+ All Categories
Home > Documents > Important Terms

Important Terms

Date post: 31-Dec-2015
Category:
Upload: austin-mercado
View: 20 times
Download: 4 times
Share this document with a friend
Description:
Important Terms 1) Genetics is the study of biologically inherited traits or (biological heredity). 2) I nherited traits are determined by the elements (units) of heredity ( genes ). A gene is a region of DNA containing genetic information. - PowerPoint PPT Presentation
Popular Tags:
21
Gene Protein Genome Proteome Genomics Proteomics
Transcript
Page 1: Important Terms

GeneProtein

GenomeProteome

GenomicsProteomics

Page 2: Important Terms

Important Terms

1 )Genetics is the study of biologically inherited traits or (biological heredity).

2 )Inherited traits are determined by the elements (units) of heredity )genes). A gene is a region of DNA containing genetic information.

3 )Genome is the total of DNA in a single cell of the organism.

Page 3: Important Terms

4) Genomics is the latest advance in molecular genetics. It deals with the DNA sequence, organization, function, and evolution of genomes.

5) Proteome is the complete set of proteins encoded in the genome .

6) Proteomics is the study of the complement of proteins presentin a cell or organism in order to identify their cellular localization, functions, and interactions.

Page 4: Important Terms

genotype

Is the genetic constitution of a cell (organism)

Page 5: Important Terms

phenotype

Is the observable properties of an organism (including its visible traits)

Page 6: Important Terms

Alleles?

Alleles are the different forms of particular gene.

Page 7: Important Terms

Heterozygous genotype

The genotype in which the pair of alleles are different.

Page 8: Important Terms

Homozygous genotype

The genotype in which the pair of alleles are alike.

Page 9: Important Terms

Dominant trait

Is that expressed in the phenotype when the genotype is either heterozygous or homozygous.

Page 10: Important Terms

Recessive trait

Is that expressed in the phenotype when the genotype is homozygous

Page 11: Important Terms

Complementary base pairing

It is the base pairing between A and T and between C and G.

The complement of A is T and the complement of C is G.

Page 12: Important Terms

RNA

1 (RNA contains the sugar ribose instead of deoxyribose in DNA.

2 (RNA is single stranded.

3 (RNA contains the base uracil (U) instead of thymine (T) which is present in DNA.

Page 13: Important Terms

Transcription & Translation

One strand of DNA directs the synthesis of a molecule of RNA (ribonucleic acid). (this is called transcription and the RNA made is called transcript).

Messenger RNA (mRNA) carries genetic information from DNA and is used as a template for polypeptide synthesis. (this is called translation).

Page 14: Important Terms

3Types of RNA to make protein

1 (Messenger RNA which is used as a template for synthesis of protein.

2 (Ribosomal RNA (rRNA) which has four types and on which polypeptide synthesis takes place.

3 (Transfer RNA (tRNA): it is a set of tRNA, each of which carries a particular amino acid as well as a three-base recognition

area to bind 3 adjacent bases in mRNA .

Page 15: Important Terms

Mutation

Mutation refers to any heritable change in a gene or in the genetic material in general.

It refers also to the process by which a change takes place.

Mutant is the result of mutation. Mutant RNA, mutant DNA, mutant protein .

Page 16: Important Terms

Sickle cell hemoglobin

GAG: codon on mRNA for glutamic acid (Aa)

GUG: codon on mRNA for valine (Aa)

wild type mutant

DNA: 5’…GAG… …GTG…3’

DNA(T): 3’…CTC… ... CAC …5’

mRNA: 5’…GAG… …GUG…3’

So glutamic acid will be replaced by valine.

Page 17: Important Terms

In the human gene for the β chain of hemoglobin, the first 21 nucleotides in the amino-acid-coding have the sequence:

3-' TACCACGTGGACTGAGGACTC -5' 1 (Deduce the base sequence of the mRNA

in this coding region?2 (What is the amino acid sequence in this

part of β chain of hemoglobin

Page 18: Important Terms

3 -'TACCACGTGGACTGAGGACAC -5‘

What is the amino acid replacement?

Page 19: Important Terms

CodonAmino AcidCodonAmino Acid

CUGLeucine / LeuACUThreonine / Thr

AUAIsoleucine / IleACAThreonine / Thr

AUGMethionine / MetCACHistidine / His

GUGValine / ValAAGLysine / Lys

UCUSerine / SerGAGGlutamic acid / Glu

CCUProline / ProCGGArgenine / Arg

CCCProline / ProUGGTrp / Tryptophan

Page 20: Important Terms
Page 21: Important Terms

Recommended