IglE Is an Outer Membrane-Associated Lipoprotein Essential forIntracellular Survival and Murine Virulence of Type A Francisellatularensis
Gregory T. Robertson,a Robert Child,b Christine Ingle,a Jean Celli,b* Michael V. Norgarda
Department of Microbiology, University of Texas Southwestern Medical Center, Dallas, Texas, USAa; Tularemia Pathogenesis Section, Laboratory of Intracellular Parasites,NIAID, National Institutes of Health, Rocky Mountain Laboratories, Hamilton, Montana, USAb
IglE is a small, hypothetical protein encoded by the duplicated Francisella pathogenicity island (FPI). Inactivation of both copiesof iglE rendered Francisella tularensis subsp. tularensis Schu S4 avirulent and incapable of intracellular replication, owing to aninability to escape the phagosome. This defect was fully reversed following single-copy expression of iglE in trans from attTn7under the control of the Francisella rpsL promoter, thereby establishing that the loss of iglE, and not polar effects on down-stream vgrG gene expression, was responsible for the defect. IglE is exported to the Francisella outer membrane as an �13.9-kDalipoprotein, determined on the basis of a combination of selective Triton X-114 solubilization, radiolabeling with [3H]palmiticacid, and sucrose density gradient membrane partitioning studies. Lastly, a genetic screen using the iglE-null live vaccine strainresulted in the identification of key regions in the carboxyl terminus of IglE that are required for intracellular replication ofFrancisella tularensis in J774A.1 macrophages. Thus, IglE is essential for Francisella tularensis virulence. Our data support amodel that likely includes protein-protein interactions at or near the bacterial cell surface that are unknown at present.
Francisella tularensis is a small, nonmotile, Gram-negative, in-tracellular bacterium and the causal agent of the zoonotic dis-
ease tularemia (1). The majority of human tularemia infectionsare caused by the two subspecies that differ in their geographicdistribution and their potential virulence for humans. F. tularensissubsp. tularensis (type A) is found only in North America and isresponsible for a severe, potentially lethal disease following expo-sure to as few as 10 CFU. F. tularensis subsp. holarctica (type B) ispresent throughout the Northern Hemisphere but is associatedwith milder disease that is rarely fatal (2, 3). In nature, tularemiaarises following exposure to infected animals, especially rodentsand lagomorphs, or through the bites of blood-feeding arthro-pods (1, 3). However, because of its low infection dose and highassociated mortality, especially following aerosol exposure, F. tu-larensis has been designated by the Centers for Disease Controland Prevention as a tier 1 biothreat agent, with high potential forillegitimate use. Several decades ago, an attenuated live vaccinestrain (LVS) was developed from F. tularensis subsp. holarctica butremains unapproved as a vaccine owing to questions regarding thegenetic nature of its attenuation and other safety concerns (1).Both LVS and a related organism, F. tularensis subsp. novicida,lack significant virulence for immunocompetent humans but cancause a tularemia-like illness in mice. As such, these two strains areoften used as biosafety level 2 experimental surrogates for morevirulent strains of F. tularensis. Although such studies have led tomany important findings regarding the biology of Francisella,there are several instances where the outcome of infections withthese lower-virulence strains was not predictive of the outcome ofinfection with a virulent type A Francisella strain, such as Schu S4(4–6).
The pathogenesis of F. tularensis is poorly understood at themolecular level, but the ability to invade and replicate in macro-phages appears to be key for productive infection (7). Francisellaenters these cells by triggering the formation of asymmetric, pseu-dopodal loops that promote initial uptake into spacious vacuoles
that progressively acquire some early and late endosomal markers(i.e., EEA-1, Rab5, Rab7, CD63, LAMP-1, and LAMP-2) but thatexclude others (i.e., cathepsin D) (8–11). Shortly after entering themacrophage, the phagosomal membrane surrounding the bacte-rium is degraded and the bacteria are released into the host cyto-sol, where extensive intracytosolic replication occurs (7). Thisleads to eventual apoptotic (12, 13) and pyroptotic (14) lysis of thehost cell and the subsequent release of the intracellular bacteriawithin. In some instances, especially late in the infection cycle ofmurine bone marrow-derived macrophages (BMMs) but not hu-man blood monocyte-derived macrophages, some cytosolic F. tu-larensis reenters the endocytic pathway in a process that involvesthe formation of autophagosomes (15, 16). Whether this serves toprotect the bacterium from actions of the host inflammasomepathway or, rather, is a host-mediated process aimed at destroyingthe pathogen remains a subject of debate. However, recent studiessuggest that the formation of these LAMP-1-positive autophago-somes, also known as Francisella-containing vacuoles (FCVs), arenot bactericidal per se but instead serve as a clearance mechanismfor replication-deficient or damaged cytosolic Francisella via a
Received 10 May 2013 Returned for modification 22 June 2013Accepted 3 August 2013
* Present address: Jean Celli, The Paul G. Allen School for Global Animal Health,College of Veterinary Medicine, Washington State University, Pullman,Washington, USA.
Supplemental material for this article may be found at http://dx.doi.org/10.1128/IAI.00595-13.
ubiquitin-LC3-SQSTM1-LC3 pathway (17). Francisella also ac-tively interferes with host intracellular signaling pathways and in-nate immune responses (9, 18–20) and promotes active immunesuppression during early pulmonary residence (21). The factorsemployed by virulent forms of this bacterium to orchestrate thesenumerous changes are, as yet, poorly defined.
Genetic studies have implicated the Francisella pathogenicityisland (FPI), an �30-kb gene cluster consisting of 16 to 19 openreading frames, as being critical for phagosomal escape and intra-cellular survival (reviewed in reference 22). The FPI gene cluster,which is present in all sequenced Francisella genomes evaluated todate, encodes several genes (i.e., pdpB, vgrG, dotU, iglI, and iglJ)that are thought to encode a type VI secretion system (T6SS) (23–25) on the basis of limited sequence homology to the same genesin other bacteria (26, 27). Interestingly, the FPI is present at asingle copy in low-virulence F. tularensis subsp. novicida but isduplicated in type A and type B strains. The presence of two iden-tical copies in the most virulent forms of F. tularensis has limitedall but a few genetic studies (8, 28–32) to lower-virulence F. tula-rensis subsp. novicida (which is more easily manipulated via stan-dard genetic techniques owing to the presence of a single copy ofthe FPI). Nevertheless, there is a growing body of evidence thatmost of the genes in the FPI are required for virulence and/orintramacrophage growth in at least one subspecies (reviewed inreference 22). On the basis of this evidence, it has been proposedthat Francisella may encode specialized multicomponent machin-ery to facilitate secretion of effector molecules either to the bacte-rial cell surface or directly into host cells. Evidence to support thisdirectly, however, is lacking at present.
iglE encodes a small, hypothetical protein that was previouslyidentified as 1 of 16 to 19 genes in the FPI required for intracellularreplication of low-virulence F. tularensis subsp. novicida (33–36).However, these authors did not address potential polar effects ondownstream vgrG gene transcription, and attempts to comple-ment the iglE mutation with a multicopy extrachromosomal plas-mid were unsuccessful (36); thus, the phenotype of the resultantmutants could not be unequivocally attributed to the loss of iglEalone. IglE was also identified as one of eight secreted proteins onthe basis of a comprehensive reporter assay of FPI-encoded pro-teins coupled to TEM (a �-lactamase) (37). IglE has a putativesignal sequence and lipobox signature motif, suggesting that itsgene may encode a bacterial lipoprotein, but it lacks significanthomology to other known proteins. The crystal structure of a re-combinant modified form of IglE has been solved (38), but thereare few additional data to substantiate how this protein mightcontribute to intracellular pathogenesis. Here we report that iglE isrequired for phagosomal escape and the intracellular survival ofvirulent type A Schu S4 in bone marrow-derived macrophages.We also show that IglE is essential for murine pathogenesis andthat these effects are not due to polar effects on downstream vgrGtranscription, as expression of iglE in trans from distal attTn7 fullyrestored virulence to the iglE-null strains. Finally, a genetic screendeveloped with LVS was employed to identify key regions of IglEthat are required for intracellular replication in J774A.1 macro-phages. These genetic analyses, along with additional biochemicalstudies, demonstrate that IglE is an outer membrane-localizedlipoprotein and identify critical residues near its carboxyl termi-nus that are required for intracellular replication of LVS inJ774A.1 macrophages. Our data further suggest that the same key
regions are essential for the ability of F. tularensis subsp. tularensisSchu S4 to cause lethal disease in mice.
MATERIALS AND METHODSBacterial strains and culture conditions. Strains and plasmids used inthis study are listed in Table 1. For routine cultivation, F. tularensis wasgrown on modified Mueller-Hinton broth (Mueller-Hinton supple-mented with 1.23 mM CaCl2, 1.03 mM MgCl, 0.1% [wt/vol] glucose,0.025% [wt/vol] ferric pyrophosphate, and 2% [wt/vol] IsoVitaleX [BDBiosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization with 1% [wt/vol]tryptone powder, 0.5% [wt/vol] NaCl, and 1.6% (wt/vol) agar and, oncecooled to 55°C, further supplemented with 2.5% [vol/vol] heat-inacti-vated donor calf serum, 0.1% [wt/vol] glucose, 0.025% [wt/vol] ferricpyrophosphate, and 2% [wt/vol] IsoVitaleX [BD Biosciences] [sMHA]).Brain heart infusion (BHI) broth was prepared as previously described(39). For initial recovery of transconjugants, a modified chocolate agar(CA�; Mueller-Hinton agar supplemented prior to autoclave steriliza-tion with 1% [wt/vol] tryptone powder, 0.5% [wt/vol] NaCl, and 1.6%[wt/vol] agar and, once cooled to 55°C, further supplemented with hemo-globin supplement [BD Biosciences], 0.1% [wt/vol] glucose, and 2% [wt/vol] IsoVitaleX BD Biosciences]) was employed. Escherichia coli DH5� orXL-1 Blue was used as the host for routine plasmid manipulation. E. coliS17.1 was used as a host for bacterial conjugation. Where needed, Franci-sella growth media were supplemented with 200 mg/liter hygromycin(Hyg), 10 mg/liter kanamycin (Kan), 100 mg/liter polymyxin B, 25 mg/liter ampicillin (Amp), or 16 mg/liter vancomycin. E. coli was grown usingLuria-Bertani broth or agar further supplemented with 200 mg/liter hy-gromycin, 30 mg/liter kanamycin, or 100 mg/liter ampicillin. Whereneeded, sucrose was added to a concentration of 8% (wt/vol) prior toautoclave sterilization.
Cloning, expression, and purification of recombinant IglE protein.A portion of the iglE open reading frame(s) [ORF(s); FTT1701/FTT1346],without the predicted N-terminal signal sequence, was amplified from F.tularensis subsp. tularensis Schu S4 genomic DNA using high-affinity Plat-inum Taq polymerase (Invitrogen) with the oligonucleotide primersGP149 (GGggatccAGTGATGGTTTGTATATCA) and GP150 (CGctcgagTTAATCTTTTTCTATGCTA). The resultant PCR product was direc-tionally cloned into the pProEX HTb vector (Invitrogen) using engi-neered BamHI and XhoI sites, respectively (lowercase letters in the primersequences), which created an amino-terminal 6� polyhistidine (H6�)fusion. Recombinant protein was induced for 3 h from clone TP254 con-taining a sequence-verified insert by the addition of isopropyl-�-D-thio-galactopyranoside to 0.5 mM. Recombinant IglE bearing a polyhistidineamino-terminal fusion tag (H6�-IglE) was then purified by affinity chro-matography using equilibrated Ni-nitrilotriacetic acid-agarose (Qiagen,Valencia, CA), as described previously (40). Protein purity and yield wereassessed by SDS-PAGE and with a DC protein assay kit (Bio-Rad).
Animal care and use. All procedures involving animals were approvedby the University of Texas (UT) Southwestern Medical Center Institu-tional Animal Care and Use Committee and the Biological and ChemicalSafety Advisory Committee. Animals were housed in microisolator cagesat the UT Southwestern Animal Resource Center and fed irradiated foodand water ad libitum.
Antibody generation and immunoblotting. Polyclonal antiseraagainst H6�-IglE were generated by injecting �0.02 mg of recombinantH6�-IglE protein intraperitoneally into 6-week-old female Sprague-Dawley rats (Harlan, Indianapolis, IN), after first emulsifying with anequal volume of complete Freund’s adjuvant (Sigma) essentially as de-scribed previously (40). Immunoblots were performed using calibratedwhole-cell lysates (WSLs) prepared in 1� SDS lysis buffer with 2-merca-petoethanol to an equivalent of 0.2 optical density (OD) units, measuredat 600 nm (OD600) per 0.1 ml of SDS lysis buffer and boiling for 10 min.Procedures were otherwise as described by Huntley and associates (40).
IglE Is Essential for F. tularensis Pathogenesis
November 2013 Volume 81 Number 11 iai.asm.org 4027
Generation of markerless deletion mutants. Splicing-overlap exten-sion (SOE) PCR (41) was used to generate an iglE deletion-insertion cas-sette in which the majority of the coding region of iglE (encompassingnucleotides 12 to 378 of the 378-bp ORF) was replaced with the FLP
recombination target (FRT)-flanked Pfn-kanamycin resistance cassette(FRT-Pfn-kan-FRT) from pLG66a (42) (see the supplemental materialfor details on strain and plasmid construction). The resultant �iglE::FRT-Pfn-kan-FRT amplicon was cut with ApaI and ligated to pTP163 (see the
TABLE 1 Bacterial strains and plasmids used in this study
Strain or plasmid Relevant characteristics Source or reference
StrainsLVS F. tularensis subsp. holarctica, type B, isolate (RG004) purified from a
single colony, direct parent for genetic studiesT. Sellati, Albany Medical College, Albany, NY
Schu S4 F. tularensis subsp. tularensis, type A, isolate (CDC 1001) purified from asingle colony, direct parent for genetic studies
Centers for Disease Control and Prevention, Ft.Collins, CO
S4-029 Schu S4 �iglE1::FRT-kan-FRT This workS4-033 Schu S4 �iglE1::FRT This workS4-035 Schu S4 �iglE1::FRT �iglE2::FRT-kan-FRT This workS4-046 Schu S4 �iglE1 �iglE2::FRT This workS4-050 Schu S4 �iglE1 �iglE2::FRT attTn7-iglE This workS4-072 Schu S4 �iglE1 �iglE2::FRT attTn7-iglE-Pro95 �(Asn95-Asp125) This workS4-074 Schu S4 �iglE1 �iglE2::FRT attTn7-iglE (Cys22-Gly) This workTP367 LVS �iglE1::FRT-kan-FRT This workTP456 LVS �iglE1::FRT This workTP488 LVS �iglE1::FRT �iglE2::FRT-kan-FRT This workTP509 LVS �iglE1 �iglE2::FRT This workTP563 TP509 with pTP181 This workTP569 LVS �iglE1 �iglE2::FRT attTn7-iglE This workTP652 LVS �iglE1 �iglE2::FRT attTn7-iglE-Pro95 �(Asn95-Asp125) This workTP656 LVS �iglE1 �iglE2::FRT attTn7-iglE (Cys22-Gly) This workTP777 LVS �iglE1 �iglE2::FRT attTn7-iglE �(Ser120-Asp125*a) This workTP809 LVS �iglE1 �iglE2::FRT attTn7-iglE-Pro120 �(Ser120-Asp125) This workTP814 LVS �iglE1 �iglE2::FRT attTn7-iglE-6� His This workTP816 LVS �iglE1 �iglE2::FRT attTn7-iglE-Pro110 �(Ser110-Asp125) This workTP818 LVS �iglE1 �iglE2::FRT attTn7-iglE-Pro126 This workTP654 LVS �iglE1 �iglE2::FRT attTn7-iglE-Pro2 �(Tyr2-Iso23) This work
PlasmidspMP590 Suicide plasmid, Kanr SacB 43pTP085 Source of FRT-flanked PgroE-hyg-T1, Hygr This workpTP086 Source of FRT-flanked PgroE-kan-T1, Kanr This workpTP101 pMP590 with Kanr deleted and replaced with PgroE-hyg-T1 from TP085,
HygrThis work
pTP163 pTP101 with oriT from pUC18T-mini-Tn7T, Hygr This workpTP181 pMP829 with Tn7 helper functions (tnsABCD) from pTNS2, Hygr This workpLG66a Source of FRT-flanked Pfn-kan, Kanr 42pTP363 pTP163 � �FTT1701 (IglE)::FRT-Pfn-kan-FRT, Kanr Hygr This workpMP829 Unstable shuttle vector, Hygr 44pUC18T-mini-Tn7T Tn7 delivery vector, oriT Ampr 46pFFlp-hyg Temperature-sensitive shuttle vector carrying Flp recombinase, Hygr 42pTP405 Unstable shuttle vector pMP829 expressing Flp under PrpsL control, Hygr This workpTP512 pTP405 with sacB from pMP590, SacB Hygr This workpTNS2 Source of Tn7 helper functions (tnsABCD), Ampr 46pTP418 pUC18T-mini-Tn7T with PrpsL-FTT1701 (iglE), Ampr This workpTP565 pTP418 with FRT-flanked PgroE-kan-T1 from pTP086 This workpTP795 pTP418 iglE internal deletion control (adds Pro126), obtained by inverse
PCR with GP301 and GP275This work
pTP806 pTP795 with FRT-flanked PgroE-kan-T1 from pTP086 This workpTP631 pTP418 with internal deletion of iglE C terminus, �(Asn96-Asp125)
(adds Pro96), obtained by inverse PCR with GP274 and GP275This work
pTP642 pTP631 with FRT-flanked PgroE-kan-T1 from pTP086 This workpTP792 pTP418 with internal deletion of iglE C terminus, �(Ser110-Asp125)
(adds Pro110), obtained by inverse PCR with GP300 and GP275This work
pTP804 pTP792 with FRT-flanked PgroE-kan-T1 from pTP086 This workpTP789 pTP418 with internal deletion of iglE C terminus, �(Ser120-Asp125)
(adds Pro120), obtained by inverse PCR with GP299 and GP275This work
pTP801 pTP789 with FRT-flanked PgroE-kan-T1 from pTP086 This workpTP750 pUC18T-mini-Tn7T with PrpsL-iglE �(Ser120-Asp125*) This workpTP754 pTP750 with FRT-flanked PgroE-kan-T1 from pTP086 This workpTP744 pUC18T-mini-Tn7T with PrpsL-iglE-6� His This workpTP808 pTP744 with FRT-flanked PgroE-kan-T1 from pTP086 This workpTP640 pUC18T-mini-Tn7T � PrpsL-iglE (Cys22-Gly) This workpTP646 pTP640 with FRT-flanked PgroE-kan-T1 from pTP086 This workpTP635 pTP418 with internal deletion of iglE signal sequence and putative
lipobox, �(Tyr2-Iso23) (adds Pro2), obtained by inverse PCR withGP272 and GP273
This work
pTP644 pTP635 with FRT-flanked PgroE-kan-T1 from pTP086 This worka The asterisk indicates that the construct lacks the nontemplated proline added by the inverse PCR mutagenesis strategy.
supplemental material), which is a modified version of a previously de-scribed sacB-containing suicide plasmid, pMP590 (43). The resultantconstruct (pTP364) was then transferred without selection from E. coliS17.1 into Francisella by conjugation using filter paper mating. Transcon-jugants were initially recovered on CA� with kanamycin and polymyxinB, passaged once on sMHA plus kanamycin to allow secondary recombi-nation, and then passaged on sMHA supplemented with kanamycin and8% (wt/vol) sucrose to select for clones that had undergone deletion of thewild-type gene and intervening sequences, including the sacB sucrose sen-sitivity marker. The FRT-flanked kanamycin resistance cassette was thenremoved essentially as described previously (42) using a modified versionof the unstable plasmid pMP829 (44) bearing the sacB counterselectionmarker from pMP590 (43) and expressing the Flp recombinase obtainedfrom pFFlp-hyg (42) (see the supplemental material). The resultant FLPhelper plasmid, pTP512, was introduced into Francisella by electropora-tion. Hygromycin-resistant (Hygr) transformants were passaged once ondrug-free sMHA and patched to screen for sensitivity to kanamycin (i.e.,excision of the FRT-flanked kanamycin resistance gene). The resultantkanamycin-sensitive clones were passaged once more through a drug-freeintermediate (usually overnight growth in sMHB) and then recoveredonto sMHA supplemented with 8% sucrose to select for clones that hadlost the unstable FLP helper plasmid pTP512. Excision of the FRT-Pfn-kan-FRT sequence leaves behind a short FRT scar and allows the FRT-Pfn-kan-FRT marker to be recycled for a second round of gene inactiva-tion, which was necessary in order to inactivate both copies of iglE(FTT1701/FTT1346) in two successive rounds of selection.
Genetic complementation via Tn7. For complementation studies,IglE functions were provided in trans from attTn7 using a mini-Tn7 de-livery system described previously for use in Francisella (45). Briefly, aPrpsL-iglE amplicon was generated by SOE PCR using Schu S4 genomicDNA as a template. PstI and BamHI sites, engineered into the flankingprimers (see the supplemental material), allowed directional cloning intoplasmid pUC18T-mini-Tn7T (46). A kanamycin resistance cassette(FRT-flanked PgroE-aphA from pTP086) was ligated into the BamHI siteof mini-Tn7 to facilitate selection of recombinant clones. Tn7 helperfunctions were provided from pTP181, a derivative of the E. coli-Franci-sella shuttle vector pMP829 (44) expressing the tnsABCD genes frompTNS2 (46). LVS-based and Schu S4-based �iglE1 �iglE2::FRT clones(TP509 and S4-046, respectively) were electrotransformed with pTP181and recovered on sMHA containing hygromycin. Following purificationof an isolate from a single colony, hygromycin-resistant clones were elec-trotransformed with pTP565 and recombinant clones were recovered onsMHA containing kanamycin. Kanamycin-resistant clones were passagedonce on sMHA lacking hygromycin to promote helper plasmid loss,which was confirmed by patching for antibiotic sensitivity. Integration ofTn7 containing PrpsL-IglE at attTn7 near the 3= glmS region was verifiedby diagnostic PCR using the primer pair GP022 (TTTACGATACCGCTTCAGCT) and GP023 (AAGGCTGATATCGCAATAGT), whose bindingsites flank attTn7 (see reference 45).
Real-time PCR. RNA was extracted from LVS or TP509 (�iglE1
�iglE2::FRT) grown at 37°C with slow aeration (115 rpm) in BHI broth(pH 6.8) to an OD600 of �0.3 to 0.7. RNA was extracted using the TRIzolreagent (Invitrogen) and then further purified and DNase I digested usinga RiboPure kit (Ambion). For quantitative PCRs, 0.1 to 0.2 �g of isolatedRNA samples from two independent experiments was analyzed usingTaqMan master mix (Applied Biosystems, Foster City, CA), reverse trans-criptase (RT), and target-specific probe (2.5 pmol/�l) and primers (2pmol/�l each). Amplification and fluorescence detection were conductedin an ABI Prism 7500fast sequence detector (PerkinElmer, Applied Bio-systems) with a program of 40 cycles, with each cycle consisting of 95°Cfor 15 s and 60°C for 1 min. Primers and probes were designed usingPrimer Express software (PerkinElmer, Applied Biosystems). A controlthat contained all the reagents listed above but that lacked reverse trans-criptase was also included to ensure the absence of DNA. All reactionswere performed in triplicate. Analysis of relative gene expression em-
ployed the 2���CT (where CT is the threshold cycle) method (47), em-ploying gyrA as an internal calibrator. Analysis included an adjustment forprimer binding efficiency on the basis of standard curves calculated usinga genomic DNA control template. Details of the primer and probe setsused for real-time PCR can be found in the supplemental material.
Macrophage culture and infection. Bone marrow cells were isolatedfrom the femurs of 6- to 10-week-old female C57BL/6J mice (The JacksonLaboratory, Bar Harbor, ME) and differentiated into macrophages for 5days at 37°C in 7% CO2 in 1 g/liter glucose in Dulbecco’s modified Eaglemedium (DMEM; Invitrogen) supplemented with 10% fetal bovine se-rum (FBS; Invitrogen), 10% L929 cell-conditioned medium, and 2 mML-glutamine in non-tissue-culture-treated petri dishes. After 5 days,loosely adherent BMMs were washed with phosphate-buffered saline(PBS), harvested by incubation in chilled cation-free PBS supplementedwith 1 g/liter D-glucose on ice for 10 min, resuspended in complete me-dium, and replated in 24-well cell-culture-treated plates at a density of 1 �105 macrophages/well. BMMs were further incubated at 37°C under a 7%CO2 atmosphere for 48 h, and the BMM cultures were replenished withcomplete medium at 24 h before infection. Immediately prior to infec-tion, a few colonies from a freshly streaked sMHA plate were suspended insMHB, and the OD600 was measured to estimate bacterial numbers. Bac-terial suspensions were then diluted in complete medium, and 0.5 ml wasadded to chilled BMMs at a multiplicity of infection (MOI) of 50. Bacteriawere centrifuged onto macrophages at 400 � g for 10 min at 4°C, andinfected BMMs incubated for 20 min at 37°C under a 7% CO2 atmo-sphere, including an initial, rapid warm-up in a 37°C water bath to syn-chronize bacterial uptake. Infected BMMs were then washed 5 times withDMEM to remove extracellular bacteria and incubated for 40 min incomplete medium and then for an additional 60 min in completemedium containing 100 mg/liter gentamicin to kill extracellular bac-teria. Thereafter, infected BMMs were incubated in gentamicin-freemedium until processing. The number of viable intracellular bacteriaper well was determined in triplicate for each time point. InfectedBMMs were washed 3 times with sterile PBS and then lysed with 1 mlof sterile 1% saponin for 3 min at room temperature, followed byrepeated pipetting to complete lysis. Serial dilutions of the lysates wererapidly plated onto sMHA and incubated for 3 days at 37°C under 7%CO2 before enumeration of the CFU.
Immunofluorescence microscopy. BMMs grown on 12-mm glasscoverslips in 24-well plates were infected, washed 3 times with PBS, fixedwith 3% paraformaldehyde, pH 7.4, at 37°C for 20 min, washed 3 timeswith PBS, and then incubated for 10 min in 50 mM NH4Cl in PBS in orderto quench free aldehyde groups. Samples were blocked and permeabilizedin blocking buffer (10% horse serum, 0.1% saponin in PBS) for 30 min atroom temperature. Cells were labeled by incubating coverslips invertedonto drops of primary antibodies diluted in blocking buffer for 45 min atroom temperature. Primary antibodies used were mouse anti-F. tularensislipopolysaccharide (US Biological, Swampscott, MA) and rat anti-mouseLAMP-1 (clone 1D4B, developed by J. T. August and obtained from theDevelopmental Studies Hybridoma Bank developed under the auspices ofthe NICHD and maintained by the University of Iowa, Department ofBiological Sciences, Iowa City, IA). Bound antibodies were detected byincubation with 1:500 dilutions in blocking buffer of Alexa Fluor 488 –donkey anti-mouse and Alexa Fluor 568 – donkey anti-rat antibodies for45 min at room temperature. Cells were washed twice with 0.1% saponinin PBS, once in PBS, and once in H2O and then mounted in Mowiol 4-88mounting medium (Calbiochem, Gibbstown, NJ). Samples were ob-served on a Carl Zeiss LSM 710 confocal laser scanning microscope forimage acquisition. Confocal images of 1,024 by 1,024 pixels were acquiredand assembled using Adobe Photoshop CS3 software.
Infection of C3H/HeN mice. Seven- to 8-week old female C3H/HeNmice were used for infection. All animals were housed in animal biosafetylevel 3 facilities. Mice were anesthetized with ketamine plus xylazine andinfected intranasally, dropwise, with 0.02 ml (0.01 ml per nostril) of eitherthe Schu S4 parent strain (CDC 1001), the �iglE1 �iglE2::FRT mutant
IglE Is Essential for F. tularensis Pathogenesis
November 2013 Volume 81 Number 11 iai.asm.org 4029
(S4-046), or the complemented �iglE1 �iglE2::FRT-Tn7-iglE clone (S4-050), the �iglE1 �iglE2::FRT-Tn7-iglE (Cys22-Gly) clone (S4-074), or�iglE1 �iglE2::FRT-Tn7-iglE �(Asn96-Asp125) clone (S4-072). Actual in-fection doses were determined by plating in triplicate onto sMHA, andmice were monitored daily for signs of morbidity and mortality. For ex-periments requiring tissue harvest, lungs, spleens, and the left lateral lobeof the liver were aseptically harvested from mice and placed in Whirl-Pakbags (Nasco, Fort Atkinson, WI). Three to 5 ml of PBS was added, andtissues were homogenized for 1 min in a stomacher (Seward, Worthing,West Sussex, United Kingdom). Organ homogenates were serially diluted10-fold in PBS, and 0.02 ml of each dilution was plated onto sMHA con-taining 100 mg/liter polymyxin B, 25 mg/liter ampicillin, and 16 mg/litervancomycin. Parallel studies confirmed that the presence of these antibi-otics does not interfere with F. tularensis growth. After 72 h of incubationat 37°C in an atmosphere of 5% CO2, the number of CFU was determinedfor each dilution, and the average number of CFU/organ was calculated.
TX-114 extraction of Francisella proteins. Triton X-114 (TX-114)phase-partitioning studies were preformed on F. tularensis subsp. holarc-tica LVS (RG004) cultivated in 4 ml of sMHB with moderate aeration untilthe OD600 reached �0.2. The cells were pelleted by centrifugation andwashed in 10 ml 1� PBS. Precondensed TX-114 (in 150 mM NaCl, 10mM Tris, pH 7.5) was added to a final concentration of 2.5% (wt/vol), andthe sample was agitated overnight at 4°C and then centrifuged at 6,000 �g at 4°C for 10 min in a prechilled 4°C rotor to remove wholly insolublematerial. The supernatant was collected and placed at 30°C for 30 min toallow phase separation. The mixture was centrifuged at 2,500 � g at 25°Cfor 20 min, and the upper TX-114 detergent-insoluble (IN) phase andlower detergent-soluble (DT) phase were carefully collected. The IN phasewas further purified by adjusting the TX-114 concentration to 2.5% (wt/vol) and repeating the phase partitioning twice, as described above. Com-bined DT phases were further purified by adding an equal volume ofaqueous 0.06% (wt/vol) TX-114 and repeating the phase-partitioningprocess. Proteins in the IN and DT fractions were harvested by precipita-tion with 2 volumes of 100% ethanol. Samples were rinsed with 70%ethanol, allowed to air dry, and suspended in 10 mM Tris. Equal amountsof protein were prepared for SDS-PAGE, and protein localization wasmonitored by immunoblotting with monospecific rat polyclonal antiserafor FopA (40) or IglE, FTT0507, or FTT0825c.
Radiolabeling with [3H]palmitic acid. Mid-log-phase cultures(OD600, �0.14 to 0.2) of TP509 (LVS �iglE1 �iglE2::FRT) or TP569 LVS(�iglE1 �iglE2::FRT-Tn7-iglE) grown in Chamberlain’s defined medium(CDM) at 37°C with aeration were back-diluted into 5 ml prewarmedCDM containing 0.25 mCi (0.05 ml) of [9,10-3H(N)]palmitic acid(PerkinElmer) to yield an OD600 of �0.03. Cultures were incubated over-night at 37°C with aeration to facilitate incorporation of the radiolabeledprecursor. The final OD600 of each culture was 0.54 and 0.57, respectively.Cell pellets were recovered by centrifugation at 6,000 � g for 20 min at10°C and frozen at �20°C until used. Frozen cell pellets were lysed in 0.1ml B-PER II reagent (Thermo Fisher Scientific) further supplementedwith EDTA-free complete protease inhibitor cocktail (Roche). Insolublematerial was removed by centrifugation, and IglE protein was recoveredfrom the WCLs by immunoprecipitation using rat polyclonal antisera toIglE (GS99) after first coupling to Dynabeads (Invitrogen) according tothe manufacturer’s instructions. Naive rat serum coupled to Dynabeadswas used in control reactions to show the specificity of the IglE immuno-precipitation reaction. Proteins were prepared for SDS-PAGE and eithersubjected to immunoblotting with IglE-specific rat polyclonal antisera ortreated with En3Hance gel autoradiography enhancement reagent(PerkinElmer), as detailed by the manufacturer. The dried gel was thenexposed to CL-X Posure film (Thermo Scientific) at �80°C for 11 days.
Subcellular localization of Francisella proteins. A previously de-scribed osmotic lysis and sucrose density gradient centrifugation proce-dure (40, 48) was used to monitor the subcellular localization of IglE or anIglE �(Asn96-Asp125) variant. Sequential gradient fractions were col-lected dropwise, and the density (g/ml) of each was determined on the
basis of the refractive indices. Samples representing each density fractionwere prepared for SDS-PAGE, and IglE localization was monitored byimmunoblotting with rat anti-IglE antisera. Rat polyclonal antiseraagainst the F. tularensis Pal or SecY protein (40) were used as outer mem-brane (OM) and inner membrane (IM) localization controls, respectively.
IglE mutagenesis and screening through J774 macrophages. Mutantalleles of iglE were constructed by PCR-mediated site-directed mutagen-esis of parent plasmid pTP418 (see the supplemental material). An inversePCR approach was used to generate specific internal in-frame iglE dele-tion mutations [i.e., iglE �(Tyr2-Iso23), iglE �(Asn96-Asp125), iglE�(Ser110-Asp125), iglE �(Ser120-Asp125)] (see Fig. 8). This results in theaddition of a single nontemplated proline residue at the site of each dele-tion. Hence, a control plasmid (pTP795) bearing no internal deletion butonly the nontemplated proline residue was also included. The iglE-H6�construct (pTP744) and the iglE �(Ser120-Asp125*) construct (pTP750)were generated using standard PCR approaches. The latter bears the sameSer120-Asp125 deletion mutation as in pTP789, but without the additionof the nontemplated proline, and serves as an additional control. The iglE(Cys22-Gly) point mutation was generated using an SOE PCR approachwith specific mutagenic primers in which the nucleotides correspondingto the codon encoding cysteine 22 (UGU) were altered to GGU, encodingglycine 22. The resultant PCR amplicons were cut with the restrictionenzymes indicated in the supplemental material and ligated to similarlyrestricted pTP418 or pUC18T-mini-Tn7T (46). In each case, the FRT-flanked PgroE-aphA cassette from pTP086 was cloned into a distal BamHIsite to facilitate selection for Tn7 insertion into the chromosome. Follow-ing sequence confirmation, each allele was integrated into the TP563chromosome using the Tn7 delivery system described above. The mutantalleles were again confirmed by sequence analysis, and protein productionwas monitored by immunoblotting using rat polyclonal IglE antisera.
Rescue of IglE function was assayed in the immortalized murineJ774A.1 macrophage cell line (TIB-67; American Type Culture Collec-tion) using a modified gentamicin protection assay. Briefly, J774A.1 cellswere cultured in DMEM containing the GlutaMAX supplement and 4.5g/liter D-glucose. DMEM was further supplemented with 10% (vol/vol)heat-inactivated fetal bovine serum (FBS; Sigma). J774A.1 macrophageswere removed from the culture dishes and seeded to tissue culture 12-wellplates at 2.5 � 105 cells/well 1 day prior to infection. J774A.1 cells wereinfected at an MOI of 20 following opsonization of freshly prepared F.tularensis subsp. holarctica LVS cultures or derivatives with DMEM plus10% complement-preserved mouse serum (Valley Biomedical, Win-chester, VA). For infections, medium was aspirated from J774A.1 cells and0.3 ml of the adjusted bacterial suspension was added to each well (�1 �107 CFU/well). The actual infection dose was confirmed by serial dilutionand plating on sMHA. To help promote synchronized infection, the cul-ture plates were centrifuged at 500 � g for 10 min at 20°C. Phagocytosiswas allowed to proceed for 1 h at 37°C in an atmosphere of 5% CO2.Macrophages were washed once in PBS at 37°C and then incubated for 1 hat 37°C with DMEM supplemented with 10% FBS and 50 mg/liter genta-micin to kill extracellular F. tularensis. Wells were washed once in PBS at37°C and incubated in DMEM supplemented with 10% FBS and 5 mg/liter gentamicin. At 2 or 22 h postinfection (p.i.), the macrophages werelysed in 0.25% (wt/vol) saponin in 1� PBS with repeated pipetting tocomplete lysis. Serial dilutions of the lysates in PBS were then rapidlyplated onto sMHA, and the plates were incubated for 3 days at 37°C in anatmosphere of 5% CO2 prior to enumeration of the CFU. The number ofviable intracellular CFU per well was determined in duplicate. The atten-uation index was calculated as the fold change in the number of CFUbetween 2 and 22 h p.i. for each test strain over the number of CFU of thecomplemented parent strain (iglE�) and represents the average of at leasttwo independent determinations standard deviations.
