figure 2.1: Deregulation of NF-κκκκB signaling and target genes in APL. A) RNA derived from
23 APL patient samples and 11 healthy bone marrow donors were subjected to reverse
transcriptase real time quantitative PCR to analyze expression levels of genes involved in TNFα
and NF-κB mediated signaling. Expression values were normalized against the β-2
microglobulin house keeping control, and further normalized with the mean of the normal pool,
and represented as fold change relative to the normal pool. Statistically significant gene
expression changes are reported for all samples analyzed by RQ-PCR B). Principal Component
Analysis (PCA) was undertaken using log- transformed fold change expression values for all
samples using Partek Genome Suite (Partek) to cluster samples based on expression profiles of
the NF-κB signaling genes. PCA clustering demonstrated that expression profiles of NF-κB
interaction network components (CCL2, VEGFa, JUN, MAP3K8, TNFAIP3, IL8, MMP9,
AZU1, NFKBIA, SOD1, and STAT5A) can differentiate between APL samples (n=23) and
normal bone marrow (n=12). C) Reversion of gene expression profiles in APL patient samples
after treatment with ATRA and chemotherapy. Paired samples obtained from APL patients at the
time of diagnosis and post-therapy were used for gene expression analysis with the same genes
as depicted in Figure 2.1 A-B. Expression values are reported as fold change relative to the
normal pool. NF-κB gene network expression profiles in treated samples more closely resembled
that of normal bone marrow. D) PCA analysis of NF-κB network expression profiles indicated
that APL samples obtained post treatment show a distinct expression profile compared to those
samples obtained at the time of disease diagnosis.
82
Figure 2.1 A-D: Deregulation of NF-κκκκB signaling and target genes in APL
APL Normal0.125
0.25
0.5
1
2
4
8
16
* p=0.0495
APL Normal0.001
0.01
0.1
1
10
* p=0.000912
APL Normal0.01
0.1
1
10
* p=0.0286
APL Normal0.1
1
10
100 * p=0.0037
APL Normal0
1
2
3
4
5
6
* p=0.0154
APL Normal0.001
0.01
0.1
1
10
* p=0.0392
APL Normal0.0001
0.001
0.01
0.1
1
10
* p=0.0119
APL Normal0.0625
0.125
0.25
0.5
1
2
4
* p=0.0318
A.
B.
83
STAT5A
APL-diagnostic APL-post-treatment0.1
1
10
100
AZU1
APL-diagnostic APL-post-treatment0.1
1
10
IL8
APL-diagnostic APL-post-treatment0.01
0.1
1
10
CCL2
APL-diagnostic APL-post-treatment0.01
0.1
1
10
SOD1
APL-diagnostic APL-post-treatment0
1
2
3
MMP9
APL-diagnostic APL-post-treatment0
1
2
3
4
5
6
C.
D.
84
2.4.2 Primary APL cells and cell lines U937-NPM-RARΑ and NB4 over-express NF-κB/p65.
APL patient gene expression profiles (Figure 2.1) suggested that NF-κB signaling was
potentially deregulated in APL. To determine whether changes in NF-κB target gene expression
could be associated with increased NF-κB/p65 expression, we assessed the protein expression of
NF-κB/p65 in primary APL blasts, compared to normal bone marrow. Significantly increased
NF-κB/p65 expression was evident in 2/8 patients, while 6/8 patients exhibited moderately
increased p65 expression (Figure 2.2A); normal bone marrow did not have dectectable levels of
NF-κB/p65 protein. Of note, phosphorylated NF-κB/p65 was evident in the 2 patients that
exhibited high levels of total NF-κB/p65. Interestingly, IκBα possessed the opposite expression
pattern, where all APL patient samples exhibited reduced levels of this protein, compared to
normal bone marrow (Figure 2.2A).
Similar to the patient data, both NPM- and PML-RARA expressing cell lines over-expressed NF-
κB/p65 compared to the control U937 and U937-GFP cell lines (Figure 2.2B). Further profiling
of additional NF-κB pathway components showed no dectectable expression differences in
IκBα, IKKα and IKKβ in U937-NPM-RARA cells. NB4 cells appeared to have elevated IKKα
levels (Figure 2.2B).
To determine the sub-cellular distribution of NF-κB/p65 in APL cells, we undertook
immunofluorescent confocal microscopy of U937-NPM-RARA and PML-RARA (NB4) cells
compared to U937-GFP controls. Our analysis indicated that the increased pool of NF-κB/p65 in
U937-NPM-RARΑ and NB4 cells localized both to the cytoplasm and the nucleus, while control
U937-GFP cells exhibited lower levels of NF-κB/p65, localizing primarily outside the nucleus
(Figure 2.2C). Together with othe gene expression deregulation, the aberrant protein expression
and localization of NF-κB/p65 in X-RARA+ patient samples and cell lines indicate that this
pathway is deregulated in APL.
85
Figure 2.2: Western blot and confocal immunofluorescence analysis of total NF-κκκκB protein
levels. A-B) Whole cell lysates from APL patient blood cells, normal bone marrow, control
U937, and U-937-GFP, and APL lines U937-NPM-RARA, and NB4-PML-RARA, cells were
probed using anti-NF-κB/p65, anti-IκBα, anti-phospho-NF-κB/p65, anti-IKKα, anti-IKKβ, and
control anti-β-actin. Protein analysis indicates marked over expression of NF-κB/p65 in the APL
cell lines relative to GFP controls, and also in patient blasts compared to normal bone marrow.
IκBα levels remained unchanged in all lines. β-actin was used as the loading control. C) Cellular
localization of NF-κB/p65 assessed by confocal immunofluorescence using anti- NF-κB/p65
shows increased expression of NF-κB/p65 in the nucleus and cytoplasm of U937-NPM-RARA
and NB4-PML-RARA expressing cells relative to U937-GFP controls. Slides were
counterstained with DAPI to visualize the nucleus.
86
Figure 2.2 A-C: Western blot and confocal immuno-fluorescence analysis of total NF-κκκκB
protein levels.
87
2.4.3 TNFα inhibits colony formation and cellular survival in U937 control, but not X-RARΑ+ cells.
In order to test whether increased accumulation of cellular NF-κB/p65 translates to differences in
cellular survival and proliferation, we tested the cell growth and survival response to TNFα. We
used a methylcellulose-based colony formation assay as an in vitro surrogate for measuring
proliferative potential; in this assay, treatment with TNFα induced a dose dependent decrease in
colony formation in control U937 cells; treatment with 1 ng/mL TNFα resulted in an 85%
decrease in colony formation (Figure 2.3A). Interestingly, we observed that U937-NPM-RARΑ
and PML-RARΑ expressing NB4 cells were significantly less sensitive to TNFα, and retained
the ability to form colonies and proliferate in the presence of this cytokine, even at doses of 100
ng/mL (Figure 2.3A). To evaluate earlier effects of TNFα on APL and control cell cytotoxicity,
we performed a time course (0-96 hrs) study using the MTS assay. TNFα induced a marked
decrease in cell survival of U937-GFP cells. U937-NPM-RARΑ and NB4 cells, in contrast,
exhibited decreased sensitivity to the cytotoxic effects of TNFα (Figure 2.3B). While cell
viability of U937-GFP reduced to 20% after 48 hrs of TNFα treatment (10 ng/mL), PML- and
NPM-RARA-expressing cells exhibited relative viabilities of 100% and 78% respectively (p <
0.05) under the same conditions (Figure 2.3B). Taken together, these data suggest that cells
expressing NPM- and PML-RARA exhibited enhanced survival upon TNFα treatment,
compared to control cells not expressing the fusions.
88
Figure 2.3: NF-κκκκB/p65 over-expressing NPM-RARA and PML-RARA cells have increased
resistance to cell death effects of TNFα. A) Cells were plated in semi-solid media in the
presence or absence of TNFα, incubated, and colonies of greater than 50 cells were counted on
Day 7. Data are represented as relative fold change in colonies relative to the untreated
condition. Colony forming ability of GFP cells were significantly reduced in the presence of
TNFα. NPM- and PML-RARA cells formed more colonies in the presence of TNFα compared
to GFP controls. B) Cells were incubated with TNFα up to 96 hours and cell viability and
growth were assessed using MTS reagent. Chemiluminescence intensity values were recorded
for each sample, background corrected and normalized against the untreated condition. Values
are represented relative to the untreated condition at each time point. Time dependant resistance
to TNFα was observed in MTS assays as cell viabilities of GFP control cells decreased with
increasing exposure to TNFα.
89
Figure 2.3 A-B: NF-κκκκB/p65 over-expressing NPM-RARA and PML-RARA cells have
increased resistance to cell death effects of TNFα.
MTS - TNFαααα time response
untreated 24 48 960.00.10.20.30.40.50.60.70.80.91.01.11.2
NPM-RARAPML-RARAGFP
Time post TNFαααα treatment (hr)
CFU - TNFαααα dose response
0.5 1 2 4 8 16 32 64 1280.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
PML-RARANPM-RARA
GFP
[TNFαααα] ng/ml
A.
B.
90
2.4.4 Enhanced NF-κB/p65 activation upon TNFα signaling in X-RARA cells.
Since X-RARA appeared to confer a survival advantage to cells treated with TNFα, and since
NF-κB was over-expressed in APL samples, we sought to determine whether the NF-κB
signaling pathway had differential activation potential in cells expressing X-RARA. We
observed that TNFα stimulation increasingly induced expression of activated, phosphorylated
NF-κB/p65 in X-RARΑ+ cells, compared to GFP controls (Figure 2.4A, panel 1; Figure 2.4B).
These cells also exhibited a higher level of active phosphorylated NF-κB/p65 under baseline, un-
stimulated conditions. While total levels of NF-κB/p65 were unaffected by TNFα through all
time points (Figure 2.4A, panel 2; Figure 2.4C), phospho- NF-κB/p65 was detected as early as
5 minutes post TNFα treatment in all cell lines, but with increased abundance in both NPM- and
PML-RARΑ+ cells compared to controls (Figure 2.4A, panel 1; Figure 2.4B). All lines
exhibited the expected induction in signal transduction upon stimulation with TNFα, as well as
degradation and reduced expression of the negative regulator of NF-κB/p65, IκBα (Figure 2.4A,
panel 3; Figure 2.4D). TNFα did not affect protein levels of IKKβ, and TNFα-mediated
signaling upstream of NF-κB/p65 remained unaffected in X-RARΑ+ cells, as evidenced by the
equivalent induction of phospho-IKKα/β in control and X-RARΑ+ cells (Figure 2.4A, panels 4
and 5). These studies demonstrated that the activation status of NF-κB/p65 in cells expressing
the APL fusions is sustained at higher levels, baseline and after TNFα induction, compared to
cells not expressing X-RARA.
91
Figure 2.4: NF-κκκκB/p65 signaling response after TNFα stimulation. Western analysis of total
protein lysates obtained after 5 minutes, 15 minutes, and 60 minutes post treatment with TNFα
indicated increased levels of phosphorylated NF-κB/p65 in NPM- and PML-RARA expressing
cells within 5 minutes of exposure to TNFα. Stimulation with TNFα induced IκBα degradation
in all samples as expected, and indicates TNFα mediated activation of the NF-κB pathway. IκBα
expression was restored to baseline levels after 60 minutes of TNFα stimulation. TNFα
stimulation did not induce changes in total levels of NF-κB/p65, phospho IκBα, IKKβ or
phospho IKKα/b. B-D) Band intensities from the western blots were quantified using ImageJ
and plotted to quantify differences between cell lines.
92
Figure 2.4 A-D: NF-κκκκB/p65 signaling response after TNFα stimulation.
93
2.4.5 TNFα induces a distinct NF-κB/p65 target gene expression profile in X-RARΑ+ cells compared to controls.
To determine whether the differential TNFα survival response in APL was associated with
increased activation and transcription of NF-κB/p65 target genes, we used real time quantitative
PCR to evaluate temporal modulation of gene expression levels involved in the NF-κB/p65
signaling network. A principle components analysis of the gene expression profiles of MMP9,
TNFAIP3, STAT5A, VEGFA, MAP3K8, NFKBIA, CCL2, IL8, and ID1 upon treatment with
TNFα alone (Figure 2.5A) or TNFα +ATRA (Figure 2.5F) for 4-120 hrs clearly indicated
distinct gene expression patterns in NPM-RARA and PML-RARA cells in comparison with
GFP. Upon stimulation with TNFα, induction of NF-κB/p65 target genes (e.g., IL8) was
observed within 60 minutes of treatment in control and X-RARΑ+ cells (Figure 2.5C).
Interestingly, TNFα mediated induction of IL8 was inhibited in X-RARA+ cells when TNFα is
used in combination with ATRA. (Figure 2.5E). These data suggests that TNFα mediated
increase in IL8 expression is partially dependent on the presence of PML-RARA and NPM-
RARA, and that ATRA signaling inhibits NF-κB/p65 mediated transcription of IL8.
2.4.6 Treatment with ATRA restores wild type TNF α cell viability response in APL.
We next tested the effects of ATRA on sensitizing cells to TNFα. ATRA induces differentiation
and degrades the X-RARA fusions; we therefore reasoned that ATRA signaling will restore wild
type TNFα response in X-RARA. Cells were treated with 10-6 M ATRA, singly and in
combination with TNFα, and cell viability was assessed by MTS. ATRA and TNFα had an
additive effect on the viability of NPM-RARA cells – the drug combination resulted in a
decreased viability and restored the wild type TNFα responsiveness in NPM-RARA cells
(Figure 2.6 A-D). ATRA did not appear to modify the TNFα response in control cells,
suggesting that the abnormal TNFα response in NPM-RARA cells is a consequence of the
presence of NPM-RARA. In PML-RARA expressing cells, ATRA and TNFα also exhibit an
additive effect, however this cell line appears to have a higher degree of resistance to TNFα-
mediated toxicity (Figure 2.6 E)
94
Figure 2.5: Expression profiles of the NF-κκκκB/p65 gene interaction network and target genes
after TNFα stimulation. A) RQ-PCR was performed to analyze changes in expression levels of
9 genes in the NF-κB interaction network after TNFα treatment. Clustering of samples using
PCA using this gene expression profile indicated that NPM- and PML-RARA expressing cells
have distinct gene expression changes in response to TNFα, compared to U937-GFP control
cells. B-E) Analysis of IL8 gene expression profile after treatment with TNFα, ATRA, and
TNFα+ATRA, compared to untreated controls. All treated samples were compared with the
corresponding untreated sample. In the untreated condition, data are represented as fold change
relative to U937-GFP control cells. F) Cells treated with a combination of ATRA and TNFα
continued to maintain distinct gene expression profiles after treatment with the combination.
95
2.5 A-C: Expression profiles of the NF-κκκκB/p65 gene interaction network and target genes
after TNFα stimulation.
96
Figure 2.6: Effects of ATRA in modifying TNFα response in NPM-RARA cells. A-C,E)
Control U937-GFP, U937-NPM-RARA and NB4-PML-RARA cells were treated singly and in
97
combination with TNFα and ATRA and cell viability was assessed using the MTS assay after 48
hours of treatment. Values are represented as cell viability relative to the vehicle treated
condition for each cell line. The combination of ATRA and TNFα worked similar to TNFα
alone in control U937-GFP cells. In U937-NPM-RARA cells, the combination of ATRA and
TNFα enhanced the effects of TNFα alone, and resulted in decreased cell proliferation and
survival. TNFα and ATRA also had an additive effect on NB4 cells. D) Additive effects of
ATRA on TNFα response in NPM-RARA cells are demonstrated using EOBA scores, calculated
as described in the methods.
98
Figure 2.6: Effects of ATRA in modifying TNFα response in NPM-RARA cells.
99
2.4.7 Pharmacological inhibition of p65 restores TNFα sensitivity in NPM-RARΑ+ cells.
Finally, in order to test if the pro-survival effects mediated by TNFα in APL are due to increased
activity of NF-κB/p65 in cells, we treated cells with NF-κB inhibitors (SN50 peptide and
parthenolide) and assessed their effects on cell viability and proliferation. Cells were pre-
incubated with SN50, SN50M control peptide, or parthenolide, and then stimulated with
TNFα to trigger NF-κB activity. The SN50 cell permeable inhibitor peptide (Calbiochem) binds
and inhibits translocation and activation of p65 in cells. Cells were treated with either the
inhibitor or control peptide in combination with TNFα, and cell survival assessed by MTS. SN50
alone reduced cell viability in our cell lines (Figure 2.7A, G), while the control peptide had no
discernable effect on cellular survival (Figure 2.7B, H). As we observed previously, TNFα
induced significant cell death in GFP controls, but not NPM-RARΑ+ or PML-RARΑ+ cells.
Upon inhibition of NF-κB/p65, TNFα was able to induce cell death effects in NPM-RARΑ+ and
PML-RARΑ+ cells (Figure 2.7 C,E,I). This effect of SN50 and TNFα in inducing cell death
was apparent in control and X-RARΑ+ cells. Our results indicate that treatment with SN50 was
sufficient to decrease viability in NPM-RARΑ and PML-RARA expressing cells and re-establish
the wild type response to TNFα.
Parthenolide is another known inhibitor of NF-κB, exerting its effects by binding to, and
inhibiting the activation of the upstream signaling protein IKKA (Hehner et al., 1999). It is also
known to alkylate NF-κB/p65 cysteine residues and thus directly inhibit NF-κB/p65 (Garcia-
Pineres et al., 2001). Parthenolide mediates other anti-oncogenic effects in leukemia cells,
including inhibition of STAT3, activation of reactive oxygen species, and down-regulation of
HDAC1. We observed that treatment with sub-lethal doses of parthenolide (0.1-0.5 µM)
sensitized cells to TNFα mediated cell death, and restored TNFα responsiveness in X-RARA+
cells (Figure 2.7J-O).
100
Figure 2.7: Effects of NF-κκκκB inhibitors (SN50 and Parthenolide) on TNFα induced
sensitivity to cell death in NPM-RARA and PML-RARA cells. A-F) Control U937-GFP and
U937-NPM-RARA were treated with vehicle controls, SN50, TNFα, and a combination of SN50
and TNFα. A, C) TNFα treatment alone decreased cell viability significantly in control U937-
GFP cells. A, E) The combination of SN50 and TNFα decreased cell proliferation and survival
in NPM-RARA+ cells. B, D, F) Treatment with the control peptide had no significant effect on
cell viability in any cell line. G-I) SN50 and the control peptide treatment in NB4-PML-RARA
also induced similar dose responses. J-M) Parthenolide mediated decrease in NF-κB/p65 activity
was sufficient to reduce proliferation and re-sensitize NPM-RARA cells to cell death induced by
TNFα. M) Dose ranges where Parthenolide and TNFα exert synergistic effects on NPM-RARA
cells are indicated using EOBA scores. N-O) Similar effects of Parthenolide on TNFα response
is indicated for NB4-PML-RARA cells.
101
Figure 2.7 A-O: Effects of NF-κκκκB inhibitors SN50 and Parthenolide on TNFα induced
sensitivity to cell death in NPM-RARA and PML-RARA cells.
102
0.0
0.2
0.4
0.6
0.8
1.0
1.2
Treatment
0.0
0.2
0.4
0.6
0.8
1.0
1.2
Treatment
0.0 2.5 5.0 7.5 10.0 12.5 15.0 17.50.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4 Control PeptideSN50
[Drug] ug/ml
G. H.
I.
103
104
0.0
0.2
0.4
0.6
0.8
1.0
1.2
NB4-PML-RARA
0.00 0.25 0.50 0.75 1.00 1.250.0
0.2
0.4
0.6
0.8
1.0
1.2
1.4Parthenolide
Parthenolide + TNFα
[Parthenolide] µµµµM
N.
O.
105
2.5 Discussion
Our report implicates deregulated NF-κB/p65 mediated survival signaling in the pathogenesis of
PML- and NPM-RARΑ+ APL. We demonstrate that both PML-RARA and NPM-RARΑ induce
a pro-survival phenotype upon TNFα stimulation, and that this is correlated with increased
abundance and activation of NF-κB/p65 in cells. Furthermore, inhibition of NF-κB/p65, as well
as treatment with ATRA, restored wild type TNF response in APL cells.
To date NPM-RARA has been identified in 6 cases of APL worldwide, making it the third most
frequent translocation in this disease (Okazuka et al., 2007). Unlike PML-RARA, NPM-RARA
does not interact with PML within the leukemic cell (Rush et al., 2006), and therefore does not
disrupt PML mediated functions within the cell. More recently it was reported that, unlike PML-
RARA, NPM-RARA does not constitutively activate autophagy in leukemia cells, and that this
mechanism therefore does not contribute to its anti-apoptotic role in the cell (Huang et al., 2011).
The effects of NPM-RARA on cell survival and apoptosis and its mechanism of action have not
been well characterized. Our study is the first that implicates this variant fusion in the
maintenance of a pro-survival phenotype.
Our group previously determined that NPM-RARA confers sensitivity to apoptosis induced by
the PPARγ agonist Troglitazone. This apoptotic response to Troglitazone was also observed in
NB4, as well as other ATRA sensitive AML cell lines (Gu et al., 2006; Kamel-Reid et al., 2003).
Several lines of evidence implicate the reduction of PPARγ protein and/or signaling to a
concomitant increase in NF-κB activity. In B cells for example, PPARγ insufficiency was shown
to promote NF-κB activation (Kato et al., 2006; Setoguchi et al., 2001). Loss of PPARγ results in
increased accumulation of NF-κB and increased expression of the NF-κB transcriptional target,
CyclinD1 (Kato et al., 2006). Activation of the PPARγ pathway can reduce cell growth and
proliferation and cancer progression in an in vivo thyroid cancer model (Kato et al., 2006).
PPARγ activation is also associated with reduced levels of NF-κB and cyclinD1 levels. We also
previously established that NPM-RARA recognizes and binds to peroxisome proliferator
activator receptor gamma response elements (PPREs) in a complex with RXRA, thereby co-
opting wild type PPARγ signaling in NPM-RARA positive cells. It is likely, therefore, that the
increased NF-κB/p65 protein levels and activity in NPM-RARA cells are, in part, consequences
106
of decreased PPARγ signaling in these cells. In this model, we envision a scenario where
Troglitazone mediated activation of PPARγ serves to decrease NF-κB signaling in NPM-RARA
cells, therefore promoting apoptosis.
Cellular survival in response to various signals in the bone marrow microenvironment is a
critical target for deregulation in leukemia. The bone marrow microenvironment produces
signals in the form of cytokines and chemokines that regulate hematopoietic cell survival. TNFα
is a pro-inflammatory cytokine that regulates cellular survival by regulating apoptosis,
differentiation, and cellular proliferation. Our evidence suggests that increased NF-κB/p65
expression and activity in NPM-RARA cells may protect APL blasts against TNFα mediated
apoptosis and loss of self-renewal, and therefore contribute to their persistence and accumulation
in the bone marrow. Previous studies (Testa et al., 1998) undertaken using PML-RARA
expressing cells demonstrated increased resistance to TNFα mediated apoptosis partially
mediated by down-regulation of TNFα receptors; our work describes an alternative pathway
contributing to TNFα resistance in both NPM-RARA and PML-RARA expressing APL.
Recent studies have demonstrated the ability of PML-RARΑ to enhance self renewal in bone
marrow progenitor cells in APL, leading to expansion of the progenitor population (Welch et al.;
Wojiski et al., 2009). Leukemogenesis occurs as transformed progenitors self renew and acquire
a pro-survival and/or proliferative advantage. Deregulation of NF-κB resulting in enhanced
survival is one “hit” that can then cooperate with the oncogenic APL fusions. Other in vitro
studies have indicated that leukemic fusion proteins activate the Wnt pathway that can confer
self renewal properties to the cell (Muller-Tidow et al., 2004; Zheng et al., 2004).
There are two ways to target increased self renewal – forced differentiation or induced cell death;
both of these processes are influenced by the activation and regulation of NF-κB/p65. Several
studies have shown that NF-κB mediated survival plays a role in the accumulation of
differentiated APL cells after treatment with ATRA, and have demonstrated that inhibiting NF-
κB results in decreased viability of the differentiated cells (Mathieu et al., 2005). Arsenic
Trioxide was found to down-regulate NF-κB and thereby contributes to APL cell apoptosis in
ATRA treated cells (Mathieu and Besancon, 2006). Both these studies implicate NF-κB
activation with pathogenesis and response to therapy in APL (Mathieu and Besancon, 2006).
107
Other studies have also associated Arsenic Trioxide’s cytotoxic effects to inhibition of the NF-
κB pathway. (Witcher et al., 2003) reported a significant degree of interaction between ATRA
and TNFα pathways in promoting differentiation. The combination of ATRA and TNFα also
results in increased NF-κB activity. They describe a model whereby ATRA and TNFα induce
the expression of genes involved in inhibiting the apoptosis response, while promoting
differentiation. They subsequently identified a transcriptional synergy that exists between TNFα
and ATRA, whereby treatment with ATRA induced chromatin modification resulting in
transcriptional activation and recruitment and binding of NF-κB to selected gene promoters
(Witcher et al., 2008). Interestingly this synergy was only evident on selected gene promoters
including DIF2, which has roles in cellular differentiation. Other genes, including IL8, did not
exhibit this induction in NF-κB binding activity upon addition of ATRA in combination with
TNFα, suggesting that certain cellular processes such as cellular differentiation may be regulated
by ATRA and TNFα, whereas other genes involved in cellular survival and proliferation may be
dominantly regulated by TNFα. The subset of genes that we analyzed to determine the growth
and survival response of cells in response to TNFα and ATRA singly and in combination did not
indicate a substantial degree of synergy between the two agents.
In a meta-analysis of genes deregulated in APL samples, (Marstrand et al., 2010), identified that
genes containing NF-κB binding sites were overrepresented in APL datasets. Additionally they
showed that treatment with the NF-κB inhibitor Parthenolide inhibited APL cell proliferation and
apoptosis. Our work extends these observations to the NPM-RARA model system, and also
indicates that pharmacological inhibition of NF-κB acts independently of ATRA in reducing cell
proliferation and survival. This may be due to the distinct pathways that the two compounds
target. ATRA induces gene expression changes and activates cellular differentiation pathways,
while inhibitors of NF-κB target cellular proliferation in response to mitogenic stimuli. ATRA
treatment directs cells toward terminal differentiation, and this effect overrides the anti-
proliferative state that NF-κB inhibitors induce.
The mechanism of NF-κB/p65 deregulation in APL and the potential for interaction between the
oncogenic fusions and NF-κB/p65 are still not completely understood. Our results show over-
expression of the Mitogen-activated protein kinase kinase kinase 8 (MAP3K8), a kinase that
108
phosphorylates and thereby activates IκB kinases, and thereby promotes activation of NF-
κB/p65. Increased expression of MAP3K8 may therefore promote NF-κB/p65 translocation and
contribute to its deregulated activity in APL. Also, as reported previously, decreased PPARγ
signaling has been associated with increased NF-κB activation and subsequent increase in
proliferation and decrease in apoptosis. Deregulated NF-κB signaling in our cell models could
therefore be the result of decreased PPARγ signaling as the fusions are known repressors of this
pathway. Along these lines, another study reported a physical interaction between NF-κB/p65
and RXRA in vitro (Na et al., 1998a; Na et al., 1998b). This interaction would potentially allow
for the existence of a complex comprising of NF-κB/p65 and the X-RARΑ-RXRA heterodimer
within the APL cell. We would expect that the recruitment of such transcriptional complexes
containing additional transactivation domains on target promoter sequences would result in
deregulated expression of both NF-κB/p65 and retinoid target genes. More work in this area is
required in order to identify the specific mechanism of X-RARΑ mediated deregulation of NF-
κB/p65 in APL.
Several studies investigated the mechanisms of constitutive NF-κB activation and regulation in
hematologic malignancies. (Paz-Priel et al., 2011) reported that CEBPα binds NF-κB/p50 to
activate transcription of anti-apoptotic genes BCL2 and FLIP. NF-κB/p50 in turn binds and
activates CEBPα. CEBPα mutants reported in AML bind p50 promoter to induce its expression.
CEBPα disrupts p50 interaction with HDAC’s when bound to anti-apoptotic genes thereby
contributing to NF-κB deregulation in AML. Interaction between activated ATM and its
interaction with the NF-κB upstream activator and signal transducer, NEMO is another
mechanism that maintains constitutive NF-κB activation in AML (Grosjean-Raillard et al.,
2009). They also identified that ATM inhibitors have the potential to synergize with NF-κB
inhibitors to induce AML cell death.
Thus, taken together, our report identifies a role for NPM-RARA in promoting cellular survival
in APL through deregulation of NF-κB/p65, a key protein involved in regulating cell
proliferation and survival. Deregulation of NF-κB/p65 leads to abnormal downstream signaling
via the TNFα pathway in APL. Future work focusing on the mechanism of NF-κB deregulation
and the clinical use of NF-κB and TNFα inhibitors in APL, and AML generally, will allow
109
further understanding into the pathogenesis and treatment of this leukemia, with the potential for
extension to other AMLs as well.
2.6 Conclusions
In this report we provide evidence for the deregulation of the NF-κB signaling network in NPM-
RARA and PML-RARA expressing APL cell systems. This is further correlated with increased
baseline resistance to TNFα induced cell death in APL. Ours is the first report identifying NF-
κB and TNFα signaling alterations as cooperating events in variant fusion expressing APL.
110
Chapter 3
Comparative analysis of downstream genetic targets of the variant Acute Promyelocytic
Leukemia fusion proteins NPM-RARA and NuMA-RARA
Mariam Thomas, Mahadeo A. Sukhai, Suzanne Kamel-Reid.
Co-Author contributions:
MAS processed and analysed publicly available gene expression datasets using the Partek
Genomics Suites software. MAS derived heatmap images in Figure 3.5 and Figure 3.6 using the
“R” statistical package. MAS and SKR reviewed all data analysis and interpretation.
111
3 Comparative analysis of downstream genetic targets of the variant Acute Promyelocytic Leukemia fusion proteins NPM-RARA and NuMA-RARA
3.1 Abstract
Acute promyelocytic leukemia (APL) is characterized by accumulation of abnormal
promyelocytes in the bone marrow and peripheral blood, and sensitivity to all-trans retinoic acid
(ATRA) treatment. APL cases have a balanced chromosomal translocation involving retinoic
acid receptor alpha (RARA) on chromosome 17. The resulting fusion proteins (X-RARA) are
aberrant transcription factors and block ATRA-induced neutrophil differentiation. Loss of
RARA signaling impairs granulopoiesis, but is not sufficient to cause a leukemic phenotype. We
sought to determine the identities of additional signaling pathways, which can potentially
cooperate with X-RARA in APL, that are commonly modulated by multiple X-RARA during
APL pathogenesis. We used U937 hematopoietic cell line models retrovirally transduced with
NPM-RARA and NuMA-RARA to determine the common genes and pathways deregulated in
APL. Affymetrix transcriptome analysis indicated that a total of 242 probesets were deregulated
at least 2-fold by NuMA-RARA (160/242 up-regulated, 82/242 down-regulated) and 444
probesets deregulated by NPM-RARA (250/444 up-regulated, 194/444 down-regulated). A total
of 105 probesets were commonly deregulated by both X-RARA (71/105 up-regulated, 34/105
down-regulated). Commonly deregulated genes were involved in cellular signal transduction and
inflammatory signaling. Promoter elements within deregulated gene targets showed an over-
representation of binding sites for the FOX family of transcription factors, implying that this
transcriptional network may cooperate with the fusion in disease development. A meta-analysis
using publicly available datasets describing direct binding targets of PML-RARA and PLZF-
RARA, indicated overlap between these targets and genes deregulated by NPM-RARA.
Overlapping genes may be potential direct targets of NPM-RARA. Further, analysis of genes
differentially regulated by leukemic stem cell (LSC) fractions demonstrated that the fusions also
exhibit deregulated expression of a subset of the LSC signature gene set. Our next goal was to
use gene expression profiles of the fusions to inform therapeutic strategies. In this regard, we
analyzed gene expression profiles induced by ATRA which is currently used in the APL
treatment regiment. These results indicated that while a subset of genes responding to ATRA
112
were wild type retinoid responsive genes, ATRA also induced the expression of a substantial
number of genes unique to each fusion. We also attempted to use the fusions’ ATRA responsive
gene profiles to identify other compounds that induce similar effects. Connectivity map analysis
identified a significant overlap in the profiles of compounds with prostaglandin signaling activity
with ATRA’s expression profile in the fusions. These data represent the first comparison of the
genetic profiles of the variant fusion proteins NPM-RARA and NuMA-RARA and their ATRA
response in a hematopoietic cell system and are a significant step in identifying key targets that
cooperate with X-RARA in the development of APL.
113
3.2 Introduction
APL is characterized by impaired granulocytic differentiation, leading to the accumulation of
promyelocytes in the bone marrow and peripheral blood (Bennett et al., 1976); association with
chromosomal translocations involving the retinoic acid receptor alpha (RARα) gene locus; and a
unique sensitivity to treatment with all-Trans retinoic acid (ATRA) (Flynn et al., 1983). More
than 99% of APL cases involve a balanced chromosomal translocation t(15;17)(q22;q21),
resulting in the fusion of the promyelocytic leukemia (PML) gene with RARA (de The et al.,
1990; de The et al., 1991). Other “variant” partner genes (collectively called “X”) have been
characterized: PLZF (Chen et al., 1993a) NPM (Hummel et al., 1999; Redner et al., 1996);
NuMA (Wells et al., 1997; Wells et al., 1996); STAT5b (Arnould et al., 1999); PRKAR1A
(Catalano et al., 2007); FIP1L1 (Kondo et al., 2008), (Menezes et al., 2011); and, BCOR
(Yamamoto et al., 2010).
It is currently accepted that X-RARA aberrantly repress gene transcription and thus deregulate
genes important in myeloid differentiation, resulting in the observed block in maturation and
increased hematopoietic progenitor self-renewal (Welch et al., 2011). In many cases, the
differentiation block can be overcome by treatment with pharmacological doses of ATRA (>10-7
M) (Melnick and Licht, 1999). This can be accounted for by the fusions’ increased ability to bind
SMRT and N-CoR, thus requiring pharmacological doses of ATRA for dissociation. X-RARA
have altered DNA binding properties (Melnick and Licht, 1999), and can bind retinoic acid
response elements (RAREs) as homodimers (Perez et al., 1993), or heterodimers with the
retinoid X receptor Α (RXRA), while wild type RARA only binds as a heterodimer (Leid et al.,
1992). Work from our lab suggests that NPM-RARA, and NuMA-RARA bind RAREs as
heterodimeric complexes with RXRA in vitro. (Kamashev et al., 2004) demonstrated that PML-
RARA oligomers have a more relaxed DNA binding profile, and bind DNA as a complex with
RXRA. This was further shown to occur in vivo as the fusion complex bound a diverse range of
DR sites (Martens et al., 2010; Wang et al., 2010). Our group also demonstrated that RXRA was
required for leukemogenesis in hCG-NuMA-RARA transgenic mice (Sukhai et al., 2008).
A number of studies have focused on understanding the role of PML-RARA in APL
pathogenesis, and its downstream effects on gene expression. The RA resistant PLZF-RARA
114
expressing variant of APL has also been studied at the level of gene expression. To date the
downstream genetic targets of NuMA- and NPM-RARA have yet to be described. While only
seen to occur in a handful of patients worldwide, the study of these variant fusions will enhance
the understanding of fusion biology in APL and offer insights to disease mechanisms and
targeting strategies in AML. Our work is the first to identify downstream transcriptional targets
of NPM-RARA and NuMA-RARA. This further expands our understanding of NPM- and
NuMA-RARA mediated effects in APL, and offers strategies to inform therapeutics in this
leukemia.
115
3.3 Materials and Methods
3.3.1 Cell culture and reagents.
The NuMA-RARA clones were generated by stable transduction of U937 cells as described in
(Sukhai et al., 2011). Empty vector transduced U937-GFP cells were used as controls. All X-
RARA and mock transduced U937 clones were cultured in RPMI 1640 medium supplemented
with L-glu, 50 U/ml penicillin, 50ug/ml streptomycin and 10 % FBS in a humidified incubator
under 5% CO2. Cells were treated with 1 µM ATRA (Sigma) for 2 – 72 hrs, or 1-5 µM arsenic
trioxide (ATO) for 2 – 72 hrs (Sigma) to assess cell differentiation and cell death responses
respectively.
3.3.2 Western blot analysis.
Cells were lysed using native protein extraction buffer containing a protease inhibitor cocktail
(Roche) by passing through a 21G needle and syringe. Cell lysates were centrifuged to remove
cellular debris and the protein was quantified using the Bradford assay. 30ug of protein from
each cell line was loaded on a SDS-PAGE, transferred to PVDF membranes, blocked with 5%
milk and incubated with the rabbit anti-RARA antibody (Santa Cruz) overnight. Blots were
detected by chemiluminescence using ECLplus after incubation with donkey-anti rabbit IgG-
HRP.
3.3.3 Cell differentiation by flow cytometry analysis.
All samples collected for flow cytometry were washed and resuspended in PBS. Samples were
incubated with antibodies (BDPharmingen) to cell surface antigens CD45 (leukocyte common
antigen), CD117 (c-Kit), and CD11b (myeloid cell-surface antigen). Incubations were carried out
at 4oC in a light protected environment. After incubation, samples were washed, resuspended in
PBS and analysed on a Becton Dickinson FACScalibur flow cytometer. Data acquisition and
analysis were accomplished using CellQuest software.
116
3.3.4 Cell viability and apoptosis analysis.
Cells were treated with the appropriate agent and harvested, washed twice with PBS, and stained
with AnnexinV/PI according to manufacturers’ instructions (BD biosciences). Cells were
analysed by flow cytometry as described previously (Kamel-Reid et al., 2003).
3.3.5 Experimental design and array hybridization.
4x106 cells from each cell line (U937-GFP, U937-NuMA-RARA, U937-NPM-RARA) were
plated in triplicate in the presence and absence of 1 µM ATRA for 4 hours. Total RNA was
extracted from all lines using TRIzol reagent (Invitrogen) and purified using the RNeasy Mini kit
(Qiagen), both according to manufacturers’ instructions. Equal amounts of RNA from triplicate
samples were pooled prior to array hybridization to reduce inter-sample variability. RNA was
quantified and sent for hybridization on the Affymetrix human genome U133 Plus 2.0 array
platform at the Centre for Applied Genomics at the Hospital for Sick Children (Toronto, ON).
Briefly, 10 µg of total RNA was used for cRNA amplification using the Invitrogen SuperScript
kit (Life Technologies, Inc., Burlington, ON, Canada). Amplification and biotin labeling of
antisense cRNA was performed using the Enzo BioArrayTM High YieldTM RNA transcript
labeling kit (Enzo Diagnostics, Farmingdale, NY, USA), according to the manufacturer’s
instructions. Microarray slides were scanned using the GeneArray 2500 scanner (Agilent
Technologies).
3.3.6 Microarray data analysis.
Microarray data were scaled and normalized using GCOS v5.0 software, and subsequently
analyzed by Genespring v7.3 (Agilent) to identify differentially regulated genes in X-RARA
expressing cells. Probe sets were filtered based on signal intensity values. Probe sets were
further filtered to retain those that satisfy a fold change cut off of 2 fold up- or down-regulated
compared to the control condition. Differentially regulated probe sets were analyzed for over-
represented Gene Ontology classifiers and KEGG pathways using the online GENECODIS tool
(http://genecodis.dacya.ucm.es/) (Tabas-Madrid et al., 2012), and the Molecular Signatures
Database (MSigDB; online at: http://www.broadinstitute.org/gsea/msigdb/index.jsp)
(Subramanian et al., 2005). Promoter elements of gene targets were assessed to identify over-
represented transcription factor motifs using the online tool Pscan
117
(159.149.109.9/pscan/help.html) (Zambelli et al., 2009). The fusion gene expression signature, as
well as the ATRA signature in APL was queried using the connectivity map tool (cmap;
http://www.broadinstitute.org/cmap/) (Lamb et al., 2006), which is a collection of gene
expression data obtained from cell cultures treated with bioactive compounds. Using algorithms
that match the input expression signature pattern with that of the entries in the database, the tool
allows the identification of small molecules and bioactive compounds that induce common
changes in gene expression.
3.3.7 Analysis of publicly available gene expression datasets.
The U937-NPM-RARA gene signature was assessed in 2 publicly available gene expression
datasets comparing LSCs with normal HSCs (Gentles et al., 2010; Majeti et al., 2009), as well as
another dataset comparing APL patient samples with normal promyelocytes, (Payton et al.,
2009); array datasets archived online in the NCBI Gene Expression Omnibus database, accession
#: GSE 24006, GSE 17054, GSE 12662. Mean fold-change for the LSC vs. HSC, as well as APL
vs. Promyelocytes comparisons were calculated for all genes, and statistical significance was
assessed by ANOVA. Lists of significantly differentially expressed genes were thus derived for
each population comparison. Visualization of gene expression profiles was performed using the
programming package “R” (v2.13.1) (http://www.R-project.org/) and the NeatMap visualization
algorithm (Rajaram and Oono, 2010). Individual genes included in the visualization set were
normalized to the sample population mean for that gene; a Z score was calculated as Z=
(expression – mean)/standard deviation in order to generate heatmaps. Genes in the heatmaps
were ordered by significance and fold-change, and samples were grouped by sample category.
118
3.4 Results
3.4.1 Transcriptional targets of NPM-RARA and NuMA-RARA are involved in diverse cellular functions.
To identify downstream genetic targets commonly modulated by multiple X-RARA, we
performed microarray analysis of U937-NPM-RARA and U937-NuMA-RARA cells, as well as
the empty vector-transduced U937-GFP line (Figure 3.1). A 331 gene set was identified to be
deregulated in U937-NPM-RARA cells compared to control U937 (see Appendix I Table
A3.1). The top three gene ontology classifiers (biological processes) represented by these
deregulated genes included signal transduction (39 genes), blood coagulation (20 genes), and
inflammatory process (16 genes) (Figure 3.2). We further assessed the signal transduction
networks deregulated by NPM-RARA, through analysis of the REACTOME, BIOCARTA and
KEGG databases. From this analysis, we determined that NPM-RARA-deregulated genes were
involved in cellular signaling networks including cytokine receptor interactions, NOD-like
receptor signaling, and PPAR signaling pathways (Table 3.1).
Similarly, U937-NuMA-RARA cells exhibited deregulated expression of 184 genes (see
Appendix I Table A3.2). A number of GO biological processes were over-represented within
this dataset; most significantly: signal transduction (25 genes), blood coagulation (12 genes), and
chemotaxis (10 genes). Cellular pathways involved in cytokine receptor interactions and steroid
biosynthesis were over-represented within the dataset, as well (Table 3.2). Genes commonly
deregulated by both NuMA- and NPM-RARA (77 genes) (Table 3.3), included several
transcription factors (ID1, JUN, MAFB, MAFF, PRDM1), cell surface markers (CD48, CD52)
and the IL8 cytokine. These commonly deregulated genes also represent pathways involved in
cytokine receptor interactions (6 genes), chemokine signaling (5 genes), and tryptophan
metabolism (3 genes) (Table 3.4).
119
Figure 3.1: Distribution of probesets deregulated by X-RARA. A) Probesets differentially
regulated at least 2-fold in NuMA-RARA vs. GFP, and NPM-RARA vs. GFP are quantified and
represented according to their regulation pattern. B) NuMA-RARA and NPM-RARA up-
regulated; and C) down-regulated genes are compared in a Venn diagram to indicate degree of
overlap between the two fusions.
120
Figure 3.1: Distribution of probesets deregulated by X-RARA.
121
Table 3.1: KEGG pathways identified to be significantly over-represented within genes deregulated by NPM-RARA.
KEGG # genes overlap
List size
p-value p-value corrected
Probeset IDs
Cytokine-cytokine receptor interaction
12 330 0.0009039 0.016836 39402_at,226218_at,223502_s_at,209294_x_at,209774_x_at,208944_at,204533_at,207008_at,205476_at,211506_s_at,216598_s_at,211527_x_at
NOD-like receptor signaling pathway
6 330 0.0003109 0.011581 39402_at,209774_x_at,202644_s_at,210538_s_at,211506_s_at,216598_s_at
Chemokine signaling pathway
10 330 0.0007905 0.019632 213135_at,209774_x_at,204533_at,1555340_x_at,207008_at,205476_at,211506i_s_at,207124_s_at,216598_s_at,239294_at
PPAR signaling pathway
6 330 0.0008734 0.01859 205769_at,205222_at,202075_s_at,218322_s_at,228766_at,204475_at
Focal adhesion 10 330 0.0013345 0.018076 215177_s_at,211966_at,200953_s_at,1555340_x_at,210538_s_at,201464_x_at,201700_at,239294_at,211527_x_at,201124_at
mTOR signaling pathway
6 330 0.0001674 0.008312 219599_at,225915_at,211690_at,202887_s_at,239294_at,211527_x_at
Tryptophan metabolism
5 330 0.000445 0.013261 200628_s_at,205222_at,217388_s_at,205749_at,203559_s_at
122
Table 3.2: KEGG pathways identified to be significantly over-represented within genes deregulated by NuMA-RARA.
KEGG # genes overlap
List size
p-value p-value corrected Probeset IDs
Cytokine-cytokine receptor interaction
9 185 0.00052 0.0165 226218_at,223501_at,204533_at,205898_at,205476_at,203935_at,1553297_a_at,211506_s_at,216598_s_at
Steroid biosynthesis
4 185 2.28E-05 0.0011 211423_s_at,221561_at,209218_at,209146_at
123
Table 3.3: Commonly deregulated gene targets identified in both NPM-RARA and NuMA-RARA expressing cells relative to control U937-
GFP
Probe Set ID Regulation Unigene (Avadis)
Gene Symbol Gene Title
1553194_at Down Hs.146542 NEGR1 neuronal growth regulator 1 1555247_a_at Down Hs.483329 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 1555339_at Down Hs.190334 RAP1A RAP1A, member of RAS oncogene family 1555340_x_at Down Hs.190334 RAP1A RAP1A, member of RAS oncogene family 1558290_a_at Down Hs.133107 PVT1 Pvt1 oncogene homolog (mouse) 201951_at Down Hs.591293 ALCAM activated leukocyte cell adhesion molecule 201952_at Down Hs.591293 ALCAM activated leukocyte cell adhesion molecule 202648_at Down 205110_s_at Down Hs.6540 FGF13 fibroblast growth factor 13 205376_at Down Hs.658245 INPP4B inositol polyphosphate-4-phosphatase, type II, 105kDa 206759_at Down Hs.465778 FCER2 Fc fragment of IgE, low affinity II, receptor for (CD23) 206760_s_at Down Hs.465778 FCER2 Fc fragment of IgE, low affinity II, receptor for (CD23) 207543_s_at Down Hs.500047 P4HA1 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase),
alpha polypeptide I 208937_s_at Down Hs.504609 ID1 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein 209560_s_at Down Hs.533717 DLK1 delta-like 1 homolog (Drosophila) 210254_at Down Hs.99960 MS4A3 membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-
specific) 213350_at Down Hs.433529 RPS11 Ribosomal protein S11 213826_s_at Down LOC100133109 similar to histone 218976_at Down Hs.260720 DNAJC12 DnaJ (Hsp40) homolog, subfamily C, member 12 219112_at Down Hs.483329 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 219697_at Down Hs.622536 HS3ST2 heparan sulfate (glucosamine) 3-O-sulfotransferase 2 219714_s_at Down Hs.656687 CACNA2D3 calcium channel, voltage-dependent, alpha 2/delta subunit 3
124
223501_at Down Hs.525157 TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b 223721_s_at Down Hs.260720 DNAJC12 DnaJ (Hsp40) homolog, subfamily C, member 12 224356_x_at Down Hs.523702 MS4A6A membrane-spanning 4-domains, subfamily A, member 6A 225942_at Down Hs.247460 NLN neurolysin (metallopeptidase M3 family) 226789_at Down Hs.697682 LOC647121 embigin homolog (mouse) pseudogene 228055_at Down Hs.636624 NAPSB napsin B aspartic peptidase pseudogene 229461_x_at Down Hs.146542 NEGR1 neuronal growth regulator 1 230078_at Down Hs.483329 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 235046_at Down Hs.176376 Transcribed locus 242476_at Down Hs.605126 Transcribed locus 243357_at Down Hs.146542 NEGR1 neuronal growth regulator 1 1554892_a_at Up Hs.99960 MS4A3 membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-
specific) 1554899_s_at Up Hs.433300 FCER1G Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide 1556657_at Up Hs.687293 CDNA FLJ36459 fis, clone THYMU2014762 1556658_a_at Up Hs.687293 CDNA FLJ36459 fis, clone THYMU2014762 1569403_at Up Hs.670065 CDNA clone IMAGE:4706427 1570561_at Up 200748_s_at Up Hs.524910 FTH1 ferritin, heavy polypeptide 1 201324_at Up Hs.436298 EMP1 epithelial membrane protein 1 201325_s_at Up Hs.436298 EMP1 epithelial membrane protein 1 201464_x_at Up Hs.525704 JUN jun oncogene 201700_at Up Hs.534307 CCND3 cyclin D3 202241_at Up Hs.444947 TRIB1 tribbles homolog 1 (Drosophila) 202859_x_at Up Hs.551925 IL8 interleukin 8 202887_s_at Up Hs.523012 DDIT4 DNA-damage-inducible transcript 4 202890_at Up Hs.486548 MAP7 microtubule-associated protein 7 202917_s_at Up Hs.416073 S100A8 S100 calcium binding protein A8 202932_at Up Hs.194148 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 202933_s_at Up Hs.194148 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 202988_s_at Up Hs.75256 RGS1 regulator of G-protein signaling 1
125
203535_at Up Hs.112405 S100A9 S100 calcium binding protein A9 203559_s_at Up Hs.647097 ABP1 amiloride binding protein 1 (amine oxidase (copper-containing) 203767_s_at Up Hs.522578 STS steroid sulfatase (microsomal), isozyme S 203936_s_at Up Hs.297413 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa type IV
collagenase) 204017_at Up Hs.709898 KDELR3 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 204044_at Up Hs.513484 QPRT quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylase
(carboxylating) 204118_at Up Hs.243564 CD48 CD48 molecule 204232_at Up Hs.433300 FCER1G Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide 204533_at Up Hs.632586 CXCL10 chemokine (C-X-C motif) ligand 10 205222_at Up Hs.429879 EHHADH enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase 205476_at Up Hs.75498 CCL20 chemokine (C-C motif) ligand 20 205749_at Up Hs.72912 CYP1A1 cytochrome P450, family 1, subfamily A, polypeptide 1 206332_s_at Up Hs.380250 IFI16 interferon, gamma-inducible protein 16 207554_x_at Up Hs.442530 TBXA2R thromboxane A2 receptor 209955_s_at Up Hs.654370 FAP fibroblast activation protein, alpha 210078_s_at Up Hs.654519 KCNAB1 potassium voltage-gated channel, shaker-related subfamily, beta member 1 210102_at Up Hs.152944 LOH11CR2A loss of heterozygosity, 11, chromosomal region 2, gene A 210471_s_at Up Hs.654519 KCNAB1 potassium voltage-gated channel, shaker-related subfamily, beta member 1 210772_at Up Hs.99855 FPR2 formyl peptide receptor 2 211506_s_at Up Hs.551925 IL8 interleukin 8 211628_x_at Up Hs.453583 FTHP1 ferritin, heavy polypeptide pseudogene 1 212509_s_at Up Hs.250723 MXRA7 matrix-remodelling associated 7 213017_at Up Hs.397978 ABHD3 abhydrolase domain containing 3 213836_s_at Up Hs.463964 WIPI1 WD repeat domain, phosphoinositide interacting 1 214211_at Up Hs.524910 FTH1 ferritin, heavy polypeptide 1 215071_s_at Up Hs.484950 HIST1H2AC histone cluster 1, H2ac 216598_s_at Up Hs.303649 CCL2 chemokine (C-C motif) ligand 2 216834_at Up Hs.75256 RGS1 regulator of G-protein signaling 1 217996_at Up Hs.602085 PHLDA1 pleckstrin homology-like domain, family A, member 1
126
217997_at Up Hs.602085 PHLDA1 pleckstrin homology-like domain, family A, member 1 218330_s_at Up Hs.502116 NAV2 neuron navigator 2 218559_s_at Up Hs.712609 MAFB v-maf musculoaponeurotic fibrosarcoma oncogene homolog B (avian) 218656_s_at Up Hs.507798 LHFP lipoma HMGIC fusion partner 218919_at Up Hs.655453 ZFAND1 zinc finger, AN1-type domain 1 219434_at Up Hs.283022 TREM1 triggering receptor expressed on myeloid cells 1 219596_at Up Hs.591123 THAP10 THAP domain containing 10 220517_at Up Hs.511668 VPS13C vacuolar protein sorting 13 homolog C (S. cerevisiae) 221909_at Up Hs.437195 RNFT2 ring finger protein, transmembrane 2 223620_at Up Hs.495989 GPR34 G protein-coupled receptor 34 224048_at Up Hs.646421 USP44 ubiquitin specific peptidase 44 224802_at Up Hs.525093 NDFIP2 Nedd4 family interacting protein 2 226218_at Up Hs.635723 IL7R interleukin 7 receptor 226254_s_at Up Hs.535734 KIAA1430 KIAA1430 226771_at Up Hs.435700 ATP8B2 ATPase, class I, type 8B, member 2 227682_at Up Hs.595314 Transcribed locus 228155_at Up Hs.500333 C10orf58 chromosome 10 open reading frame 58 228170_at Up Hs.56663 OLIG1 oligodendrocyte transcription factor 1 228285_at Up Hs.21454 TDRD9 tudor domain containing 9 228384_s_at Up Hs.238303 C10orf33 chromosome 10 open reading frame 33 228964_at Up Hs.436023 PRDM1 PR domain containing 1, with ZNF domain 336_at Up Hs.442530 TBXA2R thromboxane A2 receptor 34210_at Up Hs.276770 CD52 CD52 molecule 36711_at Up Hs.517617 MAFF v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)
127
Table 3.4: KEGG pathways identified to be significantly over-represented within genes commonly deregulated by NPM-RARA and NuMA-
RARA.
KEGG pathway
# genes in input
genelist
Input List size
# genes in reference
list
Reference list size
p-value Corrected p-value
Probesets from input gene list
Cytokine-cytokine receptor interaction
6 78 253 20393 0.00041847 0.0165294 226218_at,223501_at,204533_at,205476_at,211506_s_at,216598_s_at
Chemokine signaling pathway
5 78 182 20393 0.00066814 0.0131958 204533_at,1555340_x_at,205476_at,211506_s_at,216598_s_at
Tryptophan metabolism
3 78 40 20393 0.00048029 0.0126476 205222_at,205749_at,203559_s_at
128
Figure 3.2: Gene Ontology: biological processes annotation of X-RARA deregulated genes.
Genes deregulated more than 2 fold by A) NPM-RARA; and B) NuMA-RARA were subjected
to Gene Ontology classification analysis using the online tool GeneCodis 3. GeneCodis 3
identifies GO annotations that are over-represented in the input gene-list with respect to all the
probesets present in the U133_Plus2.0 array platform. The hyper-geometric distribution is used
to calculate p-values, which allows us to calculate the probability that a certain annotation
category occurs as frequently as the number of genes identified in that category in the input list.
P-values are also corrected for multiple hypothesis testing, using the false discovery rate method
of Benjamini and Hochberg. Distribution of GO: Biological Processes classifiers are shown with
the number of genes in each category indicated within the pie chart. Genes involved in signal
transduction, immune response and metabolic processes are overrepresented in both NuMA-
RARA and NPM-RARA.
129
Figure 3.2: Gene Ontology: biological processes annotation of X-RARA deregulated genes.
NuMA-RARA vs GFPB.
A.NPM-RARA vs GFP
130
3.4.2 Promoter sequences of X-RARA gene targets show over-representation of binding motifs for transcription factors including RELA and FOX.
Having observed that the fusions deregulate genes belonging to diverse cellular pathways, we
sought to determine whether this directly or indirectly involves other transcription factor
networks. In order to therefore identify those transcriptional networks that may cooperate with
the fusions to promote deregulated gene expression, we analyzed transcription factor binding
sites and response elements that were enriched among genes regulated by NPM-RARA and
NuMA-RARA. Promoter regions (-950 to +50 bp, relative to the transcription start site) were
queried for enrichment of known binding motifs, using the pscan online software tool and the
Jaspar database. Interestingly our analysis revealed that a number of binding site profiles
representing the Forkhead box protein (FOX) family of transcription factors were significantly
enriched in the gene set deregulated commonly by NuMA- and NPM-RARA (Table 3.5). The
FOX family of transcription factors are involved in regulating cellular growth, proliferation and
differentiation (Benayoun et al., 2011). Among genes that are commonly deregulated by NuMA
and NPM-RARA, binding sites for FOXL1, FOXF2, FOXA1, FOXD1, and FOXO3 were
significantly enriched. Consistent with our results presented in Chapter 2, RELA (NF-κB)
binding sites were also found to be significantly enriched in NPM-RARA deregulated gene sets
(Table 3.5; Figure 3.3).
We next examined whether any of the FOX transcription family members identified in our
analysis interact directly or indirectly with components of retinoid signaling or with any of the
APL fusion partners. This analysis revealed a direct genetic interaction between ZBTB16
(PLZF), and FOXL1. Also of note is the interaction between PPARγ signaling and FOXL1
(Figure 3.4). PPARγ physically interacts with both PML, and strongly interacts with RXRA.
Furthermore, our previous studies indicate that PPARγ signaling is deregulated in NPM-RARA
expressing cells, possibly through direct interactions between the NPM-RARA fusion and
PPAR-RXR complexes. It is therefore conceivable that NPM-RARA, by virtue of having
deregulated PPARγ signaling can also exhibit deregulation in FOXL1 mediated transcription and
function. PLZF is also involved in a genetic interaction with FOXO3 indirectly through its
interactions with prostaglandin family PGF, and the prostaglandin receptor PTGFR.
131
Figure 3.3: Transcription factor binding sites within proximal upstream regions of
commonly deregulated gene targets of NuMA-RARA and NPM-RARA cells. Genes
deregulated at least 2 fold in each fusion containing cell line were subjected to the Pscan
software tool. This tool scans promoter regions for motifs with binding specificity of known
transcription factors to assess motifs that are significantly over-represented and under-
represented. Publicly available Jaspar matrices were applied on promoter regions (-950 - +50) of
genes that were differentially expressed in NPM-RARA and NuMA-RARA, and predictions for
statistically significant over-represented transcription factor sites are indicated. The heat-map
contains the input genes and their contribution to the total score for a particular transcription
factor binding profile. The transcription factor profiles are rank ordered from left to right on the
heat-map based on their significance p-value. Red spots indicate that the particular gene has
higher likelihood of being a target of the transcription factor. Likewise, green spots indicate
those genes with a lower likelihood of being targeted by the transcription factor
132
Figure 3.3: Transcription factor binding sites within proximal upstream regions of
commonly deregulated gene targets of NuMA-RARA and NPM-RARA cells.
133
Figure 3.4: Gene interaction models indicating crosstalk between retinoid signaling and
FOX family of transcription factors as well as APL fusion partners. FOX transcription
factors identified from the promoter analysis were used to identify any direct interactions with
components of retinoid signaling, as well as all known APL fusion partners. The open source
software GeneMANIA was used to identify genetic associations (protein and genetic
interactions, pathways, and protein domain similarities) that exist within the gene sets. Linkages
between genes/proteins were determined based on the following criteria: 1. Co-expression –
genes are linked if they have similar expression levels between experiment collected from the
Gene Expression Omnibus repository; 2. Physical interactions – proteins found to interact in a
protein-protein interaction databases BioGRID and PathwayCommons form part of the physical
interaction; 3. Genetic interactors – genes are defined to form genetic interactions and are
functionally related when the effects of perturbing one gene is affected by pertubations to the
second gene. These data are collected from sources including BioGrid and the primary literature;
4. Proteins are linked if they have similar protein domains with dataset information collected
from domain databases InterPro, SMART, and Pfam; 5. Gene products are also linked if they
function within the same pathway with data collected from Reactome and BioCyc; 6. Predicted
interactions – gene and protein interaction prediction data is derived from functional interactions
in other organisms based on orthology. Predictions may also be based on publications from
groups that combine various data sources and report predicted genetic associations.
134
Figure 3.4: Gene interaction models indicating crosstalk between retinoid signaling and
FOX family of transcription factors as well as APL fusion partners.
135
Table 3.5: Predicted transcription factors with over-represented binding motifs in genes commonly
deregulated by NPM-RARA and NuMA-RARA. Entries marked in bold indicate overrepresented
FOX family of transcription factors, further descri bed in the text.
Matrix Name P-value TBP 0.00297745 Foxa2 0.00462995 Foxd3 0.00478648 Foxq1 0.00544663 FOXI1 0.00654774 FOXF2 0.0120441 FOXA1 0.0178016 FOXD1 0.0198657 SPIB 0.0240243 REL 0.0248111 MZF1_1-4 0.0256646 STAT1 0.0300608 TEAD1 0.0361565 FOXO3 0.0470491 MZF1_5-13 0.0490996
136
3.4.3 A subset of downstream gene targets of NPM-RARA contains regulatory motifs that are directly bound by PML-RARA and PLZF-RARA.
