R

Ib

JMa

b

Veterinary Immunology and Immunopathology 131 (2009) 9–16

A

A

R

R

A

K

V

C

S

T

T

G

f

0

d

esearch paper

n vitro effect of vitamin E on lectin-stimulated porcine peripherallood mononuclear cells

esus Hernandez a,*, Eneida Soto-Canevett a, Araceli Pinelli-Saavedra a,onica Resendiz a, Silvia Y. Moya-Camarena a, Kirk C. Klasing b

Centro de Investigacion en Alimentacion y Desarrollo, A.C., Carretera a la Victoria Km 0.6, Apdo. Postal No. 1735, Hermosillo 83000 Sonora, Mexico

Department of Animal Science, University of California, Shields Ave., Davis, CA 95616, USA

R T I C L E I N F O

rticle history:

eceived 23 April 2008

eceived in revised form 21 February 2009

ccepted 2 March 2009

eywords:

itamin E

ytokines

wine

BX21

-bet

ATA3

A B S T R A C T

In order to analyze the effect of vitamin E on Th1 and Th2 cytokine production, porcine

peripheral blood mononuclear cells (PBMC) were isolated from healthy pigs (n = 8) and

cultured with either 0, 10, 50, or 100 mM of vitamin E (a-tocopherol). PBMC were

stimulated with PHA for either, 24 h to determine: (a) the concentration of tocopherol

incorporated into the cell membrane, (b) cytokine production and (c) Th1 and Th2

regulators gene expression; or 72 h to determine the proliferation of PBMC. Vitamin E was

incorporated into the PBMC in a dose dependent manner, giving as a result a high

proliferation of cells irrespective of the dose of vitamin E used. Regarding cytokine

production, vitamin E consistently decreases the mRNA expression and the percentage of

cells producing IL-10. Vitamin E did not influence the production of IFN-g but the lowest

level of vitamin E (10 mM) was sufficient to maximally increase the proportion of cells

producing IL-2, to diminish IL-4, and discreetly increase the mRNA expression of TBX21 vs.

GATA3. In conclusion, our results revealed that vitamin E is able to suppress IL-10

production and to influence the production of IL-2, IL-4, and maybe TBX21. Vitamin E

clearly has immunomodulatory effects, though further work in vivo to determine the

physiological nature of these effects is warranted.

� 2009 Elsevier B.V. All rights reserved.

Contents lists available at ScienceDirect

Veterinary Immunology and Immunopathology

journal homepage: www.e lsev ier .com/ locate /vet imm

1. Introduction

CD4 T lymphocytes orchestrate the adaptive immuneresponse through the production of cytokines. Thecytokines produced by CD4 T cells can be divide intoTh1 (IFN-g), Th2 (IL-4) (Mosmann, 1992) or regulatory Tcells (Treg; IL-10 and TGF-b) (Belkaid, 2007). Recently, anew subset with immune regulatory effects has beenidentified, Th17 (IL-23) (Bi et al., 2007). After activation byAPC, naıve T cells engage in complex differentiation eventsbefore developing into Th1, Th2, Th17 or Treg cells. Signals

* Corresponding author. Tel.: +52 662 280 0094x294;

ax: +52 662 280 0094x294.

E-mail address: jhdez@ciad.mx (J. Hernandez).

165-2427/$ – see front matter � 2009 Elsevier B.V. All rights reserved.

oi:10.1016/j.vetimm.2009.03.001

T cells received from APC drive their differentiation andprovide the basis for the design of vaccines and/oradjuvants.

IL-12 is considered the main inducer of Th1 (Bromba-cher et al., 2003). In addition, IFN-g and IFN-a also enhancethe generation of Th1. In contrast, IL-4 promotes Th2whereas TGF-b and IL-10 are the main inductors of Tregcells. The development of Th1 cytokines is regulated by thetranscription factor T-bet, whereas GATA3 regulates Th2response. Treg regulation is more complex, but expressionof the transcription factor Foxp3 is closely related to thisphenotype (Hori et al., 2003).

Cytokines production of Th1 and Th2 has been des-cribed in pigs, humans and rodents. Th1 cytokines arecharacterized by IFN-g production in pigs infected withbacterial, viral and parasitic pathogens and in healthy pigs

J. Hernandez et al. / Veterinary Immunology and Immunopathology 131 (2009) 9–1610

(Azevedo et al., 2006; Dawson et al., 2005, 2004; de Grootet al., 2005). Also, the expression of transcription factorTBX21 (also known as T-bet) has been associated with theinduction of Th1 responses (Dawson et al., 2004). IL-4 isnot always the most important Th2 cytokine and thefunctions of IL-13 overlap considerably with those of IL-4,and IL-13 takes over the function of IL-4 in a number ofcases (Azevedo et al., 2006; Bautista et al., 2007; Dawsonet al., 2005; de Groot et al., 2005), however GATA3expression is not associated with Th2 response. Recently,Tregs has been described in pigs, which are characterizedby the production of IL-10 (Kaser et al., 2008). TGF-b-producing Tregs (also known as Th3) have not beenreported in pigs yet. However, data from our laboratoryhave shown its presence in pigs (Silva-Campa et al., inpreparation).

Nutritional immunology seeks to increase or modulatethe immune response through manipulation of the level ofdietary nutrients. Many reports have described howvitamins can modulate cytokine production after in vitro

or in vivo supplementation (Adolfsson et al., 2001;Boonstra et al., 2001; Dawson et al., 2006; Han et al.,2006, 2000; Hernandez et al., 2008; Li-Weber et al., 2002;Ma et al., 2005; Pinelli-Saavedra, 2003; Wang et al., 2007).Vitamin A enhances Th2 cytokines and improves theimmune response against gastrointestinal parasites (Daw-son et al., 2006; Wang et al., 2007). Vitamin D also polarizesTh2 by increasing expression of GATA3 and c-maf, leadingto the secretion of IL-4, IL-5 and IL-10 and inhibiting IFN-g(Boonstra et al., 2001). Vitamin E is also an immunor-egulatory nutrient; it increases the production of IL-2 inseveral species and decreases IL-4 (Adolfsson et al., 2001;Han et al., 2006, 2000). Controversy exists with regards tothe ability of vitamin E to increase IFN-g (Han et al., 2000;Malmberg et al., 2002). Vitamin E also induces theproduction of IL-10, when evaluated in lymphocytesstimulated with dendritic cells (Tan et al., 2005). Theeffects of vitamin E on the regulatory genes T-bet andGATA3 have not been evaluated.

Previous reports have involved vitamin E as an importantimmunomodulator in pigs. It has been described thatvitamin E can increase the proliferation of PHA-stimulatedPBMC, the antibody production and phagocytosis (Larsenand Tollersrud, 1981; Pinelli-Saavedra, 2003; Pinelli-Saave-dra et al., 2008). Also, it has been described that vitaminE inhibits inflammatory cytokine responses (Webel et al.,1998), but its effects on Th1 or Th2 polarization areunknown. In this work, the effects of vitamin E supple-mentation on cytokine production of porcine PBMC wereevaluated. Different concentrations of vitamin E were testedand proliferation, cytokine production and expression ofTBX21 and GATA3 were determined.

2. Materials and methods

2.1. Experimental design

In order to analyze the effect of vitamin E on Th1 andTh2 cytokines, porcine PBMC were isolated from two-month-old pigs (n = 8), cultured with different concentra-tions of vitamin E, (a-tocopherol; 0, 10, 50, and 100 mM),

and stimulated with PHA for either, 24 h to determine: (a)the concentration of vitamin E incorporated into the cellmembrane, (b) cytokine production and (c) Th1 and Th2regulators gene expression; or 72 h to determine theproliferation of PBMC. HPLC analysis was carried out toquantify vitamin E, cytokine production was analyzed byintracellular staining using flow cytometry (FACS), cyto-kine mRNAs were semi-quantified by conventional RT-PCR, Th1 (T-bet) and Th2 (GATA3) regulatory geneexpression was analyzed by real time PCR, and prolifera-tion was evaluated with carboxyfluorescein diacetate-succinimidyl ester (CFSE) and FACS analysis.

2.2. Antibodies and reagents

Mouse monoclonal antibodies (mAbs) specific forporcine IL-2 (IgG2b, clone No. 100312), IL-4 (IgG1, cloneNo. 99613), IL-10 (IgG2A, clone No. 148806), and IFN-g(IgG2b, clone No. 154007) were purchased from R&DSystems (Pullman, WA, USA), phycoerythrin (PE)-conju-gated goat-anti mouse IgG (Southern Biotech) was used asthe secondary antibody. All primers were purchased fromSigma GENOSYS, Sigma (Table 1). Primers and probes forGATA3 and T-bet were kindly supplied by Dr. HarryDawson (Table 1). Vitamin E as a-tocopherol (Cat. No.T3251) was purchased from Sigma (St. Louis, MO, USA),and CFSE from Molecular Probes (Eugene, OR, USA).

2.3. Animals

Healthy conventional Landrace/Yorkshire hybrid two-month-old pigs were housed at the metabolic unit of CIAD,A.C. Water and food were provided ad libitum. Feed suppliedthe minimal requirement (30 mg/kg fed) of vitamin E toavoid deficiencies. Pigs were kept according to the Inter-national Guidelines for Animal Care.

2.4. Preparation of vitamin E for supplementation

A stock solution of vitamin E was prepared bydissolving a-tocopherol in absolute ethanol. To optimizecellular uptake, the stock solution was then mixed withcomplement inactivated fetal bovine serum (FBS; 16000-044, GIBCO, Gland Island, NY, USA) at a final concentrationof 2.31 mM and incubated at 37 8C for 1 h in the dark withintermittent vortexing. For supplementation of PBMC,solutions of vitamin E in RPMI-1640 (R4130, Sigma) with10% of FBS were prepared and the final concentration ofvitamin E was 10, 50 or 100 mM.

2.5. PBMC proliferation assay

Fifteen millilitre of blood was collected into heparin-coated blood collection tubes (Becton-Dickinson), diluted1:2 with RPMI-1640 (Sigma), underlaid with Ficoll-Hypaque (Amersham Biosciences, Uppsala, Sweden), andcentrifuged at 500 � g for 20 min. PBMC were collectedfrom the interface, washed three times in RPMI-1640 andcell viability was determined by the trypan blue dyeexclusion method. For analysis of PBMC proliferation, cellswere stained with CFSE. Briefly, 1 ml of PBMC suspension

Table 1

Primer and probe sequences.