IglE protein stability assays. The stability of IglE or genetically mod-ified IglE variants expressed ectopically in the LVS �iglE1 �iglE2::FRTbackground was monitored in cultures treated at mid-log phase (OD600,�0.1 to 0.19) with 1 mg/liter rifampin and 4 mg/liter chloramphenicol.
Samples were recovered at various times after drug addition and chilledon ice, and then the cell pellets were recovered by centrifugation(16,000 � g, 4 min, 4°C). Samples were standardized by adjusting the cellpellets to 0.2 OD unit (OD600) per 0.1 ml SDS-PAGE lysis buffer. Celllysates were separated by SDS-PAGE, and IglE or FopA was detected fol-lowing immunoblotting with monospecific rat polyclonal antiserum forIglE or FopA, respectively.
RESULTSTwo-step deletion of duplicate copies of iglE from the Schu S4and LVS chromosomes. We modified plasmid pMP590 (43), tofacilitate efficient two-step gene inactivation of the duplicated iglElocus, using homologous recombination with an FRT-flanked ka-namycin resistance cassette and SacB-assisted allelic replacement(Fig. 1). After recovery and passage to ensure purity, clones thathad undergone the desired deletion-replacement of one of twocopies of iglE (henceforth, iglE1 clones) were selected on sMHAwith kanamycin and sucrose. The FRT-flanked kanamycin resis-tance cassette was then excised, resulting in a markerless genedeletion, by introducing an unstable hygromycin-resistant shuttlevector expressing the FLP recombinase and SacB (pTP512). Asecond round of homologous recombination was then employedto inactivate the second duplicated copy of iglE (henceforth, iglE2
clones). Helper plasmid loss and gene deletion replacement weremonitored at each step by patching for antibiotic resistance orsensitivity and by diagnostic PCR employing primer pairs thatflank the targeted regions (data not shown).
Growth of Schu S4 �iglE1 �iglE2::FRT is attenuated in mu-rine BMMs. Previous studies employing iglE mutants derivedfrom low-virulence F. tularensis subsp. novicida have suggestedthat iglE is 1 of 16 to 19 genes in the FPI required for intracellularreplication (33–36). However, the role of this duplicated geneticlocus in virulent type A F. tularensis subsp. tularensis Schu S4 hadnot been previously tested. We therefore infected BMMs withSchu S4 �iglE1 �iglE2::FRT (S4-046) and measured intracellulargrowth using a gentamicin protection assay. In contrast to thevirulent Schu S4 parent strain, intracellular replication of the SchuS4 �iglE1 �iglE2::FRT strain (an iglE-null mutant) was stronglyimpaired in BMMs, and this strain was steadily cleared from thesecells over a 24-h time course (Fig. 2A). Because other FPI mutantshave previously been shown to exhibit defects in phagosomal es-cape, we next asked whether the Schu S4 �iglE1 �iglE2::FRT mu-tant was impaired in this regard using a previously described pha-gosomal integrity assay and confocal immunofluorescencemicroscopy of bacterial colocalization with LAMP-1-positivemembranes (as measures of vacuolar versus cytosolic location)
(49). Unlike the Schu S4 wild-type parent strain, which escapedfrom its original phagosome by 1 h p.i. (�86% of bacteria werecytosolic; Fig. 2B and C) and replicated extensively in the cytosolby 10 h p.i. (Fig. 2C, top), the �iglE1 �iglE2::FRT mutant remainedenclosed within a vacuole (�62% of bacteria) at 1 and 10 h p.i.(Fig. 2B and C, middle), consistent with the intracellular killingobserved in the gentamicin protection assay (Fig. 2A). Hence, de-letion of iglE (FTT1701/FTT1346) abolishes the ability of Schu S4to escape from the phagosome and survive and replicate intracel-lularly.
Complementation of the unmarked �iglE1 �iglE2::FRT mu-tant in F. tularensis subsp. tularensis Schu S4 and LVS. As pre-vious studies using low-virulence F. tularensis subsp. novicidafailed to successfully complement the intracellular growth defectarising from loss of iglE using a multicopy plasmid-basedtranscomplementation approach, possibly owing to gene dosageeffects (36), it was unclear whether the intracellular growth defectarising from the loss of iglE was due to possible polar effects ondownstream FPI genes. We therefore employed a modified Tn7delivery system (45, 46) to insert a copy of iglE under the control ofthe Francisella rpsL promoter (PrpsL) in attTn7 near the glmSgene. Loss of IglE expression was confirmed by immunoblottingof the �iglE1 �iglE2::FRT mutants, whereas restoration of IglE ex-pression to elevated levels was observed for the Tn7-transcomple-mented clones (TP569 and S4-050; Fig. 3A). We next tested ourSchu S4-based �iglE1 �iglE2::FRT-Tn7-iglE complemented clonefor growth in BMMs. Intracellular replication was fully restored towild-type levels in the complemented Schu S4 �iglE1 �iglE2::FRTstrain constitutively expressing iglE from attTn7 (Fig. 2A), thusindicating that loss of iglE1 and iglE2 was responsible for this de-fect. Complementation of the �iglE1 �iglE2::FRT mutant also re-stored phagosomal escape and cytosolic replication (Fig. 2B andC, bottom). As genetic complementation of the intramacrophagegrowth defect of the Schu S4 �iglE1 �iglE2::FRT mutant was ac-complished in trans, these data clearly indicate that the loss of iglEand not polar effects on downstream FPI genes was indeed re-sponsible for the intracellular growth defect. This observation isimportant, as two independent real-time quantitative PCR studiesindicated a slight but highly reproducible decrease in vgrG(FTT1702) transcript amounts by �30% in strain TP509 bearingFRT-marked null mutations in both iglE1 and iglE2 (relative quan-tity of vgrG, 0.67 and 0.73, respectively, compared to that in theLVS parent strain) (data not shown). As no similar reductionswere observed for the unlinked control gene, FTT1714c (relativequantity of FTT1714c, 0.98 and 1.04, respectively), we interpretthis result to mean that the loss of iglE or the retention of the FRTscar in the deletion mutant has in some way impacted transcrip-tion levels or the transcript stability of vgrG, which is likely cotran-scribed with iglE (Fig. 1).
The virulence of Schu S4 �iglE1 �iglE2::FRT is attenuated inC3H/HeN mice. Intramacrophage growth is considered to be ahallmark of Francisella pathogenicity in vivo (7). To determinewhether the F. tularensis subsp. tularensis Schu S4 �iglE1 �iglE2::FRT mutant was defective for virulence in vivo, C3H/HeN micewere infected i.n. with 447 CFU Schu S4 or 356 CFU Schu S4�iglE1 �iglE2::FRT (10 times the i.n. lethal dose for Schu S4[strain CDC 1001] in our hands) and monitored for survivaland/or bacterial burdens in the lung, liver, and spleen at varioustimes postinfection. Use of an elevated i.n. infection dose served toensure that any attenuation observed for the iglE deletion mutant
FIG 1 Schematic depiction of iglE and flanking genes in F. tularensis subsp.holarctica LVS, F. tularensis subsp. tularensis Schu S4, and associated deriva-tives following allelic replacement by a two-step, positive selection strategy.Only the relevant portion of the FPI is shown.
IglE Is Essential for F. tularensis Pathogenesis
November 2013 Volume 81 Number 11 iai.asm.org 4031
was not marginal relative to that observed for the wild-type viru-lent parent. Whereas increasing concentrations of bacteria wererecovered from the lungs, spleens, and livers of Schu S4-infectedmice at days 3 and 5 postinfection, the Schu S4 �iglE1 �iglE2::FRTmutant was not recovered from any of these tissues at any timepoint (limit of detection, 150 CFU/spleen or lung and 446 CFU/liver), indicating that the �iglE1 �iglE2::FRT mutant exhibits asignificant (P � 0.001, day 3 and 5, lung and spleen; P � 0.01, day3; P � 0.001 day 5, liver; Bonferroni posttests) defect for in vivosurvival and/or replication (see Fig. 5). Consistent with this obser-vation, all of the Schu S4-infected mice either were severely mor-ibund or had succumbed to disease by day 5 (0 of 8 survived;median time until death, 5 days), whereas none of the �iglE1
�iglE2::FRT mutant-infected mice died or showed any overt signsof illness during the infection (P � 0.0001, log-rank [Mantel-Cox]test) (Fig. 4). Indeed, we observed no evidence for illness in C3H/HeN mice infected i.n. with an even higher i.n. challenge dose(�35,600 CFU) of the Schu S4 �iglE1 �iglE2::FRT mutant, indi-cating that the 50% lethal dose for this strain is greater than 3.6 �
FIG 2 Intracellular replication and phagosomal escape of Schu S4 are dependent on IglE. (A) Schu S4 (black), the iglE-null strain (Schu S4 �iglE1 �iglE2::FRT;red), and the iglE-null mutant complemented in trans from attTn7 (Schu S4 �iglE1 �iglE2::FRT-Tn7-iglE; blue) were used to infect BMMs seeded in 24-well platesat an MOI of 50. The intracellular numbers of CFU were determined at various times p.i. Data are presented as the means SDs from a representative experimentperformed at least twice. (B) Intracellular trafficking of Schu S4 and derivatives in BMM. At various times p.i., infected macrophages were subjected to aphagosomal integrity assay to enumerate the percentage of cytosolic bacteria. Data are the means SDs of three independent experiments. Symbols are as definedfor panel A. (C) Representative confocal micrographs of BMMs infected for 1 h or 10 h with Schu S4 and derivatives. Samples were processed for immunoflu-orescence labeling of bacteria (green) and LAMP-1-positive vacuoles (red). Single-channel images of the boxed areas are shown in the magnified insets. Whitearrows, bacteria of interest.
FIG 3 Immunoblot analysis of IglE or IglE variants in F. tularensis. (A) Cali-brated whole-cell lysates of LVS, Schu S4, the iglE-null strains (�iglE), or theiglE-null strains expressing wild-type iglE (iglE�), iglE �(Asn96-Asp125), origlE (Cys22-Gly) alleles from attTn7 were separated by SDS-PAGE and ana-lyzed by immunoblotting with rat polyclonal IglE antisera. FopA levels weremonitored by immunoblotting with rat polyclonal FopA antiserum as a load-ing control. (B) Differences in the mobility of IglE (wild-type) and IglE(Cys22-Gly) observed in SDS-polyacrylamide gels followed by immunoblot-ting with rat polyclonal IglE antisera.
104 CFU (Fig. 4). As with our infection of BMMs, the virulencedefect in the �iglE1 �iglE2::FRT mutant was restored in the com-plemented strain constitutively expressing iglE in trans fromattTn7 (no significant difference between Schu S4 and the �iglE1
�iglE2::FRT-Tn7-iglE complemented clone; P � 0.0005 for the�iglE1 �iglE2::FRT mutant versus the �iglE1 �iglE2::FRT-Tn7-iglEcomplemented clone, log-rank [Mantel-Cox] test) (Fig. 4). Allanimals infected via the i.n. route with �183 CFU of the �iglE1
�iglE2::FRT-Tn7-iglE mutant succumbed to infection, with only aslight delay in the median time until death (7 days for animalsinfected with the �iglE1 �iglE2::FRT-Tn7-iglE complementedclone) relative to that for animals infected with the Schu S4 parent(5 days for animals infected with wild-type Schu S4) being ob-served (Fig. 4). Organ CFU burdens in the lungs, livers, andspleens of animals infected with the complemented clone werealso slightly reduced relative to those in the tissues of animalsinfected with the fully virulent parent strain Schu S4 on day 3 (P �0.05, lung; not significant, liver; P � 0.01, spleen; Bonferroni post-tests) but reached equivalent levels by day 5. Importantly, thesevalues were significantly elevated over those for animals infectedwith the �iglE1 �iglE2::FRT mutant (P � 0.001, days 3 and 5, lung;P � 0.01, day 3; P � 0.001, day 5, spleen; P � 0.05, day 3; P �0.001, day 5, liver; Bonferroni posttests), which could not be re-covered from any tissues at any time point tested (Fig. 5). Theslight delay in colonization and lethality in mice infected with the�iglE1 �iglE2::FRT-Tn7-iglE complemented clone most likely re-flects elevated constitutive expression of iglE from PrpsL (Fig. 3).However, we cannot formerly exclude the possibility that slightlyreduced vgrG transcription might also contribute to this effect.Regardless, these in vivo complementation data, along with thefull restoration of in vitro intramacrophage growth with expres-sion of iglE in trans from attTn7, strongly support the notion thatthe loss of iglE is responsible for the pathogenesis defect observed.
IglE is a lipoprotein. iglE is predicted to encode a lipoproteinon the basis of the presence of a putative signal peptidase II (SPII)cleavage site and a conserved cysteine residue at position 22 in theiglE-coding sequence. However, there are limited published datato substantiate this directly (22). To test this, we first analyzed thebehavior of IglE in the nonionic detergent TX-114. TX-114 has
been shown to solubilize bacterial lipoproteins due to their am-phipathic properties imparted by the three covalently attachedlong-chain fatty acids (50). Using this approach on the biosafetylevel 2 LVS surrogate, we found enrichment of IglE in the TX-114detergent-soluble fraction, with no material remaining in the TX-114 detergent-insoluble fraction (Fig. 6A). Controls included twoputative lipoprotein candidates, FTT0507 and FTT0825c (unpub-lished), or the OM protein (OMP) FopA (40). In each case, thecandidate lipoproteins, like IglE, were solubilized into the TX-114detergent-soluble phase, whereas FopA was found in both TX-114detergent-soluble and -insoluble fractions (Fig. 6A). The basis forthe partial fractionation of FopA to both the TX-114 detergent-soluble and -insoluble fractions is at present unknown but mayreflect aggregation of internal hydrophobic patches resulting inthe heightened solubility of this beta barrel-containing integralOMP. Therefore, to verify the TX-114 phase-partitioning results,LVS �iglE1 �iglE2::FRT (�iglE) or LVS �iglE1 �iglE2::FRT-Tn7-iglE (iglE�) was grown in CDM and then pulsed for �18 h with theradiolabeled long-chain fatty acid precursor [3H]palmitic acid,shown previously to be incorporated into F. tularensis lipopro-teins (51, 52). Exposure to [3H]palmitate resulted in numerouslabeled proteins (Fig. 6B), one of which was immunoprecipitated
FIG 4 Wild-type IglE is required for lethality of Schu S4 in C3H/HeN mice.Mice were infected i.n. with 447 CFU Schu S4 (closed circles), 356 or 35,600CFU Schu S4 �iglE1 �iglE2::FRT (open circles), 183 CFU Schu S4 �iglE1
�iglE2::FRT-Tn7-iglE (filled triangles), 170 CFU Schu S4 �iglE1 �iglE2::FRT-Tn7-iglE (Cys22-Gly) (open triangles), or 183 CFU Schu S4 �iglE1 �iglE2::FRT-Tn7-iglE �(Asn96-Asp125) (filled diamonds) (n � 5 to 8 per group) andmonitored for signs of morbidity for up to 3 weeks postinfection. The data arerepresentative of two independent experiments. ***, P � 0.001 (log-rank test).
FIG 5 Mice infected with the Schu S4 �iglE1 �iglE2::FRT mutant show re-duced bacterial burdens. Mice were infected i.n. with �102 CFU Schu S4 orderivatives. On days 3 and 5 postinfection, two to four mice were humanelysacrificed, and the bacterial burdens were determined following serial dilutionand plating of organ homogenates for determination of the numbers of CFU.The limits of detection were 150 CFU/organ for spleens and lungs and 446CFU/organ for livers. The data are presented by scatter dot plot, and the hor-izontal lines indicate the mean result. The bacterial burdens for mice infectedwith each strain were compared using two-way analysis of variance and arerepresentative of two independent experiments. Filled circles, Schu S4; opencircles, Schu S4 �iglE1 �iglE2::FRT; open triangles, Schu S4 �iglE1 �iglE2::FRT-Tn7-iglE.
IglE Is Essential for F. tularensis Pathogenesis
November 2013 Volume 81 Number 11 iai.asm.org 4033
from LVS �iglE1 �iglE2::FRT-Tn7-iglE (iglE�) by anti-IglE serumbut not by control preimmune serum (Fig. 6B and C). As such, thepresence of multiple bands in the autoradiograph (Fig. 6B), butnot in the corresponding immunoblot (Fig. 6C), most likely re-flects differences in protein loading or poor resolution throughSDS-PAGE, as the former strain contained 30 times more proteinto ensure that a good signal-to-noise ratio was achieved. As ex-pected, no such band was seen for LVS �iglE1 �iglE2::FRT, whichis an iglE-null mutant and does not produce IglE protein. Takentogether, these data are consistent with the findings of in silicoanalyses identifying IglE as a lipoprotein.
OM localization of IglE. Because IglE appears to encode a li-poprotein, we next asked whether this protein is retained at the IMor if it is shuttled to the OM. In most Gram-negative bacteria,lipoprotein export to the OM or retention at the IM is governed bythe Lol sorting machinery and sequences embedded within theamino terminus of the mature lipoprotein (the so-called N � 2rule [reviewed in reference 53]). Usually, this is the amino acidimmediately following the canonical cysteine site of lipidation,wherein any amino acid other than aspartate at position N � 2allows export to the OM (53). In IglE, the N � 2 amino acid isisoleucine, which should facilitate export to the OM. To verify thisdirectly and compare the membrane distribution of IglE, strainTP569 constitutively expressing wild-type IglE from PrpsL inattTn7 was subjected to osmotic lysis and OM and IM fraction-ation experiments (40, 48). These experiments were initially per-formed using strain TP569 (LVS �iglE1 �iglE2::FRT-Tn7-iglE�)to increase the cellular content of IglE. The quality of separation
was monitored by immunoblotting with serum specific for the IMprotein SecY (found here in fractions with densities of 1.14 to 1.15g/ml) and the OM protein Pal (found principally in fractions withdensities of 1.16 to 1.19 g/ml) (Fig. 7). Using this technique, IglEwas found predominantly within the OM fractions (densities, 1.16to 1.19 g/ml) (Fig. 7). Some IglE was also observed in fractionswith lower densities (1.13 to 1.11 g/ml), which do not correspondto either membrane fraction. Although we cannot fully explainthis result on the basis of the available data, de Bruin and associates(36) reported similar findings for FPI-encoded IglA, IglB, and IglCproteins, which were speculated to form an as yet unidentifiedinsoluble macromolecular structure. Finally, to exclude the possi-bility that the OM localization of IglE was influenced by constitu-tive expression of native IglE protein in trans from a distal site inthe chromosome, we verified that native IglE from LVS had sim-ilar OM localization properties when grown under FPI-inducing(39) growth conditions in BHI broth (data not shown).
Mutant forms of IglE. The crystal structure of IglE has beensolved (38), but there are few other experimental data to explainhow this lipoprotein (Fig. 6), which lacks obvious orthologs out-side Francisella species, might contribute to F. tularensis patho-genesis. In an effort to define the key regions and residues requiredfor IglE function, we employed PCR-based mutagenesis ap-proaches to generate a series of small deletion mutations or a pointmutation in iglE using our PrpsL-iglE Tn7 clone (pTP418) as atemplate. After integration of the modified clones into the LVSiglE-null background, followed by sequence verification, wescreened each for its ability to rescue the intramacrophage growthdefect of the LVS iglE-null mutant when expressed under PrpsLcontrol from attTn7. Because our data suggest that iglE encodes anOM-localized lipoprotein, we first constructed a mutation thataltered the canonical cysteine 22 lipidation site to glycine [IglE(Cys22-Gly)]. The LVS iglE-null strain expressing iglE (Cys22-Gly) from attTn7 [LVS �iglE1 �iglE2::FRT-Tn7-iglE (C22-G)] wasstrongly impaired for intramacrophage growth (Fig. 8B), and aSchu S4 variant [Schu S4 �iglE1 �iglE2::FRT-Tn7-iglE (C22-G)]expressing the iglE Cys22-Gly allele in the iglE-null backgroundwas wholly avirulent following i.n. inoculation of �170 CFU intoC3H/HeN mice (Fig. 4). Immunoblot analysis with IglE-specificpolyclonal sera indicated that IglE (Cys22-Gly) is synthesized butappears to be less abundant than wild-type IglE expressed underthe same conditions (Fig. 3A). The IglE (Cys22-Gly) variant also
FIG 6 IglE encodes a bacterial lipoprotein. (A) TX-114 detergent-soluble and-insoluble phases were prepared from LVS, separated by SDS-PAGE, and an-alyzed by immunoblotting with the indicated monospecific polyclonal anti-sera. Abbreviations: DT, TX-114 detergent-soluble material; IN, TX-114 de-tergent-insoluble material; IglE, 0507, 0825, and FopA, blots probed with ratpolyclonal antibodies monospecific for IglE, FTT0507, FTT0825c, and FopA,respectively. (B) Autoradiograph demonstrating in vivo incorporation of[3H]palmitic acid into polypeptides in the LVS iglE-null mutant (�iglE) andthe iglE-null mutant complemented in trans from attTn7 (iglE�). Abbrevia-tions: WCL, whole-cell lysate; IP-�IglE, immunoprecipitate obtained using ratanti-IglE antiserum-coupled Dynabeads; IP-NS, immunoprecipitate obtainedusing naive rat serum-coupled Dynabeads. (C) Analysis of IglE in immuno-precipitated fractions by SDS-PAGE and immunoblotting with rat polyclonalIglE antisera. (D) The N terminus of IglE contains a lipobox motif (bold)including a canonical cysteine at position 22 (underlined).
FIG 7 Subcellular localization of IglE in F. tularensis. The LVS iglE-null mu-tant expressing wild-type iglE in trans from attTn7 (iglE�) or the same strainexpressing iglE �(Asn96-Asp125) was subjected to osmotic lysis and sucrosedensity fractionation as described in Materials and Methods. Sequential frac-tions were collected from sucrose gradients, separated by SDS-PAGE, andanalyzed by immunoblotting using rat polyclonal IglE antisera. Rat polyclonalantisera specific for Pal, a known outer membrane protein, or SecY, a knowninner membrane protein (IMP), were used as controls for localization. Sucrosegradient densities (g/ml) are shown at the top.
showed slower mobility in SDS-polyacrylamide gels than wild-type IglE, which ran with an observed molecular mass of �13.9kDa (Fig. 3B). Although the exact molecular mass of the IglE(Cys22-Gly) protein could not be proven here, linear regressionanalysis indicates that this mobility shift correlates with a pre-dicted �0.5- to 1-kDa change in overall mass. This result is con-sistent with the prediction that IglE (Cys22-Gly) should no longerbe recognized for processing by SPII (predicted molecular mass ofunprocessed IglE, 14.6 kDa) and, hence, should not be furthermodified through covalent fatty acid addition. Further studieswould be necessary to prove this directly. By comparison, an IglE�(Asn96-Asp125) variant (Fig. 3A; see below) showed increased
mobility in SDS-polyacrylamide gels, with a calculated masschange of �1.8 to 1.9 kDa, which is, again, in general agreementwith a predicted molecular mass of 11.3 kDa (Fig. 3A). Taken as awhole, these data are interpreted to mean that cysteine 22 and,hence, the lipidation of IglE are required for intramacrophagegrowth and pathogenesis of F. tularensis.