We next asked whether the NPM-RARA mediated gene deregulation occurs through direct
binding of the fusion to promoter or regulatory sites of selected gene targets. In order to do this,
we used an in silico approach comparing NPM-RARA deregulated gene targets with published
gene sets identified to be directly bound by PML-RARA (Martens et al., 2010; Wang et al.,
2010) or PLZF-RARA (Rice et al., 2009; Spicuglia et al., 2011). We hypothesized that those
genes that have been experimentally determined to be direct binding targets of PML-RARA
and/or PLZF-RARA, may also have the potential to be bound and recognized by NPM-RARA.
Datasets containing direct binding targets of PML- and PLZF-RARA were downloaded, and
manually compared against the NPM-RARA deregulated gene list to determine both degree of
overlap and the identity of overlapping targets.
Of the 331 genes deregulated by NPM-RARA, 56 genes (38 up-regulated, and 18 down-
regulated) had direct binding sites for PML-RARA (using the zinc inducible U937-PML-RARA
model) reported in Wang et al. (2011) (Table 3.6). An independent report by Martens et al.
(2011) used NB4 and primary APL patient blasts to determine PML-RARA binding sites; a
comparison against our dataset identified 18 directly targeted genes (13 up-regulated targets and
5 down-regulated targets) in common. A total of 10 genes (8 up-regulated and 2 down-regulated)
were found to be common targets in both the datasets. We hypothesize that this represents the
minimal common over-lap between genes targeted by the fusions in all physiological
backgrounds (PML-RARA cell lines, or primary patient blasts), and likely also represents genes
targeted by the NPM-RARA fusion as well.
We next identified the degree of overlap between NPM-RARA deregulated genes and direct
targets of PLZF-RARA reported in two studies (Rice et al. 2009, Spicuglia et al. 2011). The
NPM-RARA deregulated gene list was compared to direct targets of PLZF-RARA identified
from each study individually, and all common genes were identified (Table 3.9).
137
3.4.4 Potential direct transcriptional targets of NPM-RARA are functionally involved in diverse cellular processes.
To annotate pathways/networks over-represented among the putative direct targets of NPM-
RARA, we subjected the list of 65 unique genes (identified from both the PML-RARA bound
datasets) to the Molecular Signatures Database for canonical pathways annotation (MSigDB,
Broad Institute). Cellular pathways including NOD-like receptor signaling, NF-κB activation and
G1 cell cycle control are among the most significantly over-represented pathways represented by
the genes (Table 3.7). Analysis of transcription factor binding sites over-represented within these
data indicate significant (p=0.00045) over-representation of DNA binding motifs for RELA and
the NF-κB family of transcription factors (Table 3.8). In a similar manner, genes commonly
identified in the NPM-RARA dataset, and both the PLZF-RARA bound datasets were combined,
and subsequently used in pathway analysis. The top three significantly represented pathways
included the NOD like receptor signaling pathway, the NF-κB activation pathway, and the TNFα
signaling pathway (Table 3.10).
3.4.5 Potential direct transcriptional targets of NPM-RARA contain known RARE binding sites as well as PU.1 binding sites.
Both the Martens et al., (2010) and the Wang et al., (2010) reports identify that PML-RARA
binding targets included sites external to expected RAREs bound by wild type RAR:RXR
dimers. Both RARE half sites, as well as binding targets for PU.1 were contained within PML-
RARA bound genes. We were therefore interested in determining whether the potential NPM-
RARA binding target genes identified through our comparative in silico analysis, also contained
known RARE and PU.1 binding sites. Of the 57 genes that were both deregulated by NPM-
RARA and also contain PML-RARA binding sites, 43 genes (75%) also contained RARE
binding sites, and (30/57) 52% contain PU.1 binding sites (Table 3.6).
138
Table 3.6: List of NPM-RARA deregulated genes that are also direct targets of PML-RARA identified from the Wang et al., and Martens et
al. published datasets. Entries marked with an asterisk are PML-RARA binding targets, which were reported in both of these independent
published datasets.
Gene Symbol
Gene Name GO: Molecular Function Presence of RAREh site
Presence of PU.1 site
GNAS Guanine nucleotide-binding protein G(s) subunit alpha isoforms Xlas
GTPase activity; protein binding Yes Yes
MMP9* Matrix metalloproteinase-9 metallopeptidase activity Yes Yes VEGFA Vascular endothelial growth factor A growth factor activity Yes Yes BCL2A1 Bcl-2-related protein A1 receptor binding Yes Yes BIRC3 Baculoviral IAP repeat-containing protein 3 protein binding; peptidase inhibitor activity Yes Yes ABLIM1 Actin-binding LIM protein 1 structural constituent of cytoskeleton Yes Yes SERPINA1 Alpha-1-antitrypsin protein binding;
serine-type endopeptidase inhibitor activity Yes Yes
CCND3* G1/S-specific cyclin-D3 protein binding; kinase activator activity; kinase regulator activity
Yes Yes
CCL2 C-C motif chemokine 2 chemokine activity Yes Yes IL8 IL-8 chemokine activity Yes Yes IL1B Interleukin-1 beta hematopoietin/interferon-class (D200-domain) cytokine
receptor binding No Yes
DUSP10 Dual specificity protein phosphatase 10 phosphoprotein phosphatase activity; protein binding; kinase inhibitor activity; kinase regulator activity
Yes Yes
TNFRSF10B Tumor necrosis factor receptor superfamily member 10B
cytokine receptor activity; tumor necrosis factor receptor activity
Yes Yes
PSMB10 Proteasome subunit beta type-10 peptidase activity Yes Yes YES1 Proto-oncogene tyrosine-protein kinase Yes non-membrane spanning protein tyrosine kinase activity Yes Yes ABP1 Amiloride-sensitive amine oxidase [copper-
containing] oxidoreductase activity Yes Yes
CCND2 G1/S-specific cyclin-D2 protein binding; kinase activator activity; kinase regulator activity
Yes Yes
139
STXBP1 Syntaxin-binding protein 1 Yes Yes TGFBR2 TGF-beta receptor type-2 transmembrane receptor protein kinase activity;
transforming growth factor beta receptor activity; cytokine receptor activity; transmembrane receptor protein kinase activity
Yes Yes
TNFAIP3* Tumor necrosis factor, alpha-induced protein 3 hydrolase activity; double-stranded DNA binding Yes Yes S100P Protein S100-P calcium ion binding; calmodulin binding No Yes IFIH1 Interferon-induced helicase C domain-containing
protein 1 helicase activity; hydrolase activity; nucleic acid binding Yes Yes
CXCL2 GRO-beta(5-73) chemokine activity Yes Yes IFITM1 Interferon-induced transmembrane protein 1 Yes Yes FCER2 Low affinity immunoglobulin epsilon Fc receptor
soluble form receptor activity Yes Yes
TNFSF13B* Tumor necrosis factor ligand superfamily member 13b, soluble form
No Yes
LILRB1 Leukocyte immunoglobulin-like receptor subfamily B member 1
receptor activity Yes Yes
TIMP2* Metalloproteinase inhibitor 2 protein binding; metalloendopeptidase inhibitor activity Yes Yes CD48 CD48 antigen receptor activity No Yes IFI16 Gamma-interferon-inducible protein Ifi-16 transcription factor activity Yes Yes MAFF Transcription factor MafF transcription factor activity Yes Yes TUBGCP3 Gamma-tubulin complex component 3 structural constituent of cytoskeleton; microtubule binding Yes Yes EMP1 Epithelial membrane protein 1 structural constituent of cytoskeleton Yes Yes NFKBIZ NF-kappa-B inhibitor zeta transcription factor activity Yes Yes PLTP Phospholipid transfer protein No Yes RNASET2 Ribonuclease T2 endoribonuclease activity; nucleic acid binding Yes Yes RAPGEF6 Rap guanine nucleotide exchange factor 6 protein binding;small GTPase regulator activity;
guanyl-nucleotide exchange factor activity Yes Yes
RASSF4 Ras and Rab interactor 2 protein binding; small GTPase regulator activity; guanyl-nucleotide exchange factor activity
Yes Yes
OLIG1* Oligodendrocyte transcription factor 1 transcription factor activity Yes Yes MARCKSL1 MARCKS-related protein receptor binding No Yes
140
TRIB1 Tribbles homolog 1 protein kinase activity Yes Yes WIPI1 WD repeat domain phosphoinositide-interacting
protein 1 Yes Yes
PRDM1 PR domain zinc finger protein 1 transcription factor activity Yes Yes AGTPBP1 Cytosolic carboxypeptidase 1 GTPase activity; protein binding Yes Yes RASSF4 Ras association domain-containing protein 4 protein binding; small GTPase regulator activity Yes Yes DDX26B Protein DDX26B RNA helicase activity; nucleic acid binding Yes Yes C1orf106* Uncharacterized protein C1orf106 Yes Yes SH3PXD2A* SH3 and PX domain-containing protein 2A Yes Yes DMXL2 DmX-like protein 2 Yes Yes SPPL2A Signal peptide peptidase-like 2A aspartic-type endopeptidase activity Yes Yes ICAM3 Intercellular adhesion molecule 3 receptor binding Yes Yes ID1* DNA-binding protein inhibitor ID-1 transcription factor activity Yes Yes TREM1 Triggering receptor expressed on myeloid cells 1 Yes Yes LYST Lysosomal-trafficking regulator protein binding Yes Yes ZC3H12A* Zinc finger CCCH domain-containing protein 12A nucleic acid binding Yes Yes FTH1 Ferritin heavy chain No Yes SLC20A1 Sodium-dependent phosphate transporter 1 receptor activity; transmembrane transporter activity Yes Yes GNAS GPIPIRRH peptide Yes Yes MAFB Transcription factor MafB transcription factor activity No Yes GNB5 Guanine nucleotide-binding protein subunit beta-5 GTPase activity; protein binding No Yes CHD9 Chromodomain-helicase-DNA-binding protein 9 DNA helicase activity; nucleic acid binding No Yes RPS6 40S ribosomal protein S6 structural constituent of ribosome; nucleic acid binding No Yes IRF8 Interferon regulatory factor 8 transcription factor activity No Yes ADD3 Gamma-adducin structural constituent of cytoskeleton; actin binding No Yes DDIT4 DNA-damage-inducible transcript 4 protein No Yes AIF1 Allograft inflammatory factor 1 calcium ion binding; calmodulin binding;
calcium-dependent phospholipid binding No Yes
141
Table 3.7: Cellular pathways represented by potential direct targets of NPM-RARA (overlap between NPM-RARA and PML-RARA direct
binding sites)
Gene set name # Genes in Gene Set (K)
# Genes in Overlap (k) k/K p value
KEGG: Nod like receptor signaling pathway 62 6 IL8, IL1B, CXCL2, BIRC3, TNFAIP3 0.0968 2.22E-05 BIOCARTA: nthi pathway 24 3 IL8, IL1B, TGFBR2 0.125 1.40E-03 Reactome: G1 phase 16 2 CCND2, CCDN3 0.125 9.60E-03 KEGG: Cytokine cytokine receptor interaction 267 7 IL8, IL1B, CXCL2, CCL2, TGFBR2,
TNFRSF10B, TNFSF13B, 0.0262 1.22E-02
Reactome: Chemokine receptors 55 3 IL8, CXCL2, CCL2, 0.0545 1.47E-02 Reactome: Regulation of insulin secretion by glucagon like peptide 1
61 3 GNB5, GNAS, STXBP1 0.0492 1.94E-02
Biocarta: Cellcycle pathway 23 2 CCND2, CCDN3 0.087 1.94E-02 KEGG: p53 signaling pathway 69 3 CCND2, CND3, TNFRSF10B 0.0435 2.68E-02 Tumor necrosis factor pathway 28 2 BIRC3, TNFAIP3 0.0714 2.81E-02 Biocarta: Death pathway 33 2 BIRC3, TNFRSF10B 0.0606 3.81E-02 Reactome: Glucagon type ligand receptors 33 2 GNB5 GNAS 0.0606 3.81E-02 KEGG: apoptosis 88 3 IL1B, BIRC3, TNFRSF10B 0.0341 4.95E-02
142
Table 3.8: Transcription factor binding sites over- represented within potential direct targets of NPM-RARA (overlap between NPM-RARA
and PML-RARA direct binding sites). Entries marked in bold highlight the NF-κκκκB family of transcription factors, further discussed in the
text.
Matrix Name P-value Spz1 0.000299139 RELA 0.000457605 REL 0.000821731 SP1 0.00153348 NF-kappaB 0.0017763 NFKB1 0.00441016 TFAP2A 0.00582405 MZF1_5-13 0.0086943 Pax4 0.0107313 NHLH1 0.0109333 Egr1 0.0115671 Pax5 0.0118186 CEBPA 0.0120917 RREB1 0.0218203 NR2F1 0.0226081 MZF1_1-4 0.0272188 STAT1 0.0330883 AP1 0.034955 MIZF 0.0483626
143
Table 3.9: List of NPM-RARA deregulated genes that are also direct targets of PLZF-RARA identified from the Rice et al., and Spicuglia et
al., published datasets.
Gene Symbol
Gene Name GO: Molecular Function Cellular Pathway
ABLIM1 Actin-binding LIM protein 1 structural constituent of cytoskeleton Axon guidance mediated by netrin->Actin binding LIM protein 1
ADFP Adipophilin AGTPBP1 Cytosolic carboxypeptidase 1 GTPase activity;protein binding AIF1 Allograft inflammatory factor 1 calcium ion binding;calmodulin
binding;calcium-dependent phospholipid binding
ALKBH7 Alkylated DNA repair protein alkB homolog 7 ANKRD13C Ankyrin repeat domain-containing protein 13C ARHGAP18 Rho GTPase-activating protein 18 protein binding;small GTPase
regulator activity
ASNS Asparagine synthetase [glutamine-hydrolyzing ligase activity Asparagine and aspartate biosynthesis->Asparagine synthetase
ATP8B2 Probable phospholipid-transporting ATPase ID hydrolase activity;transmembrane transporter activity
BIRC3 Baculoviral IAP repeat-containing protein 3 protein binding;peptidase inhibitor activity
Apoptosis signaling pathway->Cellular inhibitor of apoptosis protein 1 and 2
BLVRB Flavin reductase oxidoreductase activity C17orf45 Putative uncharacterized protein C17orf45,
mitochondrial
C6orf65 Coiled-coil domain-containing protein C6orf65 CCL2 C-C motif chemokine 2 chemokine activity Inflammation mediated by
chemokine and cytokine signaling
144
pathway->Chemokine CCL20 CCL20(2-70) chemokine activity Inflammation mediated by
chemokine and cytokine signaling pathway->Chemokine
CCND2 G1/S-specific cyclin-D2 protein binding;kinase activator activity;kinase regulator activity
PI3 kinase pathway->Cyclin d
CCND3 G1/S-specific cyclin-D3 protein binding;kinase activator activity;kinase regulator activity
Cell cycle->Cyclin D
CD48 CD48 antigen receptor activity CD52 CAMPATH-1 antigen CDC42SE2 CDC42 small effector protein 2 CHI3L1 Chitinase-3-like protein 1 hydrolase activity, hydrolyzing N-
glycosyl compounds
CMTM3 CKLF-like MARVEL transmembrane domain-containing protein 3
COG5 Conserved oligomeric Golgi complex subunit 5 CORO2B Coronin-2B structural constituent of
cytoskeleton;actin binding
CREM cAMP-responsive element modulator transcription factor activity;transcription factor activity
Apoptosis signaling pathway->Activating transcription factor
CST3 Cystatin-C protein binding;cysteine-type endopeptidase inhibitor activity
CUL4A Cullin-4A CYBASC3 Cytochrome b ascorbate-dependent protein 3 oxidoreductase activity DDIT4 DNA-damage-inducible transcript 4 protein DMXL2 DmX-like protein 2 DNAJC13 DnaJ homolog subfamily C member 13 DUSP10 Dual specificity protein phosphatase 10 phosphoprotein phosphatase
activity;protein binding;kinase inhibitor activity;kinase regulator activity
p38 MAPK pathway->MAPK phosphatase 5
DUSP16 Dual specificity protein phosphatase 16 phosphoprotein phosphatase activity;protein binding;kinase
Oxidative stress response->MAP Kinase Phosphatases
145
inhibitor activity;kinase regulator activity
EAF2 ELL-associated factor 2 ESD S-formylglutathione hydrolase hydrolase activity, acting on ester
bonds
EVI2B Protein EVI2B FAIM3 Fas apoptotic inhibitory molecule 3 receptor activity FAM105A Protein FAM105A FCER1G High affinity immunoglobulin epsilon receptor
subunit gamma receptor activity
FHL1 Four and a half LIM domains protein 1 transcription factor activity FNDC3A Fibronectin type-III domain-containing protein 3a HHLA3 HERV-H LTR-associating protein 3 ICAM3 Intercellular adhesion molecule 3 receptor binding ID1 DNA-binding protein inhibitor ID-1 transcription factor activity IER3 Radiation-inducible immediate-early gene IEX-1 IFI16 Gamma-interferon-inducible protein Ifi-16;IFI16 transcription factor activity IFIH1 Interferon-induced helicase C domain-containing
protein 1 helicase activity; hydrolase activity; nucleic acid binding
IL1B Interleukin-1 beta hematopoietin/interferon-class (D200-domain) cytokine receptor binding
Inflammation mediated by chemokine and cytokine signaling pathway->Interleukin 2
IL8 IL-8(9-77) chemokine activity Interleukin signaling pathway->Interleukin
IL8RB High affinity interleukin-8 receptor B G-protein coupled receptor activity Interleukin signaling pathway->Receptor subunit beta
JUN Transcription factor AP-1 transcription factor activity TGF-beta signaling pathway->Co-activators or corepressors
KLF6 Krueppel-like factor 6 transcription factor activity LOH11CR2A
Loss of heterozygosity 11 chromosomal region 2 gene A protein
protein binding; serine-type endopeptidase inhibitor activity
LST1 Leukocyte-specific transcript 1 protein
146
MAN1C1 Mannosyl-oligosaccharide 1,2-alpha-mannosidase IC
hydrolase activity
MAP7 Ensconsin structural constituent of cytoskeleton; microtubule binding
MARCKSL1
MARCKS-related protein receptor binding
MEF2C Myocyte-specific enhancer factor 2C transcription factor activity p38 MAPK pathway->myocyte enhancer factor 2
MMP9 82 kDa matrix metalloproteinase-9 metallopeptidase activity Plasminogen activating cascade->pro-matrix metalloprotease 9
MS4A3 Membrane-spanning 4-domains subfamily A member 3
receptor activity
NAPB Beta-soluble NSF attachment protein NAV2 Neuron navigator 2 NEGR1 Neuronal growth regulator 1 NLN Neurolysin, mitochondrial metallopeptidase activity NR1D2 Nuclear receptor subfamily 1 group D member 2 ligand-dependent nuclear receptor
activity; transcription factor activity
OLIG1 Oligodendrocyte transcription factor 1 transcription factor activity OPTN Optineurin P4HA1 Prolyl 4-hydroxylase subunit alpha-1 oxidoreductase activity PAG1 Phosphoprotein associated with
glycosphingolipid-enriched microdomains 1
PSMB10 Proteasome subunit beta type-10 peptidase activity Parkinson disease->20S proteasome
PYHIN1 Pyrin and HIN domain-containing protein 1 transcription factor activity RAP1A Ras-related protein Rap-1A GTPase activity;protein binding Heterotrimeric G-protein signaling
pathway-Gq alpha and Go alpha mediated pathway->Ras associated protein 1
RAPGEF6 Rap guanine nucleotide exchange factor 6 protein binding;small GTPase
147
regulator activity; guanyl-nucleotide exchange factor activity
RASSF4 Ras association domain-containing protein 4 protein binding;small GTPase regulator activity
RNASET2 Ribonuclease T2 endoribonuclease activity;nucleic acid binding
S100A9 Protein S100-A9 calcium ion binding;calmodulin binding
S100P Protein S100-P calcium ion binding;calmodulin binding
SERPINA1 Alpha-1-antitrypsin protein binding;serine-type endopeptidase inhibitor activity
Blood coagulation->alpha1-antitrypsin
SLC20A1 Sodium-dependent phosphate transporter 1 receptor activity; transmembrane transporter activity
SLC27A2 Very long-chain acyl-CoA synthetase transmembrane transporter activity SLC7A11 Cystine/glutamate transporter amino acid transmembrane
transporter activity; transmembrane transporter activity
SNRPN Small nuclear ribonucleoprotein-associated protein N
RNA splicing factor activity, transesterification mechanism; mRNA binding
SPPL2A Signal peptide peptidase-like 2A aspartic-type endopeptidase activity STK4 Serine/threonine-protein kinase 4 protein kinase activity TBXA2R Thromboxane A2 receptor G-protein coupled receptor activity TFEC Transcription factor EC transcription factor activity TGFB1I1 Transforming growth factor beta-1-induced
transcript 1 protein structural constituent of cytoskeleton VEGF signaling pathway-
>Paxillin TGFBR2 TGF-beta receptor type-2 transmembrane receptor protein
kinase activity; transforming growth factor beta receptor activity; cytokine receptor activity
TGF-beta signaling pathway->TGFbetareceptor II
TNFAIP3 Tumor necrosis factor, alpha-induced protein 3 hydrolase activity;double-stranded DNA binding
Toll receptor signaling pathway->A20
148
TNFRSF10B
Tumor necrosis factor receptor superfamily member 10B
cytokine receptor activity; tumor necrosis factor receptor activity
Apoptosis signaling pathway->TRAIL-receptor
TNFSF13B Tumor necrosis factor ligand superfamily member 13b, soluble form
TREM1 Triggering receptor expressed on myeloid cells 1 TRIB1 Tribbles homolog 1 protein kinase activity TUBGCP3 Gamma-tubulin complex component 3 structural constituent of
cytoskeleton; microtubule binding
VPS13C Vacuolar protein sorting-associated protein 13C WARS Tryptophanyl-tRNA synthetase, cytoplasmic aminoacyl-tRNA ligase activity WDR25 WD repeat-containing protein 25 WIPI1 WD repeat domain phosphoinositide-interacting
protein 1
YES1 Proto-oncogene tyrosine-protein kinase Yes non-membrane spanning protein tyrosine kinase activity
Cadherin signaling pathway->Oncogene YES1
ZC3H12A Zinc finger CCCH domain-containing protein nucleic acid binding ZNF197 Zinc finger protein 197 transcription factor activity
149
Table 3.10: Cellular pathways over-represented in potential NPM-RARA direct targets (overlap between NPM-RARA transcriptional
targets and PLZF-RARA)
Gene Set Name # Genes in Gene Set (K)
# Genes in Overlap (k) k/K p value
KEGG: Nod like receptor signaling pathway 62 5 IL1B, IL8, BIRC3, TNFAIP3, CLL2
0.0806 2.46E-03
Biocarta: nthipathway 24 3 IL1B, IL8, TGFBR2 0.125 5.56E-03 Tumor necrosis factor pathway 28 3 BIRC3, TNFAIP3, CCL2 0.1071 8.61E-03 Reactome: cell surface interactions at the vascular wall
94 5 0.0532 1.42E-02
Biocarta: Dream pathway 14 2 0.1429 1.87E-02 Reactome: G1 phase 16 2 0.125 2.42E-02 Biocarta: CCR5 pathway 18 2 0.1111 3.02E-02 Biocarta: Cellcycle pathway 23 2 0.087 4.75E-02
150
3.4.6 Comparison of NPM- and NuMA-RARA expression profiles with PML-RARA.
Having profiled and characterized the X-RARA transcriptome, we next asked whether the genes
identified using our in vitro APL models are reflective of the physiological conditions in vivo.
We sought to answer this question by comparing the list of X-RARA deregulated genes to genes
that were reported to be deregulated in APL patient blasts (Payton 2009). Upon comparing our
dataset with gene expression profiles of the 14 APL cases and 5 normal promyelocytes, we
identified that 124 of the 444 probesets deregulated by NPM-RARA were shared with primary
APL patient blasts (Figure 3.5). This indicates the physiological relevance of the identified gene
signature, and also suggests that at the transcriptional level, the two fusion proteins PML- and
NPM-RARA exert common effects on the cell.
3.4.7 NPM-RARA and NuMA-RARA induced gene signatures overlap with AML LSC.
One important consideration for successful treatment in AML is targeting and elimination of the
leukemia initiating cell in addition to the bulk tumour. The leukemia initiating cell population in
APL contains the RARA fusion proteins. We were interested in determining if the fusion’s
expression signatures may allow us to predict its roles in establishing a malignant phenotype. We
performed this analysis by assessing the overlaps of fusion specific signatures with those of
recent reports outlining LSC specific gene signatures in AML patient prognostic subgroups.
The set of 444 probesets deregulated by NPM-RARA, and 105 deregulated commonly by NPM-
RARA and NuMA-RARA were manually selected from the dataset described by Gentles et al.,
(2010) (GSE 24006). Expression levels of probe-sets corresponding to either NPM-RARA
deregulated genes, or NPM- and NuMA-RARA deregulated genes, were compared to LSC vs.
HSC gene expression profiles. A total of 98 probesets in the NPM-RARA deregulated signature
was differentially regulated in the LSC fraction of AML (Figure 3.6).
We further analyzed the overlap between NPM-RARA and NuMA-RARA expression signatures
with LSC vs. HSC described in Majeti et al., (2009). In this analysis, we observed that a total of
95 probesets were commonly deregulated in this LSC vs. HSC dataset. This overlap in gene
expression changes induced by NPM-RARA and that induced by LSCs in AML, is consistent
151
with our hypothesis that the fusion induces global transcriptional changes that exhibit similarities
with the expression profiles of LSCs in AML.
152
Figure 3.5: Comparison of X-RARA gene expression profiles with published APL patient
expression datasets. Probesets that are differentially regulated in NPM-RARA, as well as
commonly in NPM-RARA and NuMA-RARA were identified within the public dataset
comparing APL patient data with normal promyelocytes (Payton 2009). Probesets that were
differentially co-regulated in the NPM-RARA dataset as well as the APL vs. promyelocyte
dataset, were noted and visualized on a heatmap to show common gene expression profiles
induced by the NPM-RARA cell line model, and primary APL blasts expressing PML-RARA.
153
Figure 3.5: Comparison of X-RARA gene expression profiles with published APL patient
expression datasets.
APL Promyelocyte
201242_s_at208792_s_at208791_at209122_at221563_at228170_at201464_x_at206067_s_at226771_at219654_at205518_s_at212509_s_at204561_x_at209014_at201005_at201324_at205047_s_at211240_x_at202260_s_at226218_at205419_at207124_s_at205488_at36711_at224725_at202932_at228285_at226254_s_at224802_at215016_x_at202933_s_at224799_at218847_at221601_s_at200644_at34210_at231175_at224733_at211964_at223218_s_at228384_s_at218656_s_at209555_s_at201920_at219330_at205067_at212886_at212820_at224817_at200748_s_at1556658_a_at219566_at202643_s_at204044_at235957_at241681_at211628_x_at39402_at232504_at202672_s_at202644_s_at206488_s_at209651_at228766_at240413_at225033_at216834_at214211_at217967_s_at214751_at201325_s_at204224_s_at209774_x_at1556657_at209789_at205114_s_at213017_at209803_s_at64942_at233070_at218919_at221902_at230064_at1552691_at200868_s_at202659_at1552386_at222859_s_at200628_s_at230078_at219599_at219112_at204499_at1557261_at219666_at223746_at223922_x_at219551_at211742_s_at1555247_a_at243341_at224356_x_at1554892_a_at210254_at223280_x_at224346_at212467_at1560026_at202648_at239294_at218217_at209901_x_at200908_s_at219694_at204949_at226789_at203923_s_at213642_at213826_s_at214181_x_at203922_s_at213350_at207008_at203936_s_at
1 2 3 4 5 6 7 8 9 10 11 12 13 14 1 2 3 4 5
154
155
Figure 3.6: Comparison of X-RARA gene expression profiles with published AML-LSC
expression datasets. Probesets that are differentially regulated in NPM-RARA, as well as
commonly in NPM-RARA and NuMA-RARA were identified within the public dataset
comparing AML-LSC fractions with normal stem cells. A) Gene expression profiles from AML
LSC samples (n=9) and normal bone marrow HSC (n=4) used in the report by Gentles et al.,
2010 (GSE 24006) was interrogated using probesets that were deregulated in our NPM-RARA
and NuMA-RARA dataset. B) In a similar analysis, expression profiles of AML LSC samples
(n=9) and normal bone marrow HSC (n=4) published by Majeti et al., 2009 (GSE 17054) was
assessed. Probesets that were differentially regulated in the X-RARA dataset as well as LSC
fractions vs. BM were noted and visualized on a heatmap to show overlapping expression
profiles induced by NPM-RARA in cell line models, and LSCs in primary AML blasts.
156
Figure 3.6: Comparison of X-RARA gene expression profiles with published AML-LSC expression datasets.
HSC LSC
A.
206067_s_at217388_s_at205114_s_at201005_at228766_at228170_at204232_at209555_s_at202241_at223620_at206488_s_at225622_at215071_s_at217966_s_at226353_at211240_x_at204561_x_at217967_s_at209122_at231175_at225173_at217996_at228964_at1554899_s_at240413_at201663_s_at230860_at226218_at223343_at209921_at336_at215985_at225171_at205419_at237246_at219330_at221563_at213017_at202917_s_at223344_s_at215177_s_at219566_at204044_at217678_at200723_s_at225915_at218322_s_at201951_at201952_at219694_at1553185_at1556316_s_at201539_s_at200908_s_at217867_x_at226990_at200953_s_at212231_at223501_at226785_at213826_s_at243366_s_at204643_s_at243370_at239294_at210298_x_at204949_at210222_s_at225065_x_at232383_at212616_at211937_at229026_at218918_at222446_s_at213135_at1559410_at224709_s_at214505_s_at213642_at212229_s_at1558822_at206715_at201828_x_at213350_at205376_at205942_s_at225768_at1566482_at235046_at210377_at219599_at212686_at210299_s_at207871_s_at201540_at200965_s_at209560_s_at
1 2 3 4 1 2 3 4 5 6 7 8LSC HSC
B.
206067_s_at228766_at217388_s_at209555_s_at205114_s_at228170_at206488_s_at201005_at204232_at223620_at202241_at225622_at217967_s_at231175_at204561_x_at211240_x_at217966_s_at226353_at228964_at225173_at215071_s_at209122_at217996_at1554899_s_at205419_at336_at240413_at225171_at226218_at215985_at209921_at230860_at219566_at223343_at202917_s_at1559240_at223344_s_at217678_at215177_s_at207554_x_at201124_at220517_at237246_at201663_s_at205488_at213017_at219330_at202833_s_at243634_at1559948_at243489_at221563_at218322_s_at213826_s_at210298_x_at243366_s_at212231_at200908_s_at222446_s_at204643_s_at226785_at200723_s_at1559410_at210222_s_at211937_at218918_at212616_at239294_at225065_x_at232383_at213135_at200953_s_at204949_at213642_at214505_s_at229026_at224709_s_at201828_x_at212229_s_at1558822_at206715_at213350_at205376_at205942_s_at235046_at225768_at1566482_at219599_at210377_at212686_at210299_s_at201540_at207871_s_at200965_s_at209560_s_at
1 2 3 4 5 6 7 8 9 1 2 3 4
157
3.4.8 X-RARA retinoic acid responsive genes.
To determine early ATRA responsive transcripts in NuMA- and NPM-RARA cells, cells were
treated with 1 µM ATRA for 4 hours and RNA was extracted and analyzed. These data
determined 510 (174 down, 336 up) early ATRA-responsive transcripts in U937-NPM-RARA
cells (Figure 3.7; see Appendix I Table A3.3). A total of 289 (75 down, 214 up) ATRA-
regulated transcripts were recorded for U937-NuMA-RARA cells (see Appendix I Table A3.4).
U937-GFP cells were used to determine the wild type ATRA response, and exhibited 352 ATRA
responsive targets (116 down, 236 up) (see Appendix I Table A3.5). The ATRA response in
NuMA-RARA, NPM-RARA, and the GFP system included 152 commonly regulated targets;
these potentially represent early wild-type retinoid responsive signaling genes that are also
affected by the fusions (Table 3.11; Figure 3.7). Interestingly, 41% of ATRA responsive targets
in NPM-RARA, and 27% of ATRA responsive probesets in NuMA-RARA were unique to these
specific fusions, and not regulated by ATRA in wild type cells; these may represent novel
retinoid responsive targets affected by the variant APL fusion proteins.
Our goal in this analysis was to compare the retinoid response at the level of transcriptional
control, and understand how retinoid induced signaling and transcriptional control is affected in
cells expressing NPM-RARA and NuMA-RARA. To this end, we identified that, of the 22
transcription factor binding motifs significantly over-represented in the wild type ATRA
response dataset (in GFP control cells), the majority (13/22 = 59%) of these were shared by
NPM-RARA cells (Table 3.12; Table 3.14). This set included both RAR:RXR and NF-κB
binding sites. Interestingly, the binding motifs identified to be unique to NPM-RARA alone
includes dimers containing PPARγ:RXRA. This is in agreement with previous studies from our
lab identifying the deregulation of PPARγ signaling in NPM-RARA expressing cells.
Additionally, ras responsive element binding protein 1 (RREB1), nuclear factor of activated T-
cells, cytoplasmic, calcineurin-dependent 2 (NFATC2), CCCTC-binding factor (CTCF) and
Paired box 4 (PAX4) binding sites were significantly enriched in the fusion target list, implying
that the global transcriptional disruption induced by the fusion is in part mediated through
deregulated activity in these other transcriptional control networks. NuMA-RARA ATRA
response targets had enriched binding sites that overlapped with those of control cells (Table
3.13, Table 3.14). This overlap suggests that early ATRA targets in NuMA-RARA cells
158
classical retinoid signaling genes, which are also involved in the ATRA response profile of
control wild type cells.
We next compared the ATRA responsive gene targets in NPM-RARA with that of genes
deregulated in APL patient blasts. This analysis identified that 151 ATRA responsive gene
targets in NPM-RARA were also deregulated in APL patient samples. Furthermore, these probe
sets showed opposite regulation patterns in APL patients versus the ATRA responsive case, as
expected. This indicates that the ATRA responsive gene sets identified in the NPM-RARA cell
line are physiologically relevant, as they are also direct/indirect targets of the PML-RARA fusion
protein in primary APL patient blasts.
Having identified early ATRA responsive gene targets of the fusion, we next asked whether any
of these targets overlapped with PML-RARA and PLZF-RARA direct binding sites that were
also identified to be deregulated by the NPM-RARA fusion. A total of 10 such genes including
BIRC3, C1orf106, CCL2, CD48, IL1B, MAFF, OLIG1, TREM1, TRIB1, and ID1 were
identified as gene targets that are deregulated by NPM-RARA, directly bound by PML-RARA,
and transcriptionally responsive to treatment with ATRA. These genes which are modulated
early after retinoic acid treatment and also deregulated by the presence of NPM-RARA represent
a critical subset of fusion direct targets.
159
Figure 3.7: ATRA induced gene expression changes in NPM-RARA, and NuMA-RARA in
comparison with wild type U937-GFP. A) Probesets differentially regulated at least 2-fold
after 4-hrs of ATRA treatment in NuMA-RARA, NPM-RARA, and control U937-GFP are
quantified and represented according to their regulation pattern. B) Venn diagrams representing
genes up-regulated; and C) down-regulated after ATRA treatment in NuMA-RARA, NPM-
RARA, and control GFP are compared to indicate degree of overlap between the two fusion
retinoid responses and the wild type response. D) The NPM-RARA retinoid response; and E)
NuMA-RARA retinoid response were compared to highlight the presence of wild type retinoid
response genes in both NPM-RARA and NuMA-RARA ATRA response targets. In addition, the
presence of novel retinoid targets present uniquely within the NPM-RARA and NuMA-RARA
datasets are also noted.
160
Figure 3.7: ATRA induced gene expression changes in NPM-RARA, and NuMA-RARA in
comparison with wild type U937-GFP.
161
Table 3.11: Genes commonly up- and down-regulated after ATRA treatment commonly in NPM-RARA, NuMA-RARA and wild type U937-
GFP cells.
Probe Set ID Regulation Unigene (Avadis)
Gene Symbol
Gene Title
201565_s_at Down Hs.180919 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 201566_x_at Down Hs.180919 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein 202431_s_at Down Hs.202453 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 203304_at Down Hs.533336 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus laevis) 204794_at Down Hs.1183 DUSP2 dual specificity phosphatase 2 204897_at Down Hs.199248 PTGER4 prostaglandin E receptor 4 (subtype EP4) 205419_at Down Hs.784 EBI2 Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled
receptor) 206157_at Down Hs.591286 PTX3 pentraxin-related gene, rapidly induced by IL-1 beta 209099_x_at Down Hs.224012 JAG1 jagged 1 (Alagille syndrome) 209184_s_at Down Hs.442344 IRS2 insulin receptor substrate 2 209606_at Down Hs.270 PSCDBP pleckstrin homology, Sec7 and coiled-coil domains, binding protein 213931_at Down Hs.591670 ID2 /// ID2B inhibitor of DNA binding 2, dominant negative helix-loop-helix protein /// inhibitor
of DNA binding 2B, dominant negative helix-loop-helix protein 216268_s_at Down Hs.224012 JAG1 jagged 1 (Alagille syndrome) 219497_s_at Down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 219498_s_at Down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 219890_at Down Hs.446235 CLEC5A C-type lectin domain family 5, member A 220116_at Down Hs.98280 KCNN2 potassium intermediate/small conductance calcium-activated channel, subfamily N,
member 2 221586_s_at Down Hs.445758 E2F5 E2F transcription factor 5, p130-binding 221766_s_at Down Hs.10784 FAM46A family with sequence similarity 46, member A 222891_s_at Down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 223403_s_at Down Hs.86337 POLR1B polymerase (RNA) I polypeptide B, 128kDa 224973_at Down Hs.10784 FAM46A family with sequence similarity 46, member A 227037_at Down Hs.31652 LOC201164 similar to CG12314 gene product
162
227210_at Down Hs.407983 SFMBT2 Scm-like with four mbt domains 2 227242_s_at Down Hs.699395 EBF3 early B-cell factor 3 227481_at Down Hs.16064 CNKSR3 CNKSR family member 3 228170_at Down Hs.56663 OLIG1 oligodendrocyte transcription factor 1 229638_at Down Hs.499205 IRX3 iroquois homeobox 3 236738_at Down Hs.710781 LOC401097 Similar to LOC166075 239129_at Down 239605_x_at Down Hs.657657 Transcribed locus 240747_at Down Hs.667630 Transcribed locus 242388_x_at Down Hs.601883 Transcribed locus 243529_at Down Hs.116602 MARS2 methionyl-tRNA synthetase 2, mitochondrial 1554240_a_at Up Hs.174103 ITGAL integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen
1; alpha polypeptide) 1555431_a_at Up Hs.55378 IL31RA interleukin 31 receptor A 1555680_a_at Up Hs.433337 SMOX spermine oxidase 1555728_a_at Up Hs.325960 MS4A4A membrane-spanning 4-domains, subfamily A, member 4 1563745_a_at Up Hs.309176 LOC283050 hypothetical LOC283050 1568619_s_at Up Hs.648523 LOC162073 hypothetical protein LOC162073 1570375_at Up Hs.661265 CDNA FLJ41985 fis, clone SPLEN2014946 200897_s_at Up Hs.151220 PALLD palladin, cytoskeletal associated protein 200906_s_at Up Hs.151220 PALLD palladin, cytoskeletal associated protein 200907_s_at Up Hs.151220 PALLD palladin, cytoskeletal associated protein 201042_at Up Hs.517033 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) 201534_s_at Up Hs.145575 UBL3 ubiquitin-like 3 201656_at Up Hs.133397 ITGA6 integrin, alpha 6 202308_at Up Hs.592123 SREBF1 sterol regulatory element binding transcription factor 1 202481_at Up Hs.289347 DHRS3 dehydrogenase/reductase (SDR family) member 3 202627_s_at Up Hs.414795 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1),
member 1 202628_s_at Up Hs.414795 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1),
member 1 202770_s_at Up Hs.13291 CCNG2 cyclin G2
163
202869_at Up Hs.524760 OAS1 2',5'-oligoadenylate synthetase 1, 40/46kDa 202887_s_at Up Hs.523012 DDIT4 DNA-damage-inducible transcript 4 203760_s_at Up Hs.75367 SLA Src-like-adaptor 203761_at Up Hs.75367 SLA Src-like-adaptor 203887_s_at Up Hs.2030 THBD Thrombomodulin 203888_at Up Hs.2030 THBD Thrombomodulin 204112_s_at Up Hs.42151 HNMT histamine N-methyltransferase 204429_s_at Up Hs.530003 SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 204430_s_at Up Hs.530003 SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter), member 5 204526_s_at Up Hs.442657 TBC1D8 TBC1 domain family, member 8 (with GRAM domain) 204961_s_at Up Hs.655201 LOC648998
/// NCF1 /// NCF1B /// NCF1C
similar to Neutrophil cytosol factor 1 (NCF-1) (Neutrophil NADPH oxidase factor 1) (47 kDa neutrophil oxidase factor) (p47-phox) (NCF-47K) (47 kDa autosomal chronic granulomatous disease protein) (NOXO2) /// neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) /// neutrophil cytosolic factor 1B pseudogene /// neutrophil cytosolic factor 1C pseudogene
205016_at Up Hs.170009 TGFA transforming growth factor, alpha 205027_s_at Up Hs.432453 MAP3K8 mitogen-activated protein kinase kinase kinase 8 205233_s_at Up Hs.477083 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 205476_at Up Hs.75498 CCL20 chemokine (C-C motif) ligand 20 205692_s_at Up Hs.479214 CD38 CD38 molecule 205749_at Up Hs.72912 CYP1A1 cytochrome P450, family 1, subfamily A, polypeptide 1 205780_at Up Hs.475055 BIK BCL2-interacting killer (apoptosis-inducing) 205789_at Up Hs.1799 CD1D CD1d molecule 206028_s_at Up Hs.306178 MERTK c-mer proto-oncogene tyrosine kinase 206126_at Up Hs.113916 CXCR5 chemokine (C-X-C motif) receptor 5 206369_s_at Up Hs.32942 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 206370_at Up Hs.32942 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 208438_s_at Up Hs.1422 FGR Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog 208937_s_at Up Hs.504609 ID1 inhibitor of DNA binding 1, dominant negative helix-loop-helix protein 209392_at Up Hs.190977 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin) 209435_s_at Up Hs.655209 ARHGEF2 rho/rac guanine nucleotide exchange factor (GEF) 2 210264_at Up Hs.239891 GPR35 G protein-coupled receptor 35
164
210357_s_at Up Hs.433337 SMOX spermine oxidase 211026_s_at Up Hs.277035 MGLL monoglyceride lipase 211913_s_at Up Hs.306178 MERTK c-mer proto-oncogene tyrosine kinase 212230_at Up Hs.708050 PPAP2B phosphatidic acid phosphatase type 2B 212501_at Up Hs.517106 CEBPB CCAAT/enhancer binding protein (C/EBP), beta 212769_at Up Hs.709205 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 212770_at Up Hs.709205 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 214084_x_at Up LOC648998 similar to Neutrophil cytosol factor 1 (NCF-1) (Neutrophil NADPH oxidase factor
1) (47 kDa neutrophil oxidase factor) (p47-phox) (NCF-47K) (47 kDa autosomal chronic granulomatous disease protein) (NOXO2)
214523_at Up Hs.558308 CEBPE CCAAT/enhancer binding protein (C/EBP), epsilon 214639_s_at Up Hs.67397 HOXA1 homeobox A1 214977_at Up Hs.654670 CDNA FLJ13790 fis, clone THYRO1000026 215177_s_at Up Hs.133397 ITGA6 integrin, alpha 6 215342_s_at Up Hs.585378 RABGAP1L RAB GTPase activating protein 1-like 218501_at up Hs.476402 ARHGEF3 Rho guanine nucleotide exchange factor (GEF) 3 218627_at up Hs.525634 DRAM damage-regulated autophagy modulator 218723_s_at up Hs.507866 C13orf15 chromosome 13 open reading frame 15 219010_at up Hs.518997 C1orf106 chromosome 1 open reading frame 106 219607_s_at up Hs.325960 MS4A4A membrane-spanning 4-domains, subfamily A, member 4 219994_at up Hs.310421 APBB1IP amyloid beta (A4) precursor protein-binding, family B, member 1 interacting
protein 221266_s_at up Hs.652230 TM7SF4 transmembrane 7 superfamily member 4 221345_at up Hs.248056 FFAR2 free fatty acid receptor 2 221601_s_at up Hs.58831 FAIM3 Fas apoptotic inhibitory molecule 3 221602_s_at up Hs.58831 FAIM3 Fas apoptotic inhibitory molecule 3 223276_at up Hs.29444 MST150 MSTP150 223567_at up Hs.465642 SEMA6B sema domain, transmembrane domain (TM), and cytoplasmic domain,
(semaphorin) 6B 223620_at up Hs.495989 GPR34 G protein-coupled receptor 34 224916_at up Hs.379754 TMEM173 transmembrane protein 173 224929_at up Hs.379754 TMEM173 transmembrane protein 173
165
224964_s_at up Hs.187772 GNG2 guanine nucleotide binding protein (G protein), gamma 2 225347_at up Hs.497399 ARL8A ADP-ribosylation factor-like 8A 225372_at up Hs.47382 C10orf54 chromosome 10 open reading frame 54 225373_at up Hs.47382 C10orf54 chromosome 10 open reading frame 54 225763_at up Hs.493867 RCSD1 RCSD domain containing 1 225919_s_at up Hs.493639 C9orf72 chromosome 9 open reading frame 72 226487_at up Hs.661785 C12orf34 chromosome 12 open reading frame 34 226722_at up Hs.134742 FAM20C family with sequence similarity 20, member C 226756_at up Hs.633903 CDNA FLJ25556 fis, clone JTH02629 227396_at up Hs.318547 PTPRJ protein tyrosine phosphatase, receptor type, J 227484_at up Hs.710097 CDNA FLJ41690 fis, clone HCASM2009405 227792_at up Hs.648523 LOC162073 hypothetical protein LOC162073 227915_at up Hs.510327 ASB2 ankyrin repeat and SOCS box-containing 2 228648_at up Hs.655559 LRG1 leucine-rich alpha-2-glycoprotein 1 228772_at up Hs.42151 HNMT histamine N-methyltransferase 229670_at up Hs.180284 5.5 kb mRNA upregulated in retinoic acid treated HL-60 neutrophilic cells 229971_at up Hs.187884 GPR114 G protein-coupled receptor 114 230218_at up Hs.72956 HIC1 hypermethylated in cancer 1 230333_at up Hs.656630 Transcribed locus 230925_at up Hs.310421 APBB1IP amyloid beta (A4) precursor protein-binding, family B, member 1 interacting
protein 231496_at up Hs.145519 FCAMR Fc receptor, IgA, IgM, high affinity 231779_at up Hs.449207 IRAK2 interleukin-1 receptor-associated kinase 2 231969_at up Hs.21958 STOX2 storkhead box 2 232687_at up Hs.100912 CDNA FLJ33091 fis, clone TRACH2000660 232861_at up Hs.654693 PDP2 pyruvate dehydrogenase phosphatase isoenzyme 2 233857_s_at up Hs.510327 ASB2 ankyrin repeat and SOCS box-containing 2 234987_at up Hs.660221 Transcribed locus 235421_at up Hs.432453/
//Hs.663033
MAP3K8 Mitogen-activated protein kinase kinase kinase 8 /// CDNA clone IMAGE:4689481
236191_at up Hs.667427 Transcribed locus
166
236407_at up Hs.121495 KCNE1 potassium voltage-gated channel, Isk-related family, member 1 236717_at up Hs.525977 LOC165186 similar to RIKEN cDNA 4632412N22 gene 237252_at up Hs.2030 THBD Thrombomodulin 237442_at up 238032_at up Hs.655631 Transcribed locus 238439_at up Hs.217484 ANKRD22 ankyrin repeat domain 22 238669_at up Hs.201978 PTGS1 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and
cyclooxygenase) 239294_at up Hs.561747 Transcribed locus 242426_at up Hs.696574 NRG4 neuregulin 4 242525_at up Hs.439122 Transcribed locus 243541_at up Hs.55378 IL31RA interleukin 31 receptor A 243819_at up 244665_at up Hs.668855 Transcribed locus 36711_at up Hs.517617 MAFF v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) 37152_at up Hs.696032 PPARD peroxisome proliferator-activated receptor delta
167
Table 3.12: Promoter binding sites that are over-represented in NPM-RARA ATRA responsive
gene targets.
Matrix Name P-value SP1 2.97E-05 Egr1 0.00047222 NF-kappaB 0.00212962 MZF1_5-13 0.00258075 Myc 0.00292394 Mycn 0.00351912 NFKB1 0.00394414 RELA 0.00602767 PPARG::RXRA 0.0132587 RXR::RAR_DR5 0.0187777 Klf4 0.0217254 Myf 0.0251431 RREB1 0.0301803 NFATC2 0.0387388 MZF1_1-4 0.0405979 USF1 0.0417302 MYC::MAX 0.0460205 CTCF 0.0462299 Pax4 0.0569352
168
Table 3.13: Promoter binding sites that are over-represented in ATRA responsive gene sets in
NuMA-RARA
Matrix Name P-value MZF1_5-13 0.00182143 SP1 0.00580566 Zfp423 0.00736332 Egr1 0.0146472 RELA 0.0169182 REL 0.0301936 Myc 0.0307897 Stat3 0.0394692 USF1 0.0482355 Mycn 0.0560475
Table 3.14: Promoter binding sites that are over-represented in ATRA responsive gene targets of
wild type U937-GFP control cells.
Matrix Name P-value SP1 6.61E-05 Egr1 7.44E-05 Myc 0.00035727 Mycn 0.00091361 MZF1_5-13 0.00453245 EBF1 0.00536856 TFAP2A 0.00575004 NF-kappaB 0.00728928 NFKB1 0.0088477 USF1 0.00995671 PLAG1 0.0106753 INSM1 0.0122036 Myf 0.0132936 Klf4 0.0192914 NHLH1 0.0203228 RELA 0.0206571 MZF1_1-4 0.0219859 RXR::RAR_DR5 0.022875 Stat3 0.0233671 Zfp423 0.0284772 REL 0.0468266
169
SRF 0.0525273
170
3.4.9 Gene expression based signature identifies compounds that confer expression changes that are correlated with ATRA treatment in APL cells.
Our hypothesis was that gene expression signature profiling will allow us to inform novel
therapeutic strategies in AML. To this end, we also used X-RARA and ATRA gene expression
response profiles to connect changes at the gene expression level with potential activity of drugs
using the connectivity map database. This database allows us to screen multiple chemical
libraries using a publicly available reference that catalogues global expression changes induced
by a range of small molecules. We used this approach to identify compounds that have the
potential to induce a therapeutic gene signature, such as that induced by ATRA in our
experimental set-up.
Our ATRA response gene signature was derived separately for NuMA-RARA and NPM-RARA
after 4 hrs of treatment, which we expected would induce primary transcriptional effects of
ATRA. As these primary effects are more likely to consist of a greater proportion of direct gene
targets of ATRA, we reasoned that it would be an effective time point to use in the context of
this experiment. This strategy successfully identified Isotretinoin, another retinoid related to
retinoic acid, as a positive hit linked with the ATRA gene expression response in NuMA- and
NPM-RARA expressing cells (Figure 3.8; Table 3.15). Expression signatures induced by
Tretinoin and Isotretinoin are similar to gene expression profiles induced by ATRA in NuMA-
RARA expressing cells. This strategy accurately predicts that both compounds exhibit retinoid
signaling activity, as expected.
Dinoprost (8uM, HL60, PC3), and Aloprostadil (11uM, HL60) were both identified as inducing
gene expression signatures which positively correlate with that of ATRA in both NuMA-RARA
and NPM-RARA cells (Figure 3.8; Table 3.15). Both Dinoprost and aloprostadil are included in
a class of drugs that act as agonists of the prostaglandin F receptor, and prostaglandin E1
signaling pathways respectively. Other prostaglandin signaling drugs including 15-delta
prostaglandin J2 were also identified from this analysis.
171
Figure 3.8: Using gene expression profiling to predict chemical compounds with activity
similar to that of ATRA in X-RARA cells.
Isotretinoin and tretinoin are two different isoforms of retinoic acid and their expression profiles
were identified as matching ATRA treated X-RARA cells as expected. Expression profiles of 4
hr ATRA treated X-RARA cells also showed enrichment of Dinoprost (8uM, HL60 and PC3),
Alprostadil (11uM, HL60; 10uM PC3), and Dinoprostone (10uM, 8uM PC3) expression
signatures. The barview consists of 6100 horizontal lines, each of which represents one
individual treatment occurrence. Instances containing A) Isotretinoin and tretinoin; and B)
Dinoprost (n=2), Alprostadil (n=4), and Dinoprostone (n=2) are represented as black horizontal
lines on the barview. Enrichment of the ATRA expression profile is indicated for a particular C)
Isotretinoin and D) Dinoprost instance. Probesets induced by ATRA (shown in red), and
repressed by ATRA (shown in green) are shown for the best matched Tretinoin (1uM, HL60)
and Dinoprost (8uM, HL60) instance.
172
Figure 3.8: Using gene expression profiling to predict chemical compounds with activity
similar to that of ATRA in X-RARA cells.
Isotretinoin
Dinoprost,Alprostadil, Dinoprostoneinstances
Isotretinoinand Tretinoininstances
Dinoprost
AT
RA
sig
natu
re
AT
RA
sig
natu
re
Tretinoin
Dinoprost
173
Table 3.15: Compounds identified from gene expression matching analysis using ATRA responsive gene targets in NPM-RARA. Compounds
that target the prostaglanding signaling network are highlighted in bold.
rank batch cmap name dose cell score up down 1 650 Tretinoin 1 µM HL60 1 0.602 -0.398 2 750 Tretinoin 1 µM HL60 0.992 0.611 -0.381 3 602 Tretinoin 1 µM HL60 0.987 0.585 -0.402 4 619 Isotretinoin 13 µM HL60 0.857 0.496 -0.36 5 41 Tretinoin 1 µM HL60 0.696 0.405 -0.29 6 622 Tretinoin 13 µM HL60 0.673 0.42 -0.253 7 648 Podophyllotoxin 10 µM HL60 0.615 0.341 -0.273 8 749 (-)-isoprenaline 16 µM HL60 0.603 0.349 -0.254 9 664 Alprostadil 11 µM HL60 0.602 0.304 -0.298
10 640 dihydroergocristine 6 µM HL60 0.582 0.23 -0.352 11 665 Quinpirole 16 µM HL60 0.576 0.297 -0.279 12 634 Dinoprost 8 µM HL60 0.574 0.277 -0.297 13 750 15-delta prostaglandin J2 10 µM HL60 0.569 0.234 -0.335 14 644 co-dergocrine mesilate 6 µM HL60 0.564 0.246 -0.318 15 750 LY-294002 10 µM HL60 0.563 0.147 -0.417 16 619 Pergolide 10 µM HL60 0.555 0.27 -0.285 17 635 Orciprenaline 8 µM HL60 0.543 0.261 -0.282 18 651 Isoetarine 12 µM HL60 0.536 0.272 -0.264 19 619 Fenoterol 10 µM HL60 0.533 0.282 -0.251 20 661 Prestwick-983 17 µM HL60 0.531 0.283 -0.248 21 648 Tetryzoline 17 µM HL60 0.521 0.261 -0.26 22 618 Mebendazole 14 µM HL60 0.516 0.288 -0.228 23 634 Puromycin 7 µM HL60 0.508 0.272 -0.236 24 707 Maprotiline 13 µM MCF7 0.504 0.272 -0.232 25 651 Corbadrine 22 µM HL60 0.5 0.237 -0.263
174
3.5 Discussion
Our data represent the first determination of the gene expression profiles of the APL variant
fusion proteins NPM-RARA and NuMA-RARA in a hematopoietic cell system. Our studies are a
significant step toward identifying key genes and pathways that may cooperate with X-RARA in
the development of APL.
Studies utilizing artificial fusion genes, with heterologous oligomerization domains fused to the
C-terminal domains of RARA, showed that, while these artificial fusions could recapitulate the
in vitro properties of PML-RARA, they did not give rise to leukemia in vivo (Sternsdorf et al.,
2006). These data further suggest that loss of retinoid signaling alone was insufficient for
leukemia development. X-RARA must therefore modulate additional signaling pathways, outside
of retinoid signaling, during APL pathogenesis. Several lines of evidence support this
hypothesis: First, PML-RARA, acting as an oligomer with RXRA, binds a wider range of
response elements in vitro than RARA (Kamashev et al., 2004). Previous data from our lab
indicate that NPM-RARA and NuMA-RARA bind to, and repress transcription from, vitamin D3
response elements (VDREs) and peroxisome proliferator activated response elements (PPREs)
(Kamel-Reid et al., 2003). Our whole genome analysis of NuMA- and NPM-RARA+ cells
indicated that the fusions also directly or indirectly affect pathways involving cytokine receptors
and chemokine signaling mediated by up-regulation of factors such as IL8, CCL2, CCL20,
CXCL10, and IL7R.
With the advent of ChIP-chip, and more recently ChIP-seq, technologies, the ability to directly
identify binding sites, and hence direct transcriptional binding targets of proteins of interest
became more feasible. PML-RARA is thought to function as an aberrant RARA, which has lost
the ability to respond to ATRA and therefore causes transcriptional repression of target genes
containing DR2 or DR-5 response elements. Recent ChIP-seq based studies by Martens et al.,
used in our analysis, demonstrated that the fusion acquires a gain of function in DNA recognition
and binding, and therefore binds an extended repertoire of genes containing DR1, DR3, DR4,
and other non-typical DR motifs. Also interestingly, fusion binding sites were found to also
contain other transcription factor motifs, including that for PU.1, which is a critical transcription
factor in normal hematopoesis and promoting differentiation of committed myeloid progenitors
(Rosenbauer and Tenen 2007). PU.1 is known to be suppressed in APL cells, but is restored after
175
treatment with ATRA (Mueller 2006). In the recent analysis of PML-RARA binding targets,
Wang et al. also report that cellular PML-RARA complexes were found to contain PU.1 as an
interaction partner in addition to RXRA at some DNA sites. Our results show that PU.1 target
sites are also present in a subset of genes deregulated by NPM-RARA, and supports the fact that
NPM-RARA, like PML-RARA, has the potential to co-opt other transcriptional networks. This
may be through the fusion acquiring the ability to recognize atypical binding motifs, or through
physical interaction with other partner transcription factors to deregulate other downstream
targets.
In addition to the presence of PU.1 binding sites, an analysis of upstream regulatory elements on
genes transcriptionally targeted by the APL fusions allowed us to identify over-represented
recognition sites for other transcription factors including the FOX family of transcription factors,
as well as RELA, which we previously reported as functionally deregulated in APL (c.f Chapter
2). The Forkhead box (FOX) proteins are transcriptional regulators with a common DNA binding
domain. While this DBD is highly conserved among more than 41 FOX family members in
humans, the genes have distinct functions and tissue specific expression (Myatt and Lam 2007).
Together, they control a wide array of cellular functions including cellular metabolism,
development, differentiation, proliferation, apoptosis, migration and invasion (Myatt and Lam
2007). The FOXO, FOXM, FOXP, FOXC and FOXA proteins have been linked to
tumorigenesis and cancer progression. Activation of FOXO is associated with cell cycle arrest
and apoptosis, and is therefore thought to have tumour suppressive functions (Brunet 1999, Kops
2002). Deregulated expression of Foxl1 is associated with gastrointestinal carcinogenesis, as
Foxl1 null mice exhibited deregulated epithelial cell proliferation through altered β-catenin and
WNT signaling (Perreault 2001). Interestingly, FOXO signaling is also implicated in restricting
HSC proliferation, and therefore preserving HSC self-renewal capacity (Coffer 2007).
As FOX transcriptional signaling has not been reported to be deregulated in APL, we sought to
determine whether any of the FOX family members identified in our analysis interact directly
with any of the fusion partners, or components of retinoid signaling. Of note is the interaction
between PPARγ signaling and FOXL1 (Figure 3.3). PPARγ physically interacts with PML, and
strongly with RXRA. Furthermore, our previous studies indicate that PPARγ signaling is
deregulated in NPM-RARA expressing cells, possibly through direct interactions between the
176
NPM-RARA fusion and PPAR-RXR complexes. It is therefore conceivable that the deregulated
PPARγ signaling in NPM-RARA, can contribute to the deregulation in FOXL1 mediated
transcription and function. PLZF is also involved in a genetic interaction with FOXO3 indirectly
through its interactions with prostaglandin family PGF, and the prostaglandin receptor PTGFR.
While we were not able to find any published literature that describes direct or indirect
interaction of FOX family members with wild type NPM, or NuMA, or other APL fusion
partners identified to date, this is a question worth pursuing further by experimentation as it
offers insights into alternative pathways that the fusions may be directly affecting.
The NPM-RARA target gene list also overlapped with signatures defining the AML LSC
population in two independent studies. This was an intriguing finding, and suggests that, like
PML-RARA, the variant fusions may also be involved in inducing or maintaining the leukemia
phenotype by affecting stem cell function. These overlapping gene targets, when assessed for
shared functional properties, were found to be involved in cell adhesion, ribosome structure, and
mTOR signaling. Cell adhesion has been described to be critical for stem cell function, and
known to be deregulated in leukemia (Clarke and Fuller, 2006). Other basic cellular pathways
such as the ribosome, and regulation of translation were also identified as novel pathways
deregulated in LSCs (Majeti et al., 2009), and found to be in common with NPM-RARA
deregulated genes. Taken together, our combined analysis comparing NPM-RARA induced gene
signatures with two AML LSC gene expression profiling studies allowed the identification of
common genes and pathways which may be effective in APL, as well as AML more broadly in
targeting the LSC fraction of the bulk tumour.
Having established the baseline functional effects of the fusions, we looked to assess the fusion’s
molecular response to the therapeutic agent, ATRA. An important observation is the proportion
of wild type retinoid signaling targets that were induced in the two fusions: We observed that the
majority (64%) of ATRA responsive targets in NuMA-RARA were also ATRA responsive in
wild type cells, while those genes uniquely regulated by the fusion comprised 27% of the dataset.
This is distinct from NPM-RARA, where the majority of ATRA responsive targets (54%) were
unique to NPM-RARA. This suggests that the two fusions have distinct responses to ATRA at
the transcriptional level, at the early time point tested. Further studies assessing later time points
in the fusions’ response to ATRA will help understand the dynamics of the ATRA response in
variant fusion biology.
177
Upon analyzing ATRA induced expression signatures in NPM-RARA, we observed that there
was a positive correlation between ATRA induced gene sets in NPM-RARA, and Prostaglandin
F receptor agonists, Dinoprost, Aloprostadil, and 15-delt Prostaglandin J2. This is supported by
very recent studies (Hegde et al., 2011) which demonstrate anti-leukemic activity for another
class of prostaglandins (delta 12 PGJ3), and apoptosis induction in BCR-ABL+ and Friend
erythroleukemia stem cells. Prior studies have also demonstrated similar in vitro growth
suppressive activity for PGE1, PGD2, and PGJ2 on cell lines and normal bone marrow
progenitors (Tsao et al., 1986). These studies showing the relevance of prostaglandin signaling as
a therapeutic target of interest in leukemia further lends credence to the applicability of cell line
models and the use of various genomic profiles to inform disease mechanisms and offer
therapeutic insights that can be validated in vivo.
3.6 Conclusions
NPM-RARA and NuMA-RARA deregulate genes involved in cellular signaling and
inflammation, and are predicted to involve other transcriptional regulators such as the FOX
family of transcription factors as cooperating factors in leukemia development. Genes
deregulated by the fusions also overlap with targets previously identified to be direct targets of
the PML-RARA and PLZF-RARA fusion proteins, and also overlap with genes deregulated by
leukemia initiating cells in acute myeloid leukemia. This gene expression profiling approach
extended to use ATRA treatment also revealed compounds with transcriptional effects that are in
common with ATRA and that may serve as additional therapeutic targets that also work to
enhance our understanding of disease mechanisms.
178
Chapter 4
Nucleophosmin is universally deregulated In Acute Promyelocytic
Leukemia
Mariam Thomas, Mahadeo A. Sukhai, Jeff L. Hummel, Yali Xuan, Mark D. Minden, Suzanne
Kamel-Reid.
Co-Author contributions:
MDM and SKR reviewed and retrieved all clinical data associated with APL patient samples
described in Table 4.2. JLH performed the experiments described in Figures 4.11 and 4.12. MAS
and MT obtained and quantified images described in Figure 4.3. YX assisted in processing
mouse cells for Figure 4.7 and the AgNOR staining protocol in Figure 4.8.
179
4 Nucleophosmin is universally deregulated in Acute Promyelocytic Leukemia
4.1 Abstract
Nucleophosmin (NPM) is a multifunctional nucleolar phosphoprotein with roles in ribosome
biogenesis, centrosome duplication, p53 response and DNA repair. NPM is juxtaposed with
retinoic acid receptor α (RARA) in Acute Promyelocytic Leukemia (APL), raising the
possibility that NPM’s functions are disrupted in this leukemia. We therefore sought to
determine the extent of NPM deregulation in the U937-NPM-RARA cell line model, and to
extend this analysis more generally to APL. NPM was distributed into abnormally large
aggregates within the nucleus and/or throughout the cytoplasm of cells expressing NuMA-
RARA, and PML-RARA, and reverted to normal after treatment with all-trans retinoic acid
(ATRA). NPM protein levels were also significantly increased in all APL fusion expressing cell
lines. Ribosomal RNA precursor expression was increased in U937-NPM-RARA cells,
compared to controls. Protein synthesis rates in U937-NPM-RARA cells were twice that in
control U937 cells. Finally, we analyzed pre-rRNA and 18S rRNA expression in bone marrow
RNA extracted at diagnosis from APL patients, to assess nucleolar function in APL. Elevated
18S rRNA levels were observed in 10/16 APL patient samples; 8/16 had similarly elevated pre-
rRNA levels. We therefore present the first evidence that NPM may be universally deregulated
in APL, leading to defective NPM function within the leukemic cell.
180
4.2 Introduction
Acute promyelocytic leukemia is characterized by a block in granulocytic differentiation, leading
to the accumulation of promyelocytes in the bone marrow and peripheral blood, and a unique
sensitivity to treatment with all-trans retinoic acid (ATRA) (Grignani et al., 1994). More than
99% of APL cases involve a balanced chromosomal translocation, resulting in the fusion of the
promyelocytic leukemia (PML) gene with retinoic acid receptor alpha (RARA) (Alcalay et al.,
1991; de The et al., 1990; Pandolfi et al., 1992; Pandolfi et al., 1991), a nuclear hormone receptor
and transcription factor (Petkovich et al., 1987). To date, seven other rare RARA fusion genes
have been identified in variants of APL, including NPM and NuMA (Arnould et al., 1999;
Catalano et al., 2007; Chen et al., 1993b; Hummel et al., 1999; Macedo Silva et al., 2005; Redner
et al., 1996; Wells et al., 1997; Wells et al., 1996; Yamamoto et al.); the resulting RARA fusion
proteins expressed in APL are collectively referred to as X-RARA.
We and others have previously reported that nucleophosmin, NPM (B23, NO38, numatrin) was
deregulated in t(5;17) APL patient cells, expressing NPM-RARA (Redner et al., 1996, Hummel
et al., 1999). NPM fusion proteins occur in several hematologic malignancies, including APL
(Duyster et al., 2001; Hummel et al., 1999; Redner et al., 1996; Yoneda-Kato et al., 1996).
Mutations in NPM’s C-terminus (NPMc), leading to its cytoplasmic accumulation, occur in
~33% of patients with normal karyotype Acute Myeloid Leukemia (AML) (den Besten et al.,
2005; Falini et al., 2005). NPM is an abundant nucleolar phosphoprotein, involved in several
regulatory processes, including ribosomal biogenesis (Dundr and Olson, 1998; Huang et al.,
2005; Zirwes et al., 1997a; Zirwes et al., 1997b), nucleolar function (Vascotto et al., 2009) and
centrosome duplication (Okuda et al., 2000; Tokuyama et al., 2001). In cells, NPM is localized
in 2-5 distinct nucleolar aggregates associated with ribonucleoprotein processing (Borer et al.,
1989; Dumbar et al., 1989; Yung et al., 1985). NPM associates with ARF and MDM2, involved
in regulation of the DNA damage response (Colombo et al., 2005).
NPM is also involved in cellular processes including ribosome biogenesis, genome stability, and
apoptotic stress response. NPM is involved in 5S rRNA nuclear export, processing and assembly
of ribosomes (Yu et al., 2006). NPM also binds nucleic acids, processes pre-rRNA molecules,
and controls protein aggregation in the nucleolus during ribosome assembly (Lindstrom and
Zhang, 2008). NPM is a key player in maintaining genomic integrity, through its control of DNA
181
repair mechanisms (Lin et al., 2010) (44). During mitosis, NPM is also involved in centrosome
duplication by protecting the cell from centrosome hyperactivation/division and therefore
checking cellular transformation (Okuda et al., 2000). NPM modulates p53 activity and stability
and therefore controls the apoptotic response. Stress stimuli are known to disrupt nucleoli and as
a result cause NPM redistribution to the nucleus, where it can interact with p53 (Kurki et al.,
2004). NPM binds and inhibits HDM2, a p53 E3 ubiquitin ligase in the nucleus (Kurki et al.,
2004). NPM deregulation in APL can also lead to altered genomic stability after genotoxic stress
and apoptosis.
Given these various functional roles of NPM, and its contribution to the phenotypes of
hematologic malignancies, we sought to determine the consequences of NPM deregulation in
APL cells expressing NPM-RARA. Herein, we examined roles in nucleolar function and protein
synthesis. We report that NPM is over-expressed and delocalized in APL cells, and that this
deregulation is associated with increased protein synthesis.
182
4.3 Materials and Methods
4.3.1 Cell culture and treatment.
The promonocytic cell line U937 and the APL cell line NB4 expressing PML-RARA, were
purchased from the American Type Culture Collection. U937-GFP, U937-NPM-RARA and
U937-NuMA-RARA cells were developed using retroviral transduction in our laboratory. All
cell lines were grown in RPMI 1640 medium, containing 10% fetal bovine serum, 1.5 m/L l-
Glutamine, and penicillin/streptomycin.
4.3.2 Western blotting.
Samples were harvested from cell cultures and patient material, and whole cell extracts prepared.
All patient material was approved for use in this study by the institutional Research Ethics Board
(REB #10-0175-TE). Nuclear/cytoplasmic fractionation was carried out as previously described
(Kamel-Reid et al., 2003). Protein concentrations were determined using the BioRad Protein
Assay kit (BioRad). Samples were run on 8% SDS-PAGE, transferred to PVDF membranes
(BioRad), and probed with mouse monoclonal anti-NPM (Abcam) and anti-β-actin-HRP (Santa
Cruz Biotechnology) antibodies. Blots were visualized using ECL+ detection reagent (GE
Healthcare). Blots were quantified using densitometry on the ImageJ 1.41o software. Band
intensities were quantified and NPM band intensities in the nuclear and cytoplamic
compartments were normalized against intensities of the nuclear maker LaminB and the
cytoplasmic marker, IkBα respectively.
4.3.3 Protein half-life analysis.
To assess NPM protein half-life, cells were treated with 100 µg/mL cycloheximide (CHX),
which inhibits de novo protein synthesis. Cells were harvested 0-8 hr after treatment and
analyzed by western blotting.
4.3.4 Laser-scanning confocal microscopy.
Cytospin preparations were made using standard hematological techniques, and immunostained
with mouse monoclonal anti-NPM (Abcam). Rhodamine-conjugated anti-mouse IgG was used as
the secondary antibody. Slides were analyzed using a Zeiss LSM510 Laser Scanning Confocal
183
Microscope, integrated camera and software (Zeiss, Germany), 63x/1.2NA water immersion
objective lens, at room temperature, and protein localization determined by scoring ≥200 cells in
5 fields of view/slide.
4.3.5 Markers of nucleolar activity.
Cell volume and proliferation, as well as protein synthesis rates, are all surrogate markers of
nucleolar activity. In order to profile the nucleolar activity of X-RARA+ cells, we examined
these markers using functional assays. Cell volume was assessed by flow cytometry. Forward
scatter, a measure of cell diameter, was determined, and used to calculate relative cell volume.
Cell proliferation rates were measured using the MTS assay (CellTiter96® AQueous Non-
Radioactive Cell proliferation assay, Promega), according to the manufacturer’s instructions.
Protein synthesis rates were determined via incorporation of a fluorescently-conjugated
methionine analogue into nascent proteins and flow cytometry, according to the manufacturer’s
protocol (Click-iT® AHA Alexa Fluor® 488 Protein Synthesis HCS Assay, Invitrogen).
4.3.6 Nucleolar organizing region morphology.
Nucleolar organizing region morphology was assessed using silver nitrate staining, as described
previously (Trere, 2000). Cytospin preparations of cell lines were prepared according to standard
methods, stained with silver nitrate, and quality control assessed using light microscopy. Slides
were then scanned using Aperio Scanscope CS system and images viewed with Aperio’s
ImageScope 10 software (Advanced Optical Microscopy Facility, University Health Network).
Five representative fields of view were selected from each slide, and further evaluated on ImageJ
software to quantify AgNOR stained nucleolar area.
4.3.7 Patient Samples.
Total RNA was extracted using TRIZol® (Invitrogen) from bone marrow aspirates of 16 APL
patients at diagnosis (Table 1), with informed consent. All patient material was approved for use
in this study by the University Health Network Research Ethics Board (REB #10-0175-TE).
184
4.3.8 Analysis of rRNA Synthesis by RT-PCR.
0.5 µg total RNA was subjected to reverse transcription using random hexamer primers and the
MuLV RT enzyme (Invitrogen). RQ-PCR was carried out for the assessment of rRNA
biosynthesis using the ABI Prism 7900 Sequence Detection System (SDS; Applied Biosystems)
and SYBR Green I reaction chemistry. Experiments were performed in duplicate for each sample
and repeated if a coefficient of variation >5% was observed. Primer sequences are outlined in
Table 4.1. Data were quantified (SDS software, v2.1, ABI) and analyzed using the ∆∆Ct method
(Livak and Schmittgen, 2001; Reis et al., 2002).
Table 4.1: List of primer sequences used in real time PCR assays.
Gene Forward primer Reverse primer
18s rRNA AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA
Pre rRNA CGCCGCTAGAGGTGAAATTC CATTCTTGGCAAATGCTTTCG
4.3.9 Co-Immunoprecipitation.
Co-IP was performed according to previously described protocols (Hummel et al., 2002). COS
X-RARAV5 cells were transfected with a pSG5-RXRA construct according to the manufacturer’s
suggested protocol for the non-liposomal DNA carrier Effectene (Qiagen). Standard western
blotting protocol was used. Blots were immunoprobed with a 1:5000 dilution of the monoclonal
NPM antibody, 1:500 dilution of the polyclonal RXRA antibody (Santa Cruz), and a 1:1500
dilution of the monoclonal V5 antibody. Electrochemical luminescent detection (NEN Life
Sciences) was carried out using anti-mouse or anti-rabbit HRP-conjugated secondary antibody at
a dilution of 1:7000 (Santa Cruz).
4.3.10 Statistical analyses.
Statistical analyses were performed using Microsoft Excel 2003 and data visualized using
GraphPad Prism 5. Two-population comparisons were performed using two-tailed t-test; multi-
population comparisons were made by ANOVA. Statistical significance was defined as p< 0.05.
185
4.4 Results
4.4.1 NPM is aberrantly expressed in NPM-RARA and PML-RARA cells.
In order to determine if wild type NPM is deregulated at the protein level in APL cells, we
examined protein samples from APL cell cultures and patients probing with anti-NPM that
recognizes the C-terminal region of wild type NPM and is absent in NPM-RARA. In comparison
with normal bone marrow, APL patient samples over-expressed NPM at the protein level
(Figure 4.1 – centre panel vs. left centre panel). Two patient samples exhibited a high degree
of over-expression, while the other samples showed moderate NPM expression in comparison
with normal bone marrow. NPM was also over-expressed in U937-NPM-RARA cells, and NB4
(PML-RARA) compared to empty vector transduced U937-GFP controls (Figure 4.1 – right
centre panel).
Having observed deregulated expression of cellular NPM levels, we questioned whether there is
a concomitant increase in levels of NPM’s nucleolar interaction partner, p14ARF. NPM and
p14ARF form nucleolar complexes that serve a role in regulating nucleolar functions including
ribosome biogenesis and protein synthesis. No changes in ARF levels were evident in normal
bone marrow compared to APL patient samples (Figure 4.1- upper left panel vs. upper centre
panel), or APL cell lines compared to control U937. (Figure 4.1 – upper right panel).
To determine whether NPM over-expression is associated with altered protein localization, we
extracted protein from nuclear and cytoplasmic compartments, and probed for NPM by western
blotting using LaminB and IκBα as nuclear and cytoplasmic markers respectively. NPM was
both nuclear and cytoplasmic in U937-NPM-RARA cells, whereas in controls, NPM was
predominantly nuclear (Figure 4.2 A, B). After normalization using the LaminB nuclear marker,
approximately 13 -15% of total NPM protein localized to the cytoplasm in control U937 and
GFP cells, whereas this proportion was increased to approximately 26% in NuMA- and 29% in
NPM-RARA expressing APL lines (Figure 4.2B). These results indicate that NPM is over-
expressed in X-RARA cells, and increasingly localizes to the cytoplasm in the presence of NPM-
RARA and NuMA-RARA.
186
Figure 4.1: NPM expression in X-RARA+ cells. (A) NPM protein expression was assessed in
APL patient samples, normal bone marrow controls as well as cell lines – control U937-GFP,
U937-NPM-RARA, and NB4-PML-RARA as described in the Methods. Briefly, 20 µg of whole
cell lysate from control (U937-GFP), as well as NPM-RARA NB4 cells, and (B) U937 clones
expressing high and low levels of NuMA-RARA were subjected to 8% SDS-PAGE, transferred
to a PVDF membrane, and incubated with anti-NPM, and anti-β-actin antibodies. While U937
control cells expressed very low levels of NPM, the NPM-RARA, PML-RARA, and NuMA-
RARA expressing cell lines exhibited significant over-expression of NPM. Similarly, total cell
lysates were also prepared from 8 APL patient samples and 4 bone marrow samples obtained
from healthy donors and subjected to SDS-PAGE followed by probing with anti-NPM and anti-
β-actin.
187
Figure 4.1: NPM expression in X-RARA+ cells.
188
Figure 4.2: NPM localization in X-RARA expressing cells. (A) Nuclear/ cytoplasmic
distribution of NPM in APL cell lines. 30 µg of protein from both nuclear and cytoplasmic
fractions were subjected to SDS-PAGE and probed with anti-NPM. Lamin B and IκBα were
used as nuclear and cytoplasmic markers respectively to ensure sufficient purity of the fractions.
(B) Band intensities were quantified using ImageJ v1.41o, and processed to compare the fraction
of NPM present in the cytoplasm and nucleus among all cell lines.
189
Figure 4.2: NPM localization in X-RARA expressing cells.
190
The increased expression and deregulated localization pattern of NPM in X-RARA+ cells was
confirmed by immunofluorescent laser scanning confocal microscopy (LSM). In control U937
cells, NPM localized to 2-4 distinct aggregates within the nucleus (Figure 4.3A) consistent with
the literature, however, in U937-NPM-RARA cells, NPM was present in a dispersed staining
pattern with distinctly smaller aggregates compared to control cells (Figure 4.3A, B). In both
U937-NuMA-RARA, and PML-RARA expressing cells, NPM localized to distinctly larger
nucleolar aggregates (Figure 4.3C, D) compared to control cells. NPM aggregates greater than
20 sq. pixels were increasingly seen at higher frequency in NuMA-RARA and PML-RARA,
compared to control cells (Figures 4.3E, G, H). Leukemic cells from bone marrow of the hCG-
NuMA-RARA transgenic mice also exhibited delocalization and over-expression of NPM (Figure
4.4). The NPM nucleolar aggregate patterns observed in U937-NuMA-RARA and NB4-PML-
RARA were similar to those seen in the OCI-AML3 cell line bearing the NPMc+ mutation
(Figure 4.5).
The basal NPM cellular distribution pattern in X-RARA+ cells was reversible after ATRA
treatment, as ATRA induced the re-formation of distinct nucleolar aggregates in NPM-RARA
cells (Figure 4.3A, B), and restored NPM aggregate size to wild type levels in NuMA-RARA
and PML-RARA cells (Figure 4.3G, H). ATRA treatment reduced total protein levels of NPM
in X-RARA+ cells, while also degrading both NPM- and PML-RARA fusion proteins over time
(Figure 4.3I, J).
191
Figure 4.3: NPM localization within nucleolar aggregates in X-RARA expressing cells. X-
RARA and control U937-GFP cells were treated with 1µM ATRA for 0-96 hrs. At each time
point, cells were harvested, fixed, and stained with anti-NPM to visualize NPM cellular
localization by immunofluorescence. Shown here are representative images of cells untreated
and treated with ATRA for 48 hrs. Cells were cytocentrifuged and immunostained with anti-
NPM antibody, as described in the Methods, and assessed by laser scanning confocal
microscopy. (A1), U937-GFP; (A2), U937-GFP + ATRA; (B1), U937-NPM-RARA; (B2) U937-
NPM-RARA + ATRA; (C1), U937-NuMA-RARA; (C2) U937-NuMA-RARA + ATRA were
GFP-positive and visualized using a rhodamine-conjugated secondary antibody. (D1) NB4; (D2)
NB4 + ATRA cells expressing PML-RARA were also stained with rhodamine conjugated
secondary antibody. Data are representative of 3 independent experiments and a minimum of n =
100 cells scored per experiment. While NPM is localized as 1-3 nucleolar aggregates in control
U937 cells (panel A1; vertical white arrows), NPM was found to localize in large nucleolar
aggregates in NPM-RARA and PML-RARA expressing cells (panels B1, C1 ). NPM displayed a
dispersed staining pattern in NPM-RARA expressing cells (panel D1). Dispersed staining is
indicated by the yellow horizontal arrows, while large NPM aggregates are indicated by the
boxes. Data collected were analyzed using ImagePro v6.0 quantification software. Frequency
distributions of NPM aggregate size in U937-GFP, NB4, U937-NPM-RARA and U937-NuMA-
RARA are illustrated in Panels E-H. In all X-RARA expressing lines, ATRA treatment restored
NPM nucleolar aggregates to more wild type patterns (white arrows). ATRA treatment in PML-
RARA and NuMA-RARA lines resulted in a marked decrease in the size and intensity of NPM
aggregates in these cells. (I) U937-NPM-RARA; and (J) NB4-PML-RARA were cultured in the
presence of 1uM ATRA and harvested at time points 24hr, 48hr, 72hr, and 96 hrs. Cell lysates
were prepared, and protein quantitated and subjected to SDS-PAGE. Proteins were transferred to
PVDF membranes and incubated using anti-NPM, anti-RARA and anti-β-actin to probe for
expression of wild type NPM, as well as the fusion proteins NPM-RARA and PML-RARA.
NPM protein expression is down regulated after ATRA treatment, and is associated with
degradation of NPM-RARA after 48 hrs of treatment and PML-RARA after 24 hrs of ATRA
treatment.
192
Figure 4.3: NPM localization within nucleolar aggregates in X-RARA expressing cells.
U937-GFP U937-GFP +RA
A1. A2.
DAPINPM
DAPINPM
U937-NPMRA U937-NPMRA +RAB1. B2.
DAPINPM
DAPINPM
NB4 (PMLRA) NB4(PMLRA) +RA
C1. C2.
DAPINPM
DAPINPM
U937-NuMARA U937-NuMARA +RAD1. D2.
DAPINPM
DAPINPM
NB4 (PMLRA)
0
10
20
30
40
50
60
70
80
90
100
< 5 5 to 10 10 to 20 20 to 40 40 to 80 > 80
Aggregate area (pixels^2)
Fre
qu
ency
(%)
- ATRA+ ATRA
G.
U937-GFP
0
10
20
30
40
50
60
70
80
90
100
< 5 5 to 10 10 to 20 20 to 40 40 to 80 > 80
Aggregate area (pixels^2)
Fre
qu
ency
(%)
- ATRA+ ATRA
E.
U937-NuMARA
0
10
20
30
40
50
60
70
80
90
100
< 5 5 to 10 10 to 20 20 to 40 40 to 80 > 80
Aggregate area (pixels^2)
Fre
qu
ency
(%)
- ATRA+ ATRA
U937-NPMRA
0
10
20
30
40
50
60
70
80
90
100
< 5 5 to 10 10 to 20 20 to 40 40 to 80 > 80
Aggregate area (pixels^2)
Fre
qu
ency
(%)
- ATRA+ ATRA
F.
H.
193
U937-PMLRARA
NPM
0 24 48 72 96
1µµµµM ATRA
0 24 48 72 96
1µµµµM ATRA
β-actin
PML-RARA
U937-NPMRARA
NPM
β-actin
NPM-RARA
hrs hrs
I. J.
194
Figure 4.4: Localization of Npm in immature neutrophils from wild-type and transgenic
mice. Immature neutrophils were harvested from the peritoneal cavities of n = 10 wild-type and
n = 10 transgenic mice, and immunostained with fluorescently conjugated antibodies to Npm and
RarA, as indicated. DAPI was used to counter-stain the nucleus of cells. A minimum of 200 cells
in at least 5 randomly selected fields of view on a given slide were selected for examination. (A)
Npm localization to the nucleus and nucleolus in a representative wild-type mouse; arrows
indicate two nucleolar aggregates of Npm. (B) Npm localization to the cytoplasm and nucleus,
with a loss in nucleolar staining, in a representative transgenic mice.
195
Figure 4.4: Localization of Npm in immature neutrophils from wild-type and transgenic
mice
Wild Type
DAPI NPM
RARA Merge
hCG-NuMA-RARA
DAPI NPM
RARA Merge
A. B.
196
Figure 4.5: Localization of NPM in NPMc+ OCI-AML3 cells. Cells were cytocentrifuged and
immunostained with anti-NPM antibody, as described in the Methods, and assessed by laser
scanning confocal microscopy. (A), control U937; and (B), OCI-AML3 and visualized using a
FITC-conjugated secondary antibody. Cytoplasmic localization of NPM was evident in OCI-
AML3 cells, in addition to strong presence of nuclear aggregates. White arrows represent wild
type nucleolar staining of NPM; yellow arrows represent increased cytoplasmic staining of
NPM; and white boxes enclose areas of large NPM aggregates.
197
Figure 4.5: Localization of NPM in NPMc+ OCI-AML3 cells.
U937 OCI-AML3
DAPINPM
DAPINPM
A. B.
198
4.4.2 NPM is post-translationally stabilized in NPM-RARA+ cells.
In order to rule out the possibility that NPM deregulation was due to mutations within the NPM1
coding sequence, we subjected cDNA from U937-NPM-RARA cells to the Amplification
Refractory Mutation System (ARMS) test for identification of the NPMc+ mutation found in
40% of normal karyotype AML patients (Noguera et al., 2005). We also sequenced the entire
length of the NPM1 cDNA in U937-NPM-RARA cells, and compared these data to the NPM1
cDNA sequence from control U937 and U937-GFP cells. No mutations were detected within the
NPM1 cDNA in U937-NPM-RARA cells. To determine whether NPM protein overexpression
was the result of increased protein stability, we examined NPM’s half life using cycloheximide
mediated blocking of de novo protein biosynthesis. As cycloheximide blocks de novo protein
synthesis, the rate of protein degradation can be assessed by western blotting at various times
after cycloheximide treatment. Western blotting of cellular lysates after cycloheximide exposure
of 5 minutes – 8 hours indicated that NPM protein half-life was substantially elevated in NPM-
RARA, NuMA-RARA, and PML-RARΑ expressing cells, compared to U937 controls (Figure
4.6). In control U937 cells NPM protein levels reduced to 50% of basal levels after between 2
and 4 hours of cycloheximide treatment (Figure 4.6). In contrast, NPM levels did not
substantially decrease even until 8 hours of treatment in NuMA-RARA cells, and only decreased
appreciably after 4 hours in NPM-RARA cells (Figure 4.6). Similar increased NPM stability
was also observed for NB4-PML-RARA cells (Figure 4.7).
199
Figure 4.6: NPM protein half-life. NPM protein half-life was measured in control and X-
RARA+ cells after treatment with the protein synthesis inhibitor cycloheximide (CHX). Cells
were treated with 100 µg/mL CHX, and at the times indicated on the western blots (0-8 hr),
protein was harvested and run on 8% SDS-PAGE, transferred to a PVDF membrane, and
incubated with anti-NPM, and anti-β-actin antibodies. NPM had a short half-life in U937 and
GFP control cells, disappearing within 2 hr post-CHX treatment. Conversely, NPM half-life was
substantially elevated in NPM-RARA and NuMA-RARA cells and retained strong expression up
to 8 hr post-CHX treatment.
200
Figure 4.6: NPM protein half-life.
U937-NPMRARA
U937-NuMARARA
U937
0h 5m 1h 2h 4h 8h
U937-GFP
0h 5m 1h 2h 4h 8h
IB: NPM IB: ββββ-actin
201
Figure 4.7: NPM half-life in NB4-PML-RARA cells. NPM protein half-life was measured in
PML-RARA+ cells after treatment with the protein synthesis inhibitor cycloheximide (CHX).
Cells were treated with 100 µg/mL CHX, and at the times indicated on the western blots (0-8 hr),
protein was harvested and run on 8% SDS-PAGE, transferred to a PVDF membrane, and
incubated with anti-NPM, and anti-β-actin antibodies. NPM half-life was substantially elevated
in PML-RARA cells and retained strong expression up to 8 hr post-CHX treatment.
202
Figure 4.7: NPM half-life in NB4-PML-RARA cells
NB4 (PMLRARA)
0h 5m 1h 2h 4h 8h 0h 5m 1h 2h 4h 8h
IB: NPM IB: ββββ-actin
203
4.4.3 NPM-RARA+ cells have a cell growth phenotype consistent with disrupted nucleolar function.
A report on NPM regulation by (Apicelli et al., 2008) indicated that disrupted NPM/ARF
stoichiometry, by ARF knockdown, was sufficient to increase NPM half-life, leading to altered
nucleolar morphology and cell growth. Nucleolar disruption in the absence of ARF was
associated with several markers of altered cell growth, such as increased rRNA expression,
volume, proliferation and protein synthesis (Apicelli et al., 2008). We reasoned that X-RARA
mediated deregulation in expression and cellular localization of NPM, may also induce similar
effects to that of ARF knock-out cells. After observing a qualitative and quantitative increase in
nucleolar organizing region size in NPM-RARA and NuMA-RARA cells (Figure 4.8), we tested
several markers of nucleolar function, including cell volume measures and rates of cellular
protein synthesis in NPM-RARA and PML-RARA cells. Relative cell volume assessed by flow
cytometry was moderately increased, by approximately 10% in NPM-RARA+ cells (Figure
4.9A). Furthermore, protein synthesis rates evaluated by methionine incorporation in U937-
NPM-RARΑ+ cells were double that in control U937 cells (Figure 4.9B).
4.4.4 Assessment of pre-rRNA and 18S rRNA expression in APL patient samples.
Having observed increased cell size and increased size of nucleolar aggregates, we examined if
this also resulted in deregulated nucleolar function and therefore increased gene transcription of
rRNAs. We analyzed pre-rRNA and 18S rRNA expression in bone marrow RNA extracted at
diagnosis from 16 APL patients (Table 4.2). Transcript expression levels of 18S rRNA was
elevated in 10/16 APL patient samples; pre-rRNA levels were similarly elevated in 8/16 samples.
Overall, pre-rRNA levels were elevated an average of 2-fold compared to normal controls, while
18S rRNA levels were elevated an average of 1.8-fold (p < 0.05 for both comparisons) (Figure
4.10).
204
Figure 4.8: Nucleolar organizing regions in X-RARA+ cells. We examined nucleolar
morphology, using silver nitrate staining of nucleolar organizing regions (NORs) as described in
the Methods. We observed increased NOR size and number in U937-NPM-RARA (panel B) and
U937-NuMA-RARA (panel C) cells, compared to U937 controls (panel A). Panel insets contain
representative areas of the slide which were cropped and zoomed in to more clearly visualize the
differences in nucleolar size and stain intensity. D) The mean nucleolar size was determined by
scoring and recording pixel size of silver nitrate stained regions within cells using thee ImageJ
software. Mean +/- SEM is plotted for each cell line. E) Histogram indicating the frequency of
certain sized nucleolar regions in U937-GFP, NPM-RARA and NuMA-RARA cells.
205
Figure 4.8 A-E: Nucleolar organizing regions in X-RARA+ cells.
206
Figure 4.9: Measures of nucleolar function in X-RARA+ cells. (A) Measurement of cell
volume in X-RARA+ cell lines compared to U937 controls, by flow cytometry, as outlined in the
Methods. Cells containing NPM-RARA and NuMA-RARA are moderately larger in diameter,
and hence, have increased volume, compared to U937 controls. (B) Measurement of protein
synthesis in X-RARA+ cell lines compared to U937 controls, through incorporation of a
fluorescent methionine analogue, as assessed by flow cytometry, as outlined in the Methods.
Cells containing X-RARA have elevated protein synthesis rates compared to the U937 controls.
207
Figure 4.9: Measures of nucleolar function in X-RARA+ cells.
A.
B.
U937-GFP NPM-RARA PML-RARA100
150
200
250
300
350*p= 0.004
*p= 0.02
U937-GFP NPM-RARA PML-RARA0
50
100
150
200
250*p= 0.03
208
Figure 4.10: Elevated rRNA synthesis rates in APL patient blasts. The expression of 18S
rRNA (A) and pre-rRNA (B) was assessed in 16 diagnostic APL samples (10 BCR1/2 and 6
BCR3) and 6 normal BM samples by RQ-PCR, as described in the methods. BCR1/2 APL
patients demonstrated significant over-expression of both the mature 18S rRNA as well as the
precursor pre-rRNA sequence, compared to both normal BM and BCR3 APL patients.
209
Figure 4.10: Elevated rRNA synthesis rates in APL patient blasts.
210
Table 4.2: Molecular characteristics of APL patient samples used in quantitative PCR assay,
described in Figure 4.10. Samples were tested for presence of the PML-RARA fusion genes, and
specific breakpoints. Further molecular characterization was performed to determine FLT3
mutation status. ITD= Internal Tandem Duplication; TKD = Tyrosine Kinase Domain
Sample
ID PML-RARA breakpoint FLT3 ITD FLT3 TKD
1 BCR 1 or 2 Negative Negative
2 BCR 1 or 2 Intermediate Positive Negative
3 BCR 1 or 2 Negative Negative
4 BCR 1 or 2 Negative Negative
5 BCR 1 or 2 Negative Negative
6 BCR 1 or 2 Intermediate Positive Negative
7 BCR 1 or 2 Negative Negative
8 BCR 1 Negative Negative
9 BCR 1 Negative Negative
10 BCR 1 Negative Negative
11 BCR 3 Intermediate Positive Negative
12 BCR 3 Negative Negative
13 BCR 3 Negative Negative
14 BCR 3 Negative Negative
15 BCR 3 Negative Negative
16 BCR 3 Intermediate Positive Negative
211
4.4.5 NPM and X-RARA interact with RXRA in COS X-RARAV5 cells.
The observations that NPM localization and expression were disrupted in cells expressing X-
RARA proteins raised the possibility that NPM function is deregulated in APL cells through
interaction with X-RARΑ. One of the molecular consequences of X-RARA expression is the
sequestration of RXRA and subsequent disruption of retinoid signaling. We further reasoned that
deregulation and altered localization of NPM may be the result of sequestration by the fusions.
Our results imply that NPM function is disrupted in cells expressing X-RARA, and that NPM
and RXRA directly interact in wild type U937 cells, as well as PML-RARA expressing NB4
cells (Figure 4.11). To test for potential NPM/RXRA/X-RARA interactions, additional
immunoprecipitation assays using RXRA antibody were carried out in COS cells expressing X-
RARAV5. To ensure sufficient levels of RXRA were present for immunoprecipitation, COS X-
RARAV5 cells were transfected with an RXRA expression construct. Western blots
immunoprobed with RXRA antibody revealed that RXRA protein immunoprecipitated with the
bead fractions of all cell lines tested (Figure 4.12 – upper panel). In addition, duplicate western
blots immunoprobed with V5 and NPM antibodies showed that X-RARA and NPM co-
immunoprecipitated with RXRA, respectively (Figure 4.12 – middle and lower panels).
Notably, the majority of X-RARA protein present in the COS X-RARAV5 cell extracts binds
RXRA, with the exception of NuMA-RARA (Figure 4.12 – middle left panel). No significant
differences in the ability of NPM to co-immunoprecipitate with RXRA were observed when
empty vector control (COS pcDNA) cells were compared to COS X-RARAV5 cells.
212
Figure 4.11: NPM co-immunoprecipitates with the retinoid receptors RXRA and RARA in
the promyelocytic leukemia cell lines U937 and NB4, and COS pcDNA cells. Western blot
analysis of immunoprecipitation (IP) assays performed on whole cell protein lysates extracted
from U937, NB4, and COS pcDNA cultured cells. Western blots (WB) were immunoprobed
with NPM monoclonal antibody to detect co-immunoprecipitation. (A) Anti-RXRA and anti-
RARA IP assays performed in U937 and NB4 cells. The first three lanes (IgH) represent the
supernatant (sup), wash, and bead fractions from an antibody-to-bead control. The
immunoglobulin heavy chain (IgHc) migrated at ~55kDa and was primarily found in the bead
fractions. NPM was detected at ~40 kDa in the bead fractions of both RXRA and RARA IPs. (B)
Anti-RXRA and anti-RARA IP assays performed in COS pcDNA cells. Similar to U937 and
NB4 cells, NPM was detected at ~40 kDa in the bead fractions of both RARA and RXRA IPs.
NPM did not precipitate in the bead control sample (A/G beads).
213
Figure 4.11: NPM co-immunoprecipitates with the retinoid receptors RXRA and RARA in
the promyelocytic leukemia cell lines U937 and NB4, and COS pcDNA cells.
RXRA RARA
214
Figure 4.12: NPM and X-RARA co-immunoprecipitate with RXRA in COS X-RARA-V5
cell lines. Western blot analysis of immunoprecipitation (IP) assay performed on whole cell
protein lysates extracted from COS X-RARA-V5 cell lines transfected with an RXRA
expression construct. Triplicate western blots (WB) from a single anti-RXRA IP assay were
immuno-probed with RXRA polyclonal antibody (upper panels), V5 monoclonal antibody
(middle panels), and NPM monoclonal antibodies (lower panels). The left panels represent the
supernatant (sup) fractions while the right panels represent the immunoprecipitated bead
fractions. A sample containing extraction buffer and the RXRA antibody (IgH) was included as
an antibody-to-bead control. Another sample containing extraction buffer and in vitro
transcribed and translated RXRA protein (RXR) was included as a blotting control and
identification marker for RXRA versus the immunoglobulin heavy chain (IgHc). NPM and X-
RARA co-immunoprecipitated with RXRA in COS X-RARA-V5 cells. NPM also co-
immunoprecipitated with RXRA in COS pcDNA empty vector cells.
215
Figure 4.12: RXRA interacts with X-RARA and NPM
RXRA
RXRAIgHC
NuMA-RARAPLZF-RARA
PML-RARANPM-RARA
WB anti-RXRA
WB anti-V5
WB anti-NPM
NPM
COS X-RARA V5
lysates
IP antibody
IP fraction sup beads
216
4.5 Discussion
Here, we report the universal deregulation and delocalization of the multifunctional nucleolar
phosphoprotein Nucleophosmin (NPM) in APL cells. NPM is up-regulated at the protein level, at
least in part due to an increase in its half-life, and is delocalized to the cytoplasm and to
abnormally large aggregates within the nucleus. Interestingly, in NPM-RARA cells we observe
that NPM is delocalized and has a diffuse microspeckled nuclear distribution, which matches that
of the NPM-RARA fusion. We demonstrate that this deregulation is possibly due to interaction
between NPM, RXRA and X-RARΑ, and that it is associated with altered nucleolar organizing
region morphology and function.
Interestingly, our co-immunoprecipitation experiments suggest that an indirect interaction with
the X-RARA/RXRA complex is possible, through the RXRA moiety, although the relevance of
this interaction to APL and to a normal cell has yet to be elucidated. Given that this interaction
would potentially remove NPM from association with the tumor suppressor ARF, thus increasing
its half-life, it may be sufficient to explain the NPM deregulation that we observe in our model
systems.
Sequestration of NPM by X-RARA is predicted to interfere with the stoichiometric balance
between NPM and the tumor suppressor ARF in the nucleolus. Previous reports indicate that a
decrease in the NPM/ARF interaction will have significant consequences to the nucleolar
functions of NPM (Apicelli et al., 2008). For example, knockdown of murine Arf protein leads to
an increase in the pool of NPM relative to Arf, thus stabilizing NPM, increasing nucleolar size,
rRNA synthesis and protein synthesis (Apicelli et al., 2008). This in turn has functional effects in
terms of increased cell volume and cell proliferation. We predicted that NPM sequestration by
the X-RARA/RXRA complex would act in a similar manner to minimize the interaction between
NPM and ARF, thus stabilizing NPM and leading to its over-expression within the cell. This
increased intra-nuclear pool of NPM would then act to increase nucleolar size, rRNA and protein
synthesis, and have functional effects on cell volume and proliferation rates. Our observations
are consistent with this hypothesis, and are applicable across multiple X-RARA, cell line models
and into our hCG-NuMA-RARA mouse model and APL patient samples.
217
Our data also provide a novel mechanism for gene deregulation in APL. NPM was deregulated in
our studies at the protein level. This is one of the first pieces of evidence, to our knowledge, of
alteration in protein expression at the post-translational level that is associated with the fusion
proteins in APL. Much previous effort has focused on the APL fusions as dominant negative
versions of the RARA transcription factor, and therefore has looked specifically at the
transcriptional roles of these fusions within the cell. Here, we provide a potential means by
which protein-protein interaction with the APL fusions can disrupt cellular processes. Although
some analysis of changes in protein expression in response to ATRA has been undertaken, a
systematic identification of all the proteins that interact with each of the APL fusions remains to
be done.
NPM is the first protein, aside from RARA, found to be universally deregulated in APL.
Historically, until the mechanism of transcriptional deregulation now synonymous with APL was
first understood, deregulation of the PML nuclear body was thought to be a primary driver
behind the leukemic phenotype. Strikingly, our data indicate that NPM may interact with RARA,
and hence the APL fusion proteins, though RXRA.
NPMc+ cells (such as the OCI AML3 cell line) display an NPM cellular phenotype very similar
to that which we reported herein. Recently, one group reported the phenotype of a murine model
expressing the NPMc+ cytoplasmic mutant (Cheng et al., 2010), and a comparison between this
model and our hCG-NuMA-RARA transgenic mice allows us to make some inferences about the
involvement of NPM deregulation in the APL phenotype. The hMRP8-NPMc+ mice developed a
mature myeloproliferation with low penetrance (Cheng et al., 2010). In contrast with the
myeloproliferative disease-like myeloid leukemia found in the hCG-NuMA-RARA transgenic
mice, this disease was limited to the bone marrow and spleen, and did not result in elevated
white cell counts or abnormal morphology of peripheral blood cells. Thus, while NPMc was
capable of conferring a distinct proliferative advantage to hematopoietic cells expressing the
hMRP8 promoter, it was incapable of driving a leukemic phenotype. Given that NPM was partly
cytoplasmic in our hCG-NuMA-RARA mice, and that the morphology of the leukemia in these
animals was similar to the myeloproliferation seen in the hMRP8-NPMc+ mice, it is possible
that cytoplasmic NPM localization in our mice contributed to the overall leukemia phenotype.
218
A similar situation is observed in the zebrafish model where expression of NPMc+ lead to
expansion of the erythromyeloid progenitor cells (Bolli et al.). A conditional knock in model of
NPMc was developed recently (Vassiliou et al., 2011). These mice harboring the NPMc mutation
had progenitors with increased replating potential (Vassiliou et al., 2011). Mice also had
decreased survival due to the development of AML characterized by splenomegaly and leukemic
infiltrates in the liver and blood. Genetic mutations that cooperate with NPMc to give rise to
leukemia (AML) were determined using transposon integration sites, where activating
integrations were discovered in Csf2 (encoding GM-CSF). NPMc can therefore initiate leukemia
in this mouse model and acts through increasing expression of HOX genes, increasing bone
marrow progenitor self-renewal, and priming cells to leukemic transformation by activation of
pro-proliferation genes and pathways, and activating mutations in selected transcriptional
regulators (Vassiliou et al., 2011).
The over-expression and the altered protein-protein interaction of NPM make it a good candidate
therapeutic target. A recent report indicated that targeted reduction of NPM protein levels, and
oligomerization potential, sensitized OCI AML3 that carry the NPMc mutations to treatment
with ATRA and cytarabine, while also inducing apoptosis (Balusu et al.). Another compound,
NSC348884, which binds and prevents oligomerization of NPM, has also been shown to be
effective in inducing apoptosis in cancer cells (Qi et al., 2008). These studies suggest that
targeting of NPM may be therapeutically relevant, and also feasible in cancers that are associated
with NPM over-expression or delocalization.
4.6 Conclusion
We present several novel findings in this study: First, that NPM is universally deregulated in
APL; second, that NPM is post-translationally regulated in APL, as opposed to transcriptionally
affected by the fusions; and, third, that nucleolar function, as measured by ribosomal RNA
biosynthesis and protein synthesis, are elevated in APL, and are associated with NPM
deregulation in a manner consistent with NPM’s roles within the cell. In this study we present
the potential for functional consequences of NPM deregulation in APL. These data are useful in
elucidating means by which the APL fusions, and by extension, other leukemia-associated fusion
proteins, may cause changes within the cell not directly associated with transcription, and shed
light on additional aspects of the cellular phenotype induced by X-RARA.
219
Chapter 5
Summary and Future directions
220
5 Summary and Future Directions
5.1 Deregulation of NF-κB and abnormal TNFα response in NPM-RARA variant APL
5.1.1 Summary
Our analysis of the NF-κB pathway in APL demonstrated that NF-κB target genes were
significantly deregulated in primary APL patient samples, relative to normal bone
marrow, using real-time quantitative RT-PCR (RQ-PCR). The majority of these
deregulated genes showed a trend toward normal expression levels in post-treatment
patient samples. These data indicate defects in NF-κB -mediated gene expression are
associated with APL pathogenesis. Western analysis of protein derived from U937-NPM-
RARA and NB4 cells demonstrated over-expression of NF-κB (p65) protein, as well as
its transcriptional target IκBA. The increased pool of NF-κB localized to both the
cytoplasm and the nucleus in U937-NPM-RARA cells.
Having observed deregulated expression of downstream targets of NF-κB, suggesting
increased activation of this signaling pathway, we then sought to examine the ability of
X-RARA to confer resistance to TNFα-mediated apoptosis. Our results in colony
formation assays indicated that NPM-RARA expressing cells formed significantly more
colonies, in the presence of 0-100 ng/mL TNFα, in a dose-dependent manner, compared
to U937 control cells. These data suggested a greater ability on the part of NPM-RARA+
cells to survive and proliferate in the presence of TNFα. Ours is the first report
implicating deregulated NF-κB mediated survival signaling in the pathogenesis of PML-
and NPM-RARΑ+ APL. We also demonstrate that both PML-RARA and NPM-RARΑ
induce a pro-survival phenotype upon TNFα stimulation, and that this is correlated with
increased abundance and activation of NF-κB in cells. Furthermore, inhibition of NF-κB,
as well as treatment with ATRA, restored cell viabilities to wild type TNFα response in
APL cells.
221
Cellular survival in response to various signals in the bone marrow microenvironment is
a critical target for deregulation in leukemia. The bone marrow microenvironment
produces signals in the form of cytokines and chemokines that regulate hematopoietic
cell survival. TNFα is a pro-inflammatory cytokine that regulates cellular survival by
regulating apoptosis, differentiation, and cellular proliferation. Our evidence therefore
suggests that increased NF-κB expression and activity in NPM-RARA cells may protect
APL blasts against TNFα mediated apoptosis and loss of self-renewal, and therefore may
contribute to their persistence and accumulation in the bone marrow.
5.1.2 Future directions
A number of questions remain to be addressed in follow-up studies. The identification of
the specific regulatory interaction between X-RARA and NF-κB signaling, particularly
whether there exists a direct protein-protein interaction between the fusions and NF-κB is
currently unknown. NF-κB is known to bind wild type NPM (Dhar et al., 2004);
depending on the specific motifs of NPM that are involved in this interaction with NF-
κB, we may reasonably expect that the NPM-RARA fusion protein will also retain the
ability to interact directly with NF-κB. Furthermore, one study reported a physical
interaction between the NF-κB/p65 interactor and inhibitor IκBβ and RXRA in vitro (Na
et al., 1998b). This interaction would potentially allow for the existence of a complex
comprising of NF-κB/p65 and the X-RARΑ-RXRA heterodimer within the APL cell and
can be tested using co-immunoprecipitation pull down assays that immunoprecipitate
fusion containing complexes, and identifiy individual components of the complex using
peptide sequencing technologies including mass spectrometry.
We would expect that the recruitment of such transcriptional complexes containing
additional transactivation domains on target promoter sequences would result in
deregulated expression of both NF-κB/p65 and retinoid target genes. Furthermore, the
functional presence of these complexes on regulatory elements of target gene
promoters/regulatory elements can be determined by subjecting chromatin
immunoprecipitated using antibodies against the fusion and against NF-κB to DNA
sequencing or array hybridization. More work in this area is required in order to identify
222
the specific mechanism of X-RARΑ mediated deregulation of NF-κB/p65 in APL. These
studies will shed light on the role of survival signaling in the presence of oncogenic
stimuli, which can be extended to other myeloid leukemias.
Our results indicate over-expression of the mitogen-activated protein kinase kinase kinase
8 (MAP3K8), a kinase that phosphorylates and thereby activates IκB kinases, promoting
the activation of NF-κB/p65. Increased expression of MAP3K8 may therefore enhance
NF-κB/p65 translocation, and contribute to its deregulated activity in APL. Also as
reported previously, decreased PPARγ signaling has been associated with increased NF-
κB activation and subsequent increase in proliferation and decrease in apoptosis.
Deregulated NF-κB signaling in our cell models could also be the result of decreased
PPARγ signaling as the fusions are known repressors of this pathway. In order to further
investigate the potential link between PPARγ signaling deregulation and its effects on
NF-κB, future work focusing on the following avenues can be explored. As Troglitazone
is a PPARγ agonist, and stimulates PPARγ signaling in the presence of the fusions,
activation of this pathway is expected to decrease NF-κB activation and survival
signaling. Likewise, forced PPARγ over-expression in the context of APL can be used to
drive signaling through this receptor, in order to test whether this leads to NF-κB
suppression.
In order to understand other underlying causes of decreased TNFα sensitivity in X-
RARA cells, whole genome lenti-viral shRNA screening could also be utilized to
determine genes involved in TNFα survival response in APL. In this experimental set-up
we would look to identify those genes which when knocked–down would increase TNFα
sensivity in fusion expressing cell lines exposed to a sh-RNA library prior to treatment
with TNFα. Using a similar experimental set up on wild type U937 cells we would also
be able to determine whether those genes involved in TNFα resistance in APL are also
involved in regulating the pathway in wild type cells.
223
5.2 Downstream genetic targets of the acute promyelocytic leukemia fusion proteins NPM-RARA and NuMA-RARA.
5.2.1 Summary
Our studies also used a whole genome approach to determine the identities of additional
signaling pathways, which can potentially cooperate with X-RARA in APL, and are
commonly modulated by multiple X-RARA during APL pathogenesis. We observed
NPM-RARA and NuMA-RARA exert distinct but overlapping transcriptional effects on
the cell. A total of 105 probesets were commonly deregulated by both X-RARA and
included genes involved in cytokine receptor interactions, signaling and metabolism.
Deregulated gene targets in NPM-RARA and NuMA-RARA overlapped with gene
signatures associated with AML leukemia stem cells, suggesting shared functional
characteristics between cell populations expressing X-RARA, and those with leukemia
initiating properties in AML. A subset of deregulated targets were also recently reported
to be direct binding targets of the APL fusion protein PML-RARA, and therefore has
strong potential to be directly bound by other variant fusion proteins as well. These data
represent the first comparison of the genetic profiles of the variant fusion proteins NPM-
RARA and NuMA-RARA in a hematopoietic cell system and are a significant step in
identifying key targets that cooperate with X-RARA in the development of APL.
5.2.2 Future directions:
Our comparative analysis of gene expression profiles of the variant NPM- and NuMA-
RARA fusions identified a common gene expression signature, and indicated that this
signature bears resemblance to the gene signature specific to leukemia stem cells in
AML. Further analysis of this association will help elucidate the impact of the APL
fusions in altering pathways involved in maintaining malignant stem cell characteristics
in leukemia. This work, when successful, could also be extended to other fusion genes
and driver mutations associated with AML, and could lead to development of
therapeutics targeted at the LSC fraction in AML.
While previous array studies have identified gene expression deregulation in stem cell-
associated cellular pathways – for example, Wnt signaling– a clear understanding of
224
direct transcriptional targets and protein interaction partners that mediate leukemic effects
in APL remains to be developed. Our integrated array analysis performed using gene
expression signatures, promoter element analysis, and other published leukemia array
datasets identified the involvement of gene networks and functional categories that
contribute to, or are directly involved in, mediating the fusions’ effects on maintaining an
LSC-like phenotype.
While several array studies have been conducted thus far, the issue remains to identify
which of these identified genetic changes drive disease pathogenesis, and separating these
from the wide range of changes that may simply be the consequence of the malignancy.
Identifying these changes that drive disease pathogenesis will be an essential step to
determining high efficacy therapeutic targets that specifically target the malignant clone.
The field still needs a reliable screening method to help prioritize those driving changes
that are critical in disease initiation and development. One potential method to more
readily identify driver changes is through the integrative analysis of multiple data types
from the same tumour sample. Integrating data obtained from SNP arrays, gene
expression analysis, proteomics, micro-RNA profiles, and mutational analysis can
provide a better understanding of the types and frequencies of changes that occur at
different genomic regions, and those genetic networks with multiple deregulated events
are worthy of further examination and therapeutic targeting.
High throughput methods are being developed to study the proteome and to examine
transcriptional regulation through the use of protein and microRNA (miRNA)
microarrays. MicroRNAs (miRNAs) are non-coding RNAs, of 18-22 nucleotides in
length, involved in regulation of gene expression by either inhibiting mRNA translation
or degrading mRNA (Di Leva et al., 2006). MiRNAs are involved in numerous important
biological processes including development, differentiation, apoptosis, and proliferation
(Bartel, 2004; Cummins and Velculescu, 2006; Harfe, 2005) and are believed to have
roles in oncogenesis as well. They can act as either tumor suppressors or as oncogenes
(Cummins and Velculescu, 2006). Evidence supports a role for miRNAs in
hematopoiesis (Chen et al., 2004; Fazi et al., 2005). These studies focused on studying
the role of miRNAs using a candidate gene approach, selecting specific target miRNAs
225
for analysis. One of the first high-throughput studies to examine the global miRNA
profile of hematopoietic cells was the report of ATRA induced changes in miRNA
expression in the PML-RARA+ APL cell line, NB4 (Garzon et al., 2007). Using a
microarray chip consisting of 245 human and mouse miRNA genes, the group identified
a list of miRNAs, including miR-107, let-7a-3, and miR-223 differentially expressed
during ATRA induced differentiation.
Taken together, whole genome miRNA profiling of acute leukemias shows promise in
the fields of understanding leukemia biology, providing additional diagnostic criteria, and
perhaps also in determining novel therapeutic targets. Future studies integrating miRNA
profiles with transcriptome and proteome information can yield powerful insights into the
pathogenesis and treatment of acute leukemias.
5.3 Nucleophosmin (NPM) is universally deregulated in Acute Promyelocytic Leukemia
5.3.1 Summary
NPM is a multifunctional nucleolar phosphoprotein with roles in ribosome biogenesis,
centrosome duplication, p53 response and DNA repair, and is commonly mutated in
AML. NPM is juxtaposed with RARA in APL, raising the possibility that NPM functions
are disrupted in this leukemia. Previous work in our lab used immunofluorescence
microscopy to demonstrate abnormal distributions of NPM in patient-derived APL cells
carrying NPM-RARA or PML-RARA, transgenic hCG-NuMA-RARA mice, as well as
cell lines expressing X-RARA: NPM was distributed into abnormally large aggregates
within the nucleus and/or throughout the cytoplasm. In this thesis, we demonstrate that
NPM distribution reverted to normal after treatment with ATRA. NPM protein levels
were also significantly increased in X-RARA+ cell lines, and APL primary patient blasts.
This is likely due to an alteration at the protein level, as NPM mRNA expression was
unaffected by X-RARA, and no mutations were detected in the NPM locus. Indeed, we
found that NPM protein half-life was increased in U937 cells expressing X-RARA.
Taken together, these data suggested a potential disruption in nucleolar architecture in
APL cells. Alterations in size and number of nucleolar organizing regions (NORs) in
226
NB4 and U937-X-RARA cells were evident by light microscopy, when compared to
U937 controls. Defects in nucleolar organization may lead to altered ribosome
biogenesis, protein synthesis, as well as cell size and proliferation. Ribosomal RNA
precursor expression was significantly increased in U937-NPM-RARA cells, compared
to controls. Relative cell volume, assessed by a flow cytometric assay, was moderately
increased in NPM-RARA+ cells, while cell proliferation rates were significantly
increased, compared to U937 controls. Analysis of protein synthesis rates in U937-NPM-
RARA+ cells indicated that the incorporation of a fluorescent methionine analogue was
increased two-fold, compared to that in control U937 cells. Finally, in order to determine
the applicability of our in vitro functional assays to APL patients, we analyzed pre-rRNA
and 18S rRNA expression in bone marrow RNA extracted at diagnosis from 16 APL
patients, in order to determine whether evidence of elevated nucleolar function was found
in APL. When taken as a group, 10/16 APLs had elevated 18S rRNA levels; 8/16 had
similarly elevated pre-rRNA levels. We therefore present the first evidence that NPM
may be universally deregulated in APL, leading to defective NPM function within the
leukemic cell. Our data also provide a novel mechanism for gene deregulation in APL.
NPM was deregulated in our studies at the protein level. This was the first evidence, to
our knowledge, of alteration in protein expression at the post-translational level that is
associated with the fusion proteins in APL. Much previous effort has focused on the APL
fusions as dominant negative versions of the RARA transcription factor, and therefore
has looked specifically at the transcriptional roles of these fusions within the cell. Here,
we provide a potential means by which protein-protein interaction with the APL fusions
can disrupt cellular processes.
5.3.2 Future directions
Our results provide evidence for interactions between RXRA and NPM, and between
RXRA and X-RARA. As NPM interacts with a variety of other nucleolar proteins as well
as other regulatory factors, it will be interesting to identify all the components of the
NPM-RXRA-X-RARA complex. A detailed analysis of this interaction network can be
achieved in a high-throughput manner by subjecting the protein complex pulled down
using anti-NPM, and anti-RARA antibodies to a mass-spectrometry based screen to
227
determine the identities of the interacting elements. These data will help determine other
functions of NPM that may be deregulated in APL and test whether direct interactions
between NPM and X-RARA contribute to the deregulation of this pathway in APL.
Increased abundance and protein half-life of NPM in X-RARA expressing cells indicates
that NPM may be differentially post-translationally regulated in this leukemia. By
subjecting endogenous NPM from both wild type and fusion expressing cells to Tandem
Mass Spectrometry, we will be able to identify differentially expressed post-translational
modifications that result in increased NPM stability in APL. These studies will help
elucidate the mechanisms involved in NPM deregulation in APL, assessing protein-
protein interactions, and post-translational modifications that can mediate increased
protein stability and deregulated activity.
Conclusions
Taken together the work described in this thesis highlights the cell biology,
transcriptional, and protein-protein interaction effects of the NPM-RARA variant
oncoprotein in APL. Future work in this field will look into further elucidating those gene
products that are directly modulated by the fusions, and therefore may be primary drivers
of APL pathogenesis.
228
Appendices
229
Appendix I: Array data tables Chapter 3
Table A3.1: Genes deregulated greater than 2-fold in U937-NPM-RARA relative to control U937-GFP Probe Set ID Fold change
([NPM-RARA] vs.