Gene Forward primer sequence (50–30) Reverse primer sequence (50–30) Probe sequence (50–30)

TBX21a TGGACCCAACTGTCAATTGCT ACGGCTGGGAACGGGATA TETb-ACCACTACTCTCCTCTCCTCCCCAACCAGT-BHQ1c

GATA3 TCTAGCAAATCCAAAAAGTGCAAA GGGTTGAACGAGCTGCTCTT TET-TCCTCCAGCGTGTCGTGCACCT-BHQ1

PPIAd GCCATGGAGCGCTTTGG TTATTAGATTTGTCCACAGTCAGCAAT TET-TGATCTTCTTGCTGGTCTTGCCATTCCT-BHQ1

IL-2 GATTTACAGTTGCTTTTGAA GTTGAGTAGATGCTTTGACA

IL-4 TACCAGCAACTTCGTCCAC ATCGTCTTTAGCCTTTCCAA

IL-10 GCATCCACTTCCCAACCA CTTCCTCATCTTCATCGTCAT

IFN-g GTTTTTCTGGCTCTTACTGC CTTCCGCTTTCTTAGGTAG

GADPH GTCTTCACCACCATGGAG CCAAAGTTGTCATGGATGACC

a Sequences for cytokines and PPIA from Porcine Immunology and Nutrition database (http://www.ars.usda.gov/Services/docs.htm?docid=6065).b TET, 6,carboxy-204,7,70-tetrachlorofluorescein.c BHQ1, black hole quencher.d PPIA, Peptidylprolyl isomerase A.

J. Hernandez et al. / Veterinary Immunology and Immunopathology 131 (2009) 9–16 11

(1 � 107 cells/ml) was incubated with 7.5 mM of CFSE(CFSE was prepared from a 5 mM stock solution dissolvedin dimethyl sulfoxide) in culture medium for 10 min atroom temperature in the dark. After incubation, 10 ml ofculture medium supplemented with 10% heat-inactivatedfetal bovine serum, 50 mM 2-mercaptoethanol (M7522,Sigma), 100 UI penicillin/ml and 100 mg streptomycin/ml(P4458, Sigma) was added to the cells. Subsequently, cellswere centrifuged at 400 � g for 20 min, suspended in 4 ml(2.5 � 106 cells/ml) of supplemented culture medium andcell viability was determined.

Proliferation assays were performed with 2.5 � 105

CFSE-treated PBMC supplemented with 0, 10, 50, or100 mM of vitamin E and stimulated with PHA (10 mg/ml; Sigma). Cells were seeded into 96-well culture plates(3596, Corning, NY, USA) in 200 ml final volume ofsupplemented RPMI-1640 culture medium and incubatedfor 72 h at 37 8C in a humid atmosphere containing 5% CO2.At the end of the culture period, 10,000 cells were acquiredon FACSCalibur equipped with CellQuest software (Becton-Dickinson, San Jose, CA, USA), data were analyzed usingCellQuest1 software (Becton-Dickinson) or WinMDI(http://facs.scripps.edu/software.html) and the blast cellswere gated by forward scatter (FSC) and side scatter (SSC)characteristics. A histogram based on the fluorescenceintensity of unstimulated CFSE-stained cells, which laywithin the blast scatter gate, was made in order todifferentiate dividing cells of lower intensity. The initialgate (R0) included the undivided cell population and thesubsequent gates (R1–R7) enclosed populations withprogressive 2-fold decreases in fluorescence intensity. Cellproliferation was determined as follows:

%divided cells ¼ 100� R1 þ R2 þ � � � þ Rn

R0 þ R1 þ R2 þ � � � þ Rn:

2.6. Flow cytometry analysis of intracellular cytokine

production

Detection of intracellular cytokine production in PHA-stimulated PBMC by two-color stain approach was done.Cells were cultured for 24 h as described above in theproliferation assay. Four hours before cell harvesting,10 mg/ml Brefeldin-A (Cat. No. B-7651, Sigma) was addedto inhibit new cytokine release. Cells were washed withphosphate–buffered saline (PBS; 0.15 M) containing 0.2%

bovine serum albumin (BSA, Cat. No. A9418, Sigma), andfixed with 4% paraformaldehyde for 10 min at 4 8C,washed, and permeabilized with 0.1% saponin in PBSand 10% BSA, and gently shaken in the dark for 15 min atroom temperature. Cells were stained with mAbs againstswine IL-2, IL-4, IL-10, or IFN-g for 30 min at 4 8C.Thereafter, cells were washed twice with 0.5% saponin/PBS and incubated with PE-conjugated goat-anti mouseIgG for 30 min. Finally, 10,000 cells were counted by flowcytometry and analyzed using CellQuest1 software orWinMDI (http://facs.scripps.edu/software.html). To ana-lyze intracellular cytokines, the blasts were first gated bytheir physical properties (FSC and SSC), then a second gatewas drawn based on the fluorescence characteristics of thegated cells. Background staining was assessed usingsamples incubated with PE-conjugated second-step anti-body only.

2.7. RT-PCR for porcine cytokines

Porcine cytokines were analyzed in PHA-stimulatedPBMC supplemented with different concentrations ofvitamin E. After 24 h, PBMC were washed once in PBSand the pellet was resuspended in TRIzol (15596-018,Invitrogen, Carlbad, CA, USA) for total RNA extractionaccording to manufacturer’s protocol. Total RNA wasresuspended in 20 ml of DEPC-treated water (1302688,Invitrogen) for further analysis. For cytokine analysis,reverse transcription was done using Superscript II reversetranscriptase (18064-022, Invitrogen) in a total volume of20 ml, following manufacturer’s recommendations. ThecDNA was stored at�20 8C until used in PCR amplification.PCR reactions were done in a 50-ml reaction using 10 mMTris–HCl, 50 mM KCl (pH 8.3), 3 mM MgCl2, 0.8 mM eachdATP, dTTP, dCTP and dGTP, 20 mM of each primer, 0.25 UTaq DNA polymerase (all products from Invitrogen), and2 ml of cDNA. The PCR reaction was carried out for 35cycles at 94 8C for 3 min, 94 8C for 30 s, 55 8C for 30 s, 72 8Cfor 1 min, and a final elongation at 72 8C for 10 min. EachPCR product (10 ml) was run on 1.2% agarose gels andstained with ethidium bromide for UV visualization. Tocompare the relative mRNA expression level of eachcytokine, the PCR products from supplemented and notsupplemented PHA stimulated PBMC were estimated in asemi-quantified manner by densitometry (Gel Logic 200Imaging System), comparing the intensity of the band,

Fig. 1. PBMC content of vitamin E. PBMC were supplemented with

different concentrations of vitamin E (a-tocopherol) for 24 h and the

content was quantified by HPLC. Results represent the Mean � SEM of 8

pigs. Statistical analyses were performed using one-way ANOVA followed by

Tukey’s multiple comparison test. Different letters denote significant

differences (P � 0.05).

J. Hernandez et al. / Veterinary Immunology and Immunopathology 131 (2009) 9–1612

relative to those of the GAPDH gene (housekeeping gene).Results are presented as the relative intensity ratio ofcytokine mRNA/GAPDH mRNA. Primers for porcine cyto-kines detection have been previously described (Hernan-dez et al., 2001) and are shown in Table 1.

2.8. Real time PCR for GATA3 and TBX21

PCR was performed with a Brilliant Quantitative PCRcore reagent kit (Stratagene, La Jolla, CA), and a SmartCy-cler system (Cephie) as previously described (Flores-Mendoza et al., 2008). The amplification conditions wereas follows: 50 8C for 2 min, 95 8C for 10 min; and 40 cyclesof 95 8C for 15 s and 60 8C for 1 min. Fluorescence signalsmeasured during amplification were processed post-amplification. For quantification of mRNA, differences inCt values between supplemented and non-supplementedPBMC were evaluated with the 2�

DDCt. The Ct values fromsupplemented and non-supplemented cells were normal-ized against an endogenous control (Peptidylprolyl iso-merase A, PPIA), and results are reported as the fold changefrom non-supplemented and supplemented PBMC. Theprimers and probes used are listed in Table 1.

2.9. Quantification of a-tocopherol from PBMC

Alpha-tocopherol was extracted from 5 � 106 cellssupplemented and not supplemented as described byHess et al. (1991) with some modifications: 500 ml ethanol(containing BHT 0.025%) was added to the cell suspensionand vortexed for 10 s. Then, 700 ml of hexane (containingBHT 0.025%) was added and shaken for 10 min, centrifugedat 14,000 rpm for 5 min, and 600 ml of the hexane layerwas removed and dried at room temperature. The driedsamples were dissolved in 400 ml methanol and vortexedfor 10 min. This mixture was injected into the highperformance liquid chromatography (HPLC) column. AVarian Solvent Delivery module Pro-Star 220 and variablewavelength UV-detector Varian 9050 were used and set atan excitation wavelength of 290 nm. Separation wasachieved using a Microsorv C-18 (R-0089200E3) C-18(100 mm � 4.6 mm) column (Varian, USA). The mobilephase was methanol:water (98:2). The detection limit was0.02 mg/ml.

2.10. Statistical analysis

Data were analyzed by one-way analysis of variance(ANOVA) using NCSS 2000 to evaluate the effect of vitaminE supplementation level on proliferation and cytokineproduction. Significant differences among treatments weredetermined by Tukey test (P < 0.05). Kruskal–Wallis testwas used to assess the effect of vitamin E on TBX21andGATA3 mRNA expression.

3. Results

3.1. Uptake of a-tocopherol

PBMC (n = 8) were supplemented with 10, 50 and100 mM of vitamin E for 24 h and the vitamin E content

was quantified by HPLC (Fig. 1). The basal content ofvitamin E in 5 � 106 cells was 0.37 � 0.06 mM (mean� SEM), whereas cells supplemented with 10, 50 and100 mM, had 2.83 � 0.27, 4.32 � 0.27, and 5.05 � 0.47 mM,respectively of vitamin E (P < 0.05), showing a significantincrease in a dose dependent manner.