Because the IglE Cys22-Gly mutation likely exerts its effects byaltering protein localization or other properties of this OM-local-ized lipoprotein (i.e., stability) but not IglE function per se, we nextconstructed a series of overlapping deletion mutations near thecarboxyl-terminal region of this protein and assayed these for res-cue of the intramacrophage growth defect of the LVS iglE-nullmutant. This region was selected because IglE lacks obvious or-thologs or functional domains (as found in the current Pfam da-tabase), and the carboxyl terminus of IglE likely extends into theperiplasm or away from the cell surface and would be most readilyaccessible to facilitate possible protein-protein or other interac-tions. Three overlapping deletion mutations encompassing aminoacids Asn96-Asp125, Ser110-Asp125, or Ser120-Asp125 (Fig. 8A)of IglE were constructed using the LVS iglE-null strain as a recip-ient host. These were then assayed for rescue of intramacrophagegrowth in J774 macrophages. As is shown in Fig. 8B, expression ofwild-type iglE (iglE�) or a mutant allele of iglE lacking Ser120-Asp125 [IglE �(Ser120-Asp125) or IglE �(Ser120-Asp125*); thelatter lacks the nontemplated proline added as part of the inversePCR mutagenesis strategy] from attTn7 fully restored the intra-macrophage growth of the iglE-null strain. This indicates that intrans expression of some relatively short carboxyl-terminal iglEdeletion mutations is well tolerated and can fully complement theintramacrophage defect of the LVS iglE-null mutant in J774 cells.To this end, expression of full-length iglE bearing a carboxyl-ter-minal polyhistidine tag (strain TP814) also fully rescued intra-macrophage growth of the iglE-null mutant (Fig. 8B). In contrast,strains expressing alleles of iglE bearing larger carboxyl-terminaldeletions [IglE �(Asn96-Asp125) or IglE �(Ser110-Asp125)]were significantly impaired (Fig. 8B). To determine if altered pro-tein was expressed, we performed an immunoblotting experimentwith polyclonal rat antiserum specific for IglE. Both IglE�(Asn96-Asp125) and IglE �(Ser110-Asp125), which failed torescue intramacrophage growth, were readily detected, albeit at areduced abundance relative to that for the constitutively expressedwild-type form of IglE (iglE�). In contrast, we were unable todetect IglE �(Tyr2-Iso23) lacking the signal peptide (Fig. 8A) inthe immunoblot, indicating that it is likely unstable (data notshown).
To address the possibility that a general inherent instability ofsome mutant forms of IglE was responsible for their inability torescue the intracellular growth of an LVS iglE-null strain, TP569expressing wild-type IglE (iglE�) and TP652 iglE �(Asn96-Asp125), TP809 iglE �(Ser120-Asp125), TP816 iglE �(Ser110-Asp125), and TP656 iglE (Cys22-Gly) were grown to mid-logphase (OD600, �0.1 to 0.19) and treated with a combination ofrifampin and chloramphenicol at 1 and 4 mg/liter, respectively, toblock transcription and translation, respectively. As expected, in-hibition of cell growth was observed 60 min after drug addition,indicating that transcription and translation within the treatedcells had indeed ceased (data not shown). We then performed animmunoblot using IglE-specific rat polyclonal antiserum to mon-itor the cellular stability of preexisting IglE over a defined periodof time. FopA levels were monitored in parallel as an internal
FIG 8 Identification of IglE variants that fail to rescue intracellular growth.(A) Schematic depiction of regions of iglE mutated in this study. (B) Deriva-tives of the LVS iglE-null mutant or the same strain expressing wild-type ormutated forms of iglE from attTn7 were used to infect J774.A1 macrophage-like cells seeded into 12-well plates at an MOI of 20. The numbers of intracel-lular CFU were determined at 2 and 22 h p.i. The data are presented as theattenuation index calculated as the fold change in the number of CFU between2 and 22 h p.i. for each test strain over the number for the complementedparent strain (iglE�) and represent the means of at least two independentdeterminations SDs. (C) Analysis of IglE abundance from calibrated proteinlysates following separation by SDS-PAGE and immunoblotting with rat poly-clonal IglE antisera. FTT0831c levels were monitored by immunoblotting withrat polyclonal FTT0831c antiserum as a loading control. IglE �(S120-D125*)is equivalent to IglE �(S120-D125) but lacks the nontemplated proline addedas part of the inverse PCR mutagenesis strategy.
IglE Is Essential for F. tularensis Pathogenesis
November 2013 Volume 81 Number 11 iai.asm.org 4035
loading control. IglE was readily detected by immunoblottingfrom protein extracts prepared at multiple time points through150 min after drug addition. We predicted that if mutant forms ofIglE were unstable and subject to constitutive proteolysis, wewould observe an appreciable depletion of the nonreplenishedcellular pool of the IglE protein over time. Although we did ob-serve a slight reduction in the cellular abundance of some mutantforms of IglE [e.g., IglE �(Ser110-D125) and IglE (Cys22-Gly)]over time, the net loss of protein over the course of 150 min ofdrug treatment was minimal and not likely to account for theappreciable difference in protein abundance in the cell (Fig. 9). Incontrast and, again, in agreement with the findings from our ear-lier immunoblotting experiments, differences in the cellularabundance of some mutant forms of IglE were again apparent inthe untreated samples (zero time point; compare the results forIglE to those for the internal loading controls in Fig. 9). This isinterpreted to mean that the IglE variants that failed to rescueintracellular growth [i.e., IglE �(Asn96-Asp125), IglE �(Ser110-Asp125), and IglE (Cys22-Gly)] are not wholly unstable or subjectto rapid general proteolysis per se. Further, as IglE is producedconstitutively in the iglE-null background from the same site(attTn7) under PrpsL control, it seems unlikely that differences intranscription or translational efficiency could account for thesedifferences. Rather, we argue that some mutant forms of IglE pro-tein must be misfolded and degraded immediately following re-lease from the ribosome, whereas other forms (that still remain inthe cell) are protected. This could occur either through inefficientfolding of some mutant forms of IglE into a stable (protease resis-tant) form or, possibly, via protection from degradation by someas yet unknown secondary stabilizing interaction.
Lastly, in order to verify that the results of our genetic screenwith LVS in J774.A1 macrophages were indicative of the fact thatkey residues of IglE are required for function in virulent type ASchu S4, a Schu S4 iglE-null strain expressing iglE �(Asn96-Asp125) from attTn7 (Fig. 3A) was constructed and tested forsystemic lethal infection of C3H/HeN mice following i.n. instilla-tion of 273 CFU. Similar to what was observed with the Schu S4iglE (Cys22-Gly) mutant, Schu S4 expressing iglE �(Asn96-Asp125) was attenuated, and none of the animals became ill dur-ing the course of the infection, indicating complete attenuation(Fig. 4). To eliminate the possibility that altered membrane traf-
ficking was responsible for the failure of IglE �(Asn96-Asp125) torescue the in vivo and intracellular growth of the Schu S4 and LVSiglE-null strains, respectively, we repeated cellular subfraction-ation experiments on TP652 expressing the iglE �(Asn96-Asp125)allele following osmotic lysis and separation of the OM and IMfractions. As is shown in Fig. 7, the IglE �(Asn96-Asp125) variantwas found exclusively in the OM fraction. However, in contrast towild-type IglE, we noted that this IglE variant was not also foundin the nonmembrane fraction with a density of 1.11 to 1.13 g/ml(Fig. 7). These combined data are interpreted to mean that regionsin the carboxyl-terminal one-third of the mature IglE protein,specifically, those encompassing asparagine 96 through serine120, contribute to IglE function and, to some extent, IglE stabilitybut are not required for proper membrane trafficking, whereasother regions, namely, serine 120 through aspartic acid 125, aredispensable for function.
DISCUSSION
The virulence of F. tularensis is thought to depend on its ability toinvade, survive, and replicate within host macrophages. Many fac-tors required for this process have been identified, principally onthe basis of work with F. tularensis subsp. novicida and LVS. How-ever, confirmation of the roles of many of these factors in fullypathogenic F. tularensis subsp. tularensis has been limited, and insome cases, the roles of these factors between these closely relatedsubspecies have been inconsistent among studies (4–6). As such,there has been increased recognition of the need to validate keyfindings for the more pathogenic strains using relevant infectionmodels. The role of IglE in Francisella pathogenesis has been eval-uated previously. Weiss and associates identified all genes in theFPI, including iglE, during a transposon-based negative-selectionscreen of F. tularensis subsp. novicida U112 virulence using anintraperitoneal murine infection model (35). iglE was also foundto be essential for intracellular replication of F. tularensis subsp.novicida U112 in murine RAW264.7 (34) and J774 (36) macro-phage-like cells. In a set of unrelated studies, iglE was required byF. tularensis subsp. novicida U112 for wild-type colonization andfull lethality of Drosophila melanogaster flies (33) but was not sim-ilarly identified in a second genetic screen employing cultured D.melanogaster-derived S2 cells (54). Importantly, none of thesestudies addressed the possibility of polar effects on downstreamFPI genes, and efforts to complement the defects arising from theloss of iglE either were not reported (33, 34) or were not successful(36). As such, the absolute role of iglE in F. tularensis subsp. novi-cida pathogenesis has remained unclear. Here we show that iglE isrequired for intramacrophage replication of strain Schu S4 inBMMs and LVS in J774 macrophage-like cells and that this defectis fully reversed by constitutive expression of iglE in trans fromPrpsL in attTn7. To our knowledge, this represents the first pub-lished report demonstrating a role for iglE in the intracellular sur-vival of virulent type A Schu S4. Further, our ability to comple-ment this defect shows that it is the loss of iglE and not polar effectscaused by the iglE mutation that gives rise to the intramacrophagegrowth defect. This establishes, for the first time, a genotype-phe-notype relationship for iglE, which is likely transcribed as part of apolycistronic operon that includes vgrG. Whereas iglE was foundto be essential for the virulence of Schu S4 in C3H/HeN mice,prior intranasal immunization with Schu S4 �iglE1 �iglE2::FRT atdoses well above those reported to protect mice with the current,unapproved LVS (55; G. T. Robertson, unpublished observation)
FIG 9 Intracellular stability of IglE or IglE derivatives expressed from attTn7in the F. tularensis subsp. holarctica LVS iglE-null background following treat-ment with rifampin and chloramphenicol. Calibrated protein lysates preparedat the indicated times after drug addition were separated by SDS-PAGE andassayed by immunoblotting with rat polyclonal IglE antisera. FopA levels weremonitored by immunoblotting with rat polyclonal FopA antisera as a loadingcontrol.
failed to protect mice from death following secondary virulentSchu S4 pulmonary challenge 42 days after the initial immuniza-tion (data not shown). These observations are entirely consistentwith those published previously, suggesting that highly attenuatedF. tularensis strains fail to engender a significant or protective im-mune response (31).
Early studies suggested that certain FPI genes are required forintramacrophage growth, whereas others are not. Hierarchal clus-tering analysis of mutant phenotypes resulting from a geneticscreen of candidate virulence factors contributing to F. tularensissubsp. novicida U112 virulence in D. melanogaster and J774 mousemacrophages indicated strong correlations among mutants lack-ing 14 of 18 FPI genes (including iglE), which was interpreted tomean that many of these genes likely contribute to a commonfunction (33). However, this model is not supported by all of theresults obtained to date. For example, whereas both LVS iglI andiglG mutants showed essentially wild-type growth in J774 macro-phages, only the iglG mutant was proficient for growth in perito-neal exudates and BMMs (22). Differences in intracellular repli-cation and induction of host cell death pathways were alsoobserved following infection of J774 macrophages with pdpC,iglC, iglG, or iglI mutants of LVS (56). Consistent with this result,Long et al. found that while Schu S4 iglI and IglJ were essential forphagosomal escape and alteration of endosomal trafficking, a mu-tant lacking pdpC was only partially defective in this regard (30).This led to the conclusion that PdpC contributes to, but is notessential for, remodeling of the host phagosomal pathway (30). Asimilar result was reported for an LVS pdpC mutant (57). As pdpCwas one of four genes (along with pdpE, pdpD, and anmK) notsimilarly required for lethality of F. tularensis subsp. novicida inthe D. melanogaster fly model, it is tempting to speculate that asubset of FPI genes performs a common, nonredundant functionand is essential for FPI activity and, hence, pathogenesis in multi-ple host species; another set may contribute to pathogenesis but isnot absolutely essential for FPI activity per se. The extent of appar-ent phagosomal escape observed here for the Schu S4 iglE-nullstrain (i.e., 38% of bacteria were cytoplasmic) was higher than thatreported for Schu S4 variants lacking either iglC (31), iglI, or iglJ orthe FPI regulator fevR (30). Instead, the reduction in phagosomalescape observed in the Schu S4 iglE-null strain was more similar tothat for Schu S4 lacking pdpC, which was only partially defective inthis regard (30). In contrast to the latter study, however, our re-sults indicate that iglE is essential for colonization and dissemina-tion in the C3H/HeN mouse model following i.n. challenge. Thisappears to be inconsistent with the observations by Long and as-sociates for a Schu S4 pdpC strain when administered to BALB/cmice at a much higher i.n. infection dose of �106 CFU (30). Fur-ther studies comparing the Schu S4 iglE-null strain to one or moreof these mutants or an FPI deletion strain would be necessary toresolve this question.
Kinetic studies indicate that iglE expression is induced slightlyduring intracellular residence and peaks near the end of the cyto-solic replication phase (58), but the function of this protein isunknown. IglE is annotated as a hypothetical protein but encodesseveral features that are typical of bacterial lipoproteins, includinga short amino-terminal signal peptide bearing a positively chargedN-terminal region, followed by a hydrophobic region and a con-served lipobox motif (Leu-Ser-Ser-Cys) which includes an invari-ant cysteine at position 22. Consistent with these features, IglE ispredicted to encode a bacterial lipoprotein, on the basis of in silico
analysis using the LipoP (version 1.0) lipoprotein predictionserver (59), which gave a reliability score of 12.5. Our TX-114phase-partitioning and [3H]palmitate incorporation studies sup-port the prediction that IglE is a bacterial lipoprotein. Further, wepredict that wild-type IglE is exclusively localized to the OM,based on osmotic lysis and separation of IM and OM fractions.Mutation of the invariant cysteine at position 22 to a glycine re-sulted in an IglE variant that was incapable of rescuing an iglE-nullmutant of LVS for intramacrophage replication in J774 cells or aSchu S4 iglE-null strain for murine virulence when administeredby the i.n. route. However, the molecular basis for this attenuationis not yet known. As measured by immunoblot, the IglE (Cys22-Gly) variant is present at lower levels and exhibits somewhat de-creased stability in time course studies. However, the IglE (Cys22-Gly) variant is not wholly unstable. Further, whereas preliminarystudies employing Sarkosyl enrichment of OMPs suggest differ-ential fractionation of IglE (Cys22-Gly) to both the soluble and IMfractions, IglE (Cys22-Gly) was observed exclusively within theOM fraction following osmotic lysis and differential separationthrough discontinuous gradient centrifugation (G. T. Robertson,unpublished). At present, we do not have an explanation for thesecontradictory results. Regardless, our in vivo and intramac-rophage survival data indicate that cysteine 22 and, by extension,processing by signal peptidase II and lipidation are essential forthe biological function of IglE.
The presence of an N-terminal signal sequence and our com-bined biochemical and genetic data suggesting that IglE is an outermembrane-anchored lipoprotein are inconsistent with the resultsof a second study which showed that IglE coupled to a beta-lacta-mase reporter is secreted from the cell in a manner that is depen-dent on other core FPI proteins (37). The same authors also notedthat PdpE (a second secreted FPI-encoded protein) also possessesa signal peptide (37). This raises the intriguing possibility eitherthat the Sec and T6SS pathways are connected in Francisella or thatsome FPI-secreted substrates (i.e., IglE) have two biological func-tions, one which requires a membrane-anchoring lipid moiety(e.g., T6SS assembly) and another where soluble protein is re-quired (e.g., as a T6SS substrate of unknown function).
Taken as a whole, the studies reported here provide strongevidence that iglE is a critical virulence factor for virulent Schu S4and that the loss of iglE is indeed responsible for the overall defectin virulence observed. Given that the loss of iglE results in defectsin both intracellular growth and phagosome escape with charac-teristics similar to those of other FPI mutants, we speculate thatIglE is important for FPI function, assembly, and/or regulation,possibly as a structural or pilot protein. Consistent with this no-tion, ectopically expressed IglE was observed to localize to the OMof LVS, and its activity required amino acid sequences at or near itscarboxyl terminus. The FPI is proposed to encode a putative se-cretion apparatus with structural and other distant similarities tothe T6SS found in many diverse bacterial species (reviewed inreference 22). However, there is little direct evidence to date tosuggest that a specific secretion apparatus exists. Several studieshave demonstrated specific interactions between various FPI-en-coded proteins (23, 28, 60, 61), and in the case of IglA, this inter-action was shown to be critical for virulence and dependent on aconserved �-helical domain (28). A more recent biochemicalstudy by de Bruin and associates posits that a non-membrane-associated multiprotein structure can be observed in immuno-blots of protein fractions assayed following separation of the OM
IglE Is Essential for F. tularensis Pathogenesis
November 2013 Volume 81 Number 11 iai.asm.org 4037
and IM through discontinuous sucrose gradients (36). Our resultsalso suggest a correlation between the ability to successfully com-plement the loss of IglE in trans and the formation of a non-membrane-associated protein fraction that is observed in sucrosedensities between 1.11 and 1.13 g/ml. Further studies on pooledfractions containing this material would be necessary to resolvewhether this represents protein aggregation or some type of struc-tured apparatus. However, given that wild-type IglE associateswith these fractions, whereas a nonfunctional IglE �(Asn96-Asp125) variant does not, it is tempting to speculate that the re-gions of IglE that are required to facilitate an IglE protein-proteinassociation(s) and, possibly, formation of an FPI-encoded struc-ture are defined by this deletion. Precedence for this idea comesfrom studies of T6SS from other organisms. For example, TssJ(SciN) is required for type VI secretion and biofilm formation inenteroaggregative E. coli; inactivation of the gene encoding TssJ orsequestration at the IM (by altering the N � 2 residue for lipopro-tein sorting) blocked TssJ translocation and protein function (62).Structural studies on TssJ (SciN) revealed a loop that was criticalfor protein-protein interactions with the IM protein TssM, thusdefining a link between the OM and IM in a manner that wasproposed to form a channel to accommodate the insertion of asecretion apparatus (63); a similar model has been proposed forVibrio cholerae (64). Interaction of a T6SS-encoded putative lipo-protein, the N-terminal domain of an IcmF homologue, and theC-terminal domain of a third protein of unknown function(EvpA) is also required for T6SS function in Edwardsiella tarda, apathogen of fish and humans (65). Other critical, but nonstruc-tural, roles have also been reported for OM-localized lipoproteinsin the regulation of T6SS function. For instance, TagQ, an OM-anchored lipoprotein, is required for transmembrane signalingthat promotes H1-T6SS activity in Pseudomonas aeruginosa in re-sponse to environmental cues (66). Our genetic data suggest thatIglE must reach a proper cellular location and that regions in thecarboxyl terminus of IglE are necessary for intracellular growthand pathogenesis. As such, we propose that these effects are me-diated by as yet undefined protein-protein interactions. However,it remains to be determined whether these effects are instead aresult of altered cellular abundance (Fig. 8C) or other unforeseenproperties resulting from deletion of the carboxyl-terminal regionof this hypothetical protein, which can now be defined as a bonafide virulence factor for virulent Schu S4. Understanding how thisprotein functions at the biochemical level will provide furtherimportant insights toward unraveling the enigma of FPI functionin Francisella pathogenesis.
ACKNOWLEDGMENTS
We thank Martin Pavelka (University of Rochester Medical Center), LarryGallagher (University of Washington), and Herbert Schweizer (ColoradoState University) for sharing genetic reagents and Nicole Dobbs (Univer-sity of Texas Southwestern Medical Center) for technical assistance withanimal studies.
This work was supported by grant number U54 AI057156 from theNational Institute of Allergy and Infectious Diseases (NIAID), NIH.
The contents are solely the responsibility of the authors and do notnecessarily represent the official views of the RCE Programs Office,NIAID, or NIH.
REFERENCES1. Ellis J, Oyston PC, Green M, Titball RW. 2002. Tularemia. Clin. Micro-
biol. Rev. 15:631– 646.
2. McLendon MK, Apicella MA, Allen LA. 2006. Francisella tularensis:taxonomy, genetics, and immunopathogenesis of a potential agent of bio-warfare. Annu. Rev. Microbiol. 60:167–185.
Acid phosphatases do not contribute to the pathogenesis of type A Fran-cisella tularensis. Infect. Immun. 78:59 – 67.
5. Lindgren H, Shen H, Zingmark C, Golovliov I, Conlan W, Sjostedt A.2007. Resistance of Francisella tularensis strains against reactive nitrogenand oxygen species with special reference to the role of KatG. Infect. Im-mun. 75:1303–1309.
6. Russo BC, Horzempa J, O’Dee DM, Schmitt DM, Brown MJ, CarlsonPE, Jr, Xavier RJ, Nau GJ. 2011. A Francisella tularensis locus required forspermine responsiveness is necessary for virulence. Infect. Immun. 79:3665–3676.
7. Pechous RD, McCarthy TR, Zahrt TC. 2009. Working toward the future:insights into Francisella tularensis pathogenesis and vaccine development.Microbiol. Mol. Biol. Rev. 73:684 –711.
8. Bonquist L, Lindgren H, Golovliov I, Guina T, Sjostedt A. 2008. MglAand Igl proteins contribute to the modulation of Francisella tularensis livevaccine strain-containing phagosomes in murine macrophages. Infect.Immun. 76:3502–3510.
9. Clemens DL, Lee BY, Horwitz MA. 2004. Virulent and avirulent strainsof Francisella tularensis prevent acidification and maturation of theirphagosomes and escape into the cytoplasm in human macrophages. In-fect. Immun. 72:3204 –3217.
10. Santic M, Asare R, Skrobonja I, Jones S, Abu Kwaik Y. 2008. Acquisitionof the vacuolar ATPase proton pump and phagosome acidification areessential for escape of Francisella tularensis into the macrophage cytosol.Infect. Immun. 76:2671–2677.
11. Santic M, Molmeret M, Abu Kwaik Y. 2005. Modulation of biogenesis ofthe Francisella tularensis subsp. novicida-containing phagosome in quies-cent human macrophages and its maturation into a phagolysosome uponactivation by IFN-gamma. Cell. Microbiol. 7:957–967.
13. Huang MT, Mortensen BL, Taxman DJ, Craven RR, Taft-Benz S, KijekTM, Fuller JR, Davis BK, Allen IC, Brickey WJ, Gris D, Wen H, KawulaTH, Ting JP. 2010. Deletion of ripA alleviates suppression of the inflam-masome and MAPK by Francisella tularensis. J. Immunol. 185:5476 –5485.
14. Fuller JR, Craven RR, Hall JD, Kijek TM, Taft-Benz S, Kawula TH.2008. RipA, a cytoplasmic membrane protein conserved among Franci-sella species, is required for intracellular survival. Infect. Immun. 76:4934 – 4943.
15. Akimana C, Al-Khodor S, Abu Kwaik Y. 2010. Host factors required formodulation of phagosome biogenesis and proliferation of Francisella tu-larensis within the cytosol. PLoS One 5:e11025. doi:10.1371/journal.pone.0011025.
16. Edwards JA, Rockx-Brouwer D, Nair V, Celli J. 2010. Restricted cyto-solic growth of Francisella tularensis subsp. tularensis by IFN-gamma ac-tivation of macrophages. Microbiology 156:327–339.
17. Chong A, Wehrly TD, Child R, Hansen B, Hwang S, Virgin HW, CelliJ. 2012. Cytosolic clearance of replication-deficient mutants reveals Fran-cisella tularensis interactions with the autophagic pathway. Autophagy8:1342–1356.
18. Clemens DL, Lee BY, Horwitz MA. 2005. Francisella tularensis entersmacrophages via a novel process involving pseudopod loops. Infect. Im-mun. 73:5892–5902.
19. McCaffrey RL, Allen LA. 2006. Francisella tularensis LVS evades killing byhuman neutrophils via inhibition of the respiratory burst and phagosomeescape. J. Leukoc. Biol. 80:1224 –1230.
20. Telepnev M, Golovliov I, Grundstrom T, Tarnvik A, Sjostedt A. 2003.Francisella tularensis inhibits Toll-like receptor-mediated activation of in-tracellular signalling and secretion of TNF-alpha and IL-1 from murinemacrophages. Cell. Microbiol. 5:41–51.
21. Bosio CM, Bielefeldt-Ohmann H, Belisle JT. 2007. Active suppression ofthe pulmonary immune response by Francisella tularensis Schu4. J. Immu-nol. 178:4538 – 4547.
22. Broms JE, Sjostedt A, Lavander M. 2011. The role of the Francisellatularensis pathogenicity island in type VI secretion, intracellular survival,and modulation of host cell signaling. Front. Microbiol. 1:136.
23. de Bruin OM, Ludu JS, Nano FE. 2007. The Francisella pathogenicity
island protein IglA localizes to the bacterial cytoplasm and is needed forintracellular growth. BMC Microbiol. 7:1. doi:10.1186/1471-2180-7-1.
24. Nano FE, Zhang N, Cowley SC, Klose KE, Cheung KK, Roberts MJ,Ludu JS, Letendre GW, Meierovics AI, Stephens G, Elkins KL. 2004. AFrancisella tularensis pathogenicity island required for intramacrophagegrowth. J. Bacteriol. 186:6430 – 6436.
25. Barker JR, Chong A, Wehrly TD, Yu JJ, Rodriguez SA, Liu J, Celli J,Arulanandam BP, Klose KE. 2009. The Francisella tularensis pathogenic-ity island encodes a secretion system that is required for phagosome escapeand virulence. Mol. Microbiol. 74:1459 –1470.
26. Mougous JD, Cuff ME, Raunser S, Shen A, Zhou M, Gifford CA,Goodman AL, Joachimiak G, Ordonez CL, Lory S, Walz T, JoachimiakA, Mekalanos JJ. 2006. A virulence locus of Pseudomonas aeruginosaencodes a protein secretion apparatus. Science 312:1526 –1530.
27. Pukatzki S, Ma AT, Sturtevant D, Krastins B, Sarracino D, Nelson WC,Heidelberg JF, Mekalanos JJ. 2006. Identification of a conserved bacterialprotein secretion system in Vibrio cholerae using the Dictyostelium hostmodel system. Proc. Natl. Acad. Sci. U. S. A. 103:1528 –1533.
28. Broms JE, Lavander M, Sjostedt A. 2009. A conserved alpha-helix essen-tial for a type VI secretion-like system of Francisella tularensis. J. Bacteriol.191:2431–2446.
29. Golovliov I, Baranov V, Krocova Z, Kovarova H, Sjostedt A. 2003. Anattenuated strain of the facultative intracellular bacterium Francisella tu-larensis can escape the phagosome of monocytic cells. Infect. Immun.71:5940 –5950.
30. Long ME, Lindemann SR, Rasmussen JA, Jones BD, Allen LA. 2013.Disruption of Francisella tularensis Schu S4 iglI, iglJ, and pdpC genes re-sults in attenuation for growth in human macrophages and in vivo viru-lence in mice and reveals a unique phenotype for pdpC. Infect. Immun.81:850 – 861.
31. Twine S, Bystrom M, Chen W, Forsman M, Golovliov I, Johansson A,Kelly J, Lindgren H, Svensson K, Zingmark C, Conlan W, Sjostedt A.2005. A mutant of Francisella tularensis strain SCHU S4 lacking the abilityto express a 58-kilodalton protein is attenuated for virulence and is aneffective live vaccine. Infect. Immun. 73:8345– 8352.
32. Kadzhaev K, Zingmark C, Golovliov I, Bolanowski M, Shen H, ConlanW, Sjostedt A. 2009. Identification of genes contributing to the virulenceof Francisella tularensis SCHU S4 in a mouse intradermal infection model.PLoS One 4:e5463. doi:10.1371/journal.pone.0005463.
33. Ahlund MK, Ryden P, Sjostedt A, Stoven S. 2010. Directed screen ofFrancisella novicida virulence determinants using Drosophila melano-gaster. Infect. Immun. 78:3118 –3128.
34. Llewellyn AC, Jones CL, Napier BA, Bina JE, Weiss DS. 2011. Macro-phage replication screen identifies a novel Francisella hydroperoxide re-sistance protein involved in virulence. PLoS One 6:e24201. doi:10.1371/journal.pone.0024201.
35. Weiss DS, Brotcke A, Henry T, Margolis JJ, Chan K, Monack DM. 2007.In vivo negative selection screen identifies genes required for Francisellavirulence. Proc. Natl. Acad. Sci. U. S. A. 104:6037– 6042.
36. de Bruin OM, Duplantis BN, Ludu JS, Hare RF, Nix EB, Schmerk CL,Robb CS, Boraston AB, Hueffer K, Nano FE. 2011. The biochemicalproperties of the Francisella pathogenicity island (FPI)-encoded proteinsIglA, IglB, IglC, PdpB and DotU suggest roles in type VI secretion. Micro-biology 157:3483–3491.
37. Broms JE, Meyer L, Sun K, Lavander M, Sjostedt A. 2012. Uniquesubstrates secreted by the type VI secretion system of Francisella tularensisduring intramacrophage infection. PLoS One 7:e50473. doi:10.1371/journal.pone.0050473.
38. Robb CS, Nano FE, Boraston AB. 2010. Cloning, expression, purifica-tion, crystallization and preliminary X-ray diffraction analysis of intracel-lular growth locus E (IglE) protein from Francisella tularensis subsp. novi-cida. Acta Crystallogr. Sect. F Struct. Biol. Cryst. Commun. 66(Pt 12):1596 –1598.
39. Hazlett KR, Caldon SD, McArthur DG, Cirillo KA, Kirimanjeswara GS,Magguilli ML, Malik M, Shah A, Broderick S, Golovliov I, Metzger DW,Rajan K, Sellati TJ, Loegering DJ. 2008. Adaptation of Francisella tular-ensis to the mammalian environment is governed by cues which can bemimicked in vitro. Infect. Immun. 76:4479 – 4488.
40. Huntley JF, Conley PG, Hagman KE, Norgard MV. 2007. Characteriza-tion of Francisella tularensis outer membrane proteins. J. Bacteriol. 189:561–574.
41. Horton RM. 1993. In vitro recombination and mutagenesis of DNA: SOE-ing together tailor-made genes. Methods Mol. Biol. 15:251–261.
42. Gallagher LA, McKevitt M, Ramage ER, Manoil C. 2008. Genetic dis-section of the Francisella novicida restriction barrier. J. Bacteriol. 190:7830 –7837.
44. LoVullo ED, Sherrill LA, Pavelka MS, Jr. 2009. Improved shuttle vectorsfor Francisella tularensis genetics. FEMS Microbiol. Lett. 291:95–102.
45. LoVullo ED, Molins-Schneekloth CR, Schweizer HP, Pavelka MS, Jr.2009. Single-copy chromosomal integration systems for Francisella tular-ensis. Microbiology 155:1152–1163.
46. Choi KH, Gaynor JB, White KG, Lopez C, Bosio CM, Karkhoff-Schweizer RR, Schweizer HP. 2005. A Tn7-based broad-range bacterialcloning and expression system. Nat. Methods 2:443– 448.
47. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression datausing real-time quantitative PCR and the 2(�Delta Delta C(T)) method.Methods 25:402– 408.
48. Huntley JF, Robertson GT, Norgard MV. 2010. Method for the isolationof Francisella tularensis outer membranes. J. Vis. Exp. 2010:2044. doi:10.3791/2044.
49. Checroun C, Wehrly TD, Fischer ER, Hayes SF, Celli J. 2006. Au-tophagy-mediated reentry of Francisella tularensis into the endocytic com-partment after cytoplasmic replication. Proc. Natl. Acad. Sci. U. S. A.103:14578 –14583.
50. Radolf JD, Chamberlain NR, Clausell A, Norgard MV. 1988. Identifi-cation and localization of integral membrane proteins of virulent Trepo-nema pallidum subsp. pallidum by phase partitioning with the nonionicdetergent Triton X-114. Infect. Immun. 56:490 – 498.
51. Parra MC, Shaffer SA, Hajjar AM, Gallis BM, Hager A, Goodlett DR,Guina T, Miller S, Collins CM. 2010. Identification, cloning, expression,and purification of Francisella lpp3: an immunogenic lipoprotein. Micro-biol. Res. 165:531–545.
52. Sjostedt A, Tarnvik A, Sandstrom G. 1991. The T-cell-stimulating 17-kilodalton protein of Francisella tularensis LVS is a lipoprotein. Infect.Immun. 59:3163–3168.
53. Okuda S, Tokuda H. 2011. Lipoprotein sorting in bacteria. Annu. Rev.Microbiol. 65:239 –259.
54. Asare R, Akimana C, Jones S, Abu Kwaik Y. 2010. Molecular bases ofproliferation of Francisella tularensis in arthropod vectors. Environ. Mi-crobiol. 12:2587–2612.
55. Pechous RD, McCarthy TR, Mohapatra NP, Soni S, Penoske RM,Salzman NH, Frank DW, Gunn JS, Zahrt TC. 2008. A Francisellatularensis Schu S4 purine auxotroph is highly attenuated in mice but offerslimited protection against homologous intranasal challenge. PLoS One3:e2487. doi:10.1371/journal.pone.0002487.
56. Lindgren M, Eneslatt K, Broms JE, Sjostedt A. 2013. Importance ofPdpC, IglC, IglI, and IglG for modulation of a host cell death pathwayinduced by Francisella tularensis LVS. Infect. Immun. 81:2076 –2084.
57. Lindgren M, Broms JE, Meyer L, Golovliov I, Sjostedt A. 2013. TheFrancisella tularensis LVS �pdpC mutant exhibits a unique phenotypeduring intracellular infection. BMC Microbiol. 13:20. doi:10.1186/1471-2180-13-20.
58. Wehrly TD, Chong A, Virtaneva K, Sturdevant DE, Child R, EdwardsJA, Brouwer D, Nair V, Fischer ER, Wicke L, Curda AJ, Kupko JJ, III,Martens C, Crane DD, Bosio CM, Porcella SF, Celli J. 2009. Intracellularbiology and virulence determinants of Francisella tularensis revealed bytranscriptional profiling inside macrophages. Cell. Microbiol. 11:1128 –1150.
59. Juncker AS, Willenbrock H, Von Heijne G, Brunak S, Nielsen H, KroghA. 2003. Prediction of lipoprotein signal peptides in Gram-negative bac-teria. Protein Sci. 12:1652–1662.
60. Karna SL, Zogaj X, Barker JR, Seshu J, Dove SL, Klose KE. 2010. Abacterial two-hybrid system that utilizes Gateway cloning for rapid screen-ing of protein-protein interactions. Biotechniques 49:831– 833.
61. Ludu JS, de Bruin OM, Duplantis BN, Schmerk CL, Chou AY, ElkinsKL, Nano FE. 2008. The Francisella pathogenicity island protein PdpD isrequired for full virulence and associates with homologues of the type VIsecretion system. J. Bacteriol. 190:4584 – 4595.
62. Aschtgen MS, Bernard CS, De Bentzmann S, Lloubes R, Cascales E.2008. SciN is an outer membrane lipoprotein required for type VI secre-tion in enteroaggregative Escherichia coli. J. Bacteriol. 190:7523–7531.
63. Felisberto-Rodrigues C, Durand E, Aschtgen MS, Blangy S, Ortiz-Lombardia M, Douzi B, Cambillau C, Cascales E. 2011. Towards a
IglE Is Essential for F. tularensis Pathogenesis
November 2013 Volume 81 Number 11 iai.asm.org 4039
structural comprehension of bacterial type VI secretion systems: charac-terization of the TssJ-TssM complex of an Escherichia coli pathovar. PLoSPathog. 7:e1002386. doi:10.1371/journal.ppat.1002386.
64. Leiman PG, Basler M, Ramagopal UA, Bonanno JB, Sauder JM, Pu-katzki S, Burley SK, Almo SC, Mekalanos JJ. 2009. Type VI secretionapparatus and phage tail-associated protein complexes share a commonevolutionary origin. Proc. Natl. Acad. Sci. U. S. A. 106:4154 – 4159.
65. Zheng J, Leung KY. 2007. Dissection of a type VI secretion system inEdwardsiella tarda. Mol. Microbiol. 66:1192–1206.
66. Casabona MG, Silverman JM, Sall KM, Boyer F, Coute Y, Poirel J,Grunwald D, Mougous JD, Elsen S, Attree I. 2013. An ABC transporterand an outer membrane lipoprotein participate in posttranslational acti-vation of type VI secretion in Pseudomonas aeruginosa. Environ. Micro-biol. 15:471– 486.
![Page 1: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/1.jpg)
![Page 2: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/2.jpg)
![Page 3: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/3.jpg)
![Page 4: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/4.jpg)
![Page 5: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/5.jpg)
![Page 6: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/6.jpg)
![Page 7: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/7.jpg)
![Page 8: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/8.jpg)
![Page 9: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/9.jpg)
![Page 10: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/10.jpg)
![Page 11: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/11.jpg)
![Page 12: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/12.jpg)
![Page 13: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/13.jpg)
![Page 14: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/14.jpg)
![Page 15: IglE Is an Outer Membrane-Associated Lipoprotein Essential for … · Biosciences] [sMHB]) or on modified Mueller-Hinton agar (Mueller-Hinton supplemented prior to autoclave sterilization](https://reader034.documents.pub/reader034/viewer/2022042413/5f2d1fed52f71526ed71a186/html5/thumbnails/15.jpg)