[CONTROL])
Regulation ([NPM-
RARA] vs. [CONTROL])
Unigene (Avadis)
Gene Symbol Gene Title
226990_at 2.0001063 down Hs.471818 CAPRIN1 cell cycle associated protein 1 204587_at 2.000131 down Hs.194686 SLC25A14 solute carrier family 25 (mitochondrial carrier, brain),
member 14 212467_at 2.0027783 down Hs.12707 DNAJC13 DnaJ (Hsp40) homolog, subfamily C, member 13 234975_at 2.0033357 down Hs.592542///H
s.712597 CDNA FLJ39067 fis, clone NT2RP7014910 /// CDNA
FLJ38048 fis, clone CTONG2014264 219360_s_at 2.0098498 down Hs.467101 TRPM4 transient receptor potential cation channel, subfamily M,
member 4 200628_s_at 2.0141098 down Hs.497599 WARS tryptophanyl-tRNA synthetase 238599_at 2.0143933 down Hs.656212 IRAK1BP1 interleukin-1 receptor-associated kinase 1 binding protein 1 215910_s_at 2.0153017 down Hs.508010 FNDC3A fibronectin type III domain containing 3A 1552691_at 2.0158374 down Hs.558599 ARL11 ADP-ribosylation factor-like 11 211742_s_at 2.0171018 down Hs.5509 EVI2B ecotropic viral integration site 2B 226236_at 2.018499 down Hs.349092 LOC388789 hypothetical LOC388789 238684_at 2.0201747 down Hs.633823 Transcribed locus 223318_s_at 2.0207672 down Hs.111099 ALKBH7 alkB, alkylation repair homolog 7 (E. coli) 219576_at 2.021013 down Hs.446275 MAP7D3 MAP7 domain containing 3 1552622_s_at 2.02213 down Hs.696339 LOC100134053
/// LOC392713 /// LOC441259 /// POLR2J2 /// POLR2J4
polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa pseudogene /// DNA directed RNA polymerase II polypeptide J-related /// similar to hCG1989139 /// PMS2 postmeiotic segregation increased 2 (S. cerevisiae)-like /// similar to POLR2J4 protein
244766_at 2.0253541 down Hs.460179 LOC440345 /// LOC440354 /// LOC595101 /// LOC641298 ///
PI-3-kinase-related kinase SMG-1 /// hypothetical protein LOC440345 /// PI-3-kinase-related kinase SMG-1 pseudogene /// hypothetical LOC728423 /// similar to PI-3-kinase-related kinase SMG-1
230
LOC728423 /// LOC729513 /// SMG1
214181_x_at 2.025713 down Hs.436066 LST1 leukocyte specific transcript 1 218138_at 2.026455 down Hs.472119 MKKS McKusick-Kaufman syndrome 206398_s_at 2.028411 down Hs.652262 CD19 CD19 molecule 209628_at 2.0312347 down Hs.25010 NXT2 nuclear transport factor 2-like export factor 2 207008_at 2.034133 down Hs.846 IL8RB interleukin 8 receptor, beta 1570441_at 2.0343087 down Hs.269471 NAPB N-ethylmaleimide-sensitive factor attachment protein, beta 211582_x_at 2.036575 down Hs.436066 LST1 leukocyte specific transcript 1 225762_x_at 2.0415037 down Hs.370699 LOC284801 hypothetical protein LOC284801 209539_at 2.041854 down Hs.522795 ARHGEF6 Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6 202075_s_at 2.0443308 down Hs.439312 PLTP phospholipid transfer protein 1559410_at 2.0455973 down Hs.490920 Transcribed locus 219551_at 2.0457556 down Hs.477325 EAF2 ELL associated factor 2 212616_at 2.045807 down Hs.59159 CHD9 chromodomain helicase DNA binding protein 9 223746_at 2.0461335 down Hs.472838 STK4 serine/threonine kinase 4 215739_s_at 2.0482981 down Hs.224152 TUBGCP3 tubulin, gamma complex associated protein 3 230064_at 2.0492828 down Hs.650577 Transcribed locus 201267_s_at 2.050726 down Hs.250758 PSMC3 proteasome (prosome, macropain) 26S subunit, ATPase, 3 225915_at 2.0515246 down Hs.87159 CAB39L calcium binding protein 39-like 1560026_at 2.0552907 down Hs.685021 CDNA clone IMAGE:5285703 236699_at 2.058871 down Hs.660409 CDNA FLJ90129 fis, clone HEMBB1000309 200965_s_at 2.0590336 down Hs.438236 ABLIM1 actin binding LIM protein 1 234681_s_at 2.0597532 down Hs.371979 CHD6 chromodomain helicase DNA binding protein 6 225768_at 2.0673113 down Hs.37288 NR1D2 nuclear receptor subfamily 1, group D, member 2 200722_s_at 2.067345 down Hs.471818 CAPRIN1 cell cycle associated protein 1 242024_at 2.0687475 down Hs.656132 Transcribed locus 219697_at 2.0763223 down Hs.622536 HS3ST2 heparan sulfate (glucosamine) 3-O-sulfotransferase 2 217984_at 2.0788753 down Hs.529989 RNASET2 ribonuclease T2 207871_s_at 2.081942 down Hs.368131 ST7 suppression of tumorigenicity 7
231
225065_x_at 2.083929 down Hs.368934 C17orf45 chromosome 17 open reading frame 45 231939_s_at 2.094253 down Hs.258272 BDP1 B double prime 1, subunit of RNA polymerase III
transcription initiation factor IIIB 225305_at 2.094777 down Hs.578109 SLC25A29 solute carrier family 25, member 29 222765_x_at 2.0996466 down Hs.369284 ESF1 ESF1, nucleolar pre-rRNA processing protein, homolog (S.
cerevisiae) 211581_x_at 2.1002464 down Hs.436066 LST1 leukocyte specific transcript 1 209901_x_at 2.1039147 down Hs.76364 AIF1 allograft inflammatory factor 1 226436_at 2.107545 down Hs.522895 RASSF4 Ras association (RalGDS/AF-6) domain family member 4 243341_at 2.111661 down 204205_at 2.112657 down Hs.660143 APOBEC3F ///
APOBEC3G apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G /// apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3F
244779_at 2.1131718 down Hs.587465 CDNA FLJ34038 fis, clone FCBBF2005645 210222_s_at 2.1211119 down Hs.368626 RTN1 reticulon 1 200868_s_at 2.1215606 down Hs.144949 ZNF313 zinc finger protein 313 242476_at 2.1248302 down Hs.605126 Transcribed locus 243366_s_at 2.1272874 down Hs.72981 Transcribed locus 202659_at 2.1324925 down Hs.9661 PSMB10 proteasome (prosome, macropain) subunit, beta type, 10 244718_at 2.1389098 down Hs.471067 LOC339483 Hypothetical LOC339483 202854_at 2.1476676 down Hs.412707 HPRT1 hypoxanthine phosphoribosyltransferase 1 (Lesch-Nyhan
syndrome) 219599_at 2.1498694 down Hs.648394 EIF4B eukaryotic translation initiation factor 4B 210943_s_at 2.150597 down Hs.532411 LYST lysosomal trafficking regulator 1566482_at 2.160243 down Hs.684006 Transcribed locus 222859_s_at 2.1645083 down Hs.436271 DAPP1 dual adaptor of phosphotyrosine and 3-phosphoinositides 1558822_at 2.1657143 down Hs.684614 Full length insert cDNA clone YP59C02 225943_at 2.1674364 down Hs.247460 NLN neurolysin (metallopeptidase M3 family) 240772_at 2.1703398 down Hs.687668 Transcribed locus 227485_at 2.1742713 down Hs.496829 DDX26B DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B 200723_s_at 2.174671 down Hs.471818 CAPRIN1 cell cycle associated protein 1 204643_s_at 2.1786573 down Hs.171458 ENOX2 ecto-NOX disulfide-thiol exchanger 2
232
1562194_at 2.183296 down Hs.684712 Full length insert cDNA clone YW28D08 221514_at 2.1872556 down Hs.458598 UTP14A UTP14, U3 small nucleolar ribonucleoprotein, homolog A
(yeast) 218322_s_at 2.1907299 down Hs.11638 ACSL5 acyl-CoA synthetase long-chain family member 5 223922_x_at 2.1933236 down Hs.523702 MS4A6A membrane-spanning 4-domains, subfamily A, member 6A 201539_s_at 2.1956432 down Hs.435369 FHL1 four and a half LIM domains 1 1554892_a_at 2.207399 down Hs.99960 MS4A3 membrane-spanning 4-domains, subfamily A, member 3
(hematopoietic cell-specific) 211937_at 2.2092397 down Hs.648394 EIF4B eukaryotic translation initiation factor 4B 226289_at 2.2250307 down Hs.471818 CAPRIN1 cell cycle associated protein 1 220252_x_at 2.22847 down Hs.665009 CXorf21 chromosome X open reading frame 21 202201_at 2.2379 down Hs.515785 BLVRB biliverdin reductase B (flavin reductase (NADPH) 222003_s_at 2.2533574 down Hs.591002 DOCK6 dedicator of cytokinesis 6 209009_at 2.2579336 down Hs.432491 ESD esterase D/formylglutathione hydrolase 239017_at 2.2613833 down Hs.351043 Transcribed locus 243370_at 2.2642157 down Hs.471818 CAPRIN1 cell cycle associated protein 1 207543_s_at 2.2717898 down Hs.500047 P4HA1 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline
4-hydroxylase), alpha polypeptide I 1561939_at 2.2795866 down Hs.503721 DYNC2H1 dynein, cytoplasmic 2, heavy chain 1 229498_at 2.2831652 down Hs.291319 Transcribed locus 1557261_at 2.2937984 down Hs.655308 LOC652637 ///
WHDC1L1 /// WHDC1L2
WAS protein homology region 2 domain containing 1-like 1 /// WAS protein homology region 2 domain containing 1-like 2 /// similar to junction-mediating and regulatory protein
243514_at 2.2962644 down Hs.661045 Transcribed locus 209294_x_at 2.3005726 down Hs.521456 TNFRSF10B tumor necrosis factor receptor superfamily, member 10b 1556316_s_at 2.3006198 down Hs.707281 LOC284889 hypothetical protein LOC284889 1553185_at 2.3046198 down Hs.657750 RASEF RAS and EF-hand domain containing 224789_at 2.3079128 down Hs.709474 WDR40A WD repeat domain 40A 229367_s_at 2.3168159 down Hs.647105 GIMAP6 GTPase, IMAP family member 6 223328_at 2.3228679 down Hs.287412 ARMC10 armadillo repeat containing 10 217867_x_at 2.3252523 down Hs.529408 BACE2 beta-site APP-cleaving enzyme 2 1564972_x_at 2.3369355 down Hs.631789 SETDB2 SET domain, bifurcated 2
233
232466_at 2.3381941 down Hs.339735 CUL4A Cullin 4A 230435_at 2.3404386 down Hs.710370 LOC375190 hypothetical LOC375190 204499_at 2.3487406 down Hs.494321 AGTPBP1 ATP/GTP binding protein 1 239294_at 2.3601356 down Hs.561747 Transcribed locus 234303_s_at 2.362843 down Hs.152009 GPR85 G protein-coupled receptor 85 228523_at 2.3698564 down Hs.591918 NANOS1 nanos homolog 1 (Drosophila) 223502_s_at 2.3810837 down Hs.525157 TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b 226789_at 2.388231 down Hs.697682 LOC647121 embigin homolog (mouse) pseudogene 226785_at 2.3931837 down Hs.88252 ATP11C ATPase, class VI, type 11C 243357_at 2.398746 down Hs.146542 NEGR1 neuronal growth regulator 1 226999_at 2.399876 down Hs.632430 RNPC3 RNA-binding region (RNP1, RRM) containing 3 220331_at 2.399885 down Hs.25121 CYP46A1 cytochrome P450, family 46, subfamily A, polypeptide 1 202304_at 2.405207 down Hs.508010 FNDC3A fibronectin type III domain containing 3A 209199_s_at 2.4231865 down Hs.699175 MEF2C myocyte enhancer factor 2C 210254_at 2.424963 down Hs.99960 MS4A3 membrane-spanning 4-domains, subfamily A, member 3
(hematopoietic cell-specific) 212686_at 2.4263275 down Hs.435479 PPM1H protein phosphatase 1H (PP2C domain containing) 201360_at 2.4286895 down Hs.304682 CST3 cystatin C 200953_s_at 2.4785903 down Hs.376071 CCND2 cyclin D2 226835_s_at 2.5095668 down Hs.356766 C20orf199 chromosome 20 open reading frame 199 203630_s_at 2.5241778 down Hs.239631 COG5 component of oligomeric golgi complex 5 212229_s_at 2.5375736 down Hs.159699 FBXO21 F-box protein 21 212231_at 2.5438178 down Hs.159699 FBXO21 F-box protein 21 213642_at 2.5552883 down 210298_x_at 2.5561078 down Hs.435369 FHL1 four and a half LIM domains 1 224346_at 2.5577912 down 204949_at 2.5660028 down Hs.654563 ICAM3 intercellular adhesion molecule 3 235520_at 2.5661733 down Hs.308418 ZNF280C zinc finger protein 280C 218918_at 2.56725 down Hs.197043 MAN1C1 mannosidase, alpha, class 1C, member 1 229937_x_at 2.567973 down Hs.667388 LILRB1 Leukocyte immunoglobulin-like receptor, subfamily B (with
TM and ITIM domains), member 1
234
229026_at 2.5713942 down Hs.653643 Transcribed locus 228055_at 2.576628 down Hs.636624 NAPSB napsin B aspartic peptidase pseudogene 206403_at 2.6169062 down Hs.378901 ZNF536 zinc finger protein 536 223501_at 2.6326554 down Hs.525157 TNFSF13B tumor necrosis factor (ligand) superfamily, member 13b 226814_at 2.654285 down Hs.656071 ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif,
9 200952_s_at 2.6592095 down Hs.376071 CCND2 cyclin D2 205376_at 2.6637907 down Hs.658245 INPP4B inositol polyphosphate-4-phosphatase, type II, 105kDa 202648_at 2.7345772 down 219463_at 2.7355642 down Hs.22920 C20orf103 chromosome 20 open reading frame 103 200908_s_at 2.7451262 down Hs.437594 RPLP2 ribosomal protein, large, P2 1558290_a_at 2.7996411 down Hs.133107 PVT1 Pvt1 oncogene homolog (mouse) 218217_at 2.8231165 down Hs.514950 SCPEP1 serine carboxypeptidase 1 217948_at 2.8297436 down Hs.460924 FAM127B family with sequence similarity 127, member B 206759_at 2.8359363 down Hs.465778 FCER2 Fc fragment of IgE, low affinity II, receptor for (CD23) 224407_s_at 2.8525004 down Hs.444247 RP6-213H19.1 serine/threonine protein kinase MST4 223280_x_at 2.8559701 down Hs.523702 MS4A6A membrane-spanning 4-domains, subfamily A, member 6A 237899_at 2.8577225 down Hs.631532 LOC729994 hypothetical LOC729994 219694_at 2.866797 down Hs.591751 FAM105A family with sequence similarity 105, member A 214505_s_at 2.874888 down Hs.435369 FHL1 four and a half LIM domains 1 210299_s_at 2.8758771 down Hs.435369 FHL1 four and a half LIM domains 1 204057_at 2.8920434 down Hs.137427 IRF8 interferon regulatory factor 8 205942_s_at 2.9905415 down Hs.706754 ACSM3 acyl-CoA synthetase medium-chain family member 3 225942_at 3.023462 down Hs.247460 NLN neurolysin (metallopeptidase M3 family) 1552612_at 3.0316563 down Hs.508829 CDC42SE2 CDC42 small effector 2 209560_s_at 3.037277 down Hs.533717 DLK1 delta-like 1 homolog (Drosophila) 218476_at 3.050557 down Hs.522449 POMT1 protein-O-mannosyltransferase 1 227976_at 3.074569 down Hs.42239 LOC644538 hypothetical protein LOC644538 201828_x_at 3.1145337 down Hs.522789 FAM127A family with sequence similarity 127, member A 218499_at 3.146391 down Hs.444247 RP6-213H19.1 serine/threonine protein kinase MST4 201601_x_at 3.2108214 down Hs.458414 IFITM1 interferon induced transmembrane protein 1 (9-27)
235
232383_at 3.2426195 down Hs.125962 TFEC transcription factor EC 214022_s_at 3.248919 down Hs.458414 IFITM1 interferon induced transmembrane protein 1 (9-27) 210377_at 3.2570925 down Hs.706754 ACSM3 acyl-CoA synthetase medium-chain family member 3 219666_at 3.3481128 down Hs.523702 MS4A6A membrane-spanning 4-domains, subfamily A, member 6A 201952_at 3.3782434 down Hs.591293 ALCAM activated leukocyte cell adhesion molecule 206760_s_at 3.428722 down Hs.465778 FCER2 Fc fragment of IgE, low affinity II, receptor for (CD23) 208937_s_at 3.5412586 down Hs.504609 ID1 inhibitor of DNA binding 1, dominant negative helix-loop-
helix protein 213826_s_at 3.5833752 down LOC100133109 similar to histone 1553194_at 3.6176825 down Hs.146542 NEGR1 neuronal growth regulator 1 223721_s_at 3.6589942 down Hs.260720 DNAJC12 DnaJ (Hsp40) homolog, subfamily C, member 12 224356_x_at 3.6768126 down Hs.523702 MS4A6A membrane-spanning 4-domains, subfamily A, member 6A 201951_at 3.6924899 down Hs.591293 ALCAM activated leukocyte cell adhesion molecule 213135_at 3.7599144 down Hs.517228 TIAM1 T-cell lymphoma invasion and metastasis 1 229461_x_at 3.8539445 down Hs.146542 NEGR1 neuronal growth regulator 1 205081_at 3.9021432 down Hs.70327 CRIP1 cysteine-rich protein 1 (intestinal) 222446_s_at 4.0326624 down Hs.529408 BACE2 beta-site APP-cleaving enzyme 2 235046_at 4.413527 down Hs.176376 Transcribed locus 213350_at 4.5241256 down Hs.433529 RPS11 Ribosomal protein S11 205110_s_at 4.5955734 down Hs.6540 FGF13 fibroblast growth factor 13 218976_at 4.647823 down Hs.260720 DNAJC12 DnaJ (Hsp40) homolog, subfamily C, member 12 206715_at 4.648782 down Hs.125962 TFEC transcription factor EC 215047_at 5.0228643 down Hs.323858 TRIM58 tripartite motif-containing 58 228617_at 5.0417824 down Hs.441975 XAF1 XIAP associated factor 1 239340_at 5.53087 down Hs.444181 Transcribed locus 1552386_at 5.5491457 down Hs.547697 C5orf29 chromosome 5 open reading frame 29 201540_at 5.8108406 down Hs.435369 FHL1 four and a half LIM domains 1 219112_at 6.622824 down Hs.483329 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 203923_s_at 6.8786955 down Hs.292356 CYBB cytochrome b-245, beta polypeptide (chronic granulomatous
disease) 203922_s_at 7.4280715 down Hs.292356 CYBB cytochrome b-245, beta polypeptide (chronic granulomatous
disease)
236
224709_s_at 7.61829 down Hs.508829 CDC42SE2 CDC42 small effector 2 1552613_s_at 7.6911745 down Hs.508829 CDC42SE2 CDC42 small effector 2 242715_at 10.302398 down Hs.444181 Transcribed locus 1555247_a_at 12.315356 down Hs.483329 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 219714_s_at 14.661497 down Hs.656687 CACNA2D3 calcium channel, voltage-dependent, alpha 2/delta subunit 3 230078_at 34.80333 down Hs.483329 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6 1555339_at 47.755352 down Hs.190334 RAP1A RAP1A, member of RAS oncogene family 1555340_x_at 66.98855 down Hs.190334 RAP1A RAP1A, member of RAS oncogene family 241808_at 2.0012462 up Hs.658042 CDNA FLJ36977 fis, clone BRACE2006344 217678_at 2.006411 up Hs.390594 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+
system) member 11 207124_s_at 2.0091777 up Hs.155090 GNB5 guanine nucleotide binding protein (G protein), beta 5 224655_at 2.0091856 up Hs.493362 AK3 adenylate kinase 3 226771_at 2.010245 up Hs.435700 ATP8B2 ATPase, class I, type 8B, member 2 224733_at 2.0119143 up Hs.298198 CMTM3 CKLF-like MARVEL transmembrane domain containing 3 201920_at 2.0148942 up Hs.187946 SLC20A1 solute carrier family 20 (phosphate transporter), member 1 227425_at 2.0177138 up Hs.186810 REPS2 RALBP1 associated Eps domain containing 2 210471_s_at 2.0186863 up Hs.654519 KCNAB1 potassium voltage-gated channel, shaker-related subfamily,
beta member 1 206332_s_at 2.0190833 up Hs.380250 IFI16 interferon, gamma-inducible protein 16 241681_at 2.020528 up Hs.656858 Transcribed locus 202073_at 2.0241623 up Hs.332706 OPTN optineurin 212509_s_at 2.0265996 up Hs.250723 MXRA7 matrix-remodelling associated 7 217388_s_at 2.0278747 up Hs.470126 KYNU kynureninase (L-kynurenine hydrolase) 1557038_s_at 2.0323508 up Hs.225914 Clone IMAGE:110862, mRNA sequence 204561_x_at 2.0337727 up Hs.655423 APOC2 ///
APOC4 apolipoprotein C-II /// apolipoprotein C-IV
232422_at 2.0343502 up Hs.350868 RP11-151A6.2 hypothetical protein BC004360 231912_s_at 2.0359485 up Hs.632303 DKFZP434B03
35 DKFZP434B0335 protein
202672_s_at 2.0361893 up Hs.460 ATF3 activating transcription factor 3 225173_at 2.040095 up Hs.486458 ARHGAP18 Rho GTPase activating protein 18
237
219654_at 2.0449255 up Hs.114062 PTPLA protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A
207229_at 2.0467234 up Hs.159297 KLRA1 killer cell lectin-like receptor subfamily A, member 1 218376_s_at 2.0478377 up Hs.33476 MICAL1 microtubule associated monoxygenase, calponin and LIM
domain containing 1 230511_at 2.0480478 up Hs.200250 CREM cAMP responsive element modulator 1559240_at 2.0485454 up 220387_s_at 2.049341 up Hs.142245 HHLA3 HERV-H LTR-associating 3 222347_at 2.0498004 up Hs.652926 LOC644450 hypothetical protein LOC644450 201663_s_at 2.0590868 up Hs.58992 SMC4 structural maintenance of chromosomes 4 221841_s_at 2.05947 up Hs.376206 KLF4 Kruppel-like factor 4 (gut) 219157_at 2.059561 up Hs.388668 KLHL2 kelch-like 2, Mayven (Drosophila) 201201_at 2.0599608 up Hs.695 CSTB cystatin B (stefin B) 209921_at 2.0627186 up Hs.390594 SLC7A11 solute carrier family 7, (cationic amino acid transporter, y+
system) member 11 224048_at 2.063752 up Hs.646421 USP44 ubiquitin specific peptidase 44 208944_at 2.0670264 up Hs.82028 TGFBR2 transforming growth factor, beta receptor II (70/80kDa) 204351_at 2.068727 up Hs.2962 S100P S100 calcium binding protein P 208792_s_at 2.0700374 up Hs.436657 CLU clusterin 202833_s_at 2.0704043 up Hs.525557 SERPINA1 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase,
antitrypsin), member 1 225622_at 2.0795598 up Hs.266175 PAG1 phosphoprotein associated with glycosphingolipid
microdomains 1 221190_s_at 2.081298 up Hs.529006 C18orf8 chromosome 18 open reading frame 8 218701_at 2.0813134 up Hs.118554 LACTB2 lactamase, beta 2 228652_at 2.0828218 up Hs.109540 ZNF776 zinc finger protein 776 220194_at 2.0833938 up Hs.590923 NSUN7 NOL1/NOP2/Sun domain family, member 7 219330_at 2.084181 up Hs.515130 VANGL1 vang-like 1 (van gogh, Drosophila) 231842_at 2.084993 up Hs.533953 KIAA1462 KIAA1462 211240_x_at 2.0872247 up Hs.166011 CTNND1 catenin (cadherin-associated protein), delta 1 228370_at 2.0919597 up Hs.564847 SNRPN Small nuclear ribonucleoprotein polypeptide N 210512_s_at 2.0931418 up Hs.73793 VEGFA vascular endothelial growth factor A
238
232664_at 2.0939298 up Hs.289062 FLJ12334 hypothetical gene supported by AK022396; AK097927 215177_s_at 2.0963833 up Hs.133397 ITGA6 integrin, alpha 6 219566_at 2.0967424 up Hs.466383 PLEKHF1 pleckstrin homology domain containing, family F (with
FYVE domain) member 1 209774_x_at 2.0992193 up Hs.590921 CXCL2 chemokine (C-X-C motif) ligand 2 209859_at 2.0999236 up Hs.654750 TRIM9 tripartite motif-containing 9 225389_at 2.1008906 up Hs.7367 BTBD6 BTB (POZ) domain containing 6 205067_at 2.10146 up Hs.126256 IL1B interleukin 1, beta 201124_at 2.1058223 up Hs.536663 ITGB5 integrin, beta 5 209122_at 2.1069572 up Hs.3416 ADFP adipose differentiation-related protein 231164_at 2.1108537 up Hs.376281 ABCA17P ATP-binding cassette, sub-family A (ABC1), member 17
(pseudogene) 1559948_at 2.112178 up Hs.194746 CDNA FLJ20447 fis, clone KAT05276 221398_at 2.1144664 up Hs.533755 TAS2R8 taste receptor, type 2, member 8 209803_s_at 2.122951 up Hs.154036 PHLDA2 pleckstrin homology-like domain, family A, member 2 209014_at 2.1318061 up Hs.5258 MAGED1 melanoma antigen family D, 1 202260_s_at 2.1331933 up Hs.288229 STXBP1 syntaxin binding protein 1 231779_at 2.1337702 up Hs.449207 IRAK2 interleukin-1 receptor-associated kinase 2 218706_s_at 2.13423 up Hs.363558 GRAMD3 GRAM domain containing 3 201700_at 2.1414373 up Hs.534307 CCND3 cyclin D3 207329_at 2.145752 up Hs.161839 MMP8 matrix metallopeptidase 8 (neutrophil collagenase) 227290_at 2.1460938 up Hs.60257 CDNA FLJ13598 fis, clone PLACE1009921 212886_at 2.1466742 up Hs.655336 CCDC69 coiled-coil domain containing 69 1560739_a_at 2.1565313 up Hs.663724 CDNA clone IMAGE:5300703 226909_at 2.1572163 up Hs.455089 ZNF518B zinc finger protein 518B 219489_s_at 2.1590781 up Hs.527989 NXN nucleoredoxin 224832_at 2.1613 up Hs.536535 DUSP16 dual specificity phosphatase 16 205769_at 2.162935 up Hs.11729 SLC27A2 solute carrier family 27 (fatty acid transporter), member 2 203559_s_at 2.1633184 up Hs.647097 ABP1 amiloride binding protein 1 (amine oxidase (copper-
containing) 238727_at 2.1733625 up Hs.635193 CDNA clone IMAGE:5311842 226353_at 2.187416 up Hs.401537 SPPL2A signal peptide peptidase-like 2A
239
212820_at 2.188495 up Hs.511386 DMXL2 Dmx-like 2 230569_at 2.1918945 up Hs.535734 KIAA1430 KIAA1430 221601_s_at 2.192935 up Hs.58831 FAIM3 Fas apoptotic inhibitory molecule 3 1565698_at 2.193966 up Hs.656960 HECTD2 HECT domain containing 2 207111_at 2.1982448 up Hs.2375 EMR1 egf-like module containing, mucin-like, hormone receptor-
like 1 225436_at 2.2078629 up Hs.459072 FAM108C1 family with sequence similarity 108, member C1 217552_x_at 2.208279 up Hs.334019 CR1 complement component (3b/4b) receptor 1 (Knops blood
group) 225685_at 2.2088935 up Hs.696089 CDNA FLJ31353 fis, clone MESAN2000264 243634_at 2.2166958 up Hs.205952 CDNA FLJ26764 fis, clone PRS02668 225078_at 2.228193 up Hs.531561 EMP2 epithelial membrane protein 2 211966_at 2.242716 up Hs.508716 COL4A2 collagen, type IV, alpha 2 215985_at 2.244619 up Hs.653168 C6orf12 HLA complex group 8 225079_at 2.256898 up Hs.531561 EMP2 epithelial membrane protein 2 237246_at 2.2613916 up Hs.670752 Transcribed locus 211964_at 2.2618506 up Hs.508716 COL4A2 collagen, type IV, alpha 2 1569469_a_at 2.2747583 up Hs.403934 LHX8 LIM homeobox 8 202241_at 2.2756593 up Hs.444947 TRIB1 tribbles homolog 1 (Drosophila) 209288_s_at 2.2815948 up Hs.369574 CDC42EP3 CDC42 effector protein (Rho GTPase binding) 3 215016_x_at 2.2828763 up Hs.631992 DST dystonin 223688_s_at 2.286348 up Hs.699597 LY6K lymphocyte antigen 6 complex, locus K 221902_at 2.289728 up Hs.531581 GPR153 G protein-coupled receptor 153 224725_at 2.2921298 up Hs.140903 MIB1 mindbomb homolog 1 (Drosophila) 223343_at 2.2989476 up Hs.530735 MS4A7 membrane-spanning 4-domains, subfamily A, member 7 230493_at 2.3104346 up Hs.433791 SHISA2 shisa homolog 2 (Xenopus laevis) 205222_at 2.3131294 up Hs.429879 EHHADH enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A
dehydrogenase 211590_x_at 2.3155444 up Hs.442530 TBXA2R thromboxane A2 receptor 211527_x_at 2.3224564 up Hs.73793 VEGFA vascular endothelial growth factor A 238390_at 2.3403041 up Hs.584762 Transcribed locus 224358_s_at 2.340462 up Hs.530735 MS4A7 membrane-spanning 4-domains, subfamily A, member 7
240
228731_at 2.3407497 up Hs.24321 CDNA clone IMAGE:5273964 205749_at 2.3446243 up Hs.72912 CYP1A1 cytochrome P450, family 1, subfamily A, polypeptide 1 224817_at 2.3510356 up Hs.709448 SH3PXD2A SH3 and PX domains 2A 204232_at 2.3589032 up Hs.433300 FCER1G Fc fragment of IgE, high affinity I, receptor for; gamma
polypeptide 201034_at 2.3661902 up Hs.501012 ADD3 adducin 3 (gamma) 231579_s_at 2.376706 up Hs.633514 TIMP2 TIMP metallopeptidase inhibitor 2 214751_at 2.3812814 up Hs.467223 ZNF468 zinc finger protein 468 1552727_s_at 2.3860312 up Hs.513200 ADAMTS17 ADAM metallopeptidase with thrombospondin type 1 motif,
17 36711_at 2.3862891 up Hs.517617 MAFF v-maf musculoaponeurotic fibrosarcoma oncogene homolog
F (avian) 221563_at 2.386936 up Hs.497822 DUSP10 dual specificity phosphatase 10 202464_s_at 2.397264 up Hs.195471 PFKFB3 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 205518_s_at 2.401671 up Hs.484918 CMAH cytidine monophosphate-N-acetylneuraminic acid
hydroxylase (CMP-N-acetylneuraminate monooxygenase) pseudogene
201656_at 2.4023006 up Hs.133397 ITGA6 integrin, alpha 6 1561673_at 2.4052298 up Hs.434703 CDNA clone IMAGE:5268080 205681_at 2.4061053 up Hs.227817 BCL2A1 BCL2-related protein A1 223218_s_at 2.4119098 up Hs.319171 NFKBIZ nuclear factor of kappa light polypeptide gene enhancer in B-
cells inhibitor, zeta 204044_at 2.4147956 up Hs.513484 QPRT quinolinate phosphoribosyltransferase (nicotinate-nucleotide
pyrophosphorylase (carboxylating) 204224_s_at 2.4215453 up Hs.86724 GCH1 GTP cyclohydrolase 1 (dopa-responsive dystonia) 205047_s_at 2.4257452 up Hs.489207 ASNS asparagine synthetase 213836_s_at 2.4561102 up Hs.463964 WIPI1 WD repeat domain, phosphoinositide interacting 1 201325_s_at 2.4683442 up Hs.436298 EMP1 epithelial membrane protein 1 210773_s_at 2.4940493 up Hs.99855 FPR2 formyl peptide receptor 2 200733_s_at 2.4943774 up Hs.227777 PTP4A1 protein tyrosine phosphatase type IVA, member 1 230860_at 2.504897 up Hs.282800 Transcribed locus 209683_at 2.5064533 up Hs.467769 FAM49A family with sequence similarity 49, member A
241
244390_at 2.5098689 up Hs.112791 Transcribed locus 205419_at 2.513219 up Hs.784 EBI2 Epstein-Barr virus induced gene 2 (lymphocyte-specific G
protein-coupled receptor) 200644_at 2.5132656 up Hs.75061 MARCKSL1 MARCKS-like 1 205488_at 2.5173492 up Hs.90708 GZMA granzyme A (granzyme 1, cytotoxic T-lymphocyte-
associated serine esterase 3) 214157_at 2.5319889 up Hs.125898 GNAS GNAS complex locus 1557104_at 2.5332897 up Hs.464896 ZNF397OS Zinc finger protein 397 opposite strand 201753_s_at 2.5353084 up Hs.501012 ADD3 adducin 3 (gamma) 1554899_s_at 2.5357373 up Hs.433300 FCER1G Fc fragment of IgE, high affinity I, receptor for; gamma
polypeptide 231175_at 2.5378351 up Hs.582993 C6orf65 chromosome 6 open reading frame 65 217966_s_at 2.5471883 up Hs.518662 FAM129A family with sequence similarity 129, member A 201631_s_at 2.5666416 up Hs.591785 IER3 immediate early response 3 34210_at 2.5698426 up Hs.276770 CD52 CD52 molecule 242271_at 2.5714705 up Hs.164073 SLC26A9 solute carrier family 26, member 9 219609_at 2.5732338 up Hs.497600 WDR25 WD repeat domain 25 215071_s_at 2.5748265 up Hs.484950 HIST1H2AC histone cluster 1, H2ac 218810_at 2.576255 up Hs.656294 ZC3H12A zinc finger CCCH-type containing 12A 213017_at 2.5767097 up Hs.397978 ABHD3 abhydrolase domain containing 3 227682_at 2.5885766 up Hs.595314 Transcribed locus 225033_at 2.5925033 up Hs.374257 LOC286167 hypothetical LOC286167 209651_at 2.6035943 up Hs.513530 TGFB1I1 transforming growth factor beta 1 induced transcript 1 218847_at 2.6044652 up Hs.35354 IGF2BP2 insulin-like growth factor 2 mRNA binding protein 2 205768_s_at 2.6062658 up Hs.11729 SLC27A2 solute carrier family 27 (fatty acid transporter), member 2 209120_at 2.612503 up Hs.701977 NR2F2 nuclear receptor subfamily 2, group F, member 2 1552578_a_at 2.619047 up Hs.671900 MYO3B myosin IIIB 224735_at 2.6243396 up Hs.22546 CYBASC3 cytochrome b, ascorbate dependent 3 204118_at 2.630754 up Hs.243564 CD48 CD48 molecule 1556658_a_at 2.632578 up Hs.687293 CDNA FLJ36459 fis, clone THYMU2014762 235957_at 2.6423335 up Hs.594436 Transcribed locus 224799_at 2.6737282 up Hs.525093 NDFIP2 Nedd4 family interacting protein 2
242
39402_at 2.6869698 up Hs.126256 IL1B interleukin 1, beta 219209_at 2.6904526 up Hs.163173 IFIH1 interferon induced with helicase C domain 1 203767_s_at 2.6911764 up Hs.522578 STS steroid sulfatase (microsomal), isozyme S 64942_at 2.7049022 up Hs.531581 GPR153 G protein-coupled receptor 153 202890_at 2.705124 up Hs.486548 MAP7 microtubule-associated protein 7 223344_s_at 2.7198555 up Hs.530735 MS4A7 membrane-spanning 4-domains, subfamily A, member 7 205114_s_at 2.7348754 up Hs.514107 CCL3 ///
CCL3L1 /// CCL3L3 /// LOC728830
chemokine (C-C motif) ligand 3 /// chemokine (C-C motif) ligand 3-like 1 /// chemokine (C-C motif) ligand 3-like 3 /// similar to C-C motif chemokine 3-like 1 precursor (Small-inducible cytokine A3-like 1) (Tonsillar lymphocyte LD78 beta protein) (LD78-beta(1-70) (G0/G1 switch regulatory protein 19-2) (G0S19-2 protein) (PAT 464.2)
201464_x_at 2.7501729 up Hs.525704 JUN jun oncogene 206026_s_at 2.7533123 up Hs.437322 TNFAIP6 tumor necrosis factor, alpha-induced protein 6 210538_s_at 2.7620296 up Hs.127799 BIRC3 baculoviral IAP repeat-containing 3 244313_at 2.762246 up Hs.334019 CR1 complement component (3b/4b) receptor 1 (Knops blood
group) 1555832_s_at 2.807976 up Hs.4055///Hs.
709396 KLF6 Homo sapiens, clone IMAGE:4096273, mRNA /// Kruppel-
like factor 6 231603_at 2.8095737 up Hs.112761 RNASE11 ribonuclease, RNase A family, 11 (non-active) 225171_at 2.8266404 up Hs.486458 ARHGAP18 Rho GTPase activating protein 18 1556657_at 2.839919 up Hs.687293 CDNA FLJ36459 fis, clone THYMU2014762 223620_at 2.8479464 up Hs.495989 GPR34 G protein-coupled receptor 34 231688_at 2.8591058 up Hs.557039 Transcribed locus 219596_at 2.8679712 up Hs.591123 THAP10 THAP domain containing 10 203535_at 2.912584 up Hs.112405 S100A9 S100 calcium binding protein A9 211628_x_at 2.9205534 up Hs.453583 FTHP1 ferritin, heavy polypeptide pseudogene 1 1556361_s_at 3.006104 up Hs.105016 ANKRD13C ankyrin repeat domain 13C 233070_at 3.0078309 up Hs.157035 ZNF197 zinc finger protein 197 219434_at 3.0421839 up Hs.283022 TREM1 triggering receptor expressed on myeloid cells 1 217996_at 3.0431302 up Hs.602085 PHLDA1 pleckstrin homology-like domain, family A, member 1 214211_at 3.0585701 up Hs.524910 FTH1 ferritin, heavy polypeptide 1
243
209789_at 3.065603 up Hs.551213 CORO2B coronin, actin binding protein, 2B 228766_at 3.0702918 up 228155_at 3.082404 up Hs.500333 C10orf58 chromosome 10 open reading frame 58 220765_s_at 3.092851 up Hs.469881 LIMS2 LIM and senescent cell antigen-like domains 2 217967_s_at 3.108988 up Hs.518662 FAM129A family with sequence similarity 129, member A 221909_at 3.1185892 up Hs.437195 RNFT2 ring finger protein, transmembrane 2 218656_s_at 3.135984 up Hs.507798 LHFP lipoma HMGIC fusion partner 202932_at 3.1362047 up Hs.194148 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 208791_at 3.1462173 up Hs.436657 CLU clusterin 225619_at 3.1562297 up Hs.349955 SLAIN1 SLAIN motif family, member 1 219010_at 3.189441 up Hs.518997 C1orf106 chromosome 1 open reading frame 106 201324_at 3.2454588 up Hs.436298 EMP1 epithelial membrane protein 1 201313_at 3.3799746 up Hs.511915 ENO2 enolase 2 (gamma, neuronal) 202988_s_at 3.401592 up Hs.75256 RGS1 regulator of G-protein signaling 1 201005_at 3.4259963 up Hs.114286 CD9 CD9 molecule 218330_s_at 3.434479 up Hs.502116 NAV2 neuron navigator 2 218559_s_at 3.5047252 up Hs.712609 MAFB v-maf musculoaponeurotic fibrosarcoma oncogene homolog
B (avian) 200748_s_at 3.5551684 up Hs.524910 FTH1 ferritin, heavy polypeptide 1 210078_s_at 3.5769308 up Hs.654519 KCNAB1 potassium voltage-gated channel, shaker-related subfamily,
beta member 1 228067_at 3.7344112 up Hs.469398 C2orf55 chromosome 2 open reading frame 55 224802_at 3.7923694 up Hs.525093 NDFIP2 Nedd4 family interacting protein 2 217997_at 3.8278894 up Hs.602085 PHLDA1 pleckstrin homology-like domain, family A, member 1 240413_at 3.8473117 up Hs.710248 PYHIN1 pyrin and HIN domain family, member 1 202644_s_at 3.9104502 up Hs.591338 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 226218_at 3.9202893 up Hs.635723 IL7R interleukin 7 receptor 209396_s_at 3.9217188 up Hs.382202 CHI3L1 chitinase 3-like 1 (cartilage glycoprotein-39) 202933_s_at 3.9234626 up Hs.194148 YES1 v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1 228384_s_at 3.9629326 up Hs.238303 C10orf33 chromosome 10 open reading frame 33 204967_at 3.964548 up Hs.567236 SHROOM2 shroom family member 2
244
209955_s_at 3.9984534 up Hs.654370 FAP fibroblast activation protein, alpha 1569403_at 4.016248 up Hs.670065 CDNA clone IMAGE:4706427 232504_at 4.0652027 up Hs.604728 LOC285628 hypothetical protein LOC285628 228170_at 4.202808 up Hs.56663 OLIG1 oligodendrocyte transcription factor 1 202643_s_at 4.260881 up Hs.591338 TNFAIP3 tumor necrosis factor, alpha-induced protein 3 206488_s_at 4.404789 up Hs.120949 CD36 CD36 molecule (thrombospondin receptor) 210772_at 4.470887 up Hs.99855 FPR2 formyl peptide receptor 2 228964_at 4.5651217 up Hs.436023 PRDM1 PR domain containing 1, with ZNF domain 204017_at 4.583247 up Hs.709898 KDELR3 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein
retention receptor 3 201242_s_at 4.622406 up Hs.291196 ATP1B1 ATPase, Na+/K+ transporting, beta 1 polypeptide 209555_s_at 4.6651635 up Hs.120949 CD36 CD36 molecule (thrombospondin receptor) 205943_at 4.768635 up Hs.183671 TDO2 tryptophan 2,3-dioxygenase 211506_s_at 4.9175453 up Hs.551925 IL8 interleukin 8 212062_at 5.0691304 up Hs.709380 ATP9A ATPase, class II, type 9A 202859_x_at 5.133295 up Hs.551925 IL8 interleukin 8 218919_at 5.31763 up Hs.655453 ZFAND1 zinc finger, AN1-type domain 1 205476_at 5.344622 up Hs.75498 CCL20 chemokine (C-C motif) ligand 20 207554_x_at 5.4159017 up Hs.442530 TBXA2R thromboxane A2 receptor 202917_s_at 5.495519 up Hs.416073 S100A8 S100 calcium binding protein A8 228285_at 5.541697 up Hs.21454 TDRD9 tudor domain containing 9 206067_s_at 5.8159995 up Hs.591980 WT1 Wilms tumor 1 210102_at 5.9585633 up Hs.152944 LOH11CR2A loss of heterozygosity, 11, chromosomal region 2, gene A 202887_s_at 6.2075033 up Hs.523012 DDIT4 DNA-damage-inducible transcript 4 209395_at 6.615985 up Hs.382202 CHI3L1 chitinase 3-like 1 (cartilage glycoprotein-39) 203936_s_at 8.026273 up Hs.297413 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase,
92kDa type IV collagenase) 216598_s_at 8.195094 up Hs.303649 CCL2 chemokine (C-C motif) ligand 2 336_at 9.396036 up Hs.442530 TBXA2R thromboxane A2 receptor 216834_at 10.687796 up Hs.75256 RGS1 regulator of G-protein signaling 1 1570561_at 12.199696 up
245
1553614_a_at 12.991128 up Hs.652066 FLJ25694 /// LOC100128202
hypothetical protein FLJ25694 /// hypothetical protein LOC100128202
243489_at 14.485263 up Hs.678608 Transcribed locus 226254_s_at 15.326018 up Hs.535734 KIAA1430 KIAA1430 220517_at 19.309097 up Hs.511668 VPS13C vacuolar protein sorting 13 homolog C (S. cerevisiae) 224296_x_at 24.254719 up 204533_at 27.27933 up Hs.632586 CXCL10 chemokine (C-X-C motif) ligand 10 211690_at 33.311836 up Hs.408073 RPS6 ribosomal protein S6 204475_at 37.07757 up Hs.83169 MMP1 matrix metallopeptidase 1 (interstitial collagenase)
246
Table A3.2: Genes differentially regulated greater than 2-fold in NuMA-RARA compared to control U937-GFP Probe Set ID Fold change([NUMA-
RARA] vs [CONTROL])
Regulation([NUMA-RARA] vs
[CONTROL])
Unigene (Avadis)
Gene Symbol Gene Title
201951_at 2.5140805 down Hs.591293 ALCAM activated leukocyte cell adhesion molecule
201952_at 3.2008994 down Hs.591293 ALCAM activated leukocyte cell adhesion molecule
202364_at 2.015138 down Hs.501023 MXI1 MAX interactor 1 202648_at 2.1071494 down 202925_s_at 2.0869508 down Hs.154104 PLAGL2 pleiomorphic adenoma gene-like 2 202944_at 2.1188123 down Hs.75372 NAGA N-acetylgalactosaminidase, alpha- 202954_at 2.8876154 down Hs.93002 UBE2C ubiquitin-conjugating enzyme E2C 203485_at 2.5145602 down Hs.368626 RTN1 reticulon 1 203523_at 2.1840193 down Hs.56729 LSP1 lymphocyte-specific protein 1 205110_s_at 2.0976357 down Hs.6540 FGF13 fibroblast growth factor 13 205376_at 2.4481084 down Hs.658245 INPP4B inositol polyphosphate-4-
phosphatase, type II, 105kDa 205653_at 3.6304452 down Hs.421724 CTSG cathepsin G 205898_at 2.3489182 down Hs.78913 CX3CR1 chemokine (C-X3-C motif) receptor
1 206278_at 2.6627378 down Hs.709174 PTAFR platelet-activating factor receptor 206589_at 2.0021522 down Hs.73172 GFI1 growth factor independent 1
transcription repressor 206759_at 3.2936876 down Hs.465778 FCER2 Fc fragment of IgE, low affinity II,
receptor for (CD23) 206760_s_at 3.1468818 down Hs.465778 FCER2 Fc fragment of IgE, low affinity II,
receptor for (CD23) 206851_at 2.3055432 down Hs.73839 RNASE3 ribonuclease, RNase A family, 3
(eosinophil cationic protein) 206871_at 2.0622973 down Hs.99863 ELA2 elastase 2, neutrophil 207341_at 2.6777432 down Hs.928 PRTN3 proteinase 3 (serine proteinase,
247
neutrophil, Wegener granulomatosis autoantigen)
207543_s_at 2.1209998 down Hs.500047 P4HA1 procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I
207808_s_at 2.029618 down Hs.64016 PROS1 protein S (alpha) 207983_s_at 2.0453823 down Hs.496710 STAG2 stromal antigen 2 208937_s_at 2.5915275 down Hs.504609 ID1 inhibitor of DNA binding 1,
dominant negative helix-loop-helix protein
209560_s_at 4.8076034 down Hs.533717 DLK1 delta-like 1 homolog (Drosophila) 210254_at 2.5120962 down Hs.99960 MS4A3 membrane-spanning 4-domains,
subfamily A, member 3 (hematopoietic cell-specific)
211341_at 3.387051 down Hs.654522 LOC100131317 /// POU4F1
POU class 4 homeobox 1 /// similar to hCG1781072
212840_at 2.330931 down Hs.518524 UBXD7 UBX domain containing 7 213293_s_at 2.3205166 down Hs.501778 TRIM22 tripartite motif-containing 22 213350_at 4.1874185 down Hs.433529 RPS11 Ribosomal protein S11 213703_at 2.067904 down Hs.651352 LOC150759 hypothetical protein LOC150759 213826_s_at 2.7210894 down LOC100133109 similar to histone 214575_s_at 2.2711442 down Hs.72885 AZU1 azurocidin 1 (cationic antimicrobial
protein 37) 217100_s_at 2.0867736 down Hs.518524 UBXD7 UBX domain containing 7 217941_s_at 2.0043929 down Hs.591774 ERBB2IP erbb2 interacting protein 218858_at 2.3477619 down Hs.112981 DEPDC6 DEP domain containing 6 218976_at 4.531457 down Hs.260720 DNAJC12 DnaJ (Hsp40) homolog, subfamily
C, member 12 219014_at 2.838491 down Hs.546392 PLAC8 placenta-specific 8 219112_at 2.2908504 down Hs.483329 RAPGEF6 Rap guanine nucleotide exchange
factor (GEF) 6 219295_s_at 2.2198925 down Hs.8944 PCOLCE2 procollagen C-endopeptidase
enhancer 2
248
219410_at 2.0081465 down Hs.658956 TMEM45A transmembrane protein 45A 219697_at 3.588678 down Hs.622536 HS3ST2 heparan sulfate (glucosamine) 3-O-
sulfotransferase 2 219714_s_at 8.406451 down Hs.656687 CACNA2D3 calcium channel, voltage-dependent,
alpha 2/delta subunit 3 221168_at 2.7659276 down Hs.287386 PRDM13 PR domain containing 13 222453_at 2.6440423 down Hs.221941 CYBRD1 cytochrome b reductase 1 223501_at 2.0222945 down Hs.525157 TNFSF13B tumor necrosis factor (ligand)
superfamily, member 13b 223721_s_at 3.2100446 down Hs.260720 DNAJC12 DnaJ (Hsp40) homolog, subfamily
C, member 12 224345_x_at 2.150762 down Hs.584881 C3orf28 chromosome 3 open reading frame
28 224356_x_at 2.171828 down Hs.523702 MS4A6A membrane-spanning 4-domains,
subfamily A, member 6A 224518_s_at 2.5020921 down Hs.655107 ZNF559 zinc finger protein 559 224604_at 2.0568666 down Hs.173705 LOC401152 HCV F-transactivated protein 1 225159_s_at 2.4450445 down 225942_at 2.0562873 down Hs.247460 NLN neurolysin (metallopeptidase M3
family) 225944_at 2.2761114 down Hs.247460 NLN neurolysin (metallopeptidase M3
family) 226352_at 2.0012338 down Hs.482605 JMY junction-mediating and regulatory
protein 226558_at 2.1029706 down LOC653071 similar to CG32820-PA, isoform A 226789_at 2.1677015 down Hs.697682 LOC647121 embigin homolog (mouse)
pseudogene 227198_at 2.2629147 down Hs.444414 AFF3 AF4/FMR2 family, member 3 227663_at 2.3365154 down Hs.664334 CDNA FLJ40901 fis, clone
UTERU2003704 227949_at 2.3743393 down Hs.473218 PHACTR3 phosphatase and actin regulator 3 228055_at 2.2473907 down Hs.636624 NAPSB napsin B aspartic peptidase
pseudogene
249
228623_at 2.0270693 down Hs.374460 Transcribed locus 229461_x_at 2.7272398 down Hs.146542 NEGR1 neuronal growth regulator 1 230078_at 2.5947235 down Hs.483329 RAPGEF6 Rap guanine nucleotide exchange
factor (GEF) 6 230550_at 2.012824 down Hs.523702 MS4A6A membrane-spanning 4-domains,
subfamily A, member 6A 232912_at 2.1449473 down Hs.657472 GPR180 G protein-coupled receptor 180 235046_at 3.150063 down Hs.176376 Transcribed locus 235816_s_at 2.0076482 down Hs.658997 RGL4 ral guanine nucleotide dissociation
stimulator-like 4 236766_at 2.255865 down Hs.624661 Transcribed locus 238902_at 2.02885 down Hs.655574 Transcribed locus 239798_at 2.2176015 down Hs.660359 Transcribed locus 242476_at 2.3789568 down Hs.605126 Transcribed locus 243357_at 2.069857 down Hs.146542 NEGR1 neuronal growth regulator 1 1553194_at 2.3751698 down Hs.146542 NEGR1 neuronal growth regulator 1 1553297_a_at 2.1469352 down Hs.524517 CSF3R colony stimulating factor 3 receptor
(granulocyte) 1554892_a_at 2.212003 down Hs.99960 MS4A3 membrane-spanning 4-domains,
subfamily A, member 3 (hematopoietic cell-specific)
1555247_a_at 2.5010147 down Hs.483329 RAPGEF6 Rap guanine nucleotide exchange factor (GEF) 6
1555339_at 8.438069 down Hs.190334 RAP1A RAP1A, member of RAS oncogene family
1555340_x_at 8.837916 down Hs.190334 RAP1A RAP1A, member of RAS oncogene family
1557370_s_at 2.1244938 down Hs.591221 MYCBP2 MYC binding protein 2 1558290_a_at 2.590345 down Hs.133107 PVT1 Pvt1 oncogene homolog (mouse) 1559391_s_at 2.006825 down Hs.667269 Partial mRNA; ID EE2-8E 200675_at 2.1861107 up Hs.54457 CD81 CD81 molecule 200748_s_at 2.5502985 up Hs.524910 FTH1 ferritin, heavy polypeptide 1 201324_at 4.738356 up Hs.436298 EMP1 epithelial membrane protein 1
250
201325_s_at 2.5761929 up Hs.436298 EMP1 epithelial membrane protein 1 201422_at 2.2819552 up Hs.371344 IFI30 /// PIK3R2 phosphoinositide-3-kinase,
regulatory subunit 2 (beta) /// interferon, gamma-inducible protein 30
201464_x_at 2.4171145 up Hs.525704 JUN jun oncogene 201626_at 2.2931118 up Hs.520819 INSIG1 insulin induced gene 1 201700_at 2.0883832 up Hs.534307 CCND3 cyclin D3 202068_s_at 2.5631108 up Hs.213289 LDLR low density lipoprotein receptor
(familial hypercholesterolemia) 202146_at 2.058797 up Hs.7879 IFRD1 interferon-related developmental
regulator 1 202199_s_at 2.8917031 up Hs.443861 SRPK1 SFRS protein kinase 1 202200_s_at 3.0715544 up Hs.443861 SRPK1 SFRS protein kinase 1 202207_at 2.618532 up Hs.709513 ARL4C ADP-ribosylation factor-like 4C 202241_at 2.4987798 up Hs.444947 TRIB1 tribbles homolog 1 (Drosophila) 202388_at 2.0187805 up Hs.78944 RGS2 regulator of G-protein signaling 2,
24kDa 202440_s_at 3.1627939 up Hs.117715 ST5 suppression of tumorigenicity 5 202627_s_at 2.237239 up Hs.414795 SERPINE1 serpin peptidase inhibitor, clade E
(nexin, plasminogen activator inhibitor type 1), member 1
202708_s_at 2.4584754 up Hs.2178 HIST2H2BE histone cluster 2, H2be 202859_x_at 3.3710713 up Hs.551925 IL8 interleukin 8 202887_s_at 3.1278207 up Hs.523012 DDIT4 DNA-damage-inducible transcript 4 202890_at 2.0465117 up Hs.486548 MAP7 microtubule-associated protein 7 202917_s_at 8.607895 up Hs.416073 S100A8 S100 calcium binding protein A8 202932_at 13.4396715 up Hs.194148 YES1 v-yes-1 Yamaguchi sarcoma viral
oncogene homolog 1 202933_s_at 16.98143 up Hs.194148 YES1 v-yes-1 Yamaguchi sarcoma viral
oncogene homolog 1 202988_s_at 4.1364365 up Hs.75256 RGS1 regulator of G-protein signaling 1 203535_at 4.0339875 up Hs.112405 S100A9 S100 calcium binding protein A9
251
203559_s_at 7.14856 up Hs.647097 ABP1 amiloride binding protein 1 (amine oxidase (copper-containing)
203767_s_at 3.3810694 up Hs.522578 STS steroid sulfatase (microsomal), isozyme S
203935_at 2.1324503 up Hs.470316 ACVR1 activin A receptor, type I 203936_s_at 2.877271 up Hs.297413 MMP9 matrix metallopeptidase 9 (gelatinase
B, 92kDa gelatinase, 92kDa type IV collagenase)
203980_at 2.8758497 up Hs.391561 FABP4 fatty acid binding protein 4, adipocyte
204017_at 2.1915872 up Hs.709898 KDELR3 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
204044_at 2.0071492 up Hs.513484 QPRT quinolinate phosphoribosyltransferase (nicotinate-nucleotide pyrophosphorylase (carboxylating)
204118_at 2.8159168 up Hs.243564 CD48 CD48 molecule 204232_at 2.576512 up Hs.433300 FCER1G Fc fragment of IgE, high affinity I,
receptor for; gamma polypeptide 204533_at 3.6701992 up Hs.632586 CXCL10 chemokine (C-X-C motif) ligand 10 204560_at 3.5530586 up Hs.407190 FKBP5 FK506 binding protein 5 204588_s_at 2.453063 up Hs.513147 SLC7A7 solute carrier family 7 (cationic
amino acid transporter, y+ system), member 7
205222_at 2.1246877 up Hs.429879 EHHADH enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase
205476_at 2.1502717 up Hs.75498 CCL20 chemokine (C-C motif) ligand 20 205541_s_at 2.5884073 up Hs.59523 GSPT2 G1 to S phase transition 2 205749_at 2.0112467 up Hs.72912 CYP1A1 cytochrome P450, family 1,
subfamily A, polypeptide 1 206110_at 3.0578635 up Hs.591778 HIST1H3H histone cluster 1, H3h 206332_s_at 2.1315906 up Hs.380250 IFI16 interferon, gamma-inducible protein
252
16 206584_at 4.9695334 up Hs.660766 LY96 lymphocyte antigen 96 207121_s_at 2.0590255 up Hs.411847 MAPK6 mitogen-activated protein kinase 6 207554_x_at 2.1629765 up Hs.442530 TBXA2R thromboxane A2 receptor 208527_x_at 2.1614985 up Hs.553506 HIST1H2BC ///
HIST1H2BE /// HIST1H2BF /// HIST1H2BG /// HIST1H2BI
histone cluster 1, H2bg /// histone cluster 1, H2bf /// histone cluster 1, H2be /// histone cluster 1, H2bi /// histone cluster 1, H2bc
208546_x_at 2.3202329 up Hs.247815 HIST1H2BH histone cluster 1, H2bh 208579_x_at 2.782799 up Hs.473961 H2BFS H2B histone family, member S 208891_at 2.3583512 up Hs.298654 DUSP6 dual specificity phosphatase 6 208892_s_at 2.3782177 up Hs.298654 DUSP6 dual specificity phosphatase 6 208893_s_at 2.0289226 up Hs.298654 DUSP6 dual specificity phosphatase 6 209031_at 3.0576098 up Hs.370510 CADM1 cell adhesion molecule 1 209146_at 3.228228 up Hs.105269 SC4MOL sterol-C4-methyl oxidase-like 209218_at 2.0788121 up Hs.71465 SQLE squalene epoxidase 209264_s_at 2.4884453 up Hs.654836 TSPAN4 tetraspanin 4 209306_s_at 3.2197652 up Hs.153026 SWAP70 SWAP-70 protein 209307_at 3.1477182 up Hs.153026 SWAP70 SWAP-70 protein 209398_at 6.015406 up Hs.7644 HIST1H1C histone cluster 1, H1c 209666_s_at 2.1270947 up Hs.198998 CHUK conserved helix-loop-helix
ubiquitous kinase 209806_at 6.863416 up Hs.437275 HIST1H2BK histone cluster 1, H2bk 209911_x_at 2.8247304 up Hs.591797 HIST1H2BD histone cluster 1, H2bd 209955_s_at 3.202167 up Hs.654370 FAP fibroblast activation protein, alpha 210078_s_at 5.857701 up Hs.654519 KCNAB1 potassium voltage-gated channel,
shaker-related subfamily, beta member 1
210102_at 3.740264 up Hs.152944 LOH11CR2A loss of heterozygosity, 11, chromosomal region 2, gene A
210187_at 2.2344403 up Hs.471933 FKBP1A FK506 binding protein 1A, 12kDa
253
210471_s_at 3.1541605 up Hs.654519 KCNAB1 potassium voltage-gated channel, shaker-related subfamily, beta member 1
210592_s_at 2.0403872 up Hs.28491 SAT1 spermidine/spermine N1-acetyltransferase 1
210772_at 2.0247583 up Hs.99855 FPR2 formyl peptide receptor 2 211005_at 2.3068285 up Hs.632179 LAT /// SPNS1 linker for activation of T cells ///
spinster homolog 1 (Drosophila) 211423_s_at 2.0034497 up Hs.287749 SC5DL sterol-C5-desaturase (ERG3 delta-5-
desaturase homolog, S. cerevisiae)-like
211506_s_at 3.0122337 up Hs.551925 IL8 interleukin 8 211628_x_at 2.189657 up Hs.453583 FTHP1 ferritin, heavy polypeptide
pseudogene 1 212509_s_at 2.208149 up Hs.250723 MXRA7 matrix-remodelling associated 7 212636_at 2.4118946 up Hs.510324 QKI quaking homolog, KH domain RNA
binding (mouse) 212698_s_at 2.037554 up Hs.469615 10-Sep septin 10 212706_at 2.1089957 up Hs.670011 FLJ21767 ///
LOC100132214 /// LOC100133005 /// LOC100134722 /// RASA4
RAS p21 protein activator 4 /// hypothetical protein FLJ21767 /// similar to HSPC047 protein /// similar to RAS p21 protein activator 4
213017_at 2.1210895 up Hs.397978 ABHD3 abhydrolase domain containing 3 213340_s_at 2.1779287 up Hs.49658 KIAA0495 KIAA0495 213566_at 2.9274664 up Hs.23262 RNASE6 ribonuclease, RNase A family, k6 213624_at 2.2668185 up Hs.486357 SMPDL3A sphingomyelin phosphodiesterase,
acid-like 3A 213836_s_at 2.7141345 up Hs.463964 WIPI1 WD repeat domain, phosphoinositide
interacting 1 213988_s_at 2.0447376 up Hs.28491 SAT1 spermidine/spermine N1-
acetyltransferase 1
254
214211_at 2.811307 up Hs.524910 FTH1 ferritin, heavy polypeptide 1 214290_s_at 5.104088 up Hs.530461 HIST2H2AA3 ///
HIST2H2AA4 histone cluster 2, H2aa3 /// histone cluster 2, H2aa4
214370_at 2.515506 up Hs.416073 S100A8 S100 calcium binding protein A8 214455_at 3.1538177 up Hs.553506 HIST1H2BC ///
HIST1H2BE /// HIST1H2BF /// HIST1H2BG /// HIST1H2BI
histone cluster 1, H2bg /// histone cluster 1, H2bf /// histone cluster 1, H2be /// histone cluster 1, H2bi /// histone cluster 1, H2bc
215071_s_at 12.299032 up Hs.484950 HIST1H2AC histone cluster 1, H2ac 215711_s_at 2.049024 up Hs.249441 WEE1 WEE1 homolog (S. pombe) 216598_s_at 4.422313 up Hs.303649 CCL2 chemokine (C-C motif) ligand 2 216834_at 11.807223 up Hs.75256 RGS1 regulator of G-protein signaling 1 217529_at 2.258883 up Hs.658598 MRNA; cDNA DKFZp667G1412
(from clone DKFZp667G1412) 217996_at 4.8790946 up Hs.602085 PHLDA1 pleckstrin homology-like domain,
family A, member 1 217997_at 5.0763917 up Hs.602085 PHLDA1 pleckstrin homology-like domain,
family A, member 1 218280_x_at 3.2034945 up Hs.530461 HIST2H2AA3 ///
HIST2H2AA4 histone cluster 2, H2aa3 /// histone cluster 2, H2aa4
218330_s_at 2.0383615 up Hs.502116 NAV2 neuron navigator 2 218559_s_at 4.045437 up Hs.712609 MAFB v-maf musculoaponeurotic
fibrosarcoma oncogene homolog B (avian)
218656_s_at 2.4044502 up Hs.507798 LHFP lipoma HMGIC fusion partner 218793_s_at 2.3413656 up Hs.109655 SCML1 sex comb on midleg-like 1
(Drosophila) 218919_at 5.4285846 up Hs.655453 ZFAND1 zinc finger, AN1-type domain 1 219434_at 2.1268172 up Hs.283022 TREM1 triggering receptor expressed on
myeloid cells 1 219596_at 2.5684 up Hs.591123 THAP10 THAP domain containing 10 219607_s_at 8.440766 up Hs.325960 MS4A4A membrane-spanning 4-domains,
255
subfamily A, member 4 219890_at 2.2654479 up Hs.446235 CLEC5A C-type lectin domain family 5,
member A 220255_at 3.238937 up Hs.302003 FANCE Fanconi anemia, complementation
group E 220517_at 14.522511 up Hs.511668 VPS13C vacuolar protein sorting 13 homolog
C (S. cerevisiae) 221561_at 2.9482198 up Hs.496383 SOAT1 sterol O-acyltransferase (acyl-
Coenzyme A: cholesterol acyltransferase) 1
221750_at 2.4851115 up Hs.397729 HMGCS1 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)
221909_at 2.675337 up Hs.437195 RNFT2 ring finger protein, transmembrane 2 222067_x_at 2.3068116 up Hs.591797 HIST1H2BD histone cluster 1, H2bd 336_at 3.0008388 up Hs.442530 TBXA2R thromboxane A2 receptor 34210_at 3.1154716 up Hs.276770 CD52 CD52 molecule 36711_at 2.097861 up Hs.517617 MAFF v-maf musculoaponeurotic
fibrosarcoma oncogene homolog F (avian)
37152_at 2.9896212 up Hs.696032 PPARD peroxisome proliferator-activated receptor delta
222557_at 2.0130768 up Hs.639609 STMN3 stathmin-like 3 223278_at 2.7869732 up Hs.591234 GJB2 gap junction protein, beta 2, 26kDa 223620_at 4.809363 up Hs.495989 GPR34 G protein-coupled receptor 34 223939_at 2.6680608 up Hs.279575 SUCNR1 succinate receptor 1 224048_at 3.2531075 up Hs.646421 USP44 ubiquitin specific peptidase 44 224685_at 3.113241 up Hs.709178 MLLT4 myeloid/lymphoid or mixed-lineage
leukemia (trithorax homolog, Drosophila); translocated to, 4
224802_at 2.4919844 up Hs.525093 NDFIP2 Nedd4 family interacting protein 2 224840_at 3.2165444 up Hs.407190 FKBP5 FK506 binding protein 5 224856_at 3.6593025 up Hs.407190 FKBP5 FK506 binding protein 5 225167_at 2.02882 up Hs.330463 FRMD4A FERM domain containing 4A
256
225524_at 2.2465055 up Hs.162963 ANTXR2 anthrax toxin receptor 2 225842_at 2.138169 up Hs.602085 PHLDA1 pleckstrin homology-like domain,
family A, member 1 226218_at 2.4769416 up Hs.635723 IL7R interleukin 7 receptor 226254_s_at 14.906071 up Hs.535734 KIAA1430 KIAA1430 226545_at 2.3461847 up Hs.399891 CD109 CD109 molecule 226771_at 2.0420542 up Hs.435700 ATP8B2 ATPase, class I, type 8B, member 2 227492_at 2.5360022 up Hs.654872 Clone HLS_IMAGE_1881469
mRNA sequence 227682_at 2.3687131 up Hs.595314 Transcribed locus 228155_at 2.0698576 up Hs.500333 C10orf58 chromosome 10 open reading frame
58 228170_at 2.4644752 up Hs.56663 OLIG1 oligodendrocyte transcription factor
1 228285_at 2.9728603 up Hs.21454 TDRD9 tudor domain containing 9 228384_s_at 2.3169546 up Hs.238303 C10orf33 chromosome 10 open reading frame
33 228478_at 2.1306157 up Hs.167619 Full length insert cDNA YH99G08 228964_at 5.8129516 up Hs.436023 PRDM1 PR domain containing 1, with ZNF
domain 229390_at 9.867984 up Hs.381220 FAM26F family with sequence similarity 26,
member F 229391_s_at 2.0939236 up Hs.381220 FAM26F family with sequence similarity 26,
member F 229625_at 2.5347552 up Hs.513726 GBP5 guanylate binding protein 5 230333_at 2.0256205 up Hs.656630 Transcribed locus 231406_at 2.2547612 up Hs.658598 MRNA; cDNA DKFZp667G1412
(from clone DKFZp667G1412) 231982_at 2.531045 up Hs.130714 LOC284422 similar to HSPC323 232035_at 2.2233171 up Hs.278483 HIST1H4A ///
HIST1H4B /// HIST1H4C /// HIST1H4D ///
histone cluster 1, H4i /// histone cluster 1, H4a /// histone cluster 1, H4d /// histone cluster 1, H4f /// histone cluster 1, H4k /// histone
257
HIST1H4E /// HIST1H4F /// HIST1H4H /// HIST1H4I /// HIST1H4J /// HIST1H4K /// HIST1H4L /// HIST2H4A /// HIST2H4B /// HIST4H4
cluster 1, H4j /// histone cluster 1, H4c /// histone cluster 1, H4h /// histone cluster 1, H4b /// histone cluster 1, H4e /// histone cluster 1, H4l /// histone cluster 2, H4a /// histone cluster 4, H4 /// histone cluster 2, H4b
232291_at 2.4551394 up Hs.24115 MIRHG1 microRNA host gene (non-protein coding) 1
232392_at 2.129652 up Hs.405144 SFRS3 Splicing factor, arginine/serine-rich 3 235174_s_at 2.929376 up Hs.708094 LOC100128822 hypothetical protein LOC100128822 238439_at 2.8162723 up Hs.217484 ANKRD22 ankyrin repeat domain 22 241815_at 2.439528 up Hs.551393 Transcribed locus 242218_at 2.8279521 up Hs.696032 PPARD peroxisome proliferator-activated
receptor delta 1553798_a_at 2.4437761 up Hs.660029 FBXL13 F-box and leucine-rich repeat protein
13 1554899_s_at 2.9462168 up Hs.433300 FCER1G Fc fragment of IgE, high affinity I,
receptor for; gamma polypeptide 1555728_a_at 7.0254474 up Hs.325960 MS4A4A membrane-spanning 4-domains,
subfamily A, member 4 1556657_at 2.4809327 up Hs.687293 CDNA FLJ36459 fis, clone
THYMU2014762 1556658_a_at 2.3688016 up Hs.687293 CDNA FLJ36459 fis, clone
THYMU2014762 1560527_at 3.4980316 up Hs.621233 NF-E4 transcription factor NF-E4 1569403_at 2.4424713 up Hs.670065 CDNA clone IMAGE:4706427 1570561_at 9.373462 up
258
Table A3.3: Retinoid responsive gene targets of NPM-RARA
Probe Set ID Fold
change([55 RA] vs [55])
Regulation([55 RA] vs
[55])
Unigene (Avadis)
Gene Symbol Gene Title
200871_s_at 2.246819 Up Hs.523004 PSAP prosaposin (variant Gaucher disease and variant metachromatic leukodystrophy)
200897_s_at 6.4181437 Up Hs.151220 PALLD palladin, cytoskeletal associated protein 200906_s_at 2.353638 Up Hs.151220 PALLD palladin, cytoskeletal associated protein 200907_s_at 5.401348 Up Hs.151220 PALLD palladin, cytoskeletal associated protein 201042_at 5.9615774 Up Hs.517033 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-
glutamyltransferase) 201087_at 2.0951338 Up Hs.446336 PXN paxillin 201346_at 2.1625333 Up Hs.371642 ADIPOR2 adiponectin receptor 2 201417_at 2.1510663 Up Hs.699195 SOX4 SRY (sex determining region Y)-box 4 201534_s_at 2.1852524 Up Hs.145575 UBL3 ubiquitin-like 3 201535_at 2.9850104 Up Hs.145575 UBL3 ubiquitin-like 3 201656_at 2.2116652 Up Hs.133397 ITGA6 integrin, alpha 6 201940_at 2.3748088 Up Hs.446079 CPD carboxypeptidase D 201941_at 2.0421736 Up Hs.446079 CPD carboxypeptidase D 201942_s_at 2.3704329 Up Hs.446079 CPD carboxypeptidase D 201963_at 2.292157 Up Hs.406678 ACSL1 acyl-CoA synthetase long-chain family member 1 202241_at 4.209827 Up Hs.444947 TRIB1 tribbles homolog 1 (Drosophila) 202284_s_at 3.842063 Up Hs.370771 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 202308_at 2.166196 Up Hs.592123 SREBF1 sterol regulatory element binding transcription factor 1 202481_at 7.239597 Up Hs.289347 DHRS3 dehydrogenase/reductase (SDR family) member 3 202531_at 2.2671766 Up Hs.436061 IRF1 interferon regulatory factor 1 202625_at 2.3207145 Up Hs.699154 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 202626_s_at 2.0833657 Up Hs.699154 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 202627_s_at 2.4396827 Up Hs.414795 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator
259
inhibitor type 1), member 1 202628_s_at 2.0723362 Up Hs.414795 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator
inhibitor type 1), member 1 202638_s_at 2.1473312 Up Hs.707983 ICAM1 intercellular adhesion molecule 1 (CD54), human rhinovirus receptor 202724_s_at 3.009343 Up Hs.370666 FOXO1 forkhead box O1 202770_s_at 2.4607124 Up Hs.13291 CCNG2 cyclin G2 202869_at 2.2860014 Up Hs.524760 OAS1 2',5'-oligoadenylate synthetase 1, 40/46kDa 202887_s_at 5.5921135 Up Hs.523012 DDIT4 DNA-damage-inducible transcript 4 203140_at 3.3058326 Up Hs.478588 BCL6 B-cell CLL/lymphoma 6 (zinc finger protein 51) 203471_s_at 2.1939862 Up Hs.468840 PLEK pleckstrin 203760_s_at 6.96511 Up Hs.75367 SLA Src-like-adaptor 203761_at 8.401358 Up Hs.75367 SLA Src-like-adaptor 203887_s_at 6.2533383 Up Hs.2030 THBD thrombomodulin 203888_at 4.858821 Up Hs.2030 THBD thrombomodulin 203889_at 2.3612201 Up Hs.156540 SCG5 secretogranin V (7B2 protein) 204011_at 2.2922206 Up Hs.18676 SPRY2 sprouty homolog 2 (Drosophila) 204112_s_at 2.7527354 Up Hs.42151 HNMT histamine N-methyltransferase 204162_at 2.0796025 Up Hs.414407 NDC80 NDC80 homolog, kinetochore complex component (S. cerevisiae) 204174_at 2.6172228 Up Hs.507658 ALOX5AP arachidonate 5-lipoxygenase-activating protein 204429_s_at 6.349962 Up Hs.530003 SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter),
member 5 204430_s_at 8.385023 Up Hs.530003 SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter),
member 5 204526_s_at 2.9660335 Up Hs.442657 TBC1D8 TBC1 domain family, member 8 (with GRAM domain) 204546_at 2.1756487 Up Hs.301658 KIAA0513 KIAA0513 204661_at 2.1885297 Up Hs.276770 CD52 CD52 molecule 204791_at 2.891596 Up Hs.108301 NR2C1 nuclear receptor subfamily 2, group C, member 1 204908_s_at 2.802626 Up Hs.31210 BCL3 B-cell CLL/lymphoma 3 204961_s_at 6.158136 Up Hs.655201 LOC648998 ///
NCF1 /// NCF1B /// NCF1C
similar to Neutrophil cytosol factor 1 (NCF-1) (Neutrophil NADPH oxidase factor 1) (47 kDa neutrophil oxidase factor) (p47-phox) (NCF-47K) (47 kDa autosomal chronic granulomatous disease protein) (NOXO2) /// neutrophil cytosolic factor 1, (chronic
260
granulomatous disease, autosomal 1) /// neutrophil cytosolic factor 1B pseudogene /// neutrophil cytosolic factor 1C pseudogene
205016_at 2.6648026 Up Hs.170009 TGFA transforming growth factor, alpha 205027_s_at 3.5026836 Up Hs.432453 MAP3K8 mitogen-activated protein kinase kinase kinase 8 205067_at 2.2558508 Up Hs.126256 IL1B interleukin 1, beta 205127_at 2.4086578 Up Hs.201978 PTGS1 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase
and cyclooxygenase) 205128_x_at 2.2821105 Up Hs.201978 PTGS1 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase
and cyclooxygenase) 205232_s_at 2.1212788 Up Hs.477083 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 205233_s_at 2.3652747 Up Hs.477083 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 205396_at 2.072369 Up Hs.618504 SMAD3 SMAD family member 3 205397_x_at 2.1071382 Up Hs.618504 SMAD3 SMAD family member 3 205398_s_at 2.5249112 Up Hs.618504 SMAD3 SMAD family member 3 205476_at 2.5043466 Up Hs.75498 CCL20 chemokine (C-C motif) ligand 20 205633_s_at 2.518799 Up Hs.476308 ALAS1 aminolevulinate, delta-, synthase 1 205692_s_at 5.818328 Up Hs.479214 CD38 CD38 molecule 205749_at 4.7893267 Up Hs.72912 CYP1A1 cytochrome P450, family 1, subfamily A, polypeptide 1 205780_at 2.4141812 Up Hs.475055 BIK BCL2-interacting killer (apoptosis-inducing) 205789_at 2.8860488 Up Hs.1799 CD1D CD1d molecule 206028_s_at 3.639326 Up Hs.306178 MERTK c-mer proto-oncogene tyrosine kinase 206126_at 4.5504775 Up Hs.113916 CXCR5 chemokine (C-X-C motif) receptor 5 206369_s_at 5.875969 Up Hs.32942 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 206370_at 5.189663 Up Hs.32942 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 206462_s_at 2.3021586 Up Hs.410969 NTRK3 neurotrophic tyrosine kinase, receptor, type 3 206472_s_at 4.021034 Up Hs.709205 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 206513_at 2.1365075 Up Hs.281898 AIM2 absent in melanoma 2 206521_s_at 2.0000608 Up Hs.592334 GTF2A1 general transcription factor IIA, 1, 19/37kDa 206873_at 2.6792235 Up Hs.100322 CA6 carbonic anhydrase VI 207606_s_at 2.6671817 Up Hs.499264 ARHGAP12 Rho GTPase activating protein 12 207629_s_at 2.173109 Up Hs.655209 ARHGEF2 rho/rac guanine nucleotide exchange factor (GEF) 2 207765_s_at 2.2349226 Up Hs.301696 KIAA1539 KIAA1539
261
208092_s_at 2.0390315 Up Hs.467769 FAM49A family with sequence similarity 49, member A 208170_s_at 2.9086053 Up Hs.493275 TRIM31 tripartite motif-containing 31 208438_s_at 7.7604666 Up Hs.1422 FGR Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog 208514_at 3.2818332 Up Hs.121495 KCNE1 potassium voltage-gated channel, Isk-related family, member 1 208614_s_at 2.1847918 Up Hs.476448 FLNB filamin B, beta (actin binding protein 278) 208749_x_at 2.103332 Up Hs.179986 FLOT1 flotillin 1 208937_s_at 47.04182 Up Hs.504609 ID1 inhibitor of DNA binding 1, dominant negative helix-loop-helix
protein 209324_s_at 2.2390127 Up Hs.413297 RGS16 regulator of G-protein signaling 16 209325_s_at 2.7166984 Up Hs.413297 RGS16 regulator of G-protein signaling 16 209333_at 2.0310307 Up Hs.47061 ULK1 unc-51-like kinase 1 (C. elegans) 209355_s_at 2.0968838 Up Hs.405156 PPAP2B phosphatidic acid phosphatase type 2B 209392_at 9.531024 Up Hs.190977 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin) 209435_s_at 2.9095101 Up Hs.655209 ARHGEF2 rho/rac guanine nucleotide exchange factor (GEF) 2 209551_at 2.013789 Up Hs.468099 YIPF4 Yip1 domain family, member 4 209706_at 2.5280802 Up Hs.55999 NKX3-1 NK3 homeobox 1 210142_x_at 2.2628121 Up Hs.179986 FLOT1 flotillin 1 210146_x_at 3.1460853 Up Hs.655652 LILRB2 leukocyte immunoglobulin-like receptor, subfamily B (with TM and
ITIM domains), member 2 210159_s_at 2.1420844 Up Hs.493275 TRIM31 tripartite motif-containing 31 210173_at 2.049891 Up Hs.318547 PTPRJ protein tyrosine phosphatase, receptor type, J 210223_s_at 2.3806376 Up Hs.101840 MR1 major histocompatibility complex, class I-related 210240_s_at 2.2366748 Up Hs.435051 CDKN2D cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4) 210264_at 4.0205555 Up Hs.239891 GPR35 G protein-coupled receptor 35 210357_s_at 4.3116674 Up Hs.433337 SMOX spermine oxidase 210538_s_at 2.6726468 Up Hs.127799 BIRC3 baculoviral IAP repeat-containing 3 210592_s_at 2.1652398 Up Hs.28491 SAT1 spermidine/spermine N1-acetyltransferase 1 210754_s_at 2.200544 Up Hs.699154 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 210839_s_at 4.8159866 Up Hs.190977 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin) 210845_s_at 2.1698377 Up Hs.466871 PLAUR plasminogen activator, urokinase receptor 211026_s_at 2.2317677 Up Hs.277035 MGLL monoglyceride lipase
262
211559_s_at 2.4680865 Up Hs.13291 CCNG2 cyclin G2 211732_x_at 2.0705788 Up Hs.42151 HNMT histamine N-methyltransferase 211913_s_at 3.152666 Up Hs.306178 MERTK c-mer proto-oncogene tyrosine kinase 211964_at 2.5366511 Up Hs.508716 COL4A2 collagen, type IV, alpha 2 211966_at 2.676469 Up Hs.508716 COL4A2 collagen, type IV, alpha 2 212230_at 2.0011234 Up Hs.708050 PPAP2B phosphatidic acid phosphatase type 2B 212419_at 2.4394522 Up Hs.523080 C10orf56 chromosome 10 open reading frame 56 212423_at 2.4178545 Up Hs.523080 C10orf56 chromosome 10 open reading frame 56 212501_at 3.8561795 Up Hs.517106 CEBPB CCAAT/enhancer binding protein (C/EBP), beta 212558_at 2.2629871 Up Hs.436944 SPRY1 sprouty homolog 1, antagonist of FGF signaling (Drosophila) 212769_at 3.297391 Up Hs.709205 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 212770_at 3.15906 Up Hs.709205 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 212944_at 3.1856778 Up Hs.302742 SLC5A3 solute carrier family 5 (inositol transporters), member 3 213164_at 2.2114139 Up Hs.302742 SLC5A3 solute carrier family 5 (inositol transporters), member 3 213167_s_at 2.1843853 Up Hs.302742 SLC5A3 solute carrier family 5 (inositol transporters), member 3 213385_at 2.1894703 Up Hs.654611 CHN2 chimerin (chimaerin) 2 213475_s_at 2.1780634 Up Hs.174103 ITGAL integrin, alpha L (antigen CD11A (p180), lymphocyte function-
associated antigen 1; alpha polypeptide) 213810_s_at 2.3184736 Up Hs.485915 C6orf166 Chromosome 6 open reading frame 166 213839_at 2.1172595 Up Hs.593760 KIAA0500 KIAA0500 protein 213926_s_at 2.2072005 Up Hs.591619 HRB HIV-1 Rev binding protein 214084_x_at 5.2366743 Up LOC648998 similar to Neutrophil cytosol factor 1 (NCF-1) (Neutrophil NADPH
oxidase factor 1) (47 kDa neutrophil oxidase factor) (p47-phox) (NCF-47K) (47 kDa autosomal chronic granulomatous disease protein) (NOXO2)
214101_s_at 2.1747372 Up Hs.708179 Transcribed locus 214196_s_at 2.0795708 Up Hs.523454 TPP1 tripeptidyl peptidase I 214523_at 3.5253074 Up Hs.558308 CEBPE CCAAT/enhancer binding protein (C/EBP), epsilon 214599_at 2.1587114 Up Hs.516439 IVL involucrin 214637_at 2.5485187 Up Hs.248156 OSM oncostatin M 214639_s_at 3.3741236 Up Hs.67397 HOXA1 homeobox A1 214724_at 5.7931156 Up Hs.655626 DIXDC1 DIX domain containing 1
263
214753_at 2.0603442 Up Hs.507680 N4BP2L2 NEDD4 binding protein 2-like 2 214977_at 2.8935628 Up Hs.654670 CDNA FLJ13790 fis, clone THYRO1000026 215177_s_at 2.9345682 Up Hs.133397 ITGA6 integrin, alpha 6 215268_at 2.1503754 Up Hs.658760 KIAA0754 hypothetical LOC643314 215342_s_at 2.0452404 Up Hs.585378 RABGAP1L RAB GTPase activating protein 1-like 215444_s_at 2.4159238 Up Hs.493275 TRIM31 tripartite motif-containing 31 215627_at 2.0265882 Up Hs.301715 CDNA FLJ13453 fis, clone PLACE1003205 215813_s_at 2.1931105 Up Hs.201978 PTGS1 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase
and cyclooxygenase) 216587_s_at 2.2156923 Up Hs.302634 FZD8 frizzled homolog 8 (Drosophila) 217104_at 2.0132565 Up Hs.459049 MTHFS ///
ST20 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) /// suppressor of tumorigenicity 20
217486_s_at 2.0104165 Up Hs.4014 ZDHHC17 zinc finger, DHHC-type containing 17 217591_at 2.0515206 Up Hs.677805 Transcribed locus 217897_at 2.0845242 Up Hs.635508 FXYD6 FXYD domain containing ion transport regulator 6 217996_at 2.4030678 Up Hs.602085 PHLDA1 pleckstrin homology-like domain, family A, member 1 217997_at 2.4917169 Up Hs.602085 PHLDA1 pleckstrin homology-like domain, family A, member 1 218284_at 2.8421624 Up Hs.618504 SMAD3 SMAD family member 3 218501_at 5.894343 Up Hs.476402 ARHGEF3 Rho guanine nucleotide exchange factor (GEF) 3 218510_x_at 2.72195 Up Hs.481704 FAM134B family with sequence similarity 134, member B 218532_s_at 3.3436737 Up Hs.481704 FAM134B family with sequence similarity 134, member B 218627_at 3.6088104 Up Hs.525634 DRAM damage-regulated autophagy modulator 218676_s_at 2.2792597 Up Hs.285218 PCTP phosphatidylcholine transfer protein 218723_s_at 2.0949621 Up Hs.507866 C13orf15 chromosome 13 open reading frame 15 219010_at 3.37471 Up Hs.518997 C1orf106 chromosome 1 open reading frame 106 219317_at 2.2760723 Up Hs.438533 POLI polymerase (DNA directed) iota 219344_at 3.5494576 Up Hs.438419 SLC29A3 solute carrier family 29 (nucleoside transporters), member 3 219434_at 2.0415852 Up Hs.283022 TREM1 triggering receptor expressed on myeloid cells 1 219607_s_at 13.902484 Up Hs.325960 MS4A4A membrane-spanning 4-domains, subfamily A, member 4 219797_at 2.1064587 Up Hs.177576 MGAT4A mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-
acetylglucosaminyltransferase, isozyme A 219844_at 2.1877847 Up Hs.159066 C10orf118 chromosome 10 open reading frame 118
264
219901_at 2.3943903 Up Hs.506381 FGD6 FYVE, RhoGEF and PH domain containing 6 219994_at 4.150032 Up Hs.310421 APBB1IP amyloid beta (A4) precursor protein-binding, family B, member 1
interacting protein 220507_s_at 2.2128952 Up Hs.474388 UPB1 ureidopropionase, beta 220682_s_at 2.1781907 Up 220802_at 2.0693676 Up Hs.304081 KCNH4 potassium voltage-gated channel, subfamily H (eag-related), member
4 221142_s_at 2.0912616 Up Hs.281680 PECR peroxisomal trans-2-enoyl-CoA reductase 221249_s_at 3.0015697 Up Hs.514308 FAM117A family with sequence similarity 117, member A 221266_s_at 2.1035686 Up Hs.652230 TM7SF4 transmembrane 7 superfamily member 4 221276_s_at 2.1622188 Up Hs.712631 SYNC1 syncoilin, intermediate filament 1 221345_at 3.9440105 Up Hs.248056 FFAR2 free fatty acid receptor 2 221485_at 2.4908564 Up Hs.370487 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5 221561_at 2.2119563 Up Hs.496383 SOAT1 sterol O-acyltransferase (acyl-Coenzyme A: cholesterol
acyltransferase) 1 221601_s_at 3.0838854 Up Hs.58831 FAIM3 Fas apoptotic inhibitory molecule 3 221602_s_at 2.5654364 Up Hs.58831 FAIM3 Fas apoptotic inhibitory molecule 3 221986_s_at 3.6803215 Up Hs.407709 KLHL24 kelch-like 24 (Drosophila) 34210_at 2.0480247 Up Hs.276770 CD52 CD52 molecule 36711_at 4.527568 Up Hs.517617 MAFF v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian) 37117_at 2.015902 Up Hs.102336 ARHGAP8 ///
LOC553158 /// PRR5
Rho GTPase activating protein 8 /// proline rich 5 (renal) /// PRR5-ARHGAP8 fusion
37152_at 2.103844 Up Hs.696032 PPARD peroxisome proliferator-activated receptor delta 37170_at 2.0495327 Up Hs.146551 BMP2K BMP2 inducible kinase 222844_s_at 2.030162 Up Hs.461954 SRR serine racemase 222877_at 2.2359216 Up Hs.660596 CDNA: FLJ21027 fis, clone CAE07110 223044_at 2.2080986 Up Hs.643005 SLC40A1 solute carrier family 40 (iron-regulated transporter), member 1 223276_at 3.9754796 Up Hs.29444 MST150 MSTP150 223567_at 2.9676416 Up Hs.465642 SEMA6B sema domain, transmembrane domain (TM), and cytoplasmic domain,
(semaphorin) 6B 223620_at 2.2369268 Up Hs.495989 GPR34 G protein-coupled receptor 34
265
223634_at 2.1102068 Up Hs.474711 RASD2 RASD family, member 2 223672_at 2.7002747 Up Hs.132121 SGIP1 SH3-domain GRB2-like (endophilin) interacting protein 1 223879_s_at 2.1745186 Up Hs.148778 OXR1 oxidation resistance 1 224035_s_at 2.0562057 Up Hs.708077 BCL2L13 BCL2-like 13 (apoptosis facilitator) 224043_s_at 2.271343 Up Hs.474388 UPB1 ureidopropionase, beta 224341_x_at 2.04793 Up Hs.174312 TLR4 toll-like receptor 4 224357_s_at 2.7210784 Up Hs.325960 MS4A4A membrane-spanning 4-domains, subfamily A, member 4 224534_at 2.121217 Up Hs.229335 KREMEN1 kringle containing transmembrane protein 1 224916_at 3.251452 Up Hs.379754 TMEM173 transmembrane protein 173 224917_at 2.088817 Up MIRN21 microRNA 21 224929_at 3.2078555 Up Hs.379754 TMEM173 transmembrane protein 173 224964_s_at 4.348477 Up Hs.187772 GNG2 guanine nucleotide binding protein (G protein), gamma 2 225102_at 2.2773845 Up Hs.277035 MGLL monoglyceride lipase 225347_at 3.602254 Up Hs.497399 ARL8A ADP-ribosylation factor-like 8A 225372_at 3.7230558 Up Hs.47382 C10orf54 chromosome 10 open reading frame 54 225373_at 2.3732738 Up Hs.47382 C10orf54 chromosome 10 open reading frame 54 225763_at 3.5019486 Up Hs.493867 RCSD1 RCSD domain containing 1 225803_at 2.6384509 Up Hs.403933 FBXO32 F-box protein 32 225817_at 2.0570107 Up Hs.148989 CGNL1 cingulin-like 1 225842_at 2.6239111 Up Hs.602085 PHLDA1 pleckstrin homology-like domain, family A, member 1 225899_x_at 2.000697 Up Hs.465593 LOC643670 ///
LOC728105 /// tcag7.907
hypothetical LOC402483 /// similar to hCG1739109
225919_s_at 3.3289592 Up Hs.493639 C9orf72 chromosome 9 open reading frame 72 226039_at 2.476476 Up Hs.177576 MGAT4A mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-
acetylglucosaminyltransferase, isozyme A 226099_at 2.2057993 Up Hs.592742 ELL2 elongation factor, RNA polymerase II, 2 226119_at 2.006614 Up Hs.308480 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain
containing 1 226146_at 2.0748007 Up Hs.655606 CDNA clone IMAGE:5294560 226184_at 3.1302419 Up Hs.654630 FMNL2 formin-like 2 226344_at 2.0736291 Up Hs.496512 ZMAT1 zinc finger, matrin type 1
266
226487_at 2.3282282 Up Hs.661785 C12orf34 chromosome 12 open reading frame 34 226722_at 2.8734744 Up Hs.134742 FAM20C family with sequence similarity 20, member C 226756_at 3.5177755 Up Hs.633903 CDNA FLJ25556 fis, clone JTH02629 226799_at 2.0092845 Up Hs.506381 FGD6 FYVE, RhoGEF and PH domain containing 6 226853_at 2.0511706 Up Hs.146551 BMP2K BMP2 inducible kinase 226965_at 2.0470502 Up Hs.91085 FAM116A family with sequence similarity 116, member A 227040_at 2.7269776 Up Hs.507783 NHLRC3 NHL repeat containing 3 227396_at 2.9585493 Up Hs.318547 PTPRJ protein tyrosine phosphatase, receptor type, J 227484_at 2.5147696 Up Hs.710097 CDNA FLJ41690 fis, clone HCASM2009405 227514_at 3.208757 Up Hs.648523 LOC162073 hypothetical protein LOC162073 227792_at 3.1586435 Up Hs.648523 LOC162073 hypothetical protein LOC162073 227915_at 3.1987798 Up Hs.510327 ASB2 ankyrin repeat and SOCS box-containing 2 228083_at 2.293615 Up Hs.13768 CACNA2D4 calcium channel, voltage-dependent, alpha 2/delta subunit 4 228097_at 2.274039 Up Hs.484738 MYLIP myosin regulatory light chain interacting protein 228098_s_at 2.203799 Up Hs.484738 MYLIP myosin regulatory light chain interacting protein 228340_at 3.3667622 Up Hs.709205 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 228361_at 2.824649 Up Hs.194333 E2F2 E2F transcription factor 2 228461_at 2.5984275 Up Hs.535157 SH3MD4 SH3 multiple domains 4 228642_at 2.3802812 Up Hs.445239 CDNA FLJ12777 fis, clone NT2RP2001720 228648_at 3.6471891 Up Hs.655559 LRG1 leucine-rich alpha-2-glycoprotein 1 228772_at 2.2901244 Up Hs.42151 HNMT histamine N-methyltransferase 229278_at 2.1170728 Up Hs.40061 Transcribed locus 229285_at 2.2954693 Up Hs.518545 RNASEL ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent) 229521_at 2.6173232 Up Hs.29692 FLJ36031 hypothetical protein FLJ36031 229625_at 3.3724356 Up Hs.513726 GBP5 guanylate binding protein 5 229670_at 4.3125396 Up Hs.180284 5.5 kb mRNA upregulated in retinoic acid treated HL-60 neutrophilic
cells 229735_s_at 2.1004102 Up Hs.708897 Transcribed locus 229910_at 2.0621803 Up Hs.591481 SHE Src homology 2 domain containing E 229934_at 2.8347294 Up Hs.38218 Mir-223 transcript variant 1 mRNA, complete sequence 229971_at 2.1540885 Up Hs.187884 GPR114 G protein-coupled receptor 114
267
230170_at 3.5915139 Up Hs.248156 OSM oncostatin M 230179_at 2.1777985 Up Hs.593631 LOC285812 hypothetical protein LOC285812 230218_at 2.3413222 Up Hs.72956 HIC1 hypermethylated in cancer 1 230333_at 2.6759667 Up Hs.656630 Transcribed locus 230536_at 2.658517 Up Hs.466257 PBX4 pre-B-cell leukemia homeobox 4 230646_at 2.16772 Up Hs.524234 FNDC5 Fibronectin type III domain containing 5 230732_s_at 2.5513582 Up Hs.433728 MAPK4 Mitogen-activated protein kinase 4 230800_at 2.0529864 Up Hs.443428 ADCY4 adenylate cyclase 4 230925_at 5.8982406 Up Hs.310421 APBB1IP amyloid beta (A4) precursor protein-binding, family B, member 1
interacting protein 231214_at 2.0496953 Up Hs.21278 Transcribed locus 231283_at 2.0643651 Up Hs.177576 MGAT4A mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-
acetylglucosaminyltransferase, isozyme A 231496_at 3.1408207 Up Hs.145519 FCAMR Fc receptor, IgA, IgM, high affinity 231779_at 2.4146137 Up Hs.449207 IRAK2 interleukin-1 receptor-associated kinase 2 231969_at 2.6357288 Up Hs.21958 STOX2 storkhead box 2 231991_at 3.178446 Up Hs.382151 C20orf160 chromosome 20 open reading frame 160 232068_s_at 2.1511958 Up Hs.174312 TLR4 toll-like receptor 4 232253_at 2.0920262 Up Hs.658288 LOC441108 Hypothetical gene supported by AK128882 232306_at 2.1834612 Up Hs.54973 CDH26 cadherin-like 26 232611_at 2.1045644 Up Hs.645240 LOC92497 hypothetical LOC92497 232687_at 2.2366445 Up Hs.100912 CDNA FLJ33091 fis, clone TRACH2000660 232754_at 2.6992195 Up Hs.664518 CDNA FLJ11563 fis, clone HEMBA1003202 232861_at 2.009733 Up Hs.654693 PDP2 pyruvate dehydrogenase phosphatase isoenzyme 2 233009_at 2.013952 Up Hs.675113 CDNA FLJ14271 fis, clone PLACE1004686 233016_at 2.54932 Up Hs.288478 CDNA clone IMAGE:4817097 233857_s_at 3.3474777 Up Hs.510327 ASB2 ankyrin repeat and SOCS box-containing 2 233888_s_at 2.279395 Up Hs.450763 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 234317_s_at 2.0457516 Up Hs.21958 STOX2 storkhead box 2 234361_at 2.9642448 Up Hs.247744 CREB3L3 cAMP responsive element binding protein 3-like 3 234987_at 2.6623209 Up Hs.660221 Transcribed locus
268
234990_at 2.1560304 Up Hs.349283 CDNA clone IMAGE:4842353 235352_at 2.2367399 Up Hs.13500 CDNA FLJ31593 fis, clone NT2RI2002481 235417_at 2.0219183 Up Hs.62604 SPOCD1 SPOC domain containing 1 235421_at 2.3143904 Up Hs.432453///
Hs.663033 MAP3K8 Mitogen-activated protein kinase kinase kinase 8 /// CDNA clone
IMAGE:4689481 235505_s_at 2.009543 Up Hs.40966 MRNA full length insert cDNA clone EUROIMAGE 2362292 235516_at 2.0422332 Up Hs.253305 SEPSECS Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase 235521_at 4.8845115 Up Hs.659337 HOXA3 homeobox A3 236019_at 2.03722 Up Hs.270074 RAB12 RAB12, member RAS oncogene family 236061_at 2.3027232 Up Hs.711654 PRDM15 PR domain containing 15 236191_at 6.613427 Up Hs.667427 Transcribed locus 236223_s_at 2.0239542 Up Hs.491234 RIT1 Ras-like without CAAX 1 236407_at 5.1995955 Up Hs.121495 KCNE1 potassium voltage-gated channel, Isk-related family, member 1 236480_at 2.4092677 Up Hs.446388 CDNA FLJ41489 fis, clone BRTHA2004582 236699_at 2.4069755 Up Hs.660409 CDNA FLJ90129 fis, clone HEMBB1000309 236717_at 4.124915 Up Hs.525977 LOC165186 similar to RIKEN cDNA 4632412N22 gene 237252_at 2.5999637 Up Hs.2030 THBD thrombomodulin 237338_at 2.2278228 Up Hs.441681 B3GNT8 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 237442_at 3.7524705 Up 237458_at 2.3744226 Up Hs.547058 Transcribed locus 237701_at 2.1291585 Up Hs.98202 C12orf54 chromosome 12 open reading frame 54 238032_at 7.6221538 Up Hs.655631 Transcribed locus 238407_at 2.0112407 Up Hs.624137 Transcribed locus 238439_at 3.0459437 Up Hs.217484 ANKRD22 ankyrin repeat domain 22 238493_at 2.8231044 Up Hs.351906 ZNF506 zinc finger protein 506 238581_at 4.4943924 Up Hs.513726 GBP5 guanylate binding protein 5 238669_at 2.5256748 Up Hs.201978 PTGS1 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase
and cyclooxygenase) 238725_at 2.0562582 Up Hs.661929 Transcribed locus 239294_at 7.0116982 Up Hs.561747 Transcribed locus 241036_at 2.156731 Up
269
241394_at 2.3390722 Up Hs.464224 LOC284120 hypothetical LOC284120 242426_at 4.1953063 Up Hs.696574 NRG4 neuregulin 4 242525_at 3.1685297 Up Hs.439122 Transcribed locus 242705_x_at 2.3846107 Up Hs.592928 Full length insert cDNA clone YT86E01 242715_at 2.4447923 Up Hs.444181 Transcribed locus 243541_at 3.4468963 Up Hs.55378 IL31RA interleukin 31 receptor A 243798_at 2.1048503 Up Hs.674680 Transcribed locus 243819_at 2.0423958 Up 244665_at 3.9024503 Up Hs.668855 Transcribed locus 1552634_a_at 2.0228066 Up Hs.631642 ZNF101 zinc finger protein 101 1553133_at 2.7681775 Up Hs.493639 C9orf72 chromosome 9 open reading frame 72 1553313_s_at 2.0301917 Up Hs.302742 SLC5A3 solute carrier family 5 (inositol transporters), member 3 1553810_a_at 2.3159645 Up Hs.591308 KIAA1524 KIAA1524 1553970_s_at 2.0439599 Up Hs.533258 CEL carboxyl ester lipase (bile salt-stimulated lipase) 1554015_a_at 2.210065 Up Hs.220864 CHD2 chromodomain helicase DNA binding protein 2 1554240_a_at 2.0033767 Up Hs.174103 ITGAL integrin, alpha L (antigen CD11A (p180), lymphocyte function-
associated antigen 1; alpha polypeptide) 1554806_a_at 2.4902866 Up Hs.76917 FBXO8 F-box protein 8 1555137_a_at 2.5319905 Up Hs.506381 FGD6 FYVE, RhoGEF and PH domain containing 6 1555420_a_at 2.1739933 Up Hs.471221 KLF7 Kruppel-like factor 7 (ubiquitous) 1555431_a_at 3.4255886 Up Hs.55378 IL31RA interleukin 31 receptor A 1555680_a_at 4.0508475 Up Hs.433337 SMOX spermine oxidase 1555728_a_at 11.558348 Up Hs.325960 MS4A4A membrane-spanning 4-domains, subfamily A, member 4 1556123_a_at 2.2488248 Up Hs.637720 Homo sapiens, clone IMAGE:4863312, mRNA 1563745_a_at 4.679765 Up Hs.309176 LOC283050 hypothetical LOC283050 1556206_at 2.0964098 Up Hs.549878 CDNA clone IMAGE:4830861 1557545_s_at 2.2106662 Up Hs.501114 RNF165 ring finger protein 165 1559584_a_at 2.5446959 Up Hs.331095 C16orf54 ///
hCG_1644884 chromosome 16 open reading frame 54 /// similar to chromosome 16 open reading frame 54
1562100_at 2.1443887 Up Hs.552946 Homo sapiens, clone IMAGE:4045462, mRNA 1568619_s_at 3.5794806 Up Hs.648523 LOC162073 hypothetical protein LOC162073
270
1569334_at 2.5108023 Up Hs.24553 STRA6 stimulated by retinoic acid gene 6 homolog (mouse) 1569942_at 2.83881 Up Hs.385753 CDNA clone IMAGE:4796629 1570375_at 2.6354275 Up Hs.661265 CDNA FLJ41985 fis, clone SPLEN2014946 201565_s_at 2.500228 Down Hs.180919 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix
protein 201566_x_at 2.1079838 Down Hs.180919 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix
protein 201675_at 2.1132033 Down Hs.463506 AKAP1 A kinase (PRKA) anchor protein 1 202045_s_at 2.0621004 Down Hs.509447 GRLF1 glucocorticoid receptor DNA binding factor 1 202431_s_at 4.8014007 Down Hs.202453 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 202760_s_at 2.0902064 Down Hs.591908 PALM2-
AKAP2 PALM2-AKAP2
202800_at 2.4726875 Down Hs.481918 SLC1A3 solute carrier family 1 (glial high affinity glutamate transporter), member 3
203023_at 2.1263835 Down Hs.696283 HSPC111 hypothetical protein HSPC111 203231_s_at 2.000628 Down Hs.434961 ATXN1 ataxin 1 203304_at 2.2325277 Down Hs.533336 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus
laevis) 203612_at 2.1791766 Down Hs.106880 BYSL bystin-like 204118_at 2.3325217 Down Hs.243564 CD48 CD48 molecule 204794_at 3.0170782 Down Hs.1183 DUSP2 dual specificity phosphatase 2 204897_at 3.6472108 Down Hs.199248 PTGER4 prostaglandin E receptor 4 (subtype EP4) 204995_at 2.8569963 Down Hs.500015 CDK5R1 cyclin-dependent kinase 5, regulatory subunit 1 (p35) 205136_s_at 2.1136055 Down Hs.525006 NUFIP1 nuclear fragile X mental retardation protein interacting protein 1 205284_at 2.010743 Down Hs.533628 KIAA0133 KIAA0133 205419_at 3.2300916 Down Hs.784 EBI2 Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-
coupled receptor) 205943_at 2.163663 Down Hs.183671 TDO2 tryptophan 2,3-dioxygenase 206067_s_at 4.2541027 Down Hs.591980 WT1 Wilms tumor 1 206157_at 5.320476 Down Hs.591286 PTX3 pentraxin-related gene, rapidly induced by IL-1 beta 206653_at 2.3022125 Down Hs.282387 POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) 206772_at 2.1272707 Down Hs.570296 PTH2R parathyroid hormone 2 receptor
271
207229_at 2.4775214 Down Hs.159297 KLRA1 killer cell lectin-like receptor subfamily A, member 1 208473_s_at 2.3131196 Down Hs.709961 GP2 glycoprotein 2 (zymogen granule membrane) 209099_x_at 2.5063324 Down Hs.224012 JAG1 jagged 1 (Alagille syndrome) 209120_at 3.0593445 Down Hs.701977 NR2F2 nuclear receptor subfamily 2, group F, member 2 209184_s_at 2.2956219 Down Hs.442344 IRS2 insulin receptor substrate 2 209606_at 2.8759694 Down Hs.270 PSCDBP pleckstrin homology, Sec7 and coiled-coil domains, binding protein 209803_s_at 2.3348641 Down Hs.154036 PHLDA2 pleckstrin homology-like domain, family A, member 2 210102_at 2.307687 Down Hs.152944 LOH11CR2A loss of heterozygosity, 11, chromosomal region 2, gene A 210492_at 2.2653377 Down Hs.593942 MFAP3L microfibrillar-associated protein 3-like 210751_s_at 2.016218 Down Hs.77854 RGN regucalcin (senescence marker protein-30) 212276_at 2.197002 Down Hs.467740 LPIN1 lipin 1 213478_at 2.0787475 Down Hs.368823 RP1-21O18.1 kazrin 213931_at 2.7013195 Down Hs.591670 ID2 /// ID2B inhibitor of DNA binding 2, dominant negative helix-loop-helix
protein /// inhibitor of DNA binding 2B, dominant negative helix-loop-helix protein
214295_at 2.3415482 Down Hs.604754 KIAA0485 KIAA0485 protein 215211_at 2.023611 Down LOC730092 RRN3 RNA polymerase I transcription factor homolog (S. cerevisiae)
pseudogene 216268_s_at 2.3467796 Down Hs.224012 JAG1 jagged 1 (Alagille syndrome) 216598_s_at 2.7599106 Down Hs.303649 CCL2 chemokine (C-C motif) ligand 2 216620_s_at 2.0464752 Down Hs.98594 ARHGEF10 Rho guanine nucleotide exchange factor (GEF) 10 216749_at 2.5264196 Down Hs.677282 CDNA: FLJ21198 fis, clone COL00220 217604_at 2.0002718 Down Hs.635110 Transcribed locus 218706_s_at 2.0312455 Down Hs.363558 GRAMD3 GRAM domain containing 3 219225_at 2.014645 Down Hs.520463 LOC10013444
0 /// PGBD5 piggyBac transposable element derived 5 /// similar to PGBD5 protein
219497_s_at 3.7404122 Down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 219498_s_at 3.35297 Down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 219772_s_at 2.0480099 Down Hs.86492 SMPX small muscle protein, X-linked 219825_at 2.0878298 Down Hs.91546 CYP26B1 cytochrome P450, family 26, subfamily B, polypeptide 1 219890_at 2.4836237 Down Hs.446235 CLEC5A C-type lectin domain family 5, member A 219971_at 2.6633294 Down Hs.210546 IL21R interleukin 21 receptor
272
220116_at 4.063247 Down Hs.98280 KCNN2 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
220502_s_at 2.0347304 Down Hs.489849 SLC13A1 solute carrier family 13 (sodium/sulfate symporters), member 1 220503_at 2.495743 Down Hs.489849 SLC13A1 solute carrier family 13 (sodium/sulfate symporters), member 1 221018_s_at 2.0035052 Down Hs.333132 TDRD1 tudor domain containing 1 221298_s_at 2.0786602 Down Hs.266223 SLC22A8 solute carrier family 22 (organic anion transporter), member 8 221586_s_at 2.6404374 Down Hs.445758 E2F5 E2F transcription factor 5, p130-binding 221766_s_at 2.619421 Down Hs.10784 FAM46A family with sequence similarity 46, member A 222664_at 2.3220863 Down Hs.221873 KCTD15 potassium channel tetramerisation domain containing 15 222891_s_at 3.474895 Down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 223036_at 2.0134509 Down Hs.471452 FARSB phenylalanyl-tRNA synthetase, beta subunit 223403_s_at 2.3991299 Down Hs.86337 POLR1B polymerase (RNA) I polypeptide B, 128kDa 223688_s_at 2.3365293 Down Hs.699597 LY6K lymphocyte antigen 6 complex, locus K 224793_s_at 2.0926368 Down Hs.494622 TGFBR1 transforming growth factor, beta receptor I (activin A receptor type II-
like kinase, 53kDa) 224973_at 3.8480284 Down Hs.10784 FAM46A family with sequence similarity 46, member A 224979_s_at 2.0989978 Down Hs.464243 USP36 ubiquitin specific peptidase 36 225032_at 2.0437646 Down Hs.159430 FNDC3B fibronectin type III domain containing 3B 225962_at 2.5650084 Down Hs.427284 ZNRF1 zinc and ring finger 1 226479_at 2.0452113 Down Hs.534040 KBTBD6 kelch repeat and BTB (POZ) domain containing 6 226811_at 2.9312084 Down Hs.356216 FAM46C family with sequence similarity 46, member C 227037_at 2.4785297 Down Hs.31652 LOC201164 similar to CG12314 gene product 227210_at 2.2683113 Down Hs.407983 SFMBT2 Scm-like with four mbt domains 2 227242_s_at 3.7268121 Down Hs.699395 EBF3 early B-cell factor 3 227243_s_at 2.149735 Down Hs.699395 EBF3 early B-cell factor 3 227265_at 2.0887623 Down Hs.520989 FGL2 fibrinogen-like 2 227410_at 2.3463452 Down Hs.708232 FAM43A family with sequence similarity 43, member A 227481_at 2.1525605 Down Hs.16064 CNKSR3 CNKSR family member 3 227802_at 2.1459513 Down Hs.633432 Transcribed locus 228170_at 3.4621675 Down Hs.56663 OLIG1 oligodendrocyte transcription factor 1 228645_at 2.1142652 Down SNHG9 small nucleolar RNA host gene (non-protein coding) 9
273
228781_at 2.1254125 Down Hs.62314 CDNA FLJ33158 fis, clone UTERU2000418 229144_at 2.0105622 Down Hs.368823 RP1-21O18.1 kazrin 229307_at 2.1307192 Down Hs.335239 ANKRD28 ankyrin repeat domain 28 229607_at 2.1760874 Down 229638_at 2.8994858 Down Hs.499205 IRX3 iroquois homeobox 3 230044_at 2.2387767 Down Hs.585089 NPB Neuropeptide B 230058_at 2.1725152 Down Hs.94300 LOC646891 ///
SDCCAG3 serologically defined colon cancer antigen 3 /// similar to serologically defined colon cancer antigen 3
230343_at 2.0108373 Down Hs.28773 Transcribed locus 230395_at 2.1463017 Down Hs.709488 MRNA full length insert cDNA clone EUROIMAGE 2138357 230836_at 2.9297817 Down Hs.308628 ST8SIA4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 231722_at 2.1362612 Down Hs.466057 CASP14 caspase 14, apoptosis-related cysteine peptidase 231798_at 2.9355247 Down Hs.248201 NOG noggin 232148_at 2.2736843 Down Hs.372000 NSMAF Neutral sphingomyelinase (N-SMase) activation associated factor 232181_at 2.33631 Down Hs.483816 LOC153346 hypothetical protein LOC153346 232504_at 4.109505 Down Hs.604728 LOC285628 hypothetical protein LOC285628 232610_at 2.0572758 Down Hs.709426 PARP14 poly (ADP-ribose) polymerase family, member 14 232958_at 2.2152493 Down Hs.660361 CDNA FLJ13595 fis, clone PLACE1009595 233085_s_at 2.8489802 Down Hs.591610 OBFC2A oligonucleotide/oligosaccharide-binding fold containing 2A 233591_at 2.9384553 Down Hs.306876 CDNA: FLJ23098 fis, clone LNG07440 233713_at 2.1836324 Down Hs.660880 CDNA FLJ12119 fis, clone MAMMA1000092 233961_at 2.1376956 Down Hs.677073 CDNA FLJ11859 fis, clone HEMBA1006832 234032_at 2.0185735 Down Hs.684536 Transcribed locus 235202_x_at 2.0879643 Down Hs.252543 IKIP IKK interacting protein 235265_at 2.0678198 Down Hs.379548 UBR3 ubiquitin protein ligase E3 component n-recognin 3 235359_at 2.4265985 Down Hs.709536 LRRC33 leucine rich repeat containing 33 235392_at 2.094309 Down Hs.659169 Transcribed locus 235551_at 2.3058908 Down Hs.248815 WDR4 WD repeat domain 4 235985_at 2.033237 Down Hs.657793 Transcribed locus 236096_at 2.1490674 Down Hs.655502 SIPA1L3 signal-induced proliferation-associated 1 like 3 236196_at 2.122972 Down Hs.586567 CDNA FLJ42548 fis, clone BRACE3004996
274
236561_at 3.3764417 Down Hs.494622 TGFBR1 Transforming growth factor, beta receptor I (activin A receptor type II-like kinase, 53kDa)
236738_at 3.0292625 Down Hs.710781 LOC401097 Similar to LOC166075 237031_at 2.1585586 Down Hs.146276 Full length insert cDNA clone YP08F12 237246_at 2.210518 Down Hs.670752 Transcribed locus 237593_at 2.2573826 Down Hs.667491 Transcribed locus 237597_at 2.038008 Down Hs.118228 Transcribed locus 238156_at 2.265855 Down Hs.663159 Transcribed locus 238246_at 2.0420265 Down Hs.145932 MTL5 Metallothionein-like 5, testis-specific (tesmin) 238520_at 2.0211198 Down Hs.485392 TRERF1 transcriptional regulating factor 1 238822_at 2.2096872 Down Hs.598557 Transcribed locus 239129_at 4.7192163 Down 239605_x_at 2.5360458 Down Hs.657657 Transcribed locus 239609_s_at 2.653492 Down Hs.352614 AGPAT7 1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic
acid acyltransferase, eta) 239895_at 2.242857 Down Hs.510958 AQR Aquarius homolog (mouse) 239973_at 2.2025015 Down Hs.212709 Transcribed locus 240362_at 2.288509 Down Hs.172755 BRP44L Brain protein 44-like 240747_at 3.579509 Down Hs.667630 Transcribed locus 241068_at 2.0787373 Down Hs.614053 Transcribed locus 241693_at 2.064382 Down Hs.660537 Transcribed locus 241859_at 2.4656346 Down Hs.153322 PLCL1 phospholipase C-like 1 242245_at 2.469184 Down Hs.533853 CDNA FLJ90705 fis, clone PLACE1007591 242388_x_at 2.1783433 Down Hs.601883 Transcribed locus 242435_at 2.0648775 Down Hs.89901 PDE4A Phosphodiesterase 4A, cAMP-specific (phosphodiesterase E2 dunce
homolog, Drosophila) 242673_at 2.3914204 Down Hs.599613 Transcribed locus 242943_at 2.020434 Down Hs.308628 ST8SIA4 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 243503_at 2.0134475 Down Hs.632985 Transcribed locus 243529_at 2.15252 Down Hs.116602 MARS2 methionyl-tRNA synthetase 2, mitochondrial 244183_x_at 2.0973384 Down Hs.674730 PCDHB3 protocadherin beta 3 244227_at 2.070997 Down Hs.370963 SYT6 synaptotagmin VI
275
244390_at 2.1863773 Down Hs.112791 Transcribed locus 1552521_a_at 2.1410308 Down Hs.99439 TMEM74 transmembrane protein 74 1552626_a_at 2.0103655 Down Hs.369471 TMEM163 transmembrane protein 163 1553074_at 2.011583 Down Hs.352183 ASB11 ankyrin repeat and SOCS box-containing 11 1553138_a_at 2.0253823 Down Hs.379097 ANKLE1 ankyrin repeat and LEM domain containing 1 1555300_a_at 2.0457644 Down Hs.58561 MED12L mediator complex subunit 12-like 1555777_at 2.0628526 Down Hs.136348 POSTN periostin, osteoblast specific factor 1555790_a_at 2.0564477 Down Hs.708090 TMEM192 ///
ZNF320 zinc finger protein 320 /// transmembrane protein 192
1555832_s_at 2.2229512 Down Hs.4055///Hs.709396
KLF6 Homo sapiens, clone IMAGE:4096273, mRNA /// Kruppel-like factor 6
1556194_a_at 2.08916 Down Hs.558200 CDNA FLJ33585 fis, clone BRAMY2012163 1556261_a_at 2.3748684 Down Hs.118609 CDNA FLJ40252 fis, clone TESTI2024299 1556361_s_at 3.6004255 Down Hs.105016 ANKRD13C ankyrin repeat domain 13C 1556894_at 2.1505616 Down Hs.84753 NT5DC2 5'-nucleotidase domain containing 2 1557126_a_at 2.173446 Down Hs.382865 PLD1 phospholipase D1, phosphatidylcholine-specific 1557593_at 2.5605173 Down Hs.528821 SPAG17 Sperm associated antigen 17 1558522_at 2.6067457 Down Hs.594275 Homo sapiens, clone IMAGE:3459334, mRNA 1558624_at 2.1274154 Down Hs.679977 Homo sapiens, clone IMAGE:5441027 1559078_at 2.072533 Down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 1559309_at 2.1830356 Down Hs.293689 MCFD2 multiple coagulation factor deficiency 2 1559326_at 2.0949717 Down Hs.525597 DIO3OS deiodinase, iodothyronine, type III opposite strand 1559394_a_at 2.2057455 Down Hs.660003 Full length insert cDNA clone ZC65D06 1559580_at 2.002937 Down Hs.44277 LRRC39 leucine rich repeat containing 39 1559948_at 2.374575 Down Hs.194746 CDNA FLJ20447 fis, clone KAT05276 1560426_at 2.201625 Down Hs.535389 C12orf55 chromosome 12 open reading frame 55 1560684_x_at 2.0104003 Down Hs.657985 BCL8 B-cell CLL/lymphoma 8 1561331_at 2.3409355 Down C1orf99 chromosome 1 open reading frame 99 1563420_at 2.313869 Down XGPY2 Xg pseudogene, Y-linked 2 1566991_at 2.0156975 Down Hs.291587 ARID1B AT rich interactive domain 1B (SWI1-like) 1568813_at 3.2485936 Down Hs.418285 CDNA clone IMAGE:4620359
276
1569369_at 2.2046144 Down Hs.292056 ZFYVE28 zinc finger, FYVE domain containing 28 1569469_a_at 2.1429687 Down Hs.403934 LHX8 LIM homeobox 8 1569948_at 2.0533514 Down Hs.685028 CDNA clone IMAGE:5275301 1570153_at 2.2748373 Down Hs.646618 SOHLH2 spermatogenesis and oogenesis specific basic helix-loop-helix 2 1570352_at 2.3949015 Down Hs.367437 ATM ataxia telangiectasia mutated 1570393_at 2.0387962 Down Hs.712606 EML5 echinoderm microtubule associated protein like 5
277
Table A3.4: Retinoid response gene targets in NuMA-RARA Probe Set ID Fold
change([12RA] vs [12])
Regulation ([12RA] vs
[12])
Unigene (Avadis)
Gene Symbol
Gene Title
201324_at 2.0886235 down Hs.436298 EMP1 epithelial membrane protein 1 201565_s_at 3.21204 down Hs.180919 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix
protein 201566_x_at 2.9929056 down Hs.180919 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix
protein 202206_at 2.399275 down Hs.709513 ARL4C ADP-ribosylation factor-like 4C 202431_s_at 12.158877 down Hs.202453 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 202859_x_at 2.084367 down Hs.551925 IL8 interleukin 8 203304_at 2.7989619 down Hs.533336 BAMBI BMP and activin membrane-bound inhibitor homolog (Xenopus
laevis) 203408_s_at 2.1148467 down Hs.517717 SATB1 SATB homeobox 1 203604_at 2.0690129 down Hs.709890 ZNF516 zinc finger protein 516 204072_s_at 2.3049405 down Hs.591225 FRY furry homolog (Drosophila) 204249_s_at 2.1231515 down Hs.34560 LMO2 LIM domain only 2 (rhombotin-like 1) 204794_at 2.1565883 down Hs.1183 DUSP2 dual specificity phosphatase 2 204798_at 2.948894 down Hs.654446 MYB v-myb myeloblastosis viral oncogene homolog (avian) 204897_at 5.9579215 down Hs.199248 PTGER4 prostaglandin E receptor 4 (subtype EP4) 205039_s_at 2.0252483 down Hs.435949 IKZF1 IKAROS family zinc finger 1 (Ikaros) 205284_at 2.1262233 down Hs.533628 KIAA0133 KIAA0133 205419_at 2.4826307 down Hs.784 EBI2 Epstein-Barr virus induced gene 2 (lymphocyte-specific G
protein-coupled receptor) 206157_at 4.476515 down Hs.591286 PTX3 pentraxin-related gene, rapidly induced by IL-1 beta 206170_at 2.7569294 down Hs.591251 ADRB2 adrenergic, beta-2-, receptor, surface 206806_at 2.2899141 down Hs.242947 DGKI diacylglycerol kinase, iota 206943_at 2.0320473 down Hs.494622 TGFBR1 transforming growth factor, beta receptor I (activin A receptor
type II-like kinase, 53kDa) 207980_s_at 2.2106276 down Hs.82071 CITED2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-
terminal domain, 2
278
208960_s_at 2.134312 down Hs.4055 KLF6 Kruppel-like factor 6 208961_s_at 2.071602 down Hs.4055 KLF6 Kruppel-like factor 6 209099_x_at 2.2153378 down Hs.224012 JAG1 jagged 1 (Alagille syndrome) 209120_at 2.0699842 down Hs.701977 NR2F2 nuclear receptor subfamily 2, group F, member 2 209184_s_at 3.2237732 down Hs.442344 IRS2 insulin receptor substrate 2 209185_s_at 3.1897783 down Hs.442344 IRS2 insulin receptor substrate 2 209606_at 2.753105 down Hs.270 PSCDBP pleckstrin homology, Sec7 and coiled-coil domains, binding
protein 213931_at 2.8903654 down Hs.591670 ID2 ///
ID2B inhibitor of DNA binding 2, dominant negative helix-loop-helix protein /// inhibitor of DNA binding 2B, dominant negative helix-loop-helix protein
214581_x_at 2.7177627 down Hs.443577 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 214651_s_at 2.0072289 down Hs.659350 HOXA9 homeobox A9 216012_at 2.3650792 down Hs.550193 Unidentified mRNA, partial sequence 216268_s_at 2.7129872 down Hs.224012 JAG1 jagged 1 (Alagille syndrome) 216901_s_at 2.2050683 down Hs.435949 IKZF1 IKAROS family zinc finger 1 (Ikaros) 217523_at 2.831772 down Hs.502328 CD44 CD44 molecule (Indian blood group) 218251_at 2.0469325 down Hs.522605 MID1IP1 MID1 interacting protein 1 (gastrulation specific G12 homolog
(zebrafish) 218856_at 2.5045984 down Hs.443577 TNFRSF21 tumor necrosis factor receptor superfamily, member 21 219497_s_at 4.438934 down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 219498_s_at 3.2207508 down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 219890_at 2.4856505 down Hs.446235 CLEC5A C-type lectin domain family 5, member A 220116_at 3.7291224 down Hs.98280 KCNN2 potassium intermediate/small conductance calcium-activated
channel, subfamily N, member 2 221586_s_at 2.598485 down Hs.445758 E2F5 E2F transcription factor 5, p130-binding 221766_s_at 3.498441 down Hs.10784 FAM46A family with sequence similarity 46, member A 222891_s_at 4.641202 down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 223403_s_at 2.2585576 down Hs.86337 POLR1B polymerase (RNA) I polypeptide B, 128kDa 224606_at 2.4023688 down Hs.4055 KLF6 Kruppel-like factor 6 224973_at 4.151496 down Hs.10784 FAM46A family with sequence similarity 46, member A 225167_at 2.0883074 down Hs.330463 FRMD4A FERM domain containing 4A
279
225436_at 2.206226 down Hs.459072 FAM108C1 family with sequence similarity 108, member C1 225974_at 2.0538626 down Hs.567759 TMEM64 transmembrane protein 64 227037_at 3.0964594 down Hs.31652 LOC20116
4 similar to CG12314 gene product
227210_at 2.3620021 down Hs.407983 SFMBT2 Scm-like with four mbt domains 2 227242_s_at 2.3002076 down Hs.699395 EBF3 early B-cell factor 3 227346_at 2.2483537 down Hs.488251 IKZF1 IKAROS family zinc finger 1 (Ikaros) 227410_at 2.2359083 down Hs.708232 FAM43A family with sequence similarity 43, member A 227481_at 2.3246589 down Hs.16064 CNKSR3 CNKSR family member 3 228170_at 3.0674152 down Hs.56663 OLIG1 oligodendrocyte transcription factor 1 229638_at 3.6987438 down Hs.499205 IRX3 iroquois homeobox 3 229723_at 2.0052488 down Hs.529984 TAGAP T-cell activation RhoGTPase activating protein 231786_at 2.0587091 down Hs.592172 HOXA13 homeobox A13 232291_at 2.7976894 down Hs.24115 MIRHG1 microRNA host gene (non-protein coding) 1 232504_at 2.5817292 down Hs.604728 LOC28562
8 hypothetical protein LOC285628
236738_at 8.455545 down Hs.710781 LOC401097
Similar to LOC166075
238607_at 2.3092794 down Hs.192237 ZNF342 zinc finger protein 342 239129_at 2.0111887 down 239605_x_at 2.1959515 down Hs.657657 Transcribed locus 240747_at 2.0800576 down Hs.667630 Transcribed locus 241365_at 2.0684748 down Hs.593276 CDNA FLJ42259 fis, clone TKIDN2011289 242388_x_at 2.214354 down Hs.601883 Transcribed locus 243529_at 2.1790874 down Hs.116602 MARS2 methionyl-tRNA synthetase 2, mitochondrial 244267_at 2.5540445 down Hs.674678 Transcribed locus 1554887_at 2.272857 down 1555832_s_at 2.612295 down Hs.4055///Hs.
709396 KLF6 Homo sapiens, clone IMAGE:4096273, mRNA /// Kruppel-like
factor 6 1564906_at 2.2597687 down SNHG4 small nucleolar RNA host gene (non-protein coding) 4 1569054_at 2.2992537 down Hs.481918 SLC1A3 solute carrier family 1 (glial high affinity glutamate transporter),
member 3
280
200644_at 2.9435694 up Hs.75061 MARCKSL1
MARCKS-like 1
200897_s_at 6.706352 up Hs.151220 PALLD palladin, cytoskeletal associated protein 200906_s_at 2.92617 up Hs.151220 PALLD palladin, cytoskeletal associated protein 200907_s_at 4.788296 up Hs.151220 PALLD palladin, cytoskeletal associated protein 201042_at 2.017785 up Hs.517033 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-
glutamyltransferase) 201471_s_at 2.0305166 up Hs.437277 SQSTM1 sequestosome 1 201534_s_at 2.1077316 up Hs.145575 UBL3 ubiquitin-like 3 201631_s_at 2.4305413 up Hs.591785 IER3 immediate early response 3 201656_at 2.5098853 up Hs.133397 ITGA6 integrin, alpha 6 202308_at 2.0174117 up Hs.592123 SREBF1 sterol regulatory element binding transcription factor 1 202481_at 4.625771 up Hs.289347 DHRS3 dehydrogenase/reductase (SDR family) member 3 202627_s_at 3.8934524 up Hs.414795 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator
inhibitor type 1), member 1 202628_s_at 3.1118069 up Hs.414795 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen activator
inhibitor type 1), member 1 202769_at 2.132356 up Hs.13291 CCNG2 cyclin G2 202770_s_at 2.2489765 up Hs.13291 CCNG2 cyclin G2 202869_at 6.2625756 up Hs.524760 OAS1 2',5'-oligoadenylate synthetase 1, 40/46kDa 202887_s_at 4.862352 up Hs.523012 DDIT4 DNA-damage-inducible transcript 4 203020_at 4.299632 up Hs.585378 RABGAP1
L RAB GTPase activating protein 1-like
203490_at 2.0644116 up Hs.271940 ELF4 E74-like factor 4 (ets domain transcription factor) 203567_s_at 2.0241668 up Hs.584851 TRIM38 tripartite motif-containing 38 203610_s_at 2.135064 up Hs.584851 TRIM38 tripartite motif-containing 38 203760_s_at 4.567203 up Hs.75367 SLA Src-like-adaptor 203761_at 4.160341 up Hs.75367 SLA Src-like-adaptor 203821_at 2.9183996 up Hs.799 HBEGF heparin-binding EGF-like growth factor 203887_s_at 9.840143 up Hs.2030 THBD thrombomodulin 203888_at 7.390962 up Hs.2030 THBD thrombomodulin 203936_s_at 2.7114239 up Hs.297413 MMP9 matrix metallopeptidase 9 (gelatinase B, 92kDa gelatinase, 92kDa
281
type IV collagenase) 204112_s_at 2.164019 up Hs.42151 HNMT histamine N-methyltransferase 204429_s_at 2.9717975 up Hs.530003 SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter),
member 5 204430_s_at 3.808644 up Hs.530003 SLC2A5 solute carrier family 2 (facilitated glucose/fructose transporter),
member 5 204526_s_at 2.1254432 up Hs.442657 TBC1D8 TBC1 domain family, member 8 (with GRAM domain) 204546_at 2.5628142 up Hs.301658 KIAA0513 KIAA0513 204908_s_at 3.4835668 up Hs.31210 BCL3 B-cell CLL/lymphoma 3 204961_s_at 2.6331637 up Hs.655201 LOC64899
8 /// NCF1 /// NCF1B /// NCF1C
similar to Neutrophil cytosol factor 1 (NCF-1) (Neutrophil NADPH oxidase factor 1) (47 kDa neutrophil oxidase factor) (p47-phox) (NCF-47K) (47 kDa autosomal chronic granulomatous disease protein) (NOXO2) /// neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) /// neutrophil cytosolic factor 1B pseudogene /// neutrophil cytosolic factor 1C pseudogene
205016_at 2.999059 up Hs.170009 TGFA transforming growth factor, alpha 205027_s_at 5.5103297 up Hs.432453 MAP3K8 mitogen-activated protein kinase kinase kinase 8 205114_s_at 2.541763 up Hs.514107 CCL3 ///
CCL3L1 /// CCL3L3 /// LOC728830
chemokine (C-C motif) ligand 3 /// chemokine (C-C motif) ligand 3-like 1 /// chemokine (C-C motif) ligand 3-like 3 /// similar to C-C motif chemokine 3-like 1 precursor (Small-inducible cytokine A3-like 1) (Tonsillar lymphocyte LD78 beta protein) (LD78-beta(1-70) (G0/G1 switch regulatory protein 19-2) (G0S19-2 protein) (PAT 464.2)
205233_s_at 2.145516 up Hs.477083 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 205476_at 2.3362823 up Hs.75498 CCL20 chemokine (C-C motif) ligand 20 205479_s_at 2.1671915 up Hs.77274 PLAU plasminogen activator, urokinase 205552_s_at 10.651269 up Hs.524760 OAS1 2',5'-oligoadenylate synthetase 1, 40/46kDa 205633_s_at 3.0050461 up Hs.476308 ALAS1 aminolevulinate, delta-, synthase 1 205686_s_at 2.152219 up Hs.171182 CD86 CD86 molecule 205692_s_at 2.9528363 up Hs.479214 CD38 CD38 molecule 205749_at 4.1655197 up Hs.72912 CYP1A1 cytochrome P450, family 1, subfamily A, polypeptide 1 205780_at 2.1528373 up Hs.475055 BIK BCL2-interacting killer (apoptosis-inducing)
282
205786_s_at 2.2678525 up Hs.172631 ITGAM integrin, alpha M (complement component 3 receptor 3 subunit) 205789_at 3.509333 up Hs.1799 CD1D CD1d molecule 206028_s_at 3.1643016 up Hs.306178 MERTK c-mer proto-oncogene tyrosine kinase 206126_at 2.407795 up Hs.113916 CXCR5 chemokine (C-X-C motif) receptor 5 206337_at 3.6867352 up Hs.370036 CCR7 chemokine (C-C motif) receptor 7 206369_s_at 4.118413 up Hs.32942 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 206370_at 4.350002 up Hs.32942 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 206907_at 2.678825 up Hs.1524 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 207075_at 3.0162885 up Hs.159483 NLRP3 NLR family, pyrin domain containing 3 207606_s_at 2.171973 up Hs.499264 ARHGAP1
2 Rho GTPase activating protein 12
207700_s_at 2.106243 up Hs.697989 NCOA3 nuclear receptor coactivator 3 208438_s_at 6.1830955 up Hs.1422 FGR Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene homolog 208937_s_at 8.424782 up Hs.504609 ID1 inhibitor of DNA binding 1, dominant negative helix-loop-helix
protein 208981_at 2.4985461 up Hs.709189 PECAM1 platelet/endothelial cell adhesion molecule (CD31 antigen) 208982_at 2.3103552 up Hs.709189 PECAM1 platelet/endothelial cell adhesion molecule (CD31 antigen) 208983_s_at 2.274433 up Hs.709189 PECAM1 platelet/endothelial cell adhesion molecule (CD31 antigen) 209392_at 2.1163976 up Hs.190977 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2 (autotaxin) 209435_s_at 2.0798774 up Hs.655209 ARHGEF2 rho/rac guanine nucleotide exchange factor (GEF) 2 209930_s_at 3.9308145 up Hs.75643 NFE2 nuclear factor (erythroid-derived 2), 45kDa 210004_at 2.9448462 up Hs.412484 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 210264_at 2.3631938 up Hs.239891 GPR35 G protein-coupled receptor 35 210357_s_at 3.9023316 up Hs.433337 SMOX spermine oxidase 210612_s_at 2.2949255 up Hs.434494 SYNJ2 synaptojanin 2 210895_s_at 2.93986 up Hs.171182 CD86 CD86 molecule 211026_s_at 2.0596979 up Hs.277035 MGLL monoglyceride lipase 211913_s_at 2.3331985 up Hs.306178 MERTK c-mer proto-oncogene tyrosine kinase 212226_s_at 2.188942 up Hs.405156 PPAP2B phosphatidic acid phosphatase type 2B 212230_at 2.3880374 up Hs.708050 PPAP2B phosphatidic acid phosphatase type 2B 212501_at 5.853824 up Hs.517106 CEBPB CCAAT/enhancer binding protein (C/EBP), beta
283
212769_at 2.0626068 up Hs.709205 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 212770_at 2.066573 up Hs.709205 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila) 212812_at 2.0918567 up Hs.288232 CDNA: FLJ22642 fis, clone HSI06970 212828_at 2.1780922 up Hs.434494 SYNJ2 synaptojanin 2 212948_at 2.334709 up Hs.632242 CAMTA2 calmodulin binding transcription activator 2 213475_s_at 2.1866786 up Hs.174103 ITGAL integrin, alpha L (antigen CD11A (p180), lymphocyte function-
associated antigen 1; alpha polypeptide) 214084_x_at 2.9736662 up LOC64899
8 similar to Neutrophil cytosol factor 1 (NCF-1) (Neutrophil NADPH oxidase factor 1) (47 kDa neutrophil oxidase factor) (p47-phox) (NCF-47K) (47 kDa autosomal chronic granulomatous disease protein) (NOXO2)
214523_at 3.213535 up Hs.558308 CEBPE CCAAT/enhancer binding protein (C/EBP), epsilon 214639_s_at 2.2926025 up Hs.67397 HOXA1 homeobox A1 214977_at 2.097475 up Hs.654670 CDNA FLJ13790 fis, clone THYRO1000026 215177_s_at 2.6028233 up Hs.133397 ITGA6 integrin, alpha 6 215342_s_at 4.092742 up Hs.585378 RABGAP1
L RAB GTPase activating protein 1-like
216015_s_at 2.7958415 up Hs.159483 NLRP3 NLR family, pyrin domain containing 3 217104_at 2.3176522 up Hs.459049 MTHFS ///
ST20 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) /// suppressor of tumorigenicity 20
218501_at 7.5679164 up Hs.476402 ARHGEF3 Rho guanine nucleotide exchange factor (GEF) 3 218627_at 2.9676416 up Hs.525634 DRAM damage-regulated autophagy modulator 218723_s_at 2.5117044 up Hs.507866 C13orf15 chromosome 13 open reading frame 15 219010_at 2.7844956 up Hs.518997 C1orf106 chromosome 1 open reading frame 106 219607_s_at 3.3354638 up Hs.325960 MS4A4A membrane-spanning 4-domains, subfamily A, member 4 219901_at 2.5995123 up Hs.506381 FGD6 FYVE, RhoGEF and PH domain containing 6 219994_at 2.644592 up Hs.310421 APBB1IP amyloid beta (A4) precursor protein-binding, family B, member 1
interacting protein 220148_at 2.2781162 up Hs.486520 ALDH8A1 aldehyde dehydrogenase 8 family, member A1 220494_s_at 2.3231566 up 221266_s_at 2.5050628 up Hs.652230 TM7SF4 transmembrane 7 superfamily member 4
284
221345_at 3.761886 up Hs.248056 FFAR2 free fatty acid receptor 2 221601_s_at 4.777954 up Hs.58831 FAIM3 Fas apoptotic inhibitory molecule 3 221602_s_at 3.9625475 up Hs.58831 FAIM3 Fas apoptotic inhibitory molecule 3 221748_s_at 2.7049792 up Hs.471381 TNS1 tensin 1 31845_at 2.1242719 up Hs.271940 ELF4 E74-like factor 4 (ets domain transcription factor) 34210_at 2.6051145 up Hs.276770 CD52 CD52 molecule 36711_at 6.3232007 up Hs.517617 MAFF v-maf musculoaponeurotic fibrosarcoma oncogene homolog F
(avian) 37152_at 2.2212722 up Hs.696032 PPARD peroxisome proliferator-activated receptor delta 38037_at 2.565572 up Hs.799 HBEGF heparin-binding EGF-like growth factor 222996_s_at 2.2260995 up Hs.189119 CXXC5 CXXC finger 5 223276_at 3.4076967 up Hs.29444 MST150 MSTP150 223567_at 6.1853256 up Hs.465642 SEMA6B sema domain, transmembrane domain (TM), and cytoplasmic
domain, (semaphorin) 6B 223620_at 2.1318035 up Hs.495989 GPR34 G protein-coupled receptor 34 224048_at 2.102644 up Hs.646421 USP44 ubiquitin specific peptidase 44 224516_s_at 2.4642644 up Hs.189119 CXXC5 CXXC finger 5 224916_at 3.0291984 up Hs.379754 TMEM173 transmembrane protein 173 224929_at 3.1026132 up Hs.379754 TMEM173 transmembrane protein 173 224964_s_at 2.3579462 up Hs.187772 GNG2 guanine nucleotide binding protein (G protein), gamma 2 225347_at 2.9668434 up Hs.497399 ARL8A ADP-ribosylation factor-like 8A 225372_at 2.9746375 up Hs.47382 C10orf54 chromosome 10 open reading frame 54 225373_at 2.2076936 up Hs.47382 C10orf54 chromosome 10 open reading frame 54 225763_at 2.1507406 up Hs.493867 RCSD1 RCSD domain containing 1 225842_at 2.064913 up Hs.602085 PHLDA1 pleckstrin homology-like domain, family A, member 1 225919_s_at 2.1124992 up Hs.493639 C9orf72 chromosome 9 open reading frame 72 226039_at 2.0417984 up Hs.177576 MGAT4A mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-
acetylglucosaminyltransferase, isozyme A 226146_at 2.0081341 up Hs.655606 CDNA clone IMAGE:5294560 226215_s_at 2.629909 up Hs.524800 FBXL10 F-box and leucine-rich repeat protein 10 226487_at 2.6733472 up Hs.661785 C12orf34 chromosome 12 open reading frame 34 226673_at 2.4407449 up Hs.306412 SH2D3C SH2 domain containing 3C
285
226722_at 2.0995586 up Hs.134742 FAM20C family with sequence similarity 20, member C 226756_at 2.6342082 up Hs.633903 CDNA FLJ25556 fis, clone JTH02629 226855_at 3.5249252 up Hs.632214 CDNA FLJ40954 fis, clone UTERU2010525 227396_at 2.8179464 up Hs.318547 PTPRJ protein tyrosine phosphatase, receptor type, J 227484_at 3.5488734 up Hs.710097 CDNA FLJ41690 fis, clone HCASM2009405 227701_at 2.0022275 up Hs.159066 C10orf118 chromosome 10 open reading frame 118 227792_at 2.9687207 up Hs.648523 LOC16207
3 hypothetical protein LOC162073
227915_at 3.3251038 up Hs.510327 ASB2 ankyrin repeat and SOCS box-containing 2 228120_at 2.4339266 up Hs.656677 CDNA: FLJ22073 fis, clone HEP11868 228648_at 5.729146 up Hs.655559 LRG1 leucine-rich alpha-2-glycoprotein 1 228762_at 2.5676794 up Hs.159142 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 228772_at 2.638866 up Hs.42151 HNMT histamine N-methyltransferase 228854_at 2.283559 up Hs.586747 Transcribed locus 229399_at 2.0305078 up Hs.159066 C10orf118 chromosome 10 open reading frame 118 229625_at 2.8929 up Hs.513726 GBP5 guanylate binding protein 5 229670_at 3.5084085 up Hs.180284 5.5 kb mRNA upregulated in retinoic acid treated HL-60
neutrophilic cells 229795_at 2.0522285 up Hs.48945 Transcribed locus 229971_at 3.044595 up Hs.187884 GPR114 G protein-coupled receptor 114 230218_at 2.6236181 up Hs.72956 HIC1 hypermethylated in cancer 1 230333_at 2.728373 up Hs.656630 Transcribed locus 230713_at 2.02981 up Hs.476164 Transcribed locus 230925_at 3.1246424 up Hs.310421 APBB1IP amyloid beta (A4) precursor protein-binding, family B, member 1
interacting protein 231496_at 3.575809 up Hs.145519 FCAMR Fc receptor, IgA, IgM, high affinity 231779_at 2.9554198 up Hs.449207 IRAK2 interleukin-1 receptor-associated kinase 2 231969_at 2.2740314 up Hs.21958 STOX2 storkhead box 2 232687_at 2.5561237 up Hs.100912 CDNA FLJ33091 fis, clone TRACH2000660 232754_at 2.0563302 up Hs.664518 CDNA FLJ11563 fis, clone HEMBA1003202 232861_at 4.6474376 up Hs.654693 PDP2 pyruvate dehydrogenase phosphatase isoenzyme 2 232912_at 2.1348078 up Hs.657472 GPR180 G protein-coupled receptor 180
286
233857_s_at 4.5003366 up Hs.510327 ASB2 ankyrin repeat and SOCS box-containing 2 233955_x_at 2.2768729 up Hs.189119 CXXC5 CXXC finger 5 234361_at 2.4593277 up Hs.247744 CREB3L3 cAMP responsive element binding protein 3-like 3 234987_at 4.1412725 up Hs.660221 Transcribed locus 235421_at 2.1626062 up Hs.432453///
Hs.663033 MAP3K8 Mitogen-activated protein kinase kinase kinase 8 /// CDNA clone
IMAGE:4689481 235456_at 2.520447 up Hs.130853 CDNA clone IMAGE:4819084 235505_s_at 3.9337726 up Hs.40966 MRNA full length insert cDNA clone EUROIMAGE 2362292 235521_at 2.126902 up Hs.659337 HOXA3 homeobox A3 235529_x_at 2.320773 up Hs.660221 Transcribed locus 236191_at 5.362256 up Hs.667427 Transcribed locus 236223_s_at 2.2420454 up Hs.491234 RIT1 Ras-like without CAAX 1 236407_at 6.211272 up Hs.121495 KCNE1 potassium voltage-gated channel, Isk-related family, member 1 236619_at 2.107196 up Hs.196073 Transcribed locus 236717_at 5.53467 up Hs.525977 LOC16518
6 similar to RIKEN cDNA 4632412N22 gene
237252_at 5.35475 up Hs.2030 THBD thrombomodulin 237442_at 2.538061 up 238032_at 2.6913702 up Hs.655631 Transcribed locus 238439_at 2.5457928 up Hs.217484 ANKRD22 ankyrin repeat domain 22 238581_at 7.4942203 up Hs.513726 GBP5 guanylate binding protein 5 238669_at 2.9314187 up Hs.201978 PTGS1 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H
synthase and cyclooxygenase) 239196_at 2.1484046 up Hs.217484 ANKRD22 ankyrin repeat domain 22 239258_at 2.9715037 up Hs.713163 Transcribed locus 239294_at 4.0445514 up Hs.561747 Transcribed locus 239808_at 2.0879884 up Hs.656954 Transcribed locus 239843_at 2.2132082 up Hs.491234 RIT1 Ras-like without CAAX 1 240173_at 2.106467 up Hs.602127 Transcribed locus 241742_at 2.1086307 up Hs.465812 PRAM1 PML-RARA regulated adaptor molecule 1 242426_at 4.667349 up Hs.696574 NRG4 neuregulin 4 242525_at 2.6995246 up Hs.439122 Transcribed locus
287
242598_at 2.1197417 up Hs.674063 Transcribed locus 242705_x_at 3.301952 up Hs.592928 Full length insert cDNA clone YT86E01 243463_s_at 2.2107568 up Hs.491234 RIT1 Ras-like without CAAX 1 243541_at 3.0937464 up Hs.55378 IL31RA interleukin 31 receptor A 243745_at 2.017381 up Hs.673919 Transcribed locus 243819_at 2.0161119 up 244014_x_at 2.278581 up Hs.620180 Transcribed locus 244434_at 2.0592644 up Hs.567457 Transcribed locus 244665_at 2.61225 up Hs.668855 Transcribed locus 1553043_a_at 2.9935308 up Hs.567706 CD300LF CD300 molecule-like family member f 1554240_a_at 2.4719732 up Hs.174103 ITGAL integrin, alpha L (antigen CD11A (p180), lymphocyte function-
associated antigen 1; alpha polypeptide) 1555137_a_at 2.1388674 up Hs.506381 FGD6 FYVE, RhoGEF and PH domain containing 6 1555431_a_at 2.369251 up Hs.55378 IL31RA interleukin 31 receptor A 1555680_a_at 3.22602 up Hs.433337 SMOX spermine oxidase 1555728_a_at 3.1336443 up Hs.325960 MS4A4A membrane-spanning 4-domains, subfamily A, member 4 1555875_at 2.0978556 up Hs.210751 Homo sapiens, clone IMAGE:3604678, mRNA 1563745_a_at 3.7158568 up Hs.309176 LOC28305
0 hypothetical LOC283050
1556698_a_at 2.4326565 up Hs.605082 GPRIN3 GPRIN family member 3 1557051_s_at 2.0846317 up Hs.445239 CDNA FLJ12777 fis, clone NT2RP2001720 1557545_s_at 2.8805594 up Hs.501114 RNF165 ring finger protein 165 1559214_at 2.42021 up Hs.238914 MRNA full length insert cDNA clone EUROIMAGE 839551 1559391_s_at 2.3651621 up Hs.667269 Partial mRNA; ID EE2-8E 1559883_s_at 2.4473035 up Hs.580681 SAMHD1 SAM domain and HD domain 1 1562255_at 2.885095 up Hs.436977 SYTL3 synaptotagmin-like 3 1568619_s_at 2.378154 up Hs.648523 LOC16207
3 hypothetical protein LOC162073
1569129_s_at 2.0053325 up Hs.476944 Transcribed locus 1569157_s_at 2.0833037 up Hs.665717 LOC16299
3 hypothetical protein LOC162993
1570375_at 2.2113552 up Hs.661265 CDNA FLJ41985 fis, clone SPLEN2014946
288
Table A3.5: Retinoid responsive gene targets in control GFP cells
Probe Set ID Fold change
([GRA] vs [G]) Regulation([G
RA] vs [G]) Unigene (Avadis)
Gene Symbol Gene Title
201565_s_at 3.19715 down Hs.180919 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
201566_x_at 3.0895824 down Hs.180919 ID2 inhibitor of DNA binding 2, dominant negative helix-loop-helix protein
201626_at 2.2383513 down Hs.520819 INSIG1 insulin induced gene 1 201627_s_at 2.23358 down Hs.520819 INSIG1 insulin induced gene 1 202431_s_at 5.3314357 down Hs.202453 MYC v-myc myelocytomatosis viral oncogene homolog (avian) 202760_s_at 2.2443905 down Hs.591908 PALM2-AKAP2 PALM2-AKAP2 203304_at 2.6940384 down Hs.533336 BAMBI BMP and activin membrane-bound inhibitor homolog
(Xenopus laevis) 203604_at 2.0618768 down Hs.709890 ZNF516 zinc finger protein 516 204072_s_at 2.1826165 down Hs.591225 FRY furry homolog (Drosophila) 204249_s_at 2.0089493 down Hs.34560 LMO2 LIM domain only 2 (rhombotin-like 1) 204352_at 2.1479347 down Hs.523930 TRAF5 TNF receptor-associated factor 5 204794_at 2.2907133 down Hs.1183 DUSP2 dual specificity phosphatase 2 204897_at 3.9316552 down Hs.199248 PTGER4 prostaglandin E receptor 4 (subtype EP4) 204900_x_at 2.0170596 down Hs.591715 SAP30 Sin3A-associated protein, 30kDa 205419_at 4.3923125 down Hs.784 EBI2 Epstein-Barr virus induced gene 2 (lymphocyte-specific G
protein-coupled receptor) 206157_at 3.9286077 down Hs.591286 PTX3 pentraxin-related gene, rapidly induced by IL-1 beta 206170_at 2.8135798 down Hs.591251 ADRB2 adrenergic, beta-2-, receptor, surface 206653_at 2.602806 down Hs.282387 POLR3G polymerase (RNA) III (DNA directed) polypeptide G (32kD) 206943_at 3.033631 down Hs.494622 TGFBR1 transforming growth factor, beta receptor I (activin A receptor
type II-like kinase, 53kDa) 208056_s_at 2.3279235 down Hs.513811 CBFA2T3 core-binding factor, runt domain, alpha subunit 2; translocated
to, 3 209098_s_at 2.0579336 down Hs.224012 JAG1 jagged 1 (Alagille syndrome)
289
209099_x_at 2.6896167 down Hs.224012 JAG1 jagged 1 (Alagille syndrome) 209184_s_at 2.6711507 down Hs.442344 IRS2 insulin receptor substrate 2 209185_s_at 2.7987473 down Hs.442344 IRS2 insulin receptor substrate 2 209433_s_at 2.06024 down Hs.331420 PPAT phosphoribosyl pyrophosphate amidotransferase 209606_at 2.0527284 down Hs.270 PSCDBP pleckstrin homology, Sec7 and coiled-coil domains, binding
protein 209750_at 2.1113086 down Hs.37288 NR1D2 nuclear receptor subfamily 1, group D, member 2 209803_s_at 2.7973564 down Hs.154036 PHLDA2 pleckstrin homology-like domain, family A, member 2 210347_s_at 2.4175909 down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 212875_s_at 2.0140817 down Hs.473894 C2CD2 C2 calcium-dependent domain containing 2 213005_s_at 2.1896367 down Hs.306764 KANK1 KN motif and ankyrin repeat domains 1 213478_at 2.0669103 down Hs.368823 RP1-21O18.1 kazrin 213931_at 3.1132224 down Hs.591670 ID2 /// ID2B inhibitor of DNA binding 2, dominant negative helix-loop-
helix protein /// inhibitor of DNA binding 2B, dominant negative helix-loop-helix protein
214321_at 2.3082538 down Hs.235935 NOV nephroblastoma overexpressed gene 215723_s_at 2.1080801 down Hs.382865 PLD1 phospholipase D1, phosphatidylcholine-specific 216012_at 3.1767006 down Hs.550193 Unidentified mRNA, partial sequence 216211_at 2.2012672 down Hs.659130 MRNA; cDNA DKFZp564A023 (from clone
DKFZp564A023) 216252_x_at 2.0069475 down Hs.244139 FAS Fas (TNF receptor superfamily, member 6) 216268_s_at 2.9269807 down Hs.224012 JAG1 jagged 1 (Alagille syndrome) 216598_s_at 2.0723991 down Hs.303649 CCL2 chemokine (C-C motif) ligand 2 216620_s_at 2.023201 down Hs.98594 ARHGEF10 Rho guanine nucleotide exchange factor (GEF) 10 217647_at 2.0704885 down Hs.660660 CDNA FLJ40920 fis, clone UTERU2005905 218331_s_at 2.0102592 down Hs.699500 C10orf18 chromosome 10 open reading frame 18 218618_s_at 2.0625687 down Hs.159430 FNDC3B fibronectin type III domain containing 3B 219334_s_at 2.2212722 down Hs.591610 OBFC2A oligonucleotide/oligosaccharide-binding fold containing 2A 219497_s_at 5.669927 down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 219498_s_at 4.8316703 down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 219697_at 2.1828601 down Hs.622536 HS3ST2 heparan sulfate (glucosamine) 3-O-sulfotransferase 2 219890_at 3.1078908 down Hs.446235 CLEC5A C-type lectin domain family 5, member A
290
220116_at 5.6960754 down Hs.98280 KCNN2 potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2
220459_at 2.20579 down Hs.709346 MCM3APAS minichromosome maintenance complex component 3 associated protein antisense
221586_s_at 3.1761389 down Hs.445758 E2F5 E2F transcription factor 5, p130-binding 221766_s_at 3.5650196 down Hs.10784 FAM46A family with sequence similarity 46, member A 221778_at 2.3323536 down Hs.308710 JHDM1D jumonji C domain containing histone demethylase 1 homolog
D (S. cerevisiae) 221841_s_at 2.3568435 down Hs.376206 KLF4 Kruppel-like factor 4 (gut) 222071_s_at 2.139667 down Hs.709540 SLCO4C1 solute carrier organic anion transporter family, member 4C1 222322_at 2.6270673 down Hs.661379 Transcribed locus 222668_at 2.0507164 down Hs.221873 KCTD15 potassium channel tetramerisation domain containing 15 222692_s_at 2.0523262 down Hs.159430 FNDC3B fibronectin type III domain containing 3B 222872_x_at 2.4523625 down Hs.591610 OBFC2A oligonucleotide/oligosaccharide-binding fold containing 2A 222891_s_at 7.0744944 down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 223397_s_at 2.0809543 down Hs.585728 NIP7 nuclear import 7 homolog (S. cerevisiae) 223403_s_at 2.1982484 down Hs.86337 POLR1B polymerase (RNA) I polypeptide B, 128kDa 223503_at 2.1618946 down Hs.369471 TMEM163 transmembrane protein 163 224793_s_at 2.6721416 down Hs.494622 TGFBR1 transforming growth factor, beta receptor I (activin A receptor
type II-like kinase, 53kDa) 224973_at 3.877564 down Hs.10784 FAM46A family with sequence similarity 46, member A 225032_at 2.0762935 down Hs.159430 FNDC3B fibronectin type III domain containing 3B 225974_at 2.6766124 down Hs.567759 TMEM64 transmembrane protein 64 226350_at 2.055385 down Hs.654545 CHML choroideremia-like (Rab escort protein 2) 226360_at 2.0352998 down Hs.655242 ZNRF3 zinc and ring finger 3 227037_at 2.7701855 down Hs.31652 LOC201164 similar to CG12314 gene product 227210_at 2.4669845 down Hs.407983 SFMBT2 Scm-like with four mbt domains 2 227242_s_at 2.012063 down Hs.699395 EBF3 early B-cell factor 3 227354_at 2.0498126 down Hs.266175 PAG1 phosphoprotein associated with glycosphingolipid
microdomains 1 227481_at 2.2259252 down Hs.16064 CNKSR3 CNKSR family member 3 228170_at 2.047523 down Hs.56663 OLIG1 oligodendrocyte transcription factor 1
291
228176_at 2.069586 down Hs.585118 S1PR3 sphingosine-1-phosphate receptor 3 228333_at 2.0105028 down Hs.621487 Full length insert cDNA clone YT94E02 229307_at 2.0694149 down Hs.335239 ANKRD28 ankyrin repeat domain 28 229638_at 3.289962 down Hs.499205 IRX3 iroquois homeobox 3 229686_at 2.112692 down Hs.111377 P2RY8 purinergic receptor P2Y, G-protein coupled, 8 229723_at 2.766404 down Hs.529984 TAGAP T-cell activation RhoGTPase activating protein 231310_at 2.0057406 down Hs.113170 Transcribed locus 231798_at 2.3127465 down Hs.248201 NOG noggin 232291_at 2.6771522 down Hs.24115 MIRHG1 microRNA host gene (non-protein coding) 1 232530_at 2.0205226 down Hs.382865 PLD1 phospholipase D1, phosphatidylcholine-specific 232629_at 2.1365838 down Hs.528665 PROK2 prokineticin 2 232778_at 2.005665 down Hs.640558 CDNA: FLJ22383 fis, clone HRC07564 232958_at 2.397218 down Hs.660361 CDNA FLJ13595 fis, clone PLACE1009595 233085_s_at 2.4954445 down Hs.591610 OBFC2A oligonucleotide/oligosaccharide-binding fold containing 2A 235359_at 2.527995 down Hs.709536 LRRC33 leucine rich repeat containing 33 236561_at 4.1622524 down Hs.494622 TGFBR1 Transforming growth factor, beta receptor I (activin A receptor
type II-like kinase, 53kDa) 236738_at 5.442677 down Hs.710781 LOC401097 Similar to LOC166075 239129_at 3.6913147 down 239296_at 2.335155 down Hs.672093 Transcribed locus 239605_x_at 3.0961626 down Hs.657657 Transcribed locus 239911_at 2.007892 down Hs.194725 ONECUT2 one cut homeobox 2 240008_at 2.01395 down Hs.656290 Transcribed locus 240452_at 2.5822086 down Hs.528780 GSPT1 G1 to S phase transition 1 240747_at 2.4500487 down Hs.667630 Transcribed locus 241716_at 2.1328788 down HSPD1 heat shock 60kDa protein 1 (chaperonin) 242245_at 2.069497 down Hs.533853 CDNA FLJ90705 fis, clone PLACE1007591 242388_x_at 2.634984 down Hs.601883 Transcribed locus 242550_at 2.1002643 down Hs.371001 EIF3B eukaryotic translation initiation factor 3, subunit B 242905_at 2.5441372 down Hs.262858 PNO1 partner of NOB1 homolog (S. cerevisiae) 243088_at 2.0176904 down
292
243529_at 2.085383 down Hs.116602 MARS2 methionyl-tRNA synthetase 2, mitochondrial 244022_at 2.4184115 down 244165_at 2.3861125 down Hs.699500 C10orf18 chromosome 10 open reading frame 18 244267_at 2.1750958 down Hs.674678 Transcribed locus 1552626_a_at 2.23773 down Hs.369471 TMEM163 transmembrane protein 163 1557360_at 2.2121725 down Hs.368084 LRPPRC leucine-rich PPR-motif containing 1558111_at 2.0698903 down Hs.478000 MBNL1 muscleblind-like (Drosophila) 1559078_at 3.2942047 down Hs.370549 BCL11A B-cell CLL/lymphoma 11A (zinc finger protein) 1561017_at 2.305915 down Hs.684677 Full length insert cDNA clone YW28G08 1566482_at 2.3295524 down Hs.684006 Transcribed locus 200632_s_at 2.2249727 up Hs.372914 NDRG1 N-myc downstream regulated gene 1 200897_s_at 13.084492 up Hs.151220 PALLD palladin, cytoskeletal associated protein 200906_s_at 4.925171 up Hs.151220 PALLD palladin, cytoskeletal associated protein 200907_s_at 8.944003 up Hs.151220 PALLD palladin, cytoskeletal associated protein 201042_at 2.6494477 up Hs.517033 TGM2 transglutaminase 2 (C polypeptide, protein-glutamine-gamma-
glutamyltransferase) 201534_s_at 2.166673 up Hs.145575 UBL3 ubiquitin-like 3 201631_s_at 3.5161445 up Hs.591785 IER3 immediate early response 3 201656_at 4.4946804 up Hs.133397 ITGA6 integrin, alpha 6 201925_s_at 2.3021228 up Hs.527653 CD55 CD55 molecule, decay accelerating factor for complement
(Cromer blood group) 201963_at 2.0353825 up Hs.406678 ACSL1 acyl-CoA synthetase long-chain family member 1 202241_at 3.248599 up Hs.444947 TRIB1 tribbles homolog 1 (Drosophila) 202284_s_at 2.624664 up Hs.370771 CDKN1A cyclin-dependent kinase inhibitor 1A (p21, Cip1) 202308_at 2.7079668 up Hs.592123 SREBF1 sterol regulatory element binding transcription factor 1 202481_at 6.214064 up Hs.289347 DHRS3 dehydrogenase/reductase (SDR family) member 3 202531_at 2.2103148 up Hs.436061 IRF1 interferon regulatory factor 1 202625_at 2.0354729 up Hs.699154 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 202626_s_at 2.0061784 up Hs.699154 LYN v-yes-1 Yamaguchi sarcoma viral related oncogene homolog 202627_s_at 2.331629 up Hs.414795 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen
activator inhibitor type 1), member 1 202628_s_at 2.2300718 up Hs.414795 SERPINE1 serpin peptidase inhibitor, clade E (nexin, plasminogen
293
activator inhibitor type 1), member 1 202769_at 2.736456 up Hs.13291 CCNG2 cyclin G2 202770_s_at 2.415966 up Hs.13291 CCNG2 cyclin G2 202869_at 3.5392282 up Hs.524760 OAS1 2',5'-oligoadenylate synthetase 1, 40/46kDa 202877_s_at 2.0917723 up Hs.97199 CD93 CD93 molecule 202887_s_at 21.188093 up Hs.523012 DDIT4 DNA-damage-inducible transcript 4 203020_at 2.2809913 up Hs.585378 RABGAP1L RAB GTPase activating protein 1-like 203139_at 2.2186103 up Hs.380277 DAPK1 death-associated protein kinase 1 203140_at 3.248891 up Hs.478588 BCL6 B-cell CLL/lymphoma 6 (zinc finger protein 51) 203234_at 2.2725453 up Hs.488240 UPP1 uridine phosphorylase 1 203243_s_at 2.3842292 up Hs.480311 PDLIM5 PDZ and LIM domain 5 203610_s_at 2.0810134 up Hs.584851 TRIM38 tripartite motif-containing 38 203708_at 2.0438766 up Hs.198072 PDE4B phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4
dunce homolog, Drosophila) 203760_s_at 8.513409 up Hs.75367 SLA Src-like-adaptor 203761_at 9.117418 up Hs.75367 SLA Src-like-adaptor 203887_s_at 10.292902 up Hs.2030 THBD thrombomodulin 203888_at 7.23664 up Hs.2030 THBD thrombomodulin 204112_s_at 2.616031 up Hs.42151 HNMT histamine N-methyltransferase 204174_at 2.9158792 up Hs.507658 ALOX5AP arachidonate 5-lipoxygenase-activating protein 204429_s_at 4.854275 up Hs.530003 SLC2A5 solute carrier family 2 (facilitated glucose/fructose
transporter), member 5 204430_s_at 5.3099704 up Hs.530003 SLC2A5 solute carrier family 2 (facilitated glucose/fructose
transporter), member 5 204526_s_at 2.2889469 up Hs.442657 TBC1D8 TBC1 domain family, member 8 (with GRAM domain) 204961_s_at 7.9495873 up Hs.655201 LOC648998 ///
NCF1 /// NCF1B /// NCF1C
similar to Neutrophil cytosol factor 1 (NCF-1) (Neutrophil NADPH oxidase factor 1) (47 kDa neutrophil oxidase factor) (p47-phox) (NCF-47K) (47 kDa autosomal chronic granulomatous disease protein) (NOXO2) /// neutrophil cytosolic factor 1, (chronic granulomatous disease, autosomal 1) /// neutrophil cytosolic factor 1B pseudogene /// neutrophil cytosolic factor 1C pseudogene
205016_at 2.8710318 up Hs.170009 TGFA transforming growth factor, alpha
294
205027_s_at 2.1963835 up Hs.432453 MAP3K8 mitogen-activated protein kinase kinase kinase 8 205098_at 2.5826116 up Hs.301921 CCR1 chemokine (C-C motif) receptor 1 205099_s_at 2.985556 up Hs.301921 CCR1 chemokine (C-C motif) receptor 1 205232_s_at 2.3107233 up Hs.477083 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 205233_s_at 2.090216 up Hs.477083 PAFAH2 platelet-activating factor acetylhydrolase 2, 40kDa 205476_at 2.2917933 up Hs.75498 CCL20 chemokine (C-C motif) ligand 20 205552_s_at 4.7276044 up Hs.524760 OAS1 2',5'-oligoadenylate synthetase 1, 40/46kDa 205692_s_at 5.302119 up Hs.479214 CD38 CD38 molecule 205749_at 3.4297204 up Hs.72912 CYP1A1 cytochrome P450, family 1, subfamily A, polypeptide 1 205780_at 3.5613263 up Hs.475055 BIK BCL2-interacting killer (apoptosis-inducing) 205786_s_at 2.105782 up Hs.172631 ITGAM integrin, alpha M (complement component 3 receptor 3
subunit) 205789_at 7.72333 up Hs.1799 CD1D CD1d molecule 205936_s_at 2.2207468 up Hs.411695 HK3 hexokinase 3 (white cell) 206028_s_at 5.010604 up Hs.306178 MERTK c-mer proto-oncogene tyrosine kinase 206126_at 4.1539598 up Hs.113916 CXCR5 chemokine (C-X-C motif) receptor 5 206369_s_at 5.1270146 up Hs.32942 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 206370_at 4.6538563 up Hs.32942 PIK3CG phosphoinositide-3-kinase, catalytic, gamma polypeptide 206472_s_at 3.4782596 up Hs.709205 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog,
Drosophila) 206515_at 2.0734613 up Hs.106242 CYP4F3 cytochrome P450, family 4, subfamily F, polypeptide 3 206907_at 2.24218 up Hs.1524 TNFSF9 tumor necrosis factor (ligand) superfamily, member 9 207629_s_at 2.53102 up Hs.655209 ARHGEF2 rho/rac guanine nucleotide exchange factor (GEF) 2 207700_s_at 2.4438972 up Hs.697989 NCOA3 nuclear receptor coactivator 3 208018_s_at 2.32956 up Hs.655210 HCK hemopoietic cell kinase 208438_s_at 7.8384876 up Hs.1422 FGR Gardner-Rasheed feline sarcoma viral (v-fgr) oncogene
homolog 208514_at 2.6290407 up Hs.121495 KCNE1 potassium voltage-gated channel, Isk-related family, member 1 208608_s_at 2.0687091 up Hs.655236 SNTB1 syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa,
basic component 1) 208614_s_at 2.1080954 up Hs.476448 FLNB filamin B, beta (actin binding protein 278) 208763_s_at 2.092471 up Hs.522074 TSC22D3 TSC22 domain family, member 3
295
208891_at 2.00577 up Hs.298654 DUSP6 dual specificity phosphatase 6 208937_s_at 26.153513 up Hs.504609 ID1 inhibitor of DNA binding 1, dominant negative helix-loop-
helix protein 209060_x_at 2.198667 up Hs.697989 NCOA3 nuclear receptor coactivator 3 209061_at 2.0107043 up Hs.697989 NCOA3 nuclear receptor coactivator 3 209355_s_at 2.405811 up Hs.405156 PPAP2B phosphatidic acid phosphatase type 2B 209392_at 5.194882 up Hs.190977 ENPP2 ectonucleotide pyrophosphatase/phosphodiesterase 2
(autotaxin) 209435_s_at 2.4413347 up Hs.655209 ARHGEF2 rho/rac guanine nucleotide exchange factor (GEF) 2 209498_at 2.4864943 up Hs.512682 CEACAM1 carcinoembryonic antigen-related cell adhesion molecule 1
(biliary glycoprotein) 209593_s_at 2.6336179 up Hs.252682 TOR1B torsin family 1, member B (torsin B) 209930_s_at 2.3035018 up Hs.75643 NFE2 nuclear factor (erythroid-derived 2), 45kDa 209955_s_at 2.3653529 up Hs.654370 FAP fibroblast activation protein, alpha 209993_at 2.184716 up Hs.489033 ABCB1 ATP-binding cassette, sub-family B (MDR/TAP), member 1 210002_at 2.236731 up Hs.514746 GATA6 GATA binding protein 6 210004_at 3.3632 up Hs.412484 OLR1 oxidized low density lipoprotein (lectin-like) receptor 1 210146_x_at 2.7182057 up Hs.655652 LILRB2 leukocyte immunoglobulin-like receptor, subfamily B (with
TM and ITIM domains), member 2 210264_at 3.1211681 up Hs.239891 GPR35 G protein-coupled receptor 35 210357_s_at 5.933463 up Hs.433337 SMOX spermine oxidase 210367_s_at 2.0101428 up Hs.146688 PTGES prostaglandin E synthase 211026_s_at 3.044924 up Hs.277035 MGLL monoglyceride lipase 211192_s_at 2.0021026 up Hs.398093 CD84 CD84 molecule 211352_s_at 2.2821076 up Hs.697989 NCOA3 nuclear receptor coactivator 3 211559_s_at 2.1989374 up Hs.13291 CCNG2 cyclin G2 211913_s_at 4.0624857 up Hs.306178 MERTK c-mer proto-oncogene tyrosine kinase 212226_s_at 2.6206923 up Hs.405156 PPAP2B phosphatidic acid phosphatase type 2B 212230_at 2.7832167 up Hs.708050 PPAP2B phosphatidic acid phosphatase type 2B 212423_at 2.0793097 up Hs.523080 C10orf56 chromosome 10 open reading frame 56 212501_at 3.7421806 up Hs.517106 CEBPB CCAAT/enhancer binding protein (C/EBP), beta 212769_at 3.719843 up Hs.709205 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog,
296
Drosophila) 212770_at 3.0558388 up Hs.709205 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog,
Drosophila) 214084_x_at 8.358969 up LOC648998 similar to Neutrophil cytosol factor 1 (NCF-1) (Neutrophil
NADPH oxidase factor 1) (47 kDa neutrophil oxidase factor) (p47-phox) (NCF-47K) (47 kDa autosomal chronic granulomatous disease protein) (NOXO2)
214523_at 4.19656 up Hs.558308 CEBPE CCAAT/enhancer binding protein (C/EBP), epsilon 214639_s_at 2.718203 up Hs.67397 HOXA1 homeobox A1 214708_at 2.0389485 up Hs.655236 SNTB1 syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa,
basic component 1) 214977_at 3.1757998 up Hs.654670 CDNA FLJ13790 fis, clone THYRO1000026 215177_s_at 5.242455 up Hs.133397 ITGA6 integrin, alpha 6 215342_s_at 3.401339 up Hs.585378 RABGAP1L RAB GTPase activating protein 1-like 217997_at 2.2053015 up Hs.602085 PHLDA1 pleckstrin homology-like domain, family A, member 1 218284_at 2.2188303 up Hs.618504 SMAD3 SMAD family member 3 218501_at 9.380894 up Hs.476402 ARHGEF3 Rho guanine nucleotide exchange factor (GEF) 3 218559_s_at 3.3078525 up Hs.712609 MAFB v-maf musculoaponeurotic fibrosarcoma oncogene homolog B
(avian) 218627_at 2.7044392 up Hs.525634 DRAM damage-regulated autophagy modulator 218723_s_at 2.6658025 up Hs.507866 C13orf15 chromosome 13 open reading frame 15 219010_at 5.1608343 up Hs.518997 C1orf106 chromosome 1 open reading frame 106 219607_s_at 16.446184 up Hs.325960 MS4A4A membrane-spanning 4-domains, subfamily A, member 4 219777_at 2.1516159 up Hs.647105 GIMAP6 GTPase, IMAP family member 6 219994_at 2.9461663 up Hs.310421 APBB1IP amyloid beta (A4) precursor protein-binding, family B,
member 1 interacting protein 220005_at 7.095176 up Hs.546396 P2RY13 purinergic receptor P2Y, G-protein coupled, 13 220331_at 2.0530155 up Hs.25121 CYP46A1 cytochrome P450, family 46, subfamily A, polypeptide 1 220507_s_at 2.195543 up Hs.474388 UPB1 ureidopropionase, beta 221249_s_at 2.186694 up Hs.514308 FAM117A family with sequence similarity 117, member A 221266_s_at 3.4274688 up Hs.652230 TM7SF4 transmembrane 7 superfamily member 4 221345_at 6.744044 up Hs.248056 FFAR2 free fatty acid receptor 2
297
221484_at 2.075831 up Hs.370487 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
221485_at 2.1110754 up Hs.370487 B4GALT5 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5
221561_at 2.6904418 up Hs.496383 SOAT1 sterol O-acyltransferase (acyl-Coenzyme A: cholesterol acyltransferase) 1
221601_s_at 3.567575 up Hs.58831 FAIM3 Fas apoptotic inhibitory molecule 3 221602_s_at 2.992049 up Hs.58831 FAIM3 Fas apoptotic inhibitory molecule 3 31845_at 2.0390604 up Hs.271940 ELF4 E74-like factor 4 (ets domain transcription factor) 36711_at 6.898643 up Hs.517617 MAFF v-maf musculoaponeurotic fibrosarcoma oncogene homolog F
(avian) 37152_at 2.1214638 up Hs.696032 PPARD peroxisome proliferator-activated receptor delta 222496_s_at 2.0052018 up Hs.518727 RBM47 RNA binding motif protein 47 223276_at 4.3521748 up Hs.29444 MST150 MSTP150 223567_at 6.3490977 up Hs.465642 SEMA6B sema domain, transmembrane domain (TM), and cytoplasmic
domain, (semaphorin) 6B 223620_at 3.3700576 up Hs.495989 GPR34 G protein-coupled receptor 34 223634_at 2.6509604 up Hs.474711 RASD2 RASD family, member 2 224048_at 2.2545755 up Hs.646421 USP44 ubiquitin specific peptidase 44 224916_at 2.9386487 up Hs.379754 TMEM173 transmembrane protein 173 224929_at 2.826263 up Hs.379754 TMEM173 transmembrane protein 173 224964_s_at 4.401167 up Hs.187772 GNG2 guanine nucleotide binding protein (G protein), gamma 2 225102_at 3.0217226 up Hs.277035 MGLL monoglyceride lipase 225347_at 4.439735 up Hs.497399 ARL8A ADP-ribosylation factor-like 8A 225372_at 5.093642 up Hs.47382 C10orf54 chromosome 10 open reading frame 54 225373_at 3.0249772 up Hs.47382 C10orf54 chromosome 10 open reading frame 54 225763_at 3.3711896 up Hs.493867 RCSD1 RCSD domain containing 1 225919_s_at 2.1912513 up Hs.493639 C9orf72 chromosome 9 open reading frame 72 226184_at 2.1509264 up Hs.654630 FMNL2 formin-like 2 226487_at 3.614415 up Hs.661785 C12orf34 chromosome 12 open reading frame 34 226722_at 2.898792 up Hs.134742 FAM20C family with sequence similarity 20, member C 226756_at 3.2073371 up Hs.633903 CDNA FLJ25556 fis, clone JTH02629
298
226855_at 2.2713258 up Hs.632214 CDNA FLJ40954 fis, clone UTERU2010525 227290_at 2.108611 up Hs.60257 CDNA FLJ13598 fis, clone PLACE1009921 227396_at 2.0542467 up Hs.318547 PTPRJ protein tyrosine phosphatase, receptor type, J 227484_at 2.6185803 up Hs.710097 CDNA FLJ41690 fis, clone HCASM2009405 227792_at 3.046168 up Hs.648523 LOC162073 hypothetical protein LOC162073 227915_at 3.4160256 up Hs.510327 ASB2 ankyrin repeat and SOCS box-containing 2 228055_at 3.244248 up Hs.636624 NAPSB napsin B aspartic peptidase pseudogene 228056_s_at 2.75491 up Hs.636624 NAPSB napsin B aspartic peptidase pseudogene 228083_at 2.5030475 up Hs.13768 CACNA2D4 calcium channel, voltage-dependent, alpha 2/delta subunit 4 228120_at 3.458878 up Hs.656677 CDNA: FLJ22073 fis, clone HEP11868 228320_x_at 2.1715071 up Hs.369763 CCDC64 coiled-coil domain containing 64 228340_at 3.3133652 up Hs.709205 TLE3 transducin-like enhancer of split 3 (E(sp1) homolog,
Drosophila) 228361_at 2.0575192 up Hs.194333 E2F2 E2F transcription factor 2 228439_at 2.1450005 up Hs.124840 BATF2 basic leucine zipper transcription factor, ATF-like 2 228461_at 2.023712 up Hs.535157 SH3MD4 SH3 multiple domains 4 228479_at 2.0592828 up Hs.445588 Transcribed locus 228642_at 2.1591246 up Hs.445239 CDNA FLJ12777 fis, clone NT2RP2001720 228648_at 5.1974597 up Hs.655559 LRG1 leucine-rich alpha-2-glycoprotein 1 228772_at 2.7277112 up Hs.42151 HNMT histamine N-methyltransferase 228964_at 2.4908414 up Hs.436023 PRDM1 PR domain containing 1, with ZNF domain 229521_at 2.2940986 up Hs.29692 FLJ36031 hypothetical protein FLJ36031 229670_at 5.11233 up Hs.180284 5.5 kb mRNA upregulated in retinoic acid treated HL-60
neutrophilic cells 229934_at 2.499428 up Hs.38218 Mir-223 transcript variant 1 mRNA, complete sequence 229971_at 2.8952053 up Hs.187884 GPR114 G protein-coupled receptor 114 230218_at 6.501 up Hs.72956 HIC1 hypermethylated in cancer 1 230333_at 3.0846827 up Hs.656630 Transcribed locus 230391_at 2.5469894 up Hs.439064 Transcribed locus 230925_at 3.376848 up Hs.310421 APBB1IP amyloid beta (A4) precursor protein-binding, family B,
member 1 interacting protein 230966_at 2.0041862 up IL4I1 interleukin 4 induced 1
299
231214_at 2.4020123 up Hs.21278 Transcribed locus 231496_at 3.0144367 up Hs.145519 FCAMR Fc receptor, IgA, IgM, high affinity 231779_at 3.3791144 up Hs.449207 IRAK2 interleukin-1 receptor-associated kinase 2 231969_at 2.0790067 up Hs.21958 STOX2 storkhead box 2 232687_at 2.5030003 up Hs.100912 CDNA FLJ33091 fis, clone TRACH2000660 232861_at 2.6882606 up Hs.654693 PDP2 pyruvate dehydrogenase phosphatase isoenzyme 2 233857_s_at 3.7193377 up Hs.510327 ASB2 ankyrin repeat and SOCS box-containing 2 234643_x_at 2.1369362 up Hs.612905 CDNA: FLJ21798 fis, clone HEP00573 234987_at 3.4757702 up Hs.660221 Transcribed locus 235352_at 2.266094 up Hs.13500 CDNA FLJ31593 fis, clone NT2RI2002481 235360_at 2.3207605 up LOC100131989 hypothetical LOC100131989 235421_at 2.6853423 up Hs.432453///
Hs.663033 MAP3K8 Mitogen-activated protein kinase kinase kinase 8 /// CDNA
clone IMAGE:4689481 235529_x_at 2.3057177 up Hs.660221 Transcribed locus 235964_x_at 2.5259798 up Hs.660221 Transcribed locus 236191_at 11.936588 up Hs.667427 Transcribed locus 236407_at 10.117586 up Hs.121495 KCNE1 potassium voltage-gated channel, Isk-related family, member 1 236646_at 2.4213948 up Hs.226422 C12orf59 chromosome 12 open reading frame 59 236717_at 3.0867143 up Hs.525977 LOC165186 similar to RIKEN cDNA 4632412N22 gene 237201_at 2.1277235 up Hs.10305 Transcribed locus 237252_at 5.575421 up Hs.2030 THBD thrombomodulin 237442_at 2.4092128 up 237458_at 2.5117145 up Hs.547058 Transcribed locus 238032_at 4.0849333 up Hs.655631 Transcribed locus 238439_at 4.4300766 up Hs.217484 ANKRD22 ankyrin repeat domain 22 238669_at 2.2470448 up Hs.201978 PTGS1 prostaglandin-endoperoxide synthase 1 (prostaglandin G/H
synthase and cyclooxygenase) 239196_at 2.0093157 up Hs.217484 ANKRD22 ankyrin repeat domain 22 239294_at 4.7089114 up Hs.561747 Transcribed locus 239328_at 2.1184776 up Hs.668429 CDNA FLJ35362 fis, clone SKMUS2000330 239448_at 2.04081 up Hs.658524 Transcribed locus
300
240173_at 2.0289366 up Hs.602127 Transcribed locus 240481_at 2.7046072 up Hs.673398 Transcribed locus 240991_at 2.360695 up Hs.660557 Transcribed locus 241929_at 2.690208 up Hs.656268 Transcribed locus 242426_at 2.4238043 up Hs.696574 NRG4 neuregulin 4 242525_at 4.2519603 up Hs.439122 Transcribed locus 243541_at 3.6648195 up Hs.55378 IL31RA interleukin 31 receptor A 243819_at 2.472962 up 244665_at 5.22692 up Hs.668855 Transcribed locus 244764_at 2.9311552 up Hs.648369 HIVEP3 Human immunodeficiency virus type I enhancer binding
protein 3 1552553_a_at 2.6524854 up Hs.574741 NLRC4 NLR family, CARD domain containing 4 1552690_a_at 2.105542 up Hs.13768 CACNA2D4 calcium channel, voltage-dependent, alpha 2/delta subunit 4 1553740_a_at 2.2439284 up Hs.449207 IRAK2 interleukin-1 receptor-associated kinase 2 1554240_a_at 2.2535973 up Hs.174103 ITGAL integrin, alpha L (antigen CD11A (p180), lymphocyte
function-associated antigen 1; alpha polypeptide) 1554783_s_at 2.046973 up Hs.655209 ARHGEF2 rho/rac guanine nucleotide exchange factor (GEF) 2 1555420_a_at 2.1541228 up Hs.471221 KLF7 Kruppel-like factor 7 (ubiquitous) 1555431_a_at 4.66268 up Hs.55378 IL31RA interleukin 31 receptor A 1555680_a_at 4.149489 up Hs.433337 SMOX spermine oxidase 1555728_a_at 11.893831 up Hs.325960 MS4A4A membrane-spanning 4-domains, subfamily A, member 4 1563745_a_at 4.603027 up Hs.309176 LOC283050 hypothetical LOC283050 1556698_a_at 2.9657874 up Hs.605082 GPRIN3 GPRIN family member 3 1557051_s_at 2.2071733 up Hs.445239 CDNA FLJ12777 fis, clone NT2RP2001720 1559391_s_at 2.1286786 up Hs.667269 Partial mRNA; ID EE2-8E 1559584_a_at 2.1855097 up Hs.331095 C16orf54 ///
hCG_1644884 chromosome 16 open reading frame 54 /// similar to chromosome 16 open reading frame 54
1559882_at 2.0875654 up Hs.580681 SAMHD1 SAM domain and HD domain 1 1559883_s_at 2.4523852 up Hs.580681 SAMHD1 SAM domain and HD domain 1 1568619_s_at 3.5348852 up Hs.648523 LOC162073 hypothetical protein LOC162073 1569942_at 5.638706 up Hs.385753 CDNA clone IMAGE:4796629 1570375_at 3.925189 up Hs.661265 CDNA FLJ41985 fis, clone SPLEN2014946
301
Appendix II: Characterization of in vitro cell line models of APL
In order to assess the downstream genetic targets of the variant APL fusions NPM-, and
NuMA-RARα, we utilized the pro-monocytic U937 cell line retrovirally transduced with
NuMA-RARA or NPM-RARA (Kamel-Reid et al., 2003). All U937-X-RARA lines were
tested to confirm mRNA and protein expression of X-RARA. The highest expressing
clones were selected for the experiments outlined in this thesis (Figure AII.1 A). GFP
positivity in cells was assessed by flow cytometry and used as a surrogate marker for
ensuring fusion expression in the majority of cells (Figure AII.1 B). Flow cytometry
profiling of control and fusion-expressing cells showed that the presence of the NPM-
RARA and NuMA-RARA did not have any significant effect on cellular
immunophenotype. Cells were positive for the myeloid marker CD11b, leukocyte marker
CD45, and moderately positive for the stem cell marker CD117 (Figure AII.1 C).
Response to All Trans Retinoic Acid (ATRA).
In order to establish the validity of all lines as APL model systems, we tested their ability
to undergo differentiation in response to pharmacological concentrations (1 µM) of
ATRA. Differentiation was assessed by flow cytometry using the myeloid differentiation
marker CD11b, after treatment with 1 µM ATRA in culture for 0-96 hrs. Like control
U937 cells, NPM-RARA and NuMA-RARA expressing U937 cells responded to ATRA
with induction of CD11b expression (Figure AII.1 D). ATRA response was also assessed
all cell lines at the transcriptional level, using gene expression changes in the ATRA
responsive maker C/EBPε. The earliest transcriptional changes in response to ATRA
were observed 4 hours post-treatment with a significant induction of C/EBPε expression
in all cell lines (Figure AII.1 E). This time point was used for subsequent examination of
ATRA-induced early global gene expression changes in APL cell lines (Chapter 3).
Our work has also made use of cells derived from a transgenic mouse model of APL
expressing the NuMA-RARA fusion under the control of the human cathepsin G
promoter (hCG-NuMA-RARA). This model was characterized in Sukhai et al 2004, and
bears similarities to the diasease phenotype evident in human APL patients. Mice had
302
increased granulopoesis in the bone marrow and accumulation of promyelocytes,
characteristic of impaired neutrophil differentiation.
303
Figure AII.1: Characterization of X-RARA Cell Line s.
A) Western blot indicating expression of NPM-RARA in U937-NPM-RARA cell line
and PML-RARA in the NB4 cell line. Levels of wild type RARA are also indicated
alongside the β-actin control.
B) Expression of the fusion containing construct was confirmed by assessing levels of
GFP positivity by flow cytometry. Cells were harvested and incubated with anti-CD11b,
and analyzed for expression of this myeloid marker along with expression of GFP.
C) U937-control and X-RARA cells were harvested and incubated with fluorescently
conjugated anti-CD11b, CD45, or CD117 antibodies and analyzed by flow cytometry to
confirm immunophenotype profiles after introduction of the fusions.
D) Validation and effects of pharmacological agents in U937-X-RARA cell lines.
Control and X-RARA cells were treated with 1mM ATRA, prior to analysis of CD11b
expression by flow cytometry using fluorescently conjugated CD11b antibodies.
E) Untreated and ATRA treated cells were harvested for RNA analysis at time points 0-
6hrs and expression of ATRA target gene, CEBPε was analyzed by quantitative real time
PCR.
304
Figure AII A-E: Characterization of X-RARA Cell Li nes.
PML-RARA (108kDa)
RARA (51kDa)
NPM-RARA (58kDa)
ββββ−−−−actin(43kDa)
U93
7-G
FP
U93
7-N
PM
-RA
RA
NB
4-P
ML
-RA
RA
A.
305
CD
11b
flu
ore
scen
ce NuMA-RARA
55%
66%
GFP mean fluorescence intensity
NPM-RARA
17%
91%
U937-control
65%
95%
B.
C.
CD11b Mean Fluorescence Intensity
NuMA-RARANPM-RARAU937-control
CD45 Mean Fluorescence Intensity
CD117 Mean Fluorescence Intensity
Cel
l Co
un
t
306
M1
U937
CD11b MFI
Cel
l co
un
tNPM-RARA
M1
UNT RA
NuMA-RARA
M1
UNT RAUNT RA
D.
E.U937-GFPU937-NPM-RARAU937-NuMA-RARA
Hours post ATRA treatment
UNT ATRA UNT ATRA UNT ATRA
307
308
References
Ablain, J., and de The, H. (2011). Revisiting the differentiation paradigm in acute
promyelocytic leukemia. Blood 117, 5795-5802.
Aggarwal, B. B. (2003). Signalling pathways of the TNF superfamily: a double-edged
sword. Nat Rev Immunol 3, 745-756.
Agrawal-Singh, S., Koschmieder, S., Gelsing, S., Stocking, C., Stehling, M., Thiede, C.,
Thoennissen, N. H., Kohler, G., Valk, P. J., Delwel, R., et al. (2011). Pim2 cooperates
with PML-RARalpha to induce acute myeloid leukemia in a bone marrow transplantation
model. Blood 115, 4507-4516.
Agrawal, S., Koschmieder, S., Baumer, N., Reddy, N. G., Berdel, W. E., Muller-Tidow,
C., and Serve, H. (2008). Pim2 complements Flt3 wild-type receptor in hematopoietic
progenitor cell transformation. Leukemia 22, 78-86.
Ahn, J. Y., Liu, X., Cheng, D., Peng, J., Chan, P. K., Wade, P. A., and Ye, K. (2005).
Nucleophosmin/B23, a nuclear PI(3,4,5)P(3) receptor, mediates the antiapoptotic actions
of NGF by inhibiting CAD. Mol Cell 18, 435-445.
Alcalay, M., Tiacci, E., Bergomas, R., Bigerna, B., Venturini, E., Minardi, S. P., Meani,
N., Diverio, D., Bernard, L., Tizzoni, L., et al. (2005). Acute myeloid leukemia bearing
cytoplasmic nucleophosmin (NPMc+ AML) shows a distinct gene expression profile
characterized by up-regulation of genes involved in stem-cell maintenance. Blood 106,
899-902.
Alcalay, M., Zangrilli, D., Pandolfi, P. P., Longo, L., Mencarelli, A., Giacomucci, A.,
Rocchi, M., Biondi, A., Rambaldi, A., Lo Coco, F., and et al. (1991). Translocation
breakpoint of acute promyelocytic leukemia lies within the retinoic acid receptor alpha
locus. Proc Natl Acad Sci U S A 88, 1977-1981.
309
Altucci, L., Leibowitz, M. D., Ogilvie, K. M., de Lera, A. R., and Gronemeyer, H.
(2007). RAR and RXR modulation in cancer and metabolic disease. Nat Rev Drug
Discov 6, 793-810.
Altucci, L., Rossin, A., Hirsch, O., Nebbioso, A., Vitoux, D., Wilhelm, E., Guidez, F., De
Simone, M., Schiavone, E. M., Grimwade, D., et al. (2005). Rexinoid-triggered
differentiation and tumor-selective apoptosis of acute myeloid leukemia by protein kinase
A-mediated desubordination of retinoid X receptor. Cancer Res 65, 8754-8765.
Apicelli, A. J., Maggi, L. B., Jr., Hirbe, A. C., Miceli, A. P., Olanich, M. E., Schulte-
Winkeler, C. L., Saporita, A. J., Kuchenreuther, M., Sanchez, J., Weilbaecher, K., and
Weber, J. D. (2008). A non-tumor suppressor role for basal p19ARF in maintaining
nucleolar structure and function. Mol Cell Biol 28, 1068-1080.
Arnould, C., Philippe, C., Bourdon, V., Gr goire, M. J., Berger, R., and Jonveaux, P.
(1999). The signal transducer and activator of transcription STAT5b gene is a new
partner of retinoic acid receptor alpha in acute promyelocytic-like leukaemia. Hum Mol
Genet 8, 1741-1749.
Ashkenazi, A. (2008). Directing cancer cells to self-destruct with pro-apoptotic receptor
agonists. Nat Rev Drug Discov 7, 1001-1012.
Asou, N., Kishimoto, Y., Kiyoi, H., Okada, M., Kawai, Y., Tsuzuki, M., Horikawa, K.,
Matsuda, M., Shinagawa, K., Kobayashi, T., et al. (2007). A randomized study with or
without intensified maintenance chemotherapy in patients with acute promyelocytic
leukemia who have become negative for PML-RARalpha transcript after consolidation
therapy: the Japan Adult Leukemia Study Group (JALSG) APL97 study. Blood 110, 59-
66.
Baldwin, A. S., Jr. (1996). The NF-kappa B and I kappa B proteins: new discoveries and
insights. Annu Rev Immunol 14, 649-683.
Balusu, R., Fiskus, W., Rao, R., Chong, D. G., Nalluri, S., Mudunuru, U., Ma, H., Chen,
L., Venkannagari, S., Ha, K., et al. Targeting levels or oligomerization of nucleophosmin
310
1 induces differentiation and loss of survival of human AML cells with mutant NPM1.
Blood 118, 3096-3106.
Bartel, D. P. (2004). MicroRNAs: genomics, biogenesis, mechanism, and function. Cell
116, 281-297.
Beck, W. S. (1991). Hematology [print], 5th edn (Cambridge, Mass.: MIT Press).
Benayoun, B. A., Caburet, S., and Veitia, R. A. (2011). Forkhead transcription factors:
key players in health and disease. Trends Genet 27, 224-232.
Benedetti, L., Levin, A. A., Scicchitano, B. M., Grignani, F., Allenby, G., Diverio, D., Lo
Coco, F., Avvisati, G., Ruthardt, M., Adamo, S., et al. (1997). Characterization of the
retinoid binding properties of the major fusion products present in acute promyelocytic
leukemia cells. Blood 90, 1175-1185.
Bennett, J. M., Catovsky, D., Daniel, M. T., Flandrin, G., Galton, D. A., Gralnick, H. R.,
and Sultan, C. (1976). Proposals for the classification of the acute leukaemias. French-
American-British (FAB) co-operative group. Br J Haematol 33, 451-458.
Benoit, G., Altucci, L., Flexor, M., Ruchaud, S., Lillehaug, J., Raffelsberger, W.,
Gronemeyer, H., and Lanotte, M. (1999). RAR-independent RXR signaling induces
t(15;17) leukemia cell maturation. EMBO J 18, 7011-7018.
Benoit, G. R., Flexor, M., Besancon, F., Altucci, L., Rossin, A., Hillion, J., Balajthy, Z.,
Legres, L., Segal-Bendirdjian, E., Gronemeyer, H., and Lanotte, M. (2001a).
Autonomous rexinoid death signaling is suppressed by converging signaling pathways in
immature leukemia cells. Mol Endocrinol 15, 1154-1169.
Benoit, G. R., Tong, J. H., Balajthy, Z., and Lanotte, M. (2001b). Exploring (novel) gene
expression during retinoid-induced maturation and cell death of acute promyelocytic
leukemia. Semin Hematol 38, 71-85.
Berger, R., Busson, M., Dastugue, N., Radford-Weiss, I., Michaux, L., Hagemeijer, A.,
Quilichini, B., Benattar, L., Bernard, O., and Romana, S. P. (2006). Acute
311
megakaryoblastic leukemia and loss of the RUNX1 gene. Cancer Genet Cytogenet 164,
71-73.
Bernard, K., Litman, E., Fitzpatrick, J. L., Shellman, Y. G., Argast, G., Polvinen, K.,
Everett, A. D., Fukasawa, K., Norris, D. A., Ahn, N. G., and Resing, K. A. (2003).
Functional proteomic analysis of melanoma progression. Cancer Res 63, 6716-6725.
Bernardi, R., Scaglioni, P. P., Bergmann, S., Horn, H. F., Vousden, K. H., and Pandolfi,
P. P. (2004). PML regulates p53 stability by sequestering Mdm2 to the nucleolus. Nat
Cell Biol 6, 665-672.
Berrodin, T. J., Marks, M. S., Ozato, K., Linney, E., and Lazar, M. A. (1992).
Heterodimerization among thyroid hormone receptor, retinoic acid receptor, retinoid X
receptor, chicken ovalbumin upstream promoter transcription factor, and an endogenous
liver protein. Mol Endocrinol 6, 1468-1478.
Bertwistle, D., Sugimoto, M., and Sherr, C. J. (2004). Physical and functional interactions
of the Arf tumor suppressor protein with nucleophosmin/B23. Mol Cell Biol 24, 985-996.
Birnstiel, M. L., Chipchase, M. I., and Hyde, B. B. (1963). The Nucleolus, a Source of
Ribosomes. Biochim Biophys Acta 76, 454-462.
Bischof, D., Pulford, K., Mason, D. Y., and Morris, S. W. (1997). Role of the
nucleophosmin (NPM) portion of the non-Hodgkin's lymphoma-associated NPM-
anaplastic lymphoma kinase fusion protein in oncogenesis. Mol Cell Biol 17, 2312-2325.
Boldin, M. P., Goncharov, T. M., Goltsev, Y. V., and Wallach, D. (1996). Involvement of
MACH, a novel MORT1/FADD-interacting protease, in Fas/APO-1- and TNF receptor-
induced cell death. Cell 85, 803-815.
Bolli, N., Payne, E. M., Grabher, C., Lee, J. S., Johnston, A. B., Falini, B., Kanki, J. P.,
and Look, A. T. Expression of the cytoplasmic NPM1 mutant (NPMc+) causes the
expansion of hematopoietic cells in zebrafish. Blood 115, 3329-3340.
312
Bonnet, D., and Dick, J. E. (1997). Human acute myeloid leukemia is organized as a
hierarchy that originates from a primitive hematopoietic cell. Nat Med 3, 730-737.
Boon, E. M., Keller, J. J., Wormhoudt, T. A., Giardiello, F. M., Offerhaus, G. J., van der
Neut, R., and Pals, S. T. (2004). Sulindac targets nuclear beta-catenin accumulation and
Wnt signalling in adenomas of patients with familial adenomatous polyposis and in
human colorectal cancer cell lines. Br J Cancer 90, 224-229.
Boon, K., Caron, H. N., van Asperen, R., Valentijn, L., Hermus, M. C., van Sluis, P.,
Roobeek, I., Weis, I., Voute, P. A., Schwab, M., and Versteeg, R. (2001). N-myc
enhances the expression of a large set of genes functioning in ribosome biogenesis and
protein synthesis. EMBO J 20, 1383-1393.
Bor, A. M., Chang, F. J., and Yung, B. Y. (1992). Phosphoprotein B23 translocation and
modulation of actinomycin D and doxorubicin cytotoxicity by dipyridamole in HeLa
cells. Int J Cancer 52, 658-663.
Borer, R. A., Lehner, C. F., Eppenberger, H. M., and Nigg, E. A. (1989). Major nucleolar
proteins shuttle between nucleus and cytoplasm. Cell 56, 379-390.
Bowman, S. K., Neumuller, R. A., Novatchkova, M., Du, Q., and Knoblich, J. A. (2006).
The Drosophila NuMA Homolog Mud regulates spindle orientation in asymmetric cell
division. Dev Cell 10, 731-742.
Brady, S. N., Yu, Y., Maggi, L. B., Jr., and Weber, J. D. (2004). ARF impedes NPM/B23
shuttling in an Mdm2-sensitive tumor suppressor pathway. Mol Cell Biol 24, 9327-9338.
Breitman, T. R., Collins, S. J., and Keene, B. R. (1981). Terminal differentiation of
human promyelocytic leukemic cells in primary culture in response to retinoic acid.
Blood 57, 1000-1004.
Bryder, D., Ramsfjell, V., Dybedal, I., Theilgaard-Monch, K., Hogerkorp, C. M.,
Adolfsson, J., Borge, O. J., and Jacobsen, S. E. (2001). Self-renewal of multipotent long-
term repopulating hematopoietic stem cells is negatively regulated by Fas and tumor
necrosis factor receptor activation. J Exp Med 194, 941-952.
313
Bueso-Ramos, C. E., Rocha, F. C., Shishodia, S., Medeiros, L. J., Kantarjian, H. M.,
Vadhan-Raj, S., Estrov, Z., Smith, T. L., Nguyen, M. H., and Aggarwal, B. B. (2004).
Expression of constitutively active nuclear-kappa B RelA transcription factor in blasts of
acute myeloid leukemia. Hum Pathol 35, 246-253.
Bugge, T. H., Pohl, J., Lonnoy, O., and Stunnenberg, H. G. (1992). RXR alpha, a
promiscuous partner of retinoic acid and thyroid hormone receptors. EMBO J 11, 1409-
1418.
Bullinger, L., Dohner, K., Bair, E., Frohling, S., Schlenk, R. F., Tibshirani, R., Dohner,
H., and Pollack, J. R. (2004). Use of gene-expression profiling to identify prognostic
subclasses in adult acute myeloid leukemia. N Engl J Med 350, 1605-1616.
Buza-Vidas, N., Antonchuk, J., Qian, H., Mansson, R., Luc, S., Zandi, S., Anderson, K.,
Takaki, S., Nygren, J. M., Jensen, C. T., and Jacobsen, S. E. (2006). Cytokines regulate
postnatal hematopoietic stem cell expansion: opposing roles of thrombopoietin and LNK.
Genes Dev 20, 2018-2023.
Callens, C., Chevret, S., Cayuela, J. M., Cassinat, B., Raffoux, E., de Botton, S., Thomas,
X., Guerci, A., Fegueux, N., Pigneux, A., et al. (2005). Prognostic implication of FLT3
and Ras gene mutations in patients with acute promyelocytic leukemia (APL): a
retrospective study from the European APL Group. Leukemia 19, 1153-1160.
Casorelli, I., Tenedini, E., Tagliafico, E., Blasi, M. F., Giuliani, A., Crescenzi, M., Pelosi,
E., Testa, U., Peschle, C., Mele, L., et al. (2006). Identification of a molecular signature
for leukemic promyelocytes and their normal counterparts: Focus on DNA repair genes.
Leukemia 20, 1978-1988.
Catalano, A., Dawson, M. A., Somana, K., Opat, S., Schwarer, A., Campbell, L. J., and
Iland, H. (2007). The PRKAR1A gene is fused to RARA in a new variant acute
promyelocytic leukemia. Blood 110, 4073-4076.
314
Caudill, J. S., Sternberg, A. J., Li, C. Y., Tefferi, A., Lasho, T. L., and Steensma, D. P.
(2006). C-terminal nucleophosmin mutations are uncommon in chronic myeloid
disorders. Br J Haematol 133, 638-641.
Chambon, P. (1996). A decade of molecular biology of retinoic acid receptors. FASEB J
10, 940-954.
Chan, I. T., Kutok, J. L., Williams, I. R., Cohen, S., Moore, S., Shigematsu, H., Ley, T.
J., Akashi, K., Le Beau, M. M., and Gilliland, D. G. (2006). Oncogenic K-ras cooperates
with PML-RAR alpha to induce an acute promyelocytic leukemia-like disease. Blood
108, 1708-1715.
Chan, P. K. (1992). Characterization and cellular localization of nucleophosmin/B23 in
HeLa cells treated with selected cytotoxic agents (studies of B23-translocation
mechanism). Exp Cell Res 203, 174-181.
Chan, P. K., Aldrich, M. B., and Yung, B. Y. (1987). Nucleolar protein B23 translocation
after doxorubicin treatment in murine tumor cells. Cancer Res 47, 3798-3801.
Chan, W. I., and Huntly, B. J. (2008). Leukemia stem cells in acute myeloid leukemia.
Semin Oncol 35, 326-335.
Chan, W. Y., Liu, Q. R., Borjigin, J., Busch, H., Rennert, O. M., Tease, L. A., and Chan,
P. K. (1989). Characterization of the cDNA encoding human nucleophosmin and studies
of its role in normal and abnormal growth. Biochemistry 28, 1033-1039.
Chang, K. S., Lu, J. F., Wang, G., Trujillo, J. M., Estey, E., Cork, A., Chu, D. T.,
Freireich, E. J., and Stass, S. A. (1992). The t(15;17) breakpoint in acute promyelocytic
leukemia cluster within two different sites of the myl gene: targets for the detection of
minimal residual disease by the polymerase chain reaction. Blood 79, 554-558.
Chen, C. Z., Li, L., Lodish, H. F., and Bartel, D. P. (2004). MicroRNAs modulate
hematopoietic lineage differentiation. Science 303, 83-86.
315
Chen, J., Kubalak, S. W., and Chien, K. R. (1998). Ventricular muscle-restricted
targeting of the RXRalpha gene reveals a non-cell-autonomous requirement in cardiac
chamber morphogenesis. Development 125, 1943-1949.
Chen, S. J., Zelent, A., Tong, J. H., Yu, H. Q., Wang, Z. Y., Derre, J., Berger, R.,
Waxman, S., and Chen, Z. (1993a). Rearrangements of the retinoic acid receptor alpha
and promyelocytic leukemia zinc finger genes resulting from t(11;17)(q23;q21) in a
patient with acute promyelocytic leukemia. J Clin Invest 91, 2260-2267.
Chen, Y., Gu, L., Zhou, C., Wu, X., Gao, J., Li, Q., Zhu, Y., Jia, C., and Ma, Z. (2010).
Relapsed APL patient with variant NPM-RARalpha fusion responded to arsenic trioxide-
based therapy and achieved long-term survival. Int J Hematol 91, 708-710.
Chen, Z., Brand, N. J., Chen, A., Chen, S. J., Tong, J. H., Wang, Z. Y., Waxman, S., and
Zelent, A. (1993b). Fusion between a novel Kruppel-like zinc finger gene and the retinoic
acid receptor-alpha locus due to a variant t(11;17) translocation associated with acute
promyelocytic leukaemia. EMBO J 12, 1161-1167.
Cheng, G. X., Zhu, X. H., Men, X. Q., Wang, L., Huang, Q. H., Jin, X. L., Xiong, S. M.,
Zhu, J., Guo, W. M., Chen, J. Q., et al. (1999). Distinct leukemia phenotypes in
transgenic mice and different corepressor interactions generated by promyelocytic
leukemia variant fusion genes PLZF-RARalpha and NPM-RARalpha. Proc Natl Acad Sci
U S A 96, 6318-6323.
Cheng, K., Sportoletti, P., Ito, K., Clohessy, J. G., Teruya-Feldstein, J., Kutok, J. L., and
Pandolfi, P. P. (2010). The cytoplasmic NPM mutant induces myeloproliferation in a
transgenic mouse model. Blood 115, 3341-3345.
Cheng, T., Rodrigues, N., Shen, H., Yang, Y., Dombkowski, D., Sykes, M., and Scadden,
D. T. (2000). Hematopoietic stem cell quiescence maintained by p21cip1/waf1. Science
287, 1804-1808.
Chou, W. C., Tang, J. L., Lin, L. I., Yao, M., Tsay, W., Chen, C. Y., Wu, S. J., Huang, C.
F., Chiou, R. J., Tseng, M. H., et al. (2006). Nucleophosmin mutations in de novo acute
316
myeloid leukemia: the age-dependent incidences and the stability during disease
evolution. Cancer Res 66, 3310-3316.
Chumsri, S., Matsui, W., and Burger, A. M. (2007). Therapeutic implications of leukemic
stem cell pathways. Clin Cancer Res 13, 6549-6554.
Clarke, M. F., and Fuller, M. (2006). Stem cells and cancer: two faces of eve. Cell 124,
1111-1115.
Clarke, N., Jimenez-Lara, A. M., Voltz, E., and Gronemeyer, H. (2004). Tumor
suppressor IRF-1 mediates retinoid and interferon anticancer signaling to death ligand
TRAIL. EMBO J 23, 3051-3060.
Cohen, N., Sharma, M., Kentsis, A., Perez, J. M., Strudwick, S., and Borden, K. L.
(2001). PML RING suppresses oncogenic transformation by reducing the affinity of
eIF4E for mRNA. EMBO J 20, 4547-4559.
Collins, S. J. (2002). The role of retinoids and retinoic acid receptors in normal
hematopoiesis. Leukemia 16, 1896-1905.
Colombo, E., Bonetti, P., Lazzerini Denchi, E., Martinelli, P., Zamponi, R., Marine, J. C.,
Helin, K., Falini, B., and Pelicci, P. G. (2005). Nucleophosmin is required for DNA
integrity and p19Arf protein stability. Mol Cell Biol 25, 8874-8886.
Colombo, E., Martinelli, P., Zamponi, R., Shing, D. C., Bonetti, P., Luzi, L., Volorio, S.,
Bernard, L., Pruneri, G., Alcalay, M., and Pelicci, P. G. (2006). Delocalization and
destabilization of the Arf tumor suppressor by the leukemia-associated NPM mutant.
Cancer Res 66, 3044-3050.
Compagno, M., Lim, W. K., Grunn, A., Nandula, S. V., Brahmachary, M., Shen, Q.,
Bertoni, F., Ponzoni, M., Scandurra, M., Califano, A., et al. (2009). Mutations of multiple
genes cause deregulation of NF-kappaB in diffuse large B-cell lymphoma. Nature 459,
717-721.
317
Compton, D. A., Szilak, I., and Cleveland, D. W. (1992). Primary structure of NuMA, an
intranuclear protein that defines a novel pathway for segregation of proteins at mitosis. J
Cell Biol 116, 1395-1408.
Cummins, J. M., and Velculescu, V. E. (2006). Implications of micro-RNA profiling for
cancer diagnosis. Oncogene 25, 6220-6227.
Dalenc, F., Drouet, J., Ader, I., Delmas, C., Rochaix, P., Favre, G., Cohen-Jonathan, E.,
and Toulas, C. (2002). Increased expression of a COOH-truncated nucleophosmin
resulting from alternative splicing is associated with cellular resistance to ionizing
radiation in HeLa cells. Int J Cancer 100, 662-668.
Darnell, J. E., Jr. (1997). STATs and gene regulation. Science 277, 1630-1635.
de Lera, A. R., Bourguet, W., Altucci, L., and Gronemeyer, H. (2007). Design of
selective nuclear receptor modulators: RAR and RXR as a case study. Nat Rev Drug
Discov 6, 811-820.
de The, H., and Chen, Z. (2010). Acute promyelocytic leukaemia: novel insights into the
mechanisms of cure. Nat Rev Cancer 10, 775-783.
de The, H., Chomienne, C., Lanotte, M., Degos, L., and Dejean, A. (1990). The t(15;17)
translocation of acute promyelocytic leukaemia fuses the retinoic acid receptor alpha
gene to a novel transcribed locus. Nature 347, 558-561.
de The, H., Lavau, C., Marchio, A., Chomienne, C., Degos, L., and Dejean, A. (1991).
The PML-RAR alpha fusion mRNA generated by the t(15;17) translocation in acute
promyelocytic leukemia encodes a functionally altered RAR. Cell 66, 675-684.
den Besten, W., Kuo, M. L., Williams, R. T., and Sherr, C. J. (2005). Myeloid leukemia-
associated nucleophosmin mutants perturb p53-dependent and independent activities of
the Arf tumor suppressor protein. Cell Cycle 4, 1593-1598.
Derenzini, M., Sirri, V., Pession, A., Trere, D., Roussel, P., Ochs, R. L., and Hernandez-
Verdun, D. (1995). Quantitative changes of the two major AgNOR proteins, nucleolin
318
and protein B23, related to stimulation of rDNA transcription. Exp Cell Res 219, 276-
282.
Dergunova, N. N., Bulycheva, T. I., Artemenko, E. G., Shpakova, A. P., Pegova, A. N.,
Gemjian, E. G., Dudnik, O. A., Zatsepina, O. V., and Malashenko, O. S. (2002). A major
nucleolar protein B23 as a marker of proliferation activity of human peripheral
lymphocytes. Immunol Lett 83, 67-72.
Devin, A., Cook, A., Lin, Y., Rodriguez, Y., Kelliher, M., and Liu, Z. (2000). The
distinct roles of TRAF2 and RIP in IKK activation by TNF-R1: TRAF2 recruits IKK to
TNF-R1 while RIP mediates IKK activation. Immunity 12, 419-429.
Devin, A., Lin, Y., Yamaoka, S., Li, Z., Karin, M., and Liu, Z. (2001). The alpha and
beta subunits of IkappaB kinase (IKK) mediate TRAF2-dependent IKK recruitment to
tumor necrosis factor (TNF) receptor 1 in response to TNF. Mol Cell Biol 21, 3986-3994.
Dhar, S. K., Lynn, B. C., Daosukho, C., and St Clair, D. K. (2004). Identification of
nucleophosmin as an NF-kappaB co-activator for the induction of the human SOD2 gene.
J Biol Chem 279, 28209-28219.
Di Croce, L., Raker, V. A., Corsaro, M., Fazi, F., Fanelli, M., Faretta, M., Fuks, F., Lo
Coco, F., Kouzarides, T., Nervi, C., et al. (2002). Methyltransferase recruitment and
DNA hypermethylation of target promoters by an oncogenic transcription factor. Science
295, 1079-1082.
Di Leva, G., Calin, G. A., and Croce, C. M. (2006). MicroRNAs: fundamental facts and
involvement in human diseases. Birth Defects Res C Embryo Today 78, 180-189.
Dick, J. E. (2005). Acute myeloid leukemia stem cells. Ann N Y Acad Sci 1044, 1-5.
Ding, L., Ley, T. J., Larson, D. E., Miller, C. A., Koboldt, D. C., Welch, J. S., Ritchey, J.
K., Young, M. A., Lamprecht, T., McLellan, M. D., et al. (2012). Clonal evolution in
relapsed acute myeloid leukaemia revealed by whole-genome sequencing. Nature 481,
506-510.
319
Dixit, V. M., Green, S., Sarma, V., Holzman, L. B., Wolf, F. W., O'Rourke, K., Ward, P.
A., Prochownik, E. V., and Marks, R. M. (1990). Tumor necrosis factor-alpha induction
of novel gene products in human endothelial cells including a macrophage-specific
chemotaxin. J Biol Chem 265, 2973-2978.
Dong, S., Qiu, J., Stenoien, D. L., Brinkley, W. R., Mancini, M. A., and Tweardy, D. J.
(2003). Essential role for the dimerization domain of NuMA-RARalpha in its oncogenic
activities and localization to NuMA sites within the nucleus. Oncogene 22, 858-868.
Dong, S., Stenoien, D. L., Qiu, J., Mancini, M. A., and Tweardy, D. J. (2004). Reduced
intranuclear mobility of APL fusion proteins accompanies their mislocalization and
results in sequestration and decreased mobility of retinoid X receptor alpha. Mol Cell
Biol 24, 4465-4475.
Dong, S., and Tweardy, D. J. (2002). Interactions of STAT5b-RARalpha, a novel acute
promyelocytic leukemia fusion protein, with retinoic acid receptor and STAT3 signaling
pathways. Blood 99, 2637-2646.
Dong, S., Zhu, J., Kuang, S., Qiu, J., Wang, Z., Chen, S., and Chen, L. (1997). [Study of
dominant negative effect of the PLZF-RARalpha against the wild-type RARalpha in
acute promyelocytic leukemia]. Zhonghua Xue Ye Xue Za Zhi 18, 8-12.
Dong, S., Zhu, J., Reid, A., Strutt, P., Guidez, F., Zhong, H. J., Wang, Z. Y., Licht, J.,
Waxman, S., Chomienne, C., et al. (1996). Amino-terminal protein-protein interaction
motif (POZ-domain) is responsible for activities of the promyelocytic leukemia zinc
finger-retinoic acid receptor-alpha fusion protein. Proc Natl Acad Sci U S A 93, 3624-
3629.
Downing, J. R., Shurtleff, S. A., Zielenska, M., Curcio-Brint, A. M., Behm, F. G., Head,
D. R., Sandlund, J. T., Weisenburger, D. D., Kossakowska, A. E., Thorner, P., and et al.
(1995). Molecular detection of the (2;5) translocation of non-Hodgkin's lymphoma by
reverse transcriptase-polymerase chain reaction. Blood 85, 3416-3422.
320
Du, C., Redner, R. L., Cooke, M. P., and Lavau, C. (1999). Overexpression of wild-type
retinoic acid receptor alpha (RARalpha) recapitulates retinoic acid-sensitive
transformation of primary myeloid progenitors by acute promyelocytic leukemia
RARalpha-fusion genes. Blood 94, 793-802.
Dumbar, T. S., Gentry, G. A., and Olson, M. O. (1989). Interaction of nucleolar
phosphoprotein B23 with nucleic acids. Biochemistry 28, 9495-9501.
Dundr, M., and Olson, M. O. (1998). Partially processed pre-rRNA is preserved in
association with processing components in nucleolus-derived foci during mitosis. Mol
Biol Cell 9, 2407-2422.
Duyster, J., Bai, R. Y., and Morris, S. W. (2001). Translocations involving anaplastic
lymphoma kinase (ALK). Oncogene 20, 5623-5637.
Dybedal, I., Bryder, D., Fossum, A., Rusten, L. S., and Jacobsen, S. E. (2001). Tumor
necrosis factor (TNF)-mediated activation of the p55 TNF receptor negatively regulates
maintenance of cycling reconstituting human hematopoietic stem cells. Blood 98, 1782-
1791.
Eppert, K., Takenaka, K., Lechman, E. R., Waldron, L., Nilsson, B., van Galen, P.,
Metzeler, K. H., Poeppl, A., Ling, V., Beyene, J., et al. (2011). Stem cell gene expression
programs influence clinical outcome in human leukemia. Nat Med 17, 1086-1093.
Estey, E., and Dohner, H. (2006). Acute myeloid leukaemia. Lancet 368, 1894-1907.
Falini, B., Mecucci, C., Tiacci, E., Alcalay, M., Rosati, R., Pasqualucci, L., La Starza, R.,
Diverio, D., Colombo, E., Santucci, A., et al. (2005). Cytoplasmic nucleophosmin in
acute myelogenous leukemia with a normal karyotype. N Engl J Med 352, 254-266.
Falschlehner, C., Ganten, T. M., Koschny, R., Schaefer, U., and Walczak, H. (2009).
TRAIL and other TRAIL receptor agonists as novel cancer therapeutics. Adv Exp Med
Biol 647, 195-206.
321
Fazi, F., Rosa, A., Fatica, A., Gelmetti, V., De Marchis, M. L., Nervi, C., and Bozzoni, I.
(2005). A minicircuitry comprised of microRNA-223 and transcription factors NFI-A and
C/EBPalpha regulates human granulopoiesis. Cell 123, 819-831.
Feuerstein, M., Lieb-Juckstock, V., Schnaus, H., Springmann, E., Weber, B., and
Wunderlich, M. (1988a). Compliance--a joint effort of the patient and his doctor.
Epilepsy Res Suppl 1, 51-56.
Feuerstein, N., Chan, P. K., and Mond, J. J. (1988b). Identification of numatrin, the
nuclear matrix protein associated with induction of mitogenesis, as the nucleolar protein
B23. Implication for the role of the nucleolus in early transduction of mitogenic signals. J
Biol Chem 263, 10608-10612.
Feuerstein, N., Spiegel, S., and Mond, J. J. (1988c). The nuclear matrix protein, numatrin
(B23), is associated with growth factor-induced mitogenesis in Swiss 3T3 fibroblasts and
with T lymphocyte proliferation stimulated by lectins and anti-T cell antigen receptor
antibody. J Cell Biol 107, 1629-1642.
Flex, E., Petrangeli, V., Stella, L., Chiaretti, S., Hornakova, T., Knoops, L., Ariola, C.,
Fodale, V., Clappier, E., Paoloni, F., et al. (2008). Somatically acquired JAK1 mutations
in adult acute lymphoblastic leukemia. J Exp Med 205, 751-758.
Flynn, P. J., Miller, W. J., Weisdorf, D. J., Arthur, D. C., Brunning, R., and Branda, R. F.
(1983). Retinoic acid treatment of acute promyelocytic leukemia: in vitro and in vivo
observations. Blood 62, 1211-1217.
Fox, C. J., Hammerman, P. S., Cinalli, R. M., Master, S. R., Chodosh, L. A., and
Thompson, C. B. (2003). The serine/threonine kinase Pim-2 is a transcriptionally
regulated apoptotic inhibitor. Genes Dev 17, 1841-1854.
Frelin, C., Imbert, V., Griessinger, E., Peyron, A. C., Rochet, N., Philip, P., Dageville, C.,
Sirvent, A., Hummelsberger, M., Berard, E., et al. (2005). Targeting NF-kappaB
activation via pharmacologic inhibition of IKK2-induced apoptosis of human acute
myeloid leukemia cells. Blood 105, 804-811.
322
Fu, S., Consoli, U., Hanania, E. G., Zu, Z., Claxton, D. F., Andreeff, M., and Deisseroth,
A. B. (1995). PML/RARalpha, a fusion protein in acute promyelocytic leukemia,
prevents growth factor withdrawal-induced apoptosis in TF-1 cells. Clin Cancer Res 1,
583-590.
Gal, H., Amariglio, N., Trakhtenbrot, L., Jacob-Hirsh, J., Margalit, O., Avigdor, A.,
Nagler, A., Tavor, S., Ein-Dor, L., Lapidot, T., et al. (2006). Gene expression profiles of
AML derived stem cells; similarity to hematopoietic stem cells. Leukemia 20, 2147-
2154.
Garcia-Pineres, A. J., Castro, V., Mora, G., Schmidt, T. J., Strunck, E., Pahl, H. L., and
Merfort, I. (2001). Cysteine 38 in p65/NF-kappaB plays a crucial role in DNA binding
inhibition by sesquiterpene lactones. J Biol Chem 276, 39713-39720.
Garzon, R., Garofalo, M., Martelli, M. P., Briesewitz, R., Wang, L., Fernandez-
Cymering, C., Volinia, S., Liu, C. G., Schnittger, S., Haferlach, T., et al. (2008a).
Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated
nucleophosmin. Proc Natl Acad Sci U S A 105, 3945-3950.
Garzon, R., Pichiorri, F., Palumbo, T., Visentini, M., Aqeilan, R., Cimmino, A., Wang,
H., Sun, H., Volinia, S., Alder, H., et al. (2007). MicroRNA gene expression during
retinoic acid-induced differentiation of human acute promyelocytic leukemia. Oncogene
26, 4148-4157.
Garzon, R., Volinia, S., Liu, C. G., Fernandez-Cymering, C., Palumbo, T., Pichiorri, F.,
Fabbri, M., Coombes, K., Alder, H., Nakamura, T., et al. (2008b). MicroRNA signatures
associated with cytogenetics and prognosis in acute myeloid leukemia. Blood 111, 3183-
3189.
Gentles, A. J., Plevritis, S. K., Majeti, R., and Alizadeh, A. A. (2010). Association of a
leukemic stem cell gene expression signature with clinical outcomes in acute myeloid
leukemia. JAMA 304, 2706-2715.
323
Goddard, A. D., Borrow, J., Freemont, P. S., and Solomon, E. (1991). Characterization of
a zinc finger gene disrupted by the t(15;17) in acute promyelocytic leukemia. Science
254, 1371-1374.
Golub, T. R., Slonim, D. K., Tamayo, P., Huard, C., Gaasenbeek, M., Mesirov, J. P.,
Coller, H., Loh, M. L., Downing, J. R., Caligiuri, M. A., et al. (1999). Molecular
classification of cancer: class discovery and class prediction by gene expression
monitoring. Science 286, 531-537.
Gorello, P., Cazzaniga, G., Alberti, F., Dell'Oro, M. G., Gottardi, E., Specchia, G., Roti,
G., Rosati, R., Martelli, M. F., Diverio, D., et al. (2006). Quantitative assessment of
minimal residual disease in acute myeloid leukemia carrying nucleophosmin (NPM1)
gene mutations. Leukemia 20, 1103-1108.
Grignani, F., De Matteis, S., Nervi, C., Tomassoni, L., Gelmetti, V., Cioce, M., Fanelli,
M., Ruthardt, M., Ferrara, F. F., Zamir, I., et al. (1998). Fusion proteins of the retinoic
acid receptor-alpha recruit histone deacetylase in promyelocytic leukaemia. Nature 391,
815-818.
Grignani, F., Fagioli, M., Alcalay, M., Longo, L., Pandolfi, P. P., Donti, E., Biondi, A.,
Lo Coco, F., and Pelicci, P. G. (1994). Acute promyelocytic leukemia: from genetics to
treatment. Blood 83, 10-25.
Grignani, F., Ferrucci, P. F., Testa, U., Talamo, G., Fagioli, M., Alcalay, M., Mencarelli,
A., Peschle, C., Nicoletti, I., and et al. (1993). The acute promyelocytic leukemia-specific
PML-RAR alpha fusion protein inhibits differentiation and promotes survival of myeloid
precursor cells. Cell 74, 423-431.
Grimwade, D., Biondi, A., Mozziconacci, M. J., Hagemeijer, A., Berger, R., Neat, M.,
Howe, K., Dastugue, N., Jansen, J., Radford-Weiss, I., et al. (2000). Characterization of
acute promyelocytic leukemia cases lacking the classic t(15;17): results of the European
Working Party. Groupe Francais de Cytogenetique Hematologique, Groupe de Francais
d'Hematologie Cellulaire, UK Cancer Cytogenetics Group and BIOMED 1 European
324
Community-Concerted Action "Molecular Cytogenetic Diagnosis in Haematological
Malignancies". Blood 96, 1297-1308.
Grisendi, S., Bernardi, R., Rossi, M., Cheng, K., Khandker, L., Manova, K., and Pandolfi,
P. P. (2005). Role of nucleophosmin in embryonic development and tumorigenesis.
Nature 437, 147-153.
Grisendi, S., Mecucci, C., Falini, B., and Pandolfi, P. P. (2006). Nucleophosmin and
cancer. Nat Rev Cancer 6, 493-505.
Grisendi, S., and Pandolfi, P. P. (2005). NPM mutations in acute myelogenous leukemia.
N Engl J Med 352, 291-292.
Grisolano, J. L., Wesselschmidt, R. L., Pelicci, P. G., and Ley, T. J. (1997). Altered
myeloid development and acute leukemia in transgenic mice expressing PML-RAR alpha
under control of cathepsin G regulatory sequences. Blood 89, 376-387.
Grosjean-Raillard, J., Tailler, M., Ades, L., Perfettini, J. L., Fabre, C., Braun, T., De
Botton, S., Fenaux, P., and Kroemer, G. (2009). ATM mediates constitutive NF-kappaB
activation in high-risk myelodysplastic syndrome and acute myeloid leukemia. Oncogene
28, 1099-1109.
Gu, C., Ye, T., and Wells, R. A. (2006). Synergistic effects of troglitazone in
combination with cytotoxic agents in acute myelogenous leukaemia cells. Leuk Res 30,
1447-1451.
Guardiola-Serrano, F., Rossin, A., Cahuzac, N., Luckerath, K., Melzer, I., Mailfert, S.,
Marguet, D., Zornig, M., and Hueber, A. O. (2010). Palmitoylation of human FasL
modulates its cell death-inducing function. Cell Death Dis 1, e88.
Guibal, F. C., Alberich-Jorda, M., Hirai, H., Ebralidze, A., Levantini, E., Di Ruscio, A.,
Zhang, P., Santana-Lemos, B. A., Neuberg, D., Wagers, A. J., et al. (2009). Identification
of a myeloid committed progenitor as the cancer-initiating cell in acute promyelocytic
leukemia. Blood 114, 5415-5425.
325
Guidez, F., Ivins, S., Zhu, J., Soderstrom, M., Waxman, S., and Zelent, A. (1998).
Reduced retinoic acid-sensitivities of nuclear receptor corepressor binding to PML- and
PLZF-RARalpha underlie molecular pathogenesis and treatment of acute promyelocytic
leukemia. Blood 91, 2634-2642.
Guo, A., Salomoni, P., Luo, J., Shih, A., Zhong, S., Gu, W., and Pandolfi, P. P. (2000).
The function of PML in p53-dependent apoptosis. Nat Cell Biol 2, 730-736.
Gurrieri, C., Capodieci, P., Bernardi, R., Scaglioni, P. P., Nafa, K., Rush, L. J., Verbel, D.
A., Cordon-Cardo, C., and Pandolfi, P. P. (2004). Loss of the tumor suppressor PML in
human cancers of multiple histologic origins. J Natl Cancer Inst 96, 269-279.
Guzman, M. L., Neering, S. J., Upchurch, D., Grimes, B., Howard, D. S., Rizzieri, D. A.,
Luger, S. M., and Jordan, C. T. (2001). Nuclear factor-kappaB is constitutively activated
in primitive human acute myelogenous leukemia cells. Blood 98, 2301-2307.
Haferlach, T., Kohlmann, A., Schnittger, S., Dugas, M., Hiddemann, W., Kern, W., and
Schoch, C. (2005a). AML M3 and AML M3 variant each have a distinct gene expression
signature but also share patterns different from other genetically defined AML subtypes.
Genes Chromosomes Cancer 43, 113-127.
Haferlach, T., Kohlmann, A., Schnittger, S., Dugas, M., Hiddemann, W., Kern, W., and
Schoch, C. (2005b). Global approach to the diagnosis of leukemia using gene expression
profiling. Blood 106, 1189-1198.
Haferlach, T., Kohlmann, A., Wieczorek, L., Basso, G., Kronnie, G. T., Bene, M. C., De
Vos, J., Hernandez, J. M., Hofmann, W. K., Mills, K. I., et al. (2010). Clinical utility of
microarray-based gene expression profiling in the diagnosis and subclassification of
leukemia: report from the International Microarray Innovations in Leukemia Study
Group. J Clin Oncol 28, 2529-2537.
Hallenbeck, P. L., Marks, M. S., Lippoldt, R. E., Ozato, K., and Nikodem, V. M. (1992).
Heterodimerization of thyroid hormone (TH) receptor with H-2RIIBP (RXR beta)
326
enhances DNA binding and TH-dependent transcriptional activation. Proc Natl Acad Sci
U S A 89, 5572-5576.
Harfe, B. D. (2005). MicroRNAs in vertebrate development. Curr Opin Genet Dev 15,
410-415.
Hauksdottir, H., and Privalsky, M. L. (2001). DNA recognition by the aberrant retinoic
acid receptors implicated in human acute promyelocytic leukemia. Cell Growth Differ
12, 85-98.
He, K. L., and Ting, A. T. (2002). A20 inhibits tumor necrosis factor (TNF) alpha-
induced apoptosis by disrupting recruitment of TRADD and RIP to the TNF receptor 1
complex in Jurkat T cells. Mol Cell Biol 22, 6034-6045.
He, L. Z., Guidez, F., Tribioli, C., Peruzzi, D., Ruthardt, M., Zelent, A., and Pandolfi, P.
P. (1998). Distinct interactions of PML-RARalpha and PLZF-RARalpha with co-
repressors determine differential responses to RA in APL. Nat Genet 18, 126-135.
Hegde, S., Kaushal, N., Ravindra, K. C., Chiaro, C., Hafer, K. T., Gandhi, U. H.,
Thompson, J. T., van den Heuvel, J. P., Kennett, M. J., Hankey, P., et al. (2011).
Delta12-prostaglandin J3, an omega-3 fatty acid-derived metabolite, selectively ablates
leukemia stem cells in mice. Blood 118, 6909-6919.
Hehner, S. P., Hofmann, T. G., Droge, W., and Schmitz, M. L. (1999). The
antiinflammatory sesquiterpene lactone parthenolide inhibits NF-kappa B by targeting the
I kappa B kinase complex. J Immunol 163, 5617-5623.
Hernandez-Verdun, D., and Roussel, P. (2003). Regulators of nucleolar functions. Prog
Cell Cycle Res 5, 301-308.
Hillestad, L. K. (1957). Acute promyelocytic leukemia. Acta Med Scand 159, 189-194.
Hingorani, K., Szebeni, A., and Olson, M. O. (2000). Mapping the functional domains of
nucleolar protein B23. J Biol Chem 275, 24451-24457.
327
Hock, H., Hamblen, M. J., Rooke, H. M., Schindler, J. W., Saleque, S., Fujiwara, Y., and
Orkin, S. H. (2004). Gfi-1 restricts proliferation and preserves functional integrity of
haematopoietic stem cells. Nature 431, 1002-1007.
Hoemme, C., Peerzada, A., Behre, G., Wang, Y., McClelland, M., Nieselt, K., Zschunke,
M., Disselhoff, C., Agrawal, S., Isken, F., et al. (2008). Chromatin modifications induced
by PML-RARalpha repress critical targets in leukemogenesis as analyzed by ChIP-Chip.
Blood 111, 2887-2895.
Hoffmann, A., Levchenko, A., Scott, M. L., and Baltimore, D. (2002). The IkappaB-NF-
kappaB signaling module: temporal control and selective gene activation. Science 298,
1241-1245.
Hofmann, T. G., and Will, H. (2003). Body language: the function of PML nuclear
bodies in apoptosis regulation. Cell Death Differ 10, 1290-1299.
Hong, S. H., David, G., Wong, C. W., Dejean, A., and Privalsky, M. L. (1997). SMRT
corepressor interacts with PLZF and with the PML-retinoic acid receptor alpha
(RARalpha) and PLZF-RARalpha oncoproteins associated with acute promyelocytic
leukemia. Proc Natl Acad Sci U S A 94, 9028-9033.
Hsu, H., Shu, H. B., Pan, M. G., and Goeddel, D. V. (1996). TRADD-TRAF2 and
TRADD-FADD interactions define two distinct TNF receptor 1 signal transduction
pathways. Cell 84, 299-308.
Hsu, H. L., and Yeh, N. H. (1996). Dynamic changes of NuMA during the cell cycle and
possible appearance of a truncated form of NuMA during apoptosis. J Cell Sci 109 ( Pt
2), 277-288.
Hu, J., Shen, Z. X., Sun, G. L., Chen, S. J., Wang, Z. Y., and Chen, Z. (1999). Long-term
survival and prognostic study in acute promyelocytic leukemia treated with all-trans-
retinoic acid, chemotherapy, and As2O3: an experience of 120 patients at a single
institution. Int J Hematol 70, 248-260.
328
Hu, X., and Lazar, M. A. (2000). Transcriptional repression by nuclear hormone
receptors. Trends Endocrinol Metab 11, 6-10.
Huang, N., Negi, S., Szebeni, A., and Olson, M. O. (2005). Protein NPM3 interacts with
the multifunctional nucleolar protein B23/nucleophosmin and inhibits ribosome
biogenesis. J Biol Chem 280, 5496-5502.
Huang, Y., Hou, J. K., Chen, T. T., Zhao, X. Y., Yan, Z. W., Zhang, J., Yang, J., Kogan,
S. C., and Chen, G. Q. (2011). PML-RARalpha enhances constitutive autophagic activity
through inhibiting the Akt/mTOR pathway. Autophagy 7.
Hummel, J. L., Wells, R. A., Dube, I. D., Licht, J. D., and Kamel-Reid, S. (1999).
Deregulation of NPM and PLZF in a variant t(5;17) case of acute promyelocytic
leukemia. Oncogene 18, 633-641.
Hummel, J. L., Zhang, T., Wells, R. A., and Kamel-Reid, S. (2002). The Retinoic acid
receptor alpha (RARalpha) chimeric proteins PML-, PLZF-, NPM-, and NuMA-
RARalpha have distinct intracellular localization patterns. Cell Growth Differ 13, 173-
183.
Huntly, B. J., and Gilliland, D. G. (2005). Leukaemia stem cells and the evolution of
cancer-stem-cell research. Nat Rev Cancer 5, 311-321.
Imai, T., Jiang, M., Kastner, P., Chambon, P., and Metzger, D. (2001). Selective ablation
of retinoid X receptor alpha in hepatocytes impairs their lifespan and regenerative
capacity. Proc Natl Acad Sci U S A 98, 4581-4586.
Indra, A. K., Castaneda, E., Antal, M. C., Jiang, M., Messaddeq, N., Meng, X., Loehr, C.
V., Gariglio, P., Kato, S., Wahli, W., et al. (2007). Malignant transformation of
DMBA/TPA-induced papillomas and nevi in the skin of mice selectively lacking
retinoid-X-receptor alpha in epidermal keratinocytes. J Invest Dermatol 127, 1250-1260.
Itahana, K., Bhat, K. P., Jin, A., Itahana, Y., Hawke, D., Kobayashi, R., and Zhang, Y.
(2003). Tumor suppressor ARF degrades B23, a nucleolar protein involved in ribosome
biogenesis and cell proliferation. Mol Cell 12, 1151-1164.
329
Ito, K., Bernardi, R., and Pandolfi, P. P. (2009). A novel signaling network as a critical
rheostat for the biology and maintenance of the normal stem cell and the cancer-initiating
cell. Curr Opin Genet Dev 19, 51-59.
Jacobsen, S. E., Jacobsen, F. W., Fahlman, C., and Rusten, L. S. (1994). TNF-alpha, the
great imitator: role of p55 and p75 TNF receptors in hematopoiesis. Stem Cells 12 Suppl
1, 111-126; discussion 126-118.
Jansen, J. H., Mahfoudi, A., Rambaud, S., Lavau, C., Wahli, W., and Dejean, A. (1995).
Multimeric complexes of the PML-retinoic acid receptor alpha fusion protein in acute
promyelocytic leukemia cells and interference with retinoid and peroxisome-proliferator
signaling pathways. Proc Natl Acad Sci U S A 92, 7401-7405.
Jeong, E. G., Kim, M. S., Nam, H. K., Min, C. K., Lee, S., Chung, Y. J., Yoo, N. J., and
Lee, S. H. (2008). Somatic mutations of JAK1 and JAK3 in acute leukemias and solid
cancers. Clin Cancer Res 14, 3716-3721.
Jiang, P. S., and Yung, B. Y. (1999). Down-regulation of nucleophosmin/B23 mRNA
delays the entry of cells into mitosis. Biochem Biophys Res Commun 257, 865-870.
Johnson, B. S., Mueller, L., Si, J., and Collins, S. J. (2002). The cytokines IL-3 and GM-
CSF regulate the transcriptional activity of retinoic acid receptors in different in vitro
models of myeloid differentiation. Blood 99, 746-753.
Johnson, L. N., Noble, M. E., and Owen, D. J. (1996). Active and inactive protein
kinases: structural basis for regulation. Cell 85, 149-158.
Jongen-Lavrencic, M., Sun, S. M., Dijkstra, M. K., Valk, P. J., and Lowenberg, B.
(2008). MicroRNA expression profiling in relation to the genetic heterogeneity of acute
myeloid leukemia. Blood 111, 5078-5085.
Jude, C. D., Gaudet, J. J., Speck, N. A., and Ernst, P. (2008). Leukemia and
hematopoietic stem cells: balancing proliferation and quiescence. Cell Cycle 7, 586-591.
330
Kalantry, S., Delva, L., Gaboli, M., Gandini, D., Giorgio, M., Hawe, N., He, L. Z.,
Peruzzi, D., Rivi, R., Tribioli, C., et al. (1997). Gene rearrangements in the molecular
pathogenesis of acute promyelocytic leukemia. J Cell Physiol 173, 288-296.
Kallajoki, M., Weber, K., and Osborn, M. (1991). A 210 kDa nuclear matrix protein is a
functional part of the mitotic spindle; a microinjection study using SPN monoclonal
antibodies. EMBO J 10, 3351-3362.
Kamashev, D., Vitoux, D., and De The, H. (2004). PML-RARA-RXR oligomers mediate
retinoid and rexinoid/cAMP cross-talk in acute promyelocytic leukemia cell
differentiation. J Exp Med 199, 1163-1174.
Kamel-Reid, S., Zhang, T., and Wells, R. A. (2003). Expression of NPM-RARalpha
fusion gene in hematopoietic cells confers sensitivity to troglitazone-induced apoptosis.
Oncogene 22, 6424-6435.
Kang, Y. J., Olson, M. O., Jones, C., and Busch, H. (1975). Nucleolar phosphoproteins of
normal rat liver and Novikoff hepatoma ascites cells. Cancer Res 35, 1470-1475.
Karin, M. (1999). How NF-kappaB is activated: the role of the IkappaB kinase (IKK)
complex. Oncogene 18, 6867-6874.
Karin, M. (2006). Nuclear factor-kappaB in cancer development and progression. Nature
441, 431-436.
Karin, M., Cao, Y., Greten, F. R., and Li, Z. W. (2002). NF-kappaB in cancer: from
innocent bystander to major culprit. Nat Rev Cancer 2, 301-310.
Karin, M., and Delhase, M. (2000). The I kappa B kinase (IKK) and NF-kappa B: key
elements of proinflammatory signalling. Semin Immunol 12, 85-98.
Kastner, P., Grondona, J. M., Mark, M., Gansmuller, A., LeMeur, M., Decimo, D.,
Vonesch, J. L., Dolle, P., and Chambon, P. (1994). Genetic analysis of RXR alpha
developmental function: convergence of RXR and RAR signaling pathways in heart and
eye morphogenesis. Cell 78, 987-1003.
331
Kato, Y., Ying, H., Zhao, L., Furuya, F., Araki, O., Willingham, M. C., and Cheng, S. Y.
(2006). PPARgamma insufficiency promotes follicular thyroid carcinogenesis via
activation of the nuclear factor-kappaB signaling pathway. Oncogene 25, 2736-2747.
Kelliher, M. A., Grimm, S., Ishida, Y., Kuo, F., Stanger, B. Z., and Leder, P. (1998). The
death domain kinase RIP mediates the TNF-induced NF-kappaB signal. Immunity 8,
297-303.
Kelly, L. M., Kutok, J. L., Williams, I. R., Boulton, C. L., Amaral, S. M., Curley, D. P.,
Ley, T. J., and Gilliland, D. G. (2002). PML/RARalpha and FLT3-ITD induce an APL-
like disease in a mouse model. Proc Natl Acad Sci U S A 99, 8283-8288.
Kirchner, D., Duyster, J., Ottmann, O., Schmid, R. M., Bergmann, L., and Munzert, G.
(2003). Mechanisms of Bcr-Abl-mediated NF-kappaB/Rel activation. Exp Hematol 31,
504-511.
Kiyoi, H., Naoe, T., Yokota, S., Nakao, M., Minami, S., Kuriyama, K., Takeshita, A.,
Saito, K., Hasegawa, S., Shimodaira, S., et al. (1997). Internal tandem duplication of
FLT3 associated with leukocytosis in acute promyelocytic leukemia. Leukemia Study
Group of the Ministry of Health and Welfare (Kohseisho). Leukemia 11, 1447-1452.
Kliewer, S. A., Umesono, K., Mangelsdorf, D. J., and Evans, R. M. (1992). Retinoid X
receptor interacts with nuclear receptors in retinoic acid, thyroid hormone and vitamin D3
signalling. Nature 355, 446-449.
Kogan, S. C. (2009). Curing APL: differentiation or destruction? Cancer Cell 15, 7-8.
Kondo, T., Minamino, N., Nagamura-Inoue, T., Matsumoto, M., Taniguchi, T., and
Tanaka, N. (1997). Identification and characterization of nucleophosmin/B23/numatrin
which binds the anti-oncogenic transcription factor IRF-1 and manifests oncogenic
activity. Oncogene 15, 1275-1281.
Kondo, T., Mori, A., Darmanin, S., Hashino, S., Tanaka, J., and Asaka, M. (2008). The
seventh pathogenic fusion gene FIP1L1-RARA was isolated from a t(4;17)-positive acute
promyelocytic leukemia. Haematologica 93, 1414-1416.
332
Korgaonkar, C., Hagen, J., Tompkins, V., Frazier, A. A., Allamargot, C., Quelle, F. W.,
and Quelle, D. E. (2005). Nucleophosmin (B23) targets ARF to nucleoli and inhibits its
function. Mol Cell Biol 25, 1258-1271.
Kufe, D. W., ed. (2003). Holland-Frei Cancer Medicine, 6th edition edn (Hamilton).
Kuo, M. L., den Besten, W., and Sherr, C. J. (2004). N-Terminal polyubiquitination of
the ARF tumor suppressor, a natural lysine-less protein. Cell Cycle 3, 1367-1369.
Kurki, S., Latonen, L., and Laiho, M. (2003). Cellular stress and DNA damage invoke
temporally distinct Mdm2, p53 and PML complexes and damage-specific nuclear
relocalization. J Cell Sci 116, 3917-3925.
Kurki, S., Peltonen, K., Latonen, L., Kiviharju, T. M., Ojala, P. M., Meek, D., and Laiho,
M. (2004). Nucleolar protein NPM interacts with HDM2 and protects tumor suppressor
protein p53 from HDM2-mediated degradation. Cancer Cell 5, 465-475.
Lamb, J., Crawford, E. D., Peck, D., Modell, J. W., Blat, I. C., Wrobel, M. J., Lerner, J.,
Brunet, J. P., Subramanian, A., Ross, K. N., et al. (2006). The Connectivity Map: using
gene-expression signatures to connect small molecules, genes, and disease. Science 313,
1929-1935.
Larsson, J., Blank, U., Klintman, J., Magnusson, M., and Karlsson, S. (2005). Quiescence
of hematopoietic stem cells and maintenance of the stem cell pool is not dependent on
TGF-beta signaling in vivo. Exp Hematol 33, 592-596.
Lee, E. G., Boone, D. L., Chai, S., Libby, S. L., Chien, M., Lodolce, J. P., and Ma, A.
(2000). Failure to regulate TNF-induced NF-kappaB and cell death responses in A20-
deficient mice. Science 289, 2350-2354.
Lee, S. Y., Park, J. H., Kim, S., Park, E. J., Yun, Y., and Kwon, J. (2005). A proteomics
approach for the identification of nucleophosmin and heterogeneous nuclear
ribonucleoprotein C1/C2 as chromatin-binding proteins in response to DNA double-
strand breaks. Biochem J 388, 7-15.
333
Leid, M., Kastner, P., Lyons, R., Nakshatri, H., Saunders, M., Zacharewski, T., Chen, J.
Y., Staub, A., Garnier, J. M., Mader, S., and et al. (1992). Purification, cloning, and RXR
identity of the HeLa cell factor with which RAR or TR heterodimerizes to bind target
sequences efficiently. Cell 68, 377-395.
Ley, T. J., Ding, L., Walter, M. J., McLellan, M. D., Lamprecht, T., Larson, D. E.,
Kandoth, C., Payton, J. E., Baty, J., Welch, J., et al. (2010). DNMT3A mutations in acute
myeloid leukemia. N Engl J Med 363, 2424-2433.
Ley, T. J., Minx, P. J., Walter, M. J., Ries, R. E., Sun, H., McLellan, M., DiPersio, J. F.,
Link, D. C., Tomasson, M. H., Graubert, T. A., et al. (2003). A pilot study of high-
throughput, sequence-based mutational profiling of primary human acute myeloid
leukemia cell genomes. Proc Natl Acad Sci U S A 100, 14275-14280.
Li, J., Sejas, D. P., Rani, R., Koretsky, T., Bagby, G. C., and Pang, Q. (2006a).
Nucleophosmin regulates cell cycle progression and stress response in hematopoietic
stem/progenitor cells. J Biol Chem 281, 16536-16545.
Li, J., Zhang, X., Sejas, D. P., Bagby, G. C., and Pang, Q. (2004). Hypoxia-induced
nucleophosmin protects cell death through inhibition of p53. J Biol Chem 279, 41275-
41279.
Li, M., Chiba, H., Warot, X., Messaddeq, N., Gerard, C., Chambon, P., and Metzger, D.
(2001). RXR-alpha ablation in skin keratinocytes results in alopecia and epidermal
alterations. Development 128, 675-688.
Li, M., Indra, A. K., Warot, X., Brocard, J., Messaddeq, N., Kato, S., Metzger, D., and
Chambon, P. (2000). Skin abnormalities generated by temporally controlled RXRalpha
mutations in mouse epidermis. Nature 407, 633-636.
Li, Q., and Verma, I. M. (2002). NF-kappaB regulation in the immune system. Nat Rev
Immunol 2, 725-734.
334
Li, S., Wang, L., Berman, M. A., Zhang, Y., and Dorf, M. E. (2006b). RNAi screen in
mouse astrocytes identifies phosphatases that regulate NF-kappaB signaling. Mol Cell 24,
497-509.
Li, Z., Lu, J., Sun, M., Mi, S., Zhang, H., Luo, R. T., Chen, P., Wang, Y., Yan, M., Qian,
Z., et al. (2008). Distinct microRNA expression profiles in acute myeloid leukemia with
common translocations. Proc Natl Acad Sci U S A 105, 15535-15540.
Licht, J. D., Shaknovich, R., English, M. A., Melnick, A., Li, J. Y., Reddy, J. C., Dong,
S., Chen, S. J., Zelent, A., and Waxman, S. (1996). Reduced and altered DNA-binding
and transcriptional properties of the PLZF-retinoic acid receptor-alpha chimera generated
in t(11;17)-associated acute promyelocytic leukemia. Oncogene 12, 323-336.
Lin, C. Y., Tan, B. C., Liu, H., Shih, C. J., Chien, K. Y., Lin, C. L., and Yung, B. Y.
(2010). Dephosphorylation of nucleophosmin by PP1beta facilitates pRB binding and
consequent E2F1-dependent DNA repair. Mol Biol Cell 21, 4409-4417.
Lin, H. K., Bergmann, S., and Pandolfi, P. P. (2004). Cytoplasmic PML function in TGF-
beta signalling. Nature 431, 205-211.
Lin, R. J., and Evans, R. M. (2000). Acquisition of oncogenic potential by RAR chimeras
in acute promyelocytic leukemia through formation of homodimers. Mol Cell 5, 821-830.
Lin, R. J., Nagy, L., Inoue, S., Shao, W., Miller, W. H., Jr., and Evans, R. M. (1998).
Role of the histone deacetylase complex in acute promyelocytic leukaemia. Nature 391,
811-814.
Lindstrom, M. S., and Zhang, Y. (2008). Ribosomal protein S9 is a novel B23/NPM-
binding protein required for normal cell proliferation. J Biol Chem 283, 15568-15576.
Livak, K. J., and Schmittgen, T. D. (2001). Analysis of relative gene expression data
using real-time quantitative PCR and the 2(-Delta Delta C(T) Method. Methods 25, 402-
408.
335
Longo, L., Trecca, D., Biondi, A., Lo Coco, F., Grignani, F., Maiolo, A. T., Pelicci, P. G.,
and Neri, A. (1993). Frequency of RAS and p53 mutations in acute promyelocytic
leukemias. Leuk Lymphoma 11, 405-410.
Lydersen, B. K., and Pettijohn, D. E. (1980). Human-specific nuclear protein that
associates with the polar region of the mitotic apparatus: distribution in a human/hamster
hybrid cell. Cell 22, 489-499.
Macedo Silva, M. L., Land, M., Heller, A., Abdelhay, E., do Socorro Pombo-de-Oliveira,
M., Ribeiro, R., Alves, G., Lerner, D., and Liehr, T. (2005). New rearrangement
t(3;17)(q26.3;q12) in an AML patient with a poor outcome. Oncol Rep 14, 663-666.
Majeti, R., Becker, M. W., Tian, Q., Lee, T. L., Yan, X., Liu, R., Chiang, J. H., Hood, L.,
Clarke, M. F., and Weissman, I. L. (2009). Dysregulated gene expression networks in
human acute myelogenous leukemia stem cells. Proc Natl Acad Sci U S A 106, 3396-
3401.
Mangelsdorf, D. J., Borgmeyer, U., Heyman, R. A., Zhou, J. Y., Ong, E. S., Oro, A. E.,
Kakizuka, A., and Evans, R. M. (1992). Characterization of three RXR genes that
mediate the action of 9-cis retinoic acid. Genes Dev 6, 329-344.
Mangelsdorf, D. J., and Evans, R. M. (1995). The RXR heterodimers and orphan
receptors. Cell 83, 841-850.
Marasca, R., Maffei, R., Zucchini, P., Castelli, I., Saviola, A., Martinelli, S., Ferrari, A.,
Fontana, M., Ravanetti, S., and Torelli, G. (2006). Gene expression profiling of acute
promyelocytic leukaemia identifies two subtypes mainly associated with flt3 mutational
status. Leukemia 20, 103-114.
Mark, M., Ghyselinck, N. B., Wendling, O., Dupe, V., Mascrez, B., Kastner, P., and
Chambon, P. (1999). A genetic dissection of the retinoid signalling pathway in the
mouse. Proc Nutr Soc 58, 609-613.
336
Marstrand, T. T., Borup, R., Willer, A., Borregaard, N., Sandelin, A., Porse, B. T., and
Theilgaard-Monch, K. (2010). A conceptual framework for the identification of candidate
drugs and drug targets in acute promyelocytic leukemia. Leukemia 24, 1265-1275.
Martelli, A. M., Nyakern, M., Tabellini, G., Bortul, R., Tazzari, P. L., Evangelisti, C., and
Cocco, L. (2006). Phosphoinositide 3-kinase/Akt signaling pathway and its therapeutical
implications for human acute myeloid leukemia. Leukemia 20, 911-928.
Martens, J. H., Brinkman, A. B., Simmer, F., Francoijs, K. J., Nebbioso, A., Ferrara, F.,
Altucci, L., and Stunnenberg, H. G. (2010). PML-RARalpha/RXR Alters the Epigenetic
Landscape in Acute Promyelocytic Leukemia. Cancer Cell 17, 173-185.
Mascrez, B., Mark, M., Dierich, A., Ghyselinck, N. B., Kastner, P., and Chambon, P.
(1998). The RXRalpha ligand-dependent activation function 2 (AF-2) is important for
mouse development. Development 125, 4691-4707.
Mascrez, B., Mark, M., Krezel, W., Dupe, V., LeMeur, M., Ghyselinck, N. B., and
Chambon, P. (2001). Differential contributions of AF-1 and AF-2 activities to the
developmental functions of RXR alpha. Development 128, 2049-2062.
Mathews, V., George, B., Chendamarai, E., Lakshmi, K. M., Desire, S.,
Balasubramanian, P., Viswabandya, A., Thirugnanam, R., Abraham, A., Shaji, R. V., et
al. Single-agent arsenic trioxide in the treatment of newly diagnosed acute promyelocytic
leukemia: long-term follow-up data. J Clin Oncol 28, 3866-3871.
Mathews, V., George, B., Lakshmi, K. M., Viswabandya, A., Bajel, A.,
Balasubramanian, P., Shaji, R. V., Srivastava, V. M., Srivastava, A., and Chandy, M.
(2006). Single-agent arsenic trioxide in the treatment of newly diagnosed acute
promyelocytic leukemia: durable remissions with minimal toxicity. Blood 107, 2627-
2632.
Mathieu, J., and Besancon, F. (2006). Arsenic trioxide represses NF-kappaB activation
and increases apoptosis in ATRA-treated APL cells. Ann N Y Acad Sci 1090, 203-208.
337
Mathieu, J., Giraudier, S., Lanotte, M., and Besancon, F. (2005). Retinoid-induced
activation of NF-kappaB in APL cells is not essential for granulocytic differentiation, but
prolongs the life span of mature cells. Oncogene 24, 7145-7155.
Mauro, C., Pacifico, F., Lavorgna, A., Mellone, S., Iannetti, A., Acquaviva, R.,
Formisano, S., Vito, P., and Leonardi, A. (2006). ABIN-1 binds to NEMO/IKKgamma
and co-operates with A20 in inhibiting NF-kappaB. J Biol Chem 281, 18482-18488.
Mehta, K., McQueen, T., Neamati, N., Collins, S., and Andreeff, M. (1996). Activation
of retinoid receptors RAR alpha and RXR alpha induces differentiation and apoptosis,
respectively, in HL-60 cells. Cell Growth Differ 7, 179-186.
Melnick, A., and Licht, J. D. (1999). Deconstructing a disease: RARalpha, its fusion
partners, and their roles in the pathogenesis of acute promyelocytic leukemia. Blood 93,
3167-3215.
Mendes-da-Silva, P., Moreira, A., Duro-da-Costa, J., Matias, D., and Monteiro, C.
(2000). Frequent loss of heterozygosity on chromosome 5 in non-small cell lung
carcinoma. Mol Pathol 53, 184-187.
Menezes, J., Acquadro, F., Perez-Pons de la Villa, C., Garcia-Sanchez, F., Alvarez, S.,
and Cigudosa, J. C. (2011). FIP1L1/RARA with breakpoint at FIP1L1 intron 13: a
variant translocation in acute promyelocytic leukemia. Haematologica 96, 1565-1566.
Mengeling, B. J., Phan, T. Q., Goodson, M. L., and Privalsky, M. L. (2011). Aberrant
corepressor interactions implicated in PML-RAR(alpha) and PLZF-RAR(alpha)
leukemogenesis reflect an altered recruitment and release of specific NCoR and SMRT
splice variants. J Biol Chem 286, 4236-4247.
Metzeler, K. H., Hummel, M., Bloomfield, C. D., Spiekermann, K., Braess, J., Sauerland,
M. C., Heinecke, A., Radmacher, M., Marcucci, G., Whitman, S. P., et al. (2008). An 86-
probe-set gene-expression signature predicts survival in cytogenetically normal acute
myeloid leukemia. Blood 112, 4193-4201.
338
Mi, S., Lu, J., Sun, M., Li, Z., Zhang, H., Neilly, M. B., Wang, Y., Qian, Z., Jin, J.,
Zhang, Y., et al. (2007). MicroRNA expression signatures accurately discriminate acute
lymphoblastic leukemia from acute myeloid leukemia. Proc Natl Acad Sci U S A 104,
19971-19976.
Minucci, S., Maccarana, M., Cioce, M., De Luca, P., Gelmetti, V., Segalla, S., Di Croce,
L., Giavara, S., Matteucci, C., Gobbi, A., et al. (2000). Oligomerization of RAR and
AML1 transcription factors as a novel mechanism of oncogenic activation. Mol Cell 5,
811-820.
Mizuki, M., Schwable, J., Steur, C., Choudhary, C., Agrawal, S., Sargin, B., Steffen, B.,
Matsumura, I., Kanakura, Y., Bohmer, F. D., et al. (2003). Suppression of myeloid
transcription factors and induction of STAT response genes by AML-specific Flt3
mutations. Blood 101, 3164-3173.
Morris, S. W., Kirstein, M. N., Valentine, M. B., Dittmer, K. G., Shapiro, D. N., Saltman,
D. L., and Look, A. T. (1994). Fusion of a kinase gene, ALK, to a nucleolar protein gene,
NPM, in non-Hodgkin's lymphoma. Science 263, 1281-1284.
Moss, T. (2004). At the crossroads of growth control; making ribosomal RNA. Curr Opin
Genet Dev 14, 210-217.
Muller-Tidow, C., Steffen, B., Cauvet, T., Tickenbrock, L., Ji, P., Diederichs, S., Sargin,
B., Kohler, G., Stelljes, M., Puccetti, E., et al. (2004). Translocation products in acute
myeloid leukemia activate the Wnt signaling pathway in hematopoietic cells. Mol Cell
Biol 24, 2890-2904.
Muller, M., Wilder, S., Bannasch, D., Israeli, D., Lehlbach, K., Li-Weber, M., Friedman,
S. L., Galle, P. R., Stremmel, W., Oren, M., and Krammer, P. H. (1998). p53 activates the
CD95 (APO-1/Fas) gene in response to DNA damage by anticancer drugs. J Exp Med
188, 2033-2045.
339
Mullighan, C. G., and Downing, J. R. (2009). Genome-wide profiling of genetic
alterations in acute lymphoblastic leukemia: recent insights and future directions.
Leukemia 23, 1209-1218.
Murano, K., Okuwaki, M., Hisaoka, M., and Nagata, K. (2008). Transcription regulation
of the rRNA gene by a multifunctional nucleolar protein, B23/nucleophosmin, through its
histone chaperone activity. Mol Cell Biol 28, 3114-3126.
Na, S. Y., Choi, H. S., Kim, J. W., Na, D. S., and Lee, J. W. (1998a). Bcl3, an IkappaB
protein, as a novel transcription coactivator of the retinoid X receptor. J Biol Chem 273,
30933-30938.
Na, S. Y., Kim, H. J., Lee, S. K., Choi, H. S., Na, D. S., Lee, M. O., Chung, M., Moore,
D. D., and Lee, J. W. (1998b). IkappaBbeta interacts with the retinoid X receptor and
inhibits retinoid-dependent transactivation in lipopolysaccharide-treated cells. J Biol
Chem 273, 3212-3215.
Naar, A. M., Boutin, J. M., Lipkin, S. M., Yu, V. C., Holloway, J. M., Glass, C. K., and
Rosenfeld, M. G. (1991). The orientation and spacing of core DNA-binding motifs
dictate selective transcriptional responses to three nuclear receptors. Cell 65, 1267-1279.
Nagpal, S., Friant, S., Nakshatri, H., and Chambon, P. (1993). RARs and RXRs: evidence
for two autonomous transactivation functions (AF-1 and AF-2) and heterodimerization in
vivo. EMBO J 12, 2349-2360.
Nakagawa, M., Kameoka, Y., and Suzuki, R. (2005). Nucleophosmin in acute
myelogenous leukemia. N Engl J Med 352, 1819-1820; author reply 1819-1820.
Nakamaki, T., Hino, K., Yokoyama, A., Hisatake, J., Tomoyasu, S., Honma, Y., Hozumi,
M., and Tsuruoka, N. (1994). Effect of cytokines on the proliferation and differentiation
of acute promyelocytic leukemia cells: possible relationship to the development of
"retinoic acid syndrome". Anticancer Res 14, 817-823.
Nakamura, S., Shiota, M., Nakagawa, A., Yatabe, Y., Kojima, M., Motoori, T., Suzuki,
R., Kagami, Y., Ogura, M., Morishima, Y., et al. (1997). Anaplastic large cell lymphoma:
340
a distinct molecular pathologic entity: a reappraisal with special reference to
p80(NPM/ALK) expression. Am J Surg Pathol 21, 1420-1432.
Nasr, R., Guillemin, M. C., Ferhi, O., Soilihi, H., Peres, L., Berthier, C., Rousselot, P.,
Robledo-Sarmiento, M., Lallemand-Breitenbach, V., Gourmel, B., et al. (2008).
Eradication of acute promyelocytic leukemia-initiating cells through PML-RARA
degradation. Nat Med 14, 1333-1342.
Nervi, C., Poindexter, E. C., Grignani, F., Pandolfi, P. P., Lo Coco, F., Avvisati, G.,
Pelicci, P. G., and Jetten, A. M. (1992). Characterization of the PML-RAR alpha
chimeric product of the acute promyelocytic leukemia-specific t(15;17) translocation.
Cancer Res 52, 3687-3692.
Nicci, C., Ottaviani, E., Luatti, S., Grafone, T., Tonelli, M., Motta, M. R., Malagola, M.,
Marzocchi, G., Martinelli, G., Baccarani, M., and Testoni, N. (2005). Molecular and
cytogenetic characterization of a new case of t(5;17)(q35;q21) variant acute
promyelocytic leukemia. Leukemia 19, 470-472.
Nishimura, Y., Ohkubo, T., Furuichi, Y., and Umekawa, H. (2002). Tryptophans 286 and
288 in the C-terminal region of protein B23.1 are important for its nucleolar localization.
Biosci Biotechnol Biochem 66, 2239-2242.
Noguera, N. I., Ammatuna, E., Zangrilli, D., Lavorgna, S., Divona, M., Buccisano, F.,
Amadori, S., Mecucci, C., Falini, B., and Lo-Coco, F. (2005). Simultaneous detection of
NPM1 and FLT3-ITD mutations by capillary electrophoresis in acute myeloid leukemia.
Leukemia 19, 1479-1482.
Nozawa, Y., Van Belzen, N., Van der Made, A. C., Dinjens, W. N., and Bosman, F. T.
(1996). Expression of nucleophosmin/B23 in normal and neoplastic colorectal mucosa. J
Pathol 178, 48-52.
Okazuka, K., Masuko, M., Seki, Y., Hama, H., Honma, N., Furukawa, T., Toba, K.,
Kishi, K., and Aizawa, Y. (2007). Successful all-trans retinoic acid treatment of acute
promyelocytic leukemia in a patient with NPM/RAR fusion. Int J Hematol 86, 246-249.
341
Okuda, M., Horn, H. F., Tarapore, P., Tokuyama, Y., Smulian, A. G., Chan, P. K.,
Knudsen, E. S., Hofmann, I. A., Snyder, J. D., Bove, K. E., and Fukasawa, K. (2000).
Nucleophosmin/B23 is a target of CDK2/cyclin E in centrosome duplication. Cell 103,
127-140.
Okutsu, J., Tsunoda, T., Kaneta, Y., Katagiri, T., Kitahara, O., Zembutsu, H., Yanagawa,
R., Miyawaki, S., Kuriyama, K., Kubota, N., et al. (2002). Prediction of chemosensitivity
for patients with acute myeloid leukemia, according to expression levels of 28 genes
selected by genome-wide complementary DNA microarray analysis. Mol Cancer Ther 1,
1035-1042.
Olney, H. J., Mitelman, F., Johansson, B., Mrozek, K., Berger, R., and Rowley, J. D.
(2002). Unique balanced chromosome abnormalities in treatment-related myelodysplastic
syndromes and acute myeloid leukemia: report from an international workshop. Genes
Chromosomes Cancer 33, 413-423.
Opipari, A. W., Jr., Boguski, M. S., and Dixit, V. M. (1990). The A20 cDNA induced by
tumor necrosis factor alpha encodes a novel type of zinc finger protein. J Biol Chem 265,
14705-14708.
Oren, T., Sher, J. A., and Evans, T. (2003). Hematopoiesis and retinoids: development
and disease. Leuk Lymphoma 44, 1881-1891.
Orkin, S. H., and Hochedlinger, K. (2011). Chromatin connections to pluripotency and
cellular reprogramming. Cell 145, 835-850.
Ota, J., Yamashita, Y., Okawa, K., Kisanuki, H., Fujiwara, S., Ishikawa, M., Lim Choi,
Y., Ueno, S., Ohki, R., Koinuma, K., et al. (2003). Proteomic analysis of hematopoietic
stem cell-like fractions in leukemic disorders. Oncogene 22, 5720-5728.
Pahl, H. L. (1999). Activators and target genes of Rel/NF-kappaB transcription factors.
Oncogene 18, 6853-6866.
Pandolfi, P. P., Alcalay, M., Longo, L., Fagioli, M., Zangrilli, D., Grignani, F.,
Menccarelli, A., Biondi, A., Rambaldi, A., LoCoco, F., and et al. (1992). Molecular
342
genetics of the t(15;17) of acute promyelocytic leukemia (APPL). Leukemia 6 Suppl 3,
120S-122S.
Pandolfi, P. P., Grignani, F., Alcalay, M., Mencarelli, A., Biondi, A., LoCoco, F., and
Pelicci, P. G. (1991). Structure and origin of the acute promyelocytic leukemia myl/RAR
alpha cDNA and characterization of its retinoid-binding and transactivation properties.
Oncogene 6, 1285-1292.
Pang, Q., Christianson, T. A., Koretsky, T., Carlson, H., David, L., Keeble, W., Faulkner,
G. R., Speckhart, A., and Bagby, G. C. (2003). Nucleophosmin interacts with and inhibits
the catalytic function of eukaryotic initiation factor 2 kinase PKR. J Biol Chem 278,
41709-41717.
Park, D. J., Vuong, P. T., de Vos, S., Douer, D., and Koeffler, H. P. (2003). Comparative
analysis of genes regulated by PML/RAR alpha and PLZF/RAR alpha in response to
retinoic acid using oligonucleotide arrays. Blood 102, 3727-3736.
Passegue, E., and Weisman, I. L. (2005). Leukemic stem cells: where do they come
from? Stem Cell Rev 1, 181-188.
Payton, J. E., Grieselhuber, N. R., Chang, L. W., Murakami, M., Geiss, G. K., Link, D.
C., Nagarajan, R., Watson, M. A., and Ley, T. J. (2009). High throughput digital
quantification of mRNA abundance in primary human acute myeloid leukemia samples. J
Clin Invest 119, 1714-1726.
Paz-Priel, I., Houng, S., Dooher, J., and Friedman, A. D. (2011). C/EBPalpha and
C/EBPalpha oncoproteins regulate nfkb1 and displace histone deacetylases from NF-
kappaB p50 homodimers to induce NF-kappaB target genes. Blood 117, 4085-4094.
Pearson, M., Carbone, R., Sebastiani, C., Cioce, M., Fagioli, M., Saito, S., Higashimoto,
Y., Appella, E., Minucci, S., Pandolfi, P. P., and Pelicci, P. G. (2000). PML regulates p53
acetylation and premature senescence induced by oncogenic Ras. Nature 406, 207-210.
343
Perez, A., Kastner, P., Sethi, S., Lutz, Y., Reibel, C., and Chambon, P. (1993). PMLRAR
homodimers: distinct DNA binding properties and heteromeric interactions with RXR.
EMBO J 12, 3171-3182.
Peter, M., Nakagawa, J., Doree, M., Labbe, J. C., and Nigg, E. A. (1990). Identification
of major nucleolar proteins as candidate mitotic substrates of cdc2 kinase. Cell 60, 791-
801.
Petkovich, M., Brand, N. J., Krust, A., and Chambon, P. (1987). A human retinoic acid
receptor which belongs to the family of nuclear receptors. Nature 330, 444-450.
Piazza, F., Gurrieri, C., and Pandolfi, P. P. (2001). The theory of APL. Oncogene 20,
7216-7222.
Pitti, R. M., Marsters, S. A., Lawrence, D. A., Roy, M., Kischkel, F. C., Dowd, P.,
Huang, A., Donahue, C. J., Sherwood, S. W., Baldwin, D. T., et al. (1998). Genomic
amplification of a decoy receptor for Fas ligand in lung and colon cancer. Nature 396,
699-703.
Pollock, J. L., Westervelt, P., Walter, M. J., Lane, A. A., and Ley, T. J. (2001). Mouse
models of acute promyelocytic leukemia. Curr Opin Hematol 8, 206-211.
Powell, B. L., Moser, B., Stock, W., Gallagher, R. E., Willman, C. L., Stone, R. M.,
Rowe, J. M., Coutre, S., Feusner, J. H., Gregory, J., et al. (2010). Arsenic trioxide
improves event-free and overall survival for adults with acute promyelocytic leukemia:
North American Leukemia Intergroup Study C9710. Blood 116, 3751-3757.
Pronk, C. J., Veiby, O. P., Bryder, D., and Jacobsen, S. E. (2011). Tumor necrosis factor
restricts hematopoietic stem cell activity in mice: involvement of two distinct receptors. J
Exp Med 208, 1563-1570.
Puccetti, E., and Ruthardt, M. (2004). Acute promyelocytic leukemia: PML/RARalpha
and the leukemic stem cell. Leukemia 18, 1169-1175.
344
Qi, W., Shakalya, K., Stejskal, A., Goldman, A., Beeck, S., Cooke, L., and Mahadevan,
D. (2008). NSC348884, a nucleophosmin inhibitor disrupts oligomer formation and
induces apoptosis in human cancer cells. Oncogene 27, 4210-4220.
Rajaram, S., and Oono, Y. (2010). NeatMap--non-clustering heat map alternatives in R.
BMC Bioinformatics 11, 45.
Redner, R. L., Chen, J. D., Rush, E. A., Li, H., and Pollock, S. L. (2000). The t(5;17)
acute promyelocytic leukemia fusion protein NPM-RAR interacts with co-repressor and
co-activator proteins and exhibits both positive and negative transcriptional properties.
Blood 95, 2683-2690.
Redner, R. L., Rush, E. A., Faas, S., Rudert, W. A., and Corey, S. J. (1996). The t(5;17)
variant of acute promyelocytic leukemia expresses a nucleophosmin-retinoic acid
receptor fusion. Blood 87, 882-886.
Rego, E. M., Ruggero, D., Tribioli, C., Cattoretti, G., Kogan, S., Redner, R. L., and
Pandolfi, P. P. (2006). Leukemia with distinct phenotypes in transgenic mice expressing
PML/RAR alpha, PLZF/RAR alpha or NPM/RAR alpha. Oncogene 25, 1974-1979.
Reis, P. P., Rogatto, S. R., Kowalski, L. P., Nishimoto, I. N., Montovani, J. C., Corpus,
G., Squire, J. A., and Kamel-Reid, S. (2002). Quantitative real-time PCR identifies a
critical region of deletion on 22q13 related to prognosis in oral cancer. Oncogene 21,
6480-6487.
Renaud, J. P., Rochel, N., Ruff, M., Vivat, V., Chambon, P., Gronemeyer, H., and Moras,
D. (1995). Crystal structure of the RAR-gamma ligand-binding domain bound to all-trans
retinoic acid. Nature 378, 681-689.
Reya, T., Morrison, S. J., Clarke, M. F., and Weissman, I. L. (2001). Stem cells, cancer,
and cancer stem cells. Nature 414, 105-111.
Rice, K. L., Hormaeche, I., Doulatov, S., Flatow, J. M., Grimwade, D., Mills, K. I.,
Leiva, M., Ablain, J., Ambardekar, C., McConnell, M. J., et al. (2009). Comprehensive
345
genomic screens identify a role for PLZF-RARalpha as a positive regulator of cell
proliferation via direct regulation of c-MYC. Blood 114, 5499-5511.
Ricote, M., Snyder, C. S., Leung, H. Y., Chen, J., Chien, K. R., and Glass, C. K. (2006).
Normal hematopoiesis after conditional targeting of RXRalpha in murine hematopoietic
stem/progenitor cells. J Leukoc Biol 80, 850-861.
Ritossa, F. M., and Spiegelman, S. (1965). Localization of DNA Complementary to
Ribosomal Rna in the Nucleolus Organizer Region of Drosophila Melanogaster. Proc
Natl Acad Sci U S A 53, 737-745.
Roboz, G. J., and Guzman, M. (2009). Acute myeloid leukemia stem cells: seek and
destroy. Expert Rev Hematol 2, 663-672.
Rosenbauer, F., and Tenen, D. G. (2007). Transcription factors in myeloid development:
balancing differentiation with transformation. Nat Rev Immunol 7, 105-117.
Ross, S. A., McCaffery, P. J., Drager, U. C., and De Luca, L. M. (2000). Retinoids in
embryonal development. Physiol Rev 80, 1021-1054.
Roussel, P., and Hernandez-Verdun, D. (1994). Identification of Ag-NOR proteins,
markers of proliferation related to ribosomal gene activity. Exp Cell Res 214, 465-472.
Ruggero, D., and Pandolfi, P. P. (2003). Does the ribosome translate cancer? Nat Rev
Cancer 3, 179-192.
Rush, E. A., Schlesinger, K. W., Watkins, S. C., and Redner, R. L. (2006). The NPM-
RAR fusion protein associated with the t(5;17) variant of APL does not interact with
PML. Leuk Res 30, 979-986.
Saito, Y., Kitamura, H., Hijikata, A., Tomizawa-Murasawa, M., Tanaka, S., Takagi, S.,
Uchida, N., Suzuki, N., Sone, A., Najima, Y., et al. (2010). Identification of therapeutic
targets for quiescent, chemotherapy-resistant human leukemia stem cells. Sci Transl Med
2, 17ra19.
346
Savkur, R. S., and Olson, M. O. (1998). Preferential cleavage in pre-ribosomal RNA
byprotein B23 endoribonuclease. Nucleic Acids Res 26, 4508-4515.
Schmitz, M. L., Bacher, S., and Kracht, M. (2001). I kappa B-independent control of NF-
kappa B activity by modulatory phosphorylations. Trends Biochem Sci 26, 186-190.
Schmitz, M. L., Mattioli, I., Buss, H., and Kracht, M. (2004). NF-kappaB: a multifaceted
transcription factor regulated at several levels. Chembiochem 5, 1348-1358.
Schneider-Jakob, S., Corazza, N., Badmann, A., Sidler, D., Stuber-Roos, R., Keogh, A.,
Frese, S., Tschan, M., and Brunner, T. (2010). Synergistic induction of cell death in liver
tumor cells by TRAIL and chemotherapeutic drugs via the BH3-only proteins Bim and
Bid. Cell Death Dis 1, e86.
Schofield, R. (1978). The relationship between the spleen colony-forming cell and the
haemopoietic stem cell. Blood Cells 4, 7-25.
Sen, R., and Baltimore, D. (1986). Multiple nuclear factors interact with the
immunoglobulin enhancer sequences. Cell 46, 705-716.
Setoguchi, K., Misaki, Y., Terauchi, Y., Yamauchi, T., Kawahata, K., Kadowaki, T., and
Yamamoto, K. (2001). Peroxisome proliferator-activated receptor-gamma
haploinsufficiency enhances B cell proliferative responses and exacerbates
experimentally induced arthritis. J Clin Invest 108, 1667-1675.
Shankaranarayanan, P., Rossin, A., Khanwalkar, H., Alvarez, S., Alvarez, R., Jacobson,
A., Nebbioso, A., de Lera, A. R., Altucci, L., and Gronemeyer, H. (2009). Growth factor-
antagonized rexinoid apoptosis involves permissive PPARgamma/RXR heterodimers to
activate the intrinsic death pathway by NO. Cancer Cell 16, 220-231.
Shao, W., Fanelli, M., Ferrara, F. F., Riccioni, R., Rosenauer, A., Davison, K., Lamph,
W. W., Waxman, S., Pelicci, P. G., Lo Coco, F., et al. (1998). Arsenic trioxide as an
inducer of apoptosis and loss of PML/RAR alpha protein in acute promyelocytic
leukemia cells. J Natl Cancer Inst 90, 124-133.
347
Sherr, C. J. (2001). The INK4a/ARF network in tumour suppression. Nat Rev Mol Cell
Biol 2, 731-737.
Shiohara, M., Dawson, M. I., Hobbs, P. D., Sawai, N., Higuchi, T., Koike, K.,
Komiyama, A., and Koeffler, H. P. (1999). Effects of novel RAR- and RXR-selective
retinoids on myeloid leukemic proliferation and differentiation in vitro. Blood 93, 2057-
2066.
Shiota, M., Fujimoto, J., Takenaga, M., Satoh, H., Ichinohasama, R., Abe, M., Nakano,
M., Yamamoto, T., and Mori, S. (1994). Diagnosis of t(2;5)(p23;q35)-associated Ki-1
lymphoma with immunohistochemistry. Blood 84, 3648-3652.
Si, J., and Collins, S. J. (2002). IL-3-induced enhancement of retinoic acid receptor
activity is mediated through Stat5, which physically associates with retinoic acid
receptors in an IL-3-dependent manner. Blood 100, 4401-4409.
Siller, K. H., Cabernard, C., and Doe, C. Q. (2006). The NuMA-related Mud protein
binds Pins and regulates spindle orientation in Drosophila neuroblasts. Nat Cell Biol 8,
594-600.
Skaar, T. C., Prasad, S. C., Sharareh, S., Lippman, M. E., Brunner, N., and Clarke, R.
(1998). Two-dimensional gel electrophoresis analyses identify nucleophosmin as an
estrogen regulated protein associated with acquired estrogen-independence in human
breast cancer cells. J Steroid Biochem Mol Biol 67, 391-402.
So, C. W., Dong, S., So, C. K., Cheng, G. X., Huang, Q. H., Chen, S. J., and Chan, L. C.
(2000). The impact of differential binding of wild-type RARalpha, PML-, PLZF- and
NPM-RARalpha fusion proteins towards transcriptional co-activator, RIP-140, on
retinoic acid responses in acute promyelocytic leukemia. Leukemia 14, 77-83.
Sohal, J., Phan, V. T., Chan, P. V., Davis, E. M., Patel, B., Kelly, L. M., Abrams, T. J.,
O'Farrell, A. M., Gilliland, D. G., Le Beau, M. M., and Kogan, S. C. (2003). A model of
APL with FLT3 mutation is responsive to retinoic acid and a receptor tyrosine kinase
inhibitor, SU11657. Blood 101, 3188-3197.
348
Song, H. Y., Rothe, M., and Goeddel, D. V. (1996). The tumor necrosis factor-inducible
zinc finger protein A20 interacts with TRAF1/TRAF2 and inhibits NF-kappaB activation.
Proc Natl Acad Sci U S A 93, 6721-6725.
Song, M. S., Salmena, L., Carracedo, A., Egia, A., Lo-Coco, F., Teruya-Feldstein, J., and
Pandolfi, P. P. (2008). The deubiquitinylation and localization of PTEN are regulated by
a HAUSP-PML network. Nature 455, 813-817.
Spicuglia, S., Vincent-Fabert, C., Benoukraf, T., Tiberi, G., Saurin, A. J., Zacarias-
Cabeza, J., Grimwade, D., Mills, K., Calmels, B., Bertucci, F., et al. (2011).
Characterisation of genome-wide PLZF/RARA target genes. PLoS One 6, e24176.
Steinert, G., Oancea, C., Roos, J., Hagemeyer, H., Maier, T., Ruthardt, M., and Puccetti,
E. (2011). Sulindac sulfide reverses aberrant self-renewal of progenitor cells induced by
the AML-associated fusion proteins PML/RARalpha and PLZF/RARalpha. PLoS One 6,
e22540.
Stephensen, C. B., Borowsky, A. D., and Lloyd, K. C. (2007). Disruption of Rxra gene in
thymocytes and T lymphocytes modestly alters lymphocyte frequencies, proliferation,
survival and T helper type 1/type 2 balance. Immunology 121, 484-498.
Sternsdorf, T., Phan, V. T., Maunakea, M. L., Ocampo, C. B., Sohal, J., Silletto, A.,
Galimi, F., Le Beau, M. M., Evans, R. M., and Kogan, S. C. (2006). Forced retinoic acid
receptor alpha homodimers prime mice for APL-like leukemia. Cancer Cell 9, 81-94.
Strair, R. K., Gharibo, M., Schaar, D., Rubin, A., Harrison, J., Aisner, J., Lin, H. C., Lin,
Y., Goodell, L., Anand, M., et al. (2008). Nuclear factor-kappaB modulation in patients
undergoing induction chemotherapy for acute myelogenous leukemia. Clin Cancer Res
14, 7564-7568.
Subong, E. N., Shue, M. J., Epstein, J. I., Briggman, J. V., Chan, P. K., and Partin, A. W.
(1999). Monoclonal antibody to prostate cancer nuclear matrix protein (PRO:4-216)
recognizes nucleophosmin/B23. Prostate 39, 298-304.
349
Subramanian, A., Tamayo, P., Mootha, V. K., Mukherjee, S., Ebert, B. L., Gillette, M.
A., Paulovich, A., Pomeroy, S. L., Golub, T. R., Lander, E. S., and Mesirov, J. P. (2005).
Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide
expression profiles. Proc Natl Acad Sci U S A 102, 15545-15550.
Subramanyam, D., Belair, C. D., Barry-Holson, K. Q., Lin, H., Kogan, S. C., Passegue,
E., and Blelloch, R. (2011). PML-RAR{alpha} and Dnmt3a1 cooperate in vivo to
promote acute promyelocytic leukemia. Cancer Res 70, 8792-8801.
Sucov, H. M., Dyson, E., Gumeringer, C. L., Price, J., Chien, K. R., and Evans, R. M.
(1994). RXR alpha mutant mice establish a genetic basis for vitamin A signaling in heart
morphogenesis. Genes Dev 8, 1007-1018.
Suda, T., Arai, F., and Hirao, A. (2005). Hematopoietic stem cells and their niche. Trends
Immunol 26, 426-433.
Sukhai, M. A., Thomas, M., Hamadanizadeh, S. A., Xuan, Y., Wells, R. A., and Kamel-
Reid, S. (2011). Correlation among nuclear localization of NuMA-RARalpha,
deregulation of gene expression and leukemic phenotype of hCG-NuMA-RARalpha
transgenic mice. Leuk Res 35, 670-676.
Sukhai, M. A., Thomas, M., Xuan, Y., Chan, L. S., Hamadanizadeh, S. A., Zhang, T.,
Bharadwaj, R. R., Schuh, A. C., Wells, R. A., and Kamel-Reid, S. (2008). Evidence of
functional interaction between NuMA-RARalpha and RXRalpha in an in vivo model of
acute promyelocytic leukemia. Oncogene 27, 4666-4677.
Sukhai, M. A., Wu, X., Xuan, Y., Zhang, T., Reis, P. P., Dube, K., Rego, E. M.,
Bhaumik, M., Bailey, D. J., Wells, R. A., et al. (2004). Myeloid leukemia with
promyelocytic features in transgenic mice expressing hCG-NuMA-RARalpha. Oncogene
23, 665-678.
Sun, S. C., Ganchi, P. A., Ballard, D. W., and Greene, W. C. (1993). NF-kappa B
controls expression of inhibitor I kappa B alpha: evidence for an inducible autoregulatory
pathway. Science 259, 1912-1915.
350
Szanto, A., Narkar, V., Shen, Q., Uray, I. P., Davies, P. J., and Nagy, L. (2004). Retinoid
X receptors: X-ploring their (patho)physiological functions. Cell Death Differ 11 Suppl 2,
S126-143.
Tabas-Madrid, D., Nogales-Cadenas, R., and Pascual-Montano, A. (2012). GeneCodis3:
a non-redundant and modular enrichment analysis tool for functional genomics. Nucleic
Acids Res 40, W478-483.
Tagliafico, E., Tenedini, E., Manfredini, R., Grande, A., Ferrari, F., Roncaglia, E.,
Bicciato, S., Zini, R., Salati, S., Bianchi, E., et al. (2006). Identification of a molecular
signature predictive of sensitivity to differentiation induction in acute myeloid leukemia.
Leukemia 20, 1751-1758.
Takemura, M., Ohta, N., Furuichi, Y., Takahashi, T., Yoshida, S., Olson, M. O., and
Umekawa, H. (1994). Stimulation of calf thymus DNA polymerase alpha activity by
nucleolar protein B23. Biochem Biophys Res Commun 199, 46-51.
Takemura, M., Sato, K., Nishio, M., Akiyama, T., Umekawa, H., and Yoshida, S. (1999).
Nucleolar protein B23.1 binds to retinoblastoma protein and synergistically stimulates
DNA polymerase alpha activity. J Biochem 125, 904-909.
Tang, E. D., Wang, C. Y., Xiong, Y., and Guan, K. L. (2003). A role for NF-kappaB
essential modifier/IkappaB kinase-gamma (NEMO/IKKgamma) ubiquitination in the
activation of the IkappaB kinase complex by tumor necrosis factor-alpha. J Biol Chem
278, 37297-37305.
Tang, T. K., Tang, C. J., Chao, Y. J., and Wu, C. W. (1994). Nuclear mitotic apparatus
protein (NuMA): spindle association, nuclear targeting and differential subcellular
localization of various NuMA isoforms. J Cell Sci 107 ( Pt 6), 1389-1402.
Tao, R. H., Berkova, Z., Wise, J. F., Rezaeian, A. H., Daniluk, U., Ao, X., Hawke, D. H.,
Karp, J. E., Lin, H. K., Molldrem, J. J., and Samaniego, F. (2011). PMLRARalpha binds
to Fas and suppresses Fas-mediated apoptosis through recruiting c-FLIP in vivo. Blood
118, 3107-3118.
351
Taschner, S., Koesters, C., Platzer, B., Jorgl, A., Ellmeier, W., Benesch, T., and Strobl,
H. (2007). Down-regulation of RXRalpha expression is essential for neutrophil
development from granulocyte/monocyte progenitors. Blood 109, 971-979.
Tegethoff, S., Behlke, J., and Scheidereit, C. (2003). Tetrameric oligomerization of
IkappaB kinase gamma (IKKgamma) is obligatory for IKK complex activity and NF-
kappaB activation. Mol Cell Biol 23, 2029-2041.
Testa, U., Grignani, F., Samoggia, P., Zanetti, C., Riccioni, R., Lo Coco, F., Diverio, D.,
Felli, N., Passerini, C. G., Grell, M., et al. (1998). The PML/RARalpha fusion protein
inhibits tumor necrosis factor-alpha-induced apoptosis in U937 cells and acute
promyelocytic leukemia blasts. J Clin Invest 101, 2278-2289.
Ting, A. T., Pimentel-Muinos, F. X., and Seed, B. (1996). RIP mediates tumor necrosis
factor receptor 1 activation of NF-kappaB but not Fas/APO-1-initiated apoptosis. EMBO
J 15, 6189-6196.
Tokuyama, Y., Horn, H. F., Kawamura, K., Tarapore, P., and Fukasawa, K. (2001).
Specific phosphorylation of nucleophosmin on Thr(199) by cyclin-dependent kinase 2-
cyclin E and its role in centrosome duplication. J Biol Chem 276, 21529-21537.
Trotman, L. C., Wang, X., Alimonti, A., Chen, Z., Teruya-Feldstein, J., Yang, H.,
Pavletich, N. P., Carver, B. S., Cordon-Cardo, C., Erdjument-Bromage, H., et al. (2007).
Ubiquitination regulates PTEN nuclear import and tumor suppression. Cell 128, 141-156.
Trumpp, A., Essers, M., and Wilson, A. (2010). Awakening dormant haematopoietic
stem cells. Nat Rev Immunol 10, 201-209.
Trus, M. R., Yang, L., Suarez Saiz, F., Bordeleau, L., Jurisica, I., and Minden, M. D.
(2005). The histone deacetylase inhibitor valproic acid alters sensitivity towards all trans
retinoic acid in acute myeloblastic leukemia cells. Leukemia 19, 1161-1168.
Tsao, C. J., Ozawa, K., Hosoi, T., Urabe, A., and Takaku, F. (1986). In-vitro effects of
antineoplastic prostaglandins on human leukemic cell growth and normal myelopoiesis.
Leuk Res 10, 527-532.
352
Tsimberidou, A. M., Tirado-Gomez, M., Andreeff, M., O'Brien, S., Kantarjian, H.,
Keating, M., Lopez-Berestein, G., and Estey, E. (2006). Single-agent liposomal all-trans
retinoic acid can cure some patients with untreated acute promyelocytic leukemia: an
update of The University of Texas M. D. Anderson Cancer Center Series. Leuk
Lymphoma 47, 1062-1068.
Tsui, K. H., Cheng, A. J., Chang, P. L., Pan, T. L., and Yung, B. Y. (2004). Association
of nucleophosmin/B23 mRNA expression with clinical outcome in patients with bladder
carcinoma. Urology 64, 839-844.
Turhan, A. G., Lemoine, F. M., Debert, C., Bonnet, M. L., Baillou, C., Picard, F.,
Macintyre, E. A., and Varet, B. (1995). Highly purified primitive hematopoietic stem
cells are PML-RARA negative and generate nonclonal progenitors in acute
promyelocytic leukemia. Blood 85, 2154-2161.
Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991). Direct
repeats as selective response elements for the thyroid hormone, retinoic acid, and vitamin
D3 receptors. Cell 65, 1255-1266.
Valk, P. J., Verhaak, R. G., Beijen, M. A., Erpelinck, C. A., Barjesteh van Waalwijk van
Doorn-Khosrovani, S., Boer, J. M., Beverloo, H. B., Moorhouse, M. J., van der Spek, P.
J., Lowenberg, B., and Delwel, R. (2004). Prognostically useful gene-expression profiles
in acute myeloid leukemia. N Engl J Med 350, 1617-1628.
Vardiman, J. W., Harris, N. L., and Brunning, R. D. (2002). The World Health
Organization (WHO) classification of the myeloid neoplasms. Blood 100, 2292-2302.
Vardiman, J. W., Thiele, J., Arber, D. A., Brunning, R. D., Borowitz, M. J., Porwit, A.,
Harris, N. L., Le Beau, M. M., Hellstrom-Lindberg, E., Tefferi, A., and Bloomfield, C. D.
(2009). The 2008 revision of the World Health Organization (WHO) classification of
myeloid neoplasms and acute leukemia: rationale and important changes. Blood 114,
937-951.
353
Vascotto, C., Fantini, D., Romanello, M., Cesaratto, L., Deganuto, M., Leonardi, A.,
Radicella, J. P., Kelley, M. R., D'Ambrosio, C., Scaloni, A., et al. (2009). APE1/Ref-1
interacts with NPM1 within nucleoli and plays a role in the rRNA quality control process.
Mol Cell Biol 29, 1834-1854.
Vassiliou, G. S., Cooper, J. L., Rad, R., Li, J., Rice, S., Uren, A., Rad, L., Ellis, P.,
Andrews, R., Banerjee, R., et al. (2011). Mutant nucleophosmin and cooperating
pathways drive leukemia initiation and progression in mice. Nat Genet 43, 470-475.
Verhaak, R. G., Wouters, B. J., Erpelinck, C. A., Abbas, S., Beverloo, H. B., Lugthart, S.,
Lowenberg, B., Delwel, R., and Valk, P. J. (2009). Prediction of molecular subtypes in
acute myeloid leukemia based on gene expression profiling. Haematologica 94, 131-134.
Vinay Kumar, A. K. A., Nelson Fausto, ed. (2004). Robbins & Cotran Pathologic Basis
of Disease, 7 edn.
Wade, D. P., Puckey, L. H., Knight, B. L., Acquati, F., Mihalich, A., and Taramelli, R.
(1997). Characterization of multiple enhancer regions upstream of the apolipoprotein(a)
gene. J Biol Chem 272, 30387-30399.
Walter, M. J., Park, J. S., Lau, S. K., Li, X., Lane, A. A., Nagarajan, R., Shannon, W. D.,
and Ley, T. J. (2004). Expression profiling of murine acute promyelocytic leukemia cells
reveals multiple model-dependent progression signatures. Mol Cell Biol 24, 10882-
10893.
Wang, K., Wang, P., Shi, J., Zhu, X., He, M., Jia, X., Yang, X., Qiu, F., Jin, W., Qian,
M., et al. (2010). PML/RARalpha targets promoter regions containing PU.1 consensus
and RARE half sites in acute promyelocytic leukemia. Cancer Cell 17, 186-197.
Wang, L. D., and Wagers, A. J. (2011). Dynamic niches in the origination and
differentiation of haematopoietic stem cells. Nat Rev Mol Cell Biol 12, 643-655.
Wang, W., Budhu, A., Forgues, M., and Wang, X. W. (2005). Temporal and spatial
control of nucleophosmin by the Ran-Crm1 complex in centrosome duplication. Nat Cell
Biol 7, 823-830.
354
Wang, Z. G., Ruggero, D., Ronchetti, S., Zhong, S., Gaboli, M., Rivi, R., and Pandolfi, P.
P. (1998). PML is essential for multiple apoptotic pathways. Nat Genet 20, 266-272.
Wang, Z. Y., and Chen, Z. (2008). Acute promyelocytic leukemia: from highly fatal to
highly curable. Blood 111, 2505-2515.
Warr, M. R., Pietras, E. M., and Passegue, E. (2011). Mechanisms controlling
hematopoietic stem cell functions during normal hematopoiesis and hematological
malignancies. Wiley Interdiscip Rev Syst Biol Med 3, 681-701.
Warrell, R. P., Jr., de The, H., Wang, Z. Y., and Degos, L. (1993). Acute promyelocytic
leukemia. N Engl J Med 329, 177-189.
Wartman, L. D., Larson, D. E., Xiang, Z., Ding, L., Chen, K., Lin, L., Cahan, P., Klco, J.
M., Welch, J. S., Li, C., et al. (2011). Sequencing a mouse acute promyelocytic leukemia
genome reveals genetic events relevant for disease progression. J Clin Invest 121, 1445-
1455.
Weber, J. D., Taylor, L. J., Roussel, M. F., Sherr, C. J., and Bar-Sagi, D. (1999).
Nucleolar Arf sequesters Mdm2 and activates p53. Nat Cell Biol 1, 20-26.
Welch, J. S., Yuan, W., and Ley, T. J. (2011). PML-RARA can increase hematopoietic
self-renewal without causing a myeloproliferative disease in mice. J Clin Invest 121,
1636-1645.
Wells, R. A., Catzavelos, C., and Kamel-Reid, S. (1997). Fusion of retinoic acid receptor
alpha to NuMA, the nuclear mitotic apparatus protein, by a variant translocation in acute
promyelocytic leukaemia. Nat Genet 17, 109-113.
Wells, R. A., Hummel, J. L., De Koven, A., Zipursky, A., Kirby, M., Dube, I., and
Kamel-Reid, S. (1996). A new variant translocation in acute promyelocytic leukaemia:
molecular characterization and clinical correlation. Leukemia 10, 735-740.
355
Wertz, I. E., O'Rourke, K. M., Zhou, H., Eby, M., Aravind, L., Seshagiri, S., Wu, P.,
Wiesmann, C., Baker, R., Boone, D. L., et al. (2004). De-ubiquitination and ubiquitin
ligase domains of A20 downregulate NF-kappaB signalling. Nature 430, 694-699.
Westervelt, P., Lane, A. A., Pollock, J. L., Oldfather, K., Holt, M. S., Zimonjic, D. B.,
Popescu, N. C., DiPersio, J. F., and Ley, T. J. (2003). High-penetrance mouse model of
acute promyelocytic leukemia with very low levels of PML-RARalpha expression. Blood
102, 1857-1865.
White, E. (2003). The pims and outs of survival signaling: role for the Pim-2 protein
kinase in the suppression of apoptosis by cytokines. Genes Dev 17, 1813-1816.
Wiese, C., Wilde, A., Moore, M. S., Adam, S. A., Merdes, A., and Zheng, Y. (2001).
Role of importin-beta in coupling Ran to downstream targets in microtubule assembly.
Science 291, 653-656.
Wilson, A., Oser, G. M., Jaworski, M., Blanco-Bose, W. E., Laurenti, E., Adolphe, C.,
Essers, M. A., Macdonald, H. R., and Trumpp, A. (2007). Dormant and self-renewing
hematopoietic stem cells and their niches. Ann N Y Acad Sci 1106, 64-75.
Wilson, C. S., Davidson, G. S., Martin, S. B., Andries, E., Potter, J., Harvey, R., Ar, K.,
Xu, Y., Kopecky, K. J., Ankerst, D. P., et al. (2006). Gene expression profiling of adult
acute myeloid leukemia identifies novel biologic clusters for risk classification and
outcome prediction. Blood 108, 685-696.
Witcher, M., Pettersson, F., Dupere-Richer, D., Padovani, A., Summers-Deluca, L.,
Baldwin, A. S., and Miller, W. H., Jr. (2008). Retinoic acid modulates chromatin to
potentiate tumor necrosis factor alpha signaling on the DIF2 promoter. Nucleic Acids Res
36, 435-443.
Witcher, M., Ross, D. T., Rousseau, C., Deluca, L., and Miller, W. H., Jr. (2003).
Synergy between all-trans retinoic acid and tumor necrosis factor pathways in acute
leukemia cells. Blood 102, 237-245.
356
Witcher, M., Shiu, H. Y., Guo, Q., and Miller, W. H., Jr. (2004). Combination of retinoic
acid and tumor necrosis factor overcomes the maturation block in a variety of retinoic
acid-resistant acute promyelocytic leukemia cells. Blood 104, 3335-3342.
Wojiski, S., Guibal, F. C., Kindler, T., Lee, B. H., Jesneck, J. L., Fabian, A., Tenen, D.
G., and Gilliland, D. G. (2009). PML-RARalpha initiates leukemia by conferring
properties of self-renewal to committed promyelocytic progenitors. Leukemia 23, 1462-
1471.
Xu, L., Zhao, W. L., Xiong, S. M., Su, X. Y., Zhao, M., Wang, C., Gao, Y. R., Niu, C.,
Cao, Q., Gu, B. W., et al. (2001). Molecular cytogenetic characterization and clinical
relevance of additional, complex and/or variant chromosome abnormalities in acute
promyelocytic leukemia. Leukemia 15, 1359-1368.
Yamamoto, Y., Tsuzuki, S., Tsuzuki, M., Handa, K., Inaguma, Y., and Emi, N. (2010).
BCOR as a novel fusion partner of retinoic acid receptor alpha in a t(X;17)(p11;q12)
variant of acute promyelocytic leukemia. Blood 116, 4274-4283.
Yan, B., Zemskova, M., Holder, S., Chin, V., Kraft, A., Koskinen, P. J., and Lilly, M.
(2003). The PIM-2 kinase phosphorylates BAD on serine 112 and reverses BAD-induced
cell death. J Biol Chem 278, 45358-45367.
Yang, L., Dybedal, I., Bryder, D., Nilsson, L., Sitnicka, E., Sasaki, Y., and Jacobsen, S.
E. (2005). IFN-gamma negatively modulates self-renewal of repopulating human
hemopoietic stem cells. J Immunol 174, 752-757.
Yang, L., Zhao, H., Li, S. W., Ahrens, K., Collins, C., Eckenrode, S., Ruan, Q. G.,
McIndoe, R. A., and She, J. X. (2003). Gene expression profiling during all-trans retinoic
acid-induced cell differentiation of acute promyelocytic leukemia cells. J Mol Diagn 5,
212-221.
Ye, K. (2005). Nucleophosmin/B23, a multifunctional protein that can regulate apoptosis.
Cancer Biol Ther 4, 918-923.
357
Yoneda-Kato, N., Look, A. T., Kirstein, M. N., Valentine, M. B., Raimondi, S. C.,
Cohen, K. J., Carroll, A. J., and Morris, S. W. (1996). The t(3;5)(q25.1;q34) of
myelodysplastic syndrome and acute myeloid leukemia produces a novel fusion gene,
NPM-MLF1. Oncogene 12, 265-275.
Yonemura, Y., Ku, H., Hirayama, F., Souza, L. M., and Ogawa, M. (1996). Interleukin 3
or interleukin 1 abrogates the reconstituting ability of hematopoietic stem cells. Proc Natl
Acad Sci U S A 93, 4040-4044.
Youn, B. S., Mantel, C., and Broxmeyer, H. E. (2000). Chemokines, chemokine receptors
and hematopoiesis. Immunol Rev 177, 150-174.
Yu, V. C., Delsert, C., Andersen, B., Holloway, J. M., Devary, O. V., Naar, A. M., Kim,
S. Y., Boutin, J. M., Glass, C. K., and Rosenfeld, M. G. (1991). RXR beta: a coregulator
that enhances binding of retinoic acid, thyroid hormone, and vitamin D receptors to their
cognate response elements. Cell 67, 1251-1266.
Yu, Y., Maggi, L. B., Jr., Brady, S. N., Apicelli, A. J., Dai, M. S., Lu, H., and Weber, J.
D. (2006). Nucleophosmin is essential for ribosomal protein L5 nuclear export. Mol Cell
Biol 26, 3798-3809.
Yuan, W., Payton, J. E., Holt, M. S., Link, D. C., Watson, M. A., DiPersio, J. F., and Ley,
T. J. (2007). Commonly dysregulated genes in murine APL cells. Blood 109, 961-970.
Yung, B. Y., Bor, A. M., and Chan, P. K. (1990). Short exposure to actinomycin D
induces "reversible" translocation of protein B23 as well as "reversible" inhibition of cell
growth and RNA synthesis in HeLa cells. Cancer Res 50, 5987-5991.
Yung, B. Y., Busch, H., and Chan, P. K. (1985). Translocation of nucleolar
phosphoprotein B23 (37 kDa/pI 5.1) induced by selective inhibitors of ribosome
synthesis. Biochim Biophys Acta 826, 167-173.
Zambelli, F., Pesole, G., and Pavesi, G. (2009). Pscan: finding over-represented
transcription factor binding site motifs in sequences from co-regulated or co-expressed
genes. Nucleic Acids Res 37, W247-252.
358
Zandi, E., Rothwarf, D. M., Delhase, M., Hayakawa, M., and Karin, M. (1997). The
IkappaB kinase complex (IKK) contains two kinase subunits, IKKalpha and IKKbeta,
necessary for IkappaB phosphorylation and NF-kappaB activation. Cell 91, 243-252.
Zechel, C., Shen, X. Q., Chambon, P., and Gronemeyer, H. (1994). Dimerization
interfaces formed between the DNA binding domains determine the cooperative binding
of RXR/RAR and RXR/TR heterodimers to DR5 and DR4 elements. EMBO J 13, 1414-
1424.
Zeisig, B. B., Kwok, C., Zelent, A., Shankaranarayanan, P., Gronemeyer, H., Dong, S.,
and So, C. W. (2007). Recruitment of RXR by homotetrameric RARalpha fusion proteins
is essential for transformation. Cancer Cell 12, 36-51.
Zeller, K. I., Haggerty, T. J., Barrett, J. F., Guo, Q., Wonsey, D. R., and Dang, C. V.
(2001). Characterization of nucleophosmin (B23) as a Myc target by scanning chromatin
immunoprecipitation. J Biol Chem 276, 48285-48291.
Zeng, C., He, D., and Brinkley, B. R. (1994). Localization of NuMA protein isoforms in
the nuclear matrix of mammalian cells. Cell Motil Cytoskeleton 29, 167-176.
Zheng, X., Beissert, T., Kukoc-Zivojnov, N., Puccetti, E., Altschmied, J., Strolz, C.,
Boehrer, S., Gul, H., Schneider, O., Ottmann, O. G., et al. (2004). Gamma-catenin
contributes to leukemogenesis induced by AML-associated translocation products by
increasing the self-renewal of very primitive progenitor cells. Blood 103, 3535-3543.
Zhu, J., Chen, Z., Lallemand-Breitenbach, V., and de The, H. (2002). How acute
promyelocytic leukaemia revived arsenic. Nat Rev Cancer 2, 705-713.
Zhu, J., Nasr, R., Peres, L., Riaucoux-Lormiere, F., Honore, N., Berthier, C., Kamashev,
D., Zhou, J., Vitoux, D., Lavau, C., and de The, H. (2007). RXR is an essential
component of the oncogenic PML/RARA complex in vivo. Cancer Cell 12, 23-35.
Zirwes, R. F., Kouzmenko, A. P., Peters, J. M., Franke, W. W., and Schmidt-Zachmann,
M. S. (1997a). Topogenesis of a nucleolar protein: determination of molecular segments
directing nucleolar association. Mol Biol Cell 8, 231-248.
359
Zirwes, R. F., Schmidt-Zachmann, M. S., and Franke, W. W. (1997b). Identification of a
small, very acidic constitutive nucleolar protein (NO29) as a member of the
nucleoplasmin family. Proc Natl Acad Sci U S A 94, 11387-11392.
Zon, L. I. (2008). Intrinsic and extrinsic control of haematopoietic stem-cell self-renewal.
Nature 453, 306-313.