3.2. Effect of vitamin E on lymphocyte proliferation

In order to evaluate the effect of vitamin E onlymphocyte proliferation, cells (n = 8) were stained withCFSE and cultured for 3 days in the presence of differentlevels of vitamin E. Our results showed that vitamin Eincreased the percentage of proliferating cells (P < 0.05)when cells were supplemented with any of the vitamin Elevels, but there was not a further increase after the firstlevel of supplementation (P > 0.05). When cell cycles ofproliferation were evaluated, vitamin E induced multiplecycles of proliferation in comparison to cells withoutsupplementation. Cells with 10 mM of vitamin E had 4 and5 cycles of maximum proliferation (Fig. 2A), but at 50 and100 mM cells had 7 cycles of proliferation (Fig. 2B and C).

3.3. Cytokine production of PBMC

Fig. 3 shows the results of the effect of vitamin E on Th1and Th2 cytokine production evaluated at mRNA andprotein level. Data are representative of eight pigs. ThemRNA for IL-2 increased in cells stimulated with PHA(relative intensity, RI = 232 � 84), compared to controlunstimulated cells (100 � 82; P < 0.05). PHA-stimulatedcells supplemented with 100 mM vitamin E showed a higher(P < 0.05) IL-2 mRNA (RI = 265 � 88) than non-supplemen-ted-PHA-stimulated cells (RI = 336 � 65). In contrast, 50 mMof vitamin E decreased the expression of IL-2 (P < 0.05)compared to other treatments (0, 10 and 100 mM of vitaminE) and did not show differences regarding to PHA-unstimu-lated cells (control). Supplementation with 10 mM vitamin E

Fig. 2. Effect of vitamin E on PBMC proliferation after 3 days of culture. (Top) A representative experiment showing the analysis on gated blast cells in a

proliferating culture of PHA-stimulated CFSE-stained PBMC show a sequential halving of fluorescence intensity (1–7) that corresponds to cell divisions

(continuous lines). The number 0 represent the population without cell division; proliferating cells without vitamin E (filled histogram) or with vitamin E

(open histogram) at concentration of 10 mM (A), 50 mM (B) and 100 mM (C). (Bottom) Blast cell percentages of PHA-stimulated PBMC and supplemented

(10, 50 and 100 mM) or not with vitamin E. Data represent the mean and the individual data of 8 pigs.

J. Hernandez et al. / Veterinary Immunology and Immunopathology 131 (2009) 9–16 13

was not significantly different to that of 0 mM vitamin E. Thepercentage of cells producing IL-2 was higher in PHA-stimulated than unstimulated cells (9 � 1 and 24 � 4%,respectively; P < 0.05), and 10 mM of vitamin E was sufficientto increase the proportion (28 � 7%; P < 0.05). In thepresence of 50 or 100 mm, the proportion of cells producingIL-2 was 22 � 5 and 25 � 4%, respectively (P > 0.05). ThemRNA expression of IFN-g was did not show a regular patternof response. Cells stimulated with PHA expressed higherlevels of mRNA for IFN-g (RI = 134 � 107) than unstimulatedcells (RI = 62 � 46; P < 0.05), but no differences wereobserved due to supplementation of 10, 50 or 100 mM ofvitamin E (RI = 216 � 191, 115 � 70, and 274 � 117; respec-tively; P > 0.05). Similar results were observed in thepercentage of cells producing IFN-g. A significant incrementwas observed when comparing PHA-stimulated (15 � 2%) vs.unstimulated cells (RI = 4 � 1%; P < 0.05), but no furtherchanges were caused by 10 (17 � 3%), 50 (12 � 3%) or100 mM (13 � 4%) of vitamin E (P > 0.05). The mRNAexpression for IL-4 was low in unstimulated cells(RI = 8 � 13) and increased after PHA stimulation (218 �109; P < 0.05). PHA stimulated cells incubated with 10 or50 mM vitamin E showed a trend to decrease the expressionof IL4 mRNA (RIs 101 � 103, 134 � 108 respectively;P > 0.05), which was less evident in presence of 100 mM ofvitamin E (RI = 187 � 81). The percentage of cells producingIL-4 was greater in stimulated (18 � 2%) than unstimulated

cells (6 � 1%; P < 0.05). In the presence of 10 mM of vitamin Ea significant reduction in the percentage of cells producing IL-4 was noticed (11 � 3%; P < 0.05) compared to those with50 mM (14 � 5%) or 100 mM (13 � 4%; P > 0.05). The mRNAexpression of IL-10 increased with stimulation of cells (fromRI = 166 � 118 to 318 � 111 for unstimulated and stimulatedcells; P < 0.05), and vitamin E significantly reduced itsexpression (RI = 123 � 47, and 118 � 36, for 10 and 50 mMrespectively; P < 0.05) the expression of IL-10. No changeswere observed when cells were supplemented with 100 mM(RI = 185 � 85; P > 0.05). Stimulation with PHA increased thepercentage of IL-10 cells (6 � 2 to 18 � 3%; P < 0.05). Theaddition of vitamin E (10, 50 or 100 mM), reduced the numberof cells producing IL-10 (9 � 1, 12 � 2, 9 � 2%, respectively;P < 0.05).

3.4. Modulation of TBX21 and GATA3 by vitamin E

Fig. 4 shows the relative changes in TBX21 and GATA3on PBMC stimulated with PHA and supplemented withvitamin E (n = 4). TBX21 and GATA3 mRNA levels were notsignificantly different by vitamin E supplementation(P > 0.05). However, the analysis of the proportion ofTBX21 mRNA levels related to GATA3 mRNA levelsobtained, revealed that only the lowest vitamin E con-centration used (10 mM) induced higher levels of TBX21mRNA over GATA3 mRNA (1.5-fold difference; P = 0.08).

Fig. 3. Expression of cytokines on vitamin E supplemented-PBMC. Total RNA was extracted and the mRNA relative expression (cytokine/GADPH) of

cytokines was evaluated by conventional RT-PCR. The percentage of positive cells was evaluated on 24 h PHA-stimulated PBMC by using intracellular two-

stain label as is described in Section 2. Results are expressed as Mean � SEM of 8 pigs. Data were analyzed by one-way ANOVA followed by Tukey’s test.

Different letters represent significant differences (P < 0.05).

J. Hernandez et al. / Veterinary Immunology and Immunopathology 131 (2009) 9–1614

4. Discussion

The aim of this work was to evaluate the ability ofvitamin E to modulate the production of Th1 and Th2cytokines. Our results showed that the addition of vitaminE to PBMC cultures increased their proliferation irrespec-tive of the dose of vitamin E used. However, IL-2production increases only at the highest concentrationof vitamin E (100 mM) used. No changes were observed inthe production of IFN-g, but a reduction in the productionof IL-4 and IL-10 was noticed with the lowest concentra-tion of vitamin E (10 mM). These changes were associatedwith a discrete increased mRNA expression (P = 0.08) ofTBX-21 over the expression of GATA3 with the lowestconcentration of vitamin E.

After 24 h of supplementation, we observed thatvitamin E was incorporated into the membrane of PBMCin proportion to the amount supplemented in the mediaculture. When proliferation was evaluated, higher pro-liferation was observed in presence of vitamin E. Theseresults are in agreement with previous reports in pigs

(Larsen and Tollersrud, 1981; Pinelli-Saavedra, 2003) andother species (Adolfsson et al., 2001; Han et al., 2006),which described that PBMC of mice supplemented withvitamin E induced the cells to enter more proliferationcycles, by increasing IL-2 expression and its high affinityreceptor CD25 (Adolfsson et al., 2001). In mice, vitamin Eincreases the expression of cell-related proteins cyclin B,Cdc2, and Cdc6, which are important in the regulation ofthe cell cycle (Han et al., 2006). IL-2 is the main cytokineinvolved in the proliferation of T cells. In our experiment,the change in IL-2 relative to a housekeeping gene(GAPDH) and the number of cytokine-producing cellswas evaluated. Although the intracellular cytokine stainingmethod gives information on cytokine production at thesingle-cell level, these data are relatively qualitative innature (Zhang et al., 2005). Therefore, we decided not tocompare the cytokine level on per cell basis. We observedthat IL-2 mRNA expression level responded to vitamin Elevel differently than the proportion of cells producing IL-2. At the mRNA level, we only observed significant changeswhen 100 mM of vitamin E was added, but the proportion

Fig. 4. TBX21 and GATA3 mRNA expression. Total RNA was extracted and

the mRNA expression of cytokines was quantified by real time PCR. For

quantification, differences in Ct values between supplemented and non-

supplemented PBMC were evaluated with the delta-delta equation. The

Ct values were normalized against the PPIA gene, as endogenous control,

and results (Mean � SEM of 4 pigs) are reported as the relative fold change

from non-supplemented vs. TBX21 (black bars), and GATA3 (clear bars).

Statistical analyses were performed using Kruskal–Wallis test.

J. Hernandez et al. / Veterinary Immunology and Immunopathology 131 (2009) 9–16 15

of cells producing IL-2 was increased with 10 mM. Ourresults suggest that vitamin E increases both the propor-tion of cells producing IL-2 and the total amount ofmessage, and these results could explain why proliferationwas consistently increased following addition of differentconcentrations of vitamin E.

A previous report has described the effects of vitamin Eon cells in Peyer’s patches and mesenteric lymph nodes ofweaned pigs. Vitamin E can increase the number of IgA+ B-lymphocytes compared with control animals, but noeffects were observed on the numbers of CD4+ or CD8+T-lymphocytes (Fragou et al., 2006). To our knowledge,data regarding the effects of vitamin E on Th1 or Th1cytokine response in pigs are not available. In mice and tosome extent in humans (Malmberg et al., 2002), vitamin Ehas the ability to up-regulate Th1 cytokines, especially IFN-g. According to our results, vitamin E did not up-regulatethe expression of IFN-g mRNA or the number of cellsproducing IFN-g, though we did observe a non-significanttrend for 10 and 100 mM of vitamin E to increaseexpression. Some functions of vitamin E may be specie-dependent.

Vitamin E activates protein kinase C (Tasinato et al.,1995) and NF-kB (Li-Weber et al., 2002), an importanttranscription factor in the synthesis of many cytokinesincluding IFN-g. However, one of the main transcriptionfactors responsible for IFN-g expression is TBX21 (Szaboet al., 2003). TBX21 initiates Th1 cell differentiation byactivating Th1 genetic programs and repressing Th2phenotypes. In order to explain the involvement ofvitamin E in the regulation of TBX21 and GATA3 genes,the mRNA expression of these genes was quantified byqPCR. Our results showed that only the lowest concentra-tion of vitamin E (10 mM) up-regulated the expression ofTBX21 over GATA3. Interesting, similar results wereobserved when the IFN-g was evaluated. These results

provide preliminary evidence that vitamin E could beinvolved in regulation of TBX21 and GATA3 in pigs. Theregulation of T-bet (TBX21) by vitamin E has beenevaluated previously in aged mice (Jones et al., 2003).In that report, vitamin E was able to regulate theexpression of TBX21and PPAR-a, and in consequence tocontrol the dysregulated IL-2 and IFN-g production ofaged mice.

Regarding Th2 cytokines, IL-4 was down-regulated atthe protein level and no significant changes were observedat the transcriptional level, although there was a trendtowards low mRNA expression with 10 mM of vitamin E.Supplementation of 50 or 100 mM of vitamin E did notmodify the IL-4 mRNA or protein. In humans, it has beenshown that low in vitro supplements of vitamin E reducedthe transcription of IL-4 and this was associated with theinhibition of AP-1 transcription factor (Li-Weber et al.,2002). In our results, we observed that mRNA levels ofGATA-3 were low with 10 mM of vitamin E, which suggeststhat in addition to AP-1, inhibition of GATA-3 could beimplicated in the down-regulation of IL-4. However, thishypothesis needs to be tested.

The major effects of vitamin E were observed for IL-10production. According to our results, vitamin E reducesthe expression of IL-10 mRNA and the proportion of IL-10producing cells. These data suggest that vitamin Eprovided in vitro decreases the development of Th2cytokine response and/or Treg cells. Modulation of Tregby vitamin E has not been evaluated and needs to beanalyzed in future works. Some studies have reportedthat vitamin E and C treated-human dendritic cellsreduce the allogeneic T cell response and increase theexpression of Th2 cytokines (IL-4 and IL-10) (Tan et al.,2005). This discrepancy may be attributed to the differentcell type used in both experiments or by the combinedeffect of vitamin E with vitamin C. In the present work,the low level of IL-10 observed should favor Th1responses, increasing T-bet expression and greaterinflammation; however no changes on IFN-g productionwere observed. The effect of vitamin E on IL-10production has been contradictory; while some authorsreported a decreased production (Sabat et al., 2001;Venkatraman and Chu, 1999; Wang et al., 1995) othersreported no changes (Hsieh and Lin, 2005). The mechan-isms proposed to explain this decrease in IL-10 includethe ability of vitamin E to inhibit PKC (Tasinato et al.,1995), since it has been shown that expression andsynthesis of IL-10 requires the early activation of PKC(Meisel et al., 1996). Another possible mechanism is thedecreased expression of the transcription factor GATA3,which can modulate the expression of IL-10 (Chang et al.,2007). Further experiments are needed to test thesehypotheses.

In conclusion, vitamin E was incorporated into lym-phocytes in a dose dependent manner. The lowest level ofvitamin E (10 mM) was sufficient to maximally increaselymphocyte proliferation, enhance the proportion of cellsproducing IL-2, and to diminish IL-4 and IL-10 levels.Vitamin E clearly has immunomodulatory effects andfurther work in vivo is necessary to determine thephysiological nature of these effects.

J. Hernandez et al. / Veterinary Immunology and Immunopathology 131 (2009) 9–1616

Acknowledgment

This work was supported by UC-MEXUS grant fromJesus Hernandez and Kirk C. Klasing.

References

Adolfsson, O., Huber, B.G., Meydani, S.N., 2001. Vitamin E-enhanced IL-2production in old mice: naive but not memory T cells show increasedcell division cycling and IL-2 producing capacity. J. Immunol. 167,3809.

Azevedo, M.S., Yuan, L., Pouly, S., Gonzales, A.M., Jeong, K.I., Nguyen, T.V.,Saif, L.J., 2006. Cytokine responses in gnotobiotic pigs after infectionwith virulent or attenuated human rotavirus. J. Virol. 80, 372–382.

Bautista, E.M., Nfon, C., Ferman, G.S., Golde, W.T., 2007. IL-13 replaces IL-4in development of monocyte derived dendritic cells (MoDC) of swine.Vet. Immunol. Immunopathol. 115, 56–67.

Belkaid, Y., 2007. Regulatory T cells and infection: a dangerous necessity.Nat. Rev. 7, 875–888.

Bi, Y., Liu, G., Yang, R., 2007. Th17 cell induction and immune regulatoryeffects. J. Cell. Physiol. 211, 273–278.

Boonstra, A., Barrat, F.J., Crain, C., Heath, V.L., Savelkoul, H.F., O’Garra, A.,2001. 1alpha 25-Dihydroxyvitamin d3 has a direct effect on naiveCD4(+) T cells to enhance the development of Th2 cells. J. Immunol.167, 4974–4980.

Brombacher, F., Kastelein, R.A., Alber, G., 2003. Novel IL-12 family mem-bers shed light on the orchestration of Th1 responses. Trends Immu-nol. 24, 207–212.

Chang, H.D., Helbig, C., Tykocinski, L., Kreher, S., Koeck, J., Niesner, U.,Radbruch, A., 2007. Expression of IL-10 in Th memory lymphocytes isconditional on IL-12 or IL-4, unless the IL-10 gene is imprinted byGATA-3. Eur. J. Immunol. 37, 807–817.

Dawson, H.D., Beshah, E., Nishi, S., Solano-Aguilar, G., Morimoto, M., Zhao,A., Madden, K.B., Ledbetter, T.K., Dubey, J.P., Shea-Donohue, T., Lunney,J.K., Urban Jr., J.F., 2005. Localized multigene expression patterns sup-port an evolving Th1/Th2-like paradigm in response to infections withToxoplasma gondii and Ascaris suum. Infect. Immun. 73, 1116–1128.

Dawson, H.D., Collins, G., Pyle, R., Key, M., Weeraratna, A., Deep-Dixit, V.,Nadal, C.N., Taub, D.D., 2006. Direct and indirect effects of retinoicacid on human Th2 cytokine and chemokine expression by human Tlymphocytes. BMC Immunol. 7, 27.

Dawson, H.D., Royaee, A.R., Nishi, S., Kuhar, D., Schnitzlein, W.M., Zuck-ermann, F., Urban Jr., J., Lunney, J.K., 2004. Identification of keyimmune mediators regulating T helper 1 responses in swine. Vet.Immunol. Immunopathol. 100, 105–111.

de Groot, J., Kruijt, L., Scholten, J.W., Boersma, W.J., Buist, W.G., Engel, B., vanReenen, C.G., 2005. Age, gender and litter-related variation in T-lym-phocyte cytokine production in young pigs. Immunology 115, 495–505.

Flores-Mendoza, L., Silva-Campa, E., Resendiz, M., Osorio, F.A., Hernandez,J., 2008. Porcine reproductive and respiratory syndrome virus infectsmature porcine dendritic cells and up-regulates interleukin-10 pro-duction. Clin. Vaccine Immunol. 15, 720–725.

Fragou, S., Balaskas, C., Fegeros, K., Politis, I., 2006. Effect of vitamin Esupplementation on lymphocyte distribution in gut-associated lym-phoid tissues obtained from weaned piglets. J. Vet. Med. 53, 327–333.

Han, S.N., Adolfsson, O., Lee, C.K., Prolla, T.A., Ordovas, J., Meydani, S.N.,2006. Age and vitamin E-induced changes in gene expression profilesof T cells. J. Immunol. 177, 6052–6061.

Han, S.N., Wu, D., Ha, W.K., Beharka, A., Smith, D.E., Bender, B.S., Meydani,S.N., 2000. Vitamin E supplementation increases T helper 1 cytokineproduction in old mice infected with influenza virus. Immunology100, 487–493.

Hernandez, J., Garfias, Y., Nieto, A., Mercado, C., Montano, L.F., Zenteno, E.,2001. Comparative evaluation of the CD4+CD8+ and CD4+CD8-lym-phocytes in the immune response to porcine rubulavirus. Vet. Immu-nol. Immunopathol. 79, 249–259.

Hernandez, J., Garibay-Escobar, A., Mendoza-Mendoza, A., Pinelli-Saave-dra, A., Valenzuela, O., 2008. Effect of exogenous vitamin E on pro-liferation and cytokine production in peripheral blood mononuclearcells from patients with tuberculosis. Br. J. Nutr. 99, 224–229.

Hess, D.K., Keller, H.E., Oberlin, B., Bonfant, R., Scheup, W., 1991. Simul-taneous determination of retinol, tocopherols, carotenes and lyco-pens in plants by means of high performance liquid chromatographyon reversed phase. Int. J. Vitam. Nutr. Res. 61, 232–238.

Hori, S., Nomura, T., Sakaguchi, S., 2003. Control of regulatory T celldevelopment by the transcription factor Foxp3. Science 299, 1057–1061 (New York, NY).

Hsieh, C.C., Lin, B.F., 2005. The effects of vitamin E supplementation onautoimmune-prone New Zealand black � New Zealand white F1 micefed an oxidised oil diet. Br. J. Nutr. 93, 655–662.

Jones, D.C., Ding, X., Zhang, T.Y., Daynes, R.A., 2003. Peroxisome prolif-erator-activated receptor alpha negatively regulates T-bet transcrip-tion through suppression of p38 mitogen-activated protein kinaseactivation. J. Immunol. 171, 196–203.

Kaser, T., Gerner, W., Hammer, S.E., Patzl, M., Saalmuller, A., 2008.Detection of Foxp3 protein expression in porcine T lymphocytes.Vet. Immunol. Immunopathol. 125, 92–101.

Larsen, H.J., Tollersrud, S., 1981. Effect of dietary vitamin E and seleniumon the phytohaemagglutinin response of pig lymphocytes. Res. Vet.Sci. 31, 301–305.

Li-Weber, M., Giaisi, M., Treiber, M.K., Krammer, P.H., 2002. Vitamin Einhibits IL-4 gene expression in peripheral blood T cells. Eur. J.Immunol. 32, 2401–2408.

Ma, Y., Chen, Q., Ross, A.C., 2005. Retinoic acid and polyriboinosinic:po-lyribocytidylic acid stimulate robust anti-tetanus antibody produc-tion while differentially regulating type 1/type 2 cytokines andlymphocyte populations. J. Immunol. 174, 7961–7969.

Malmberg, K.J., Lenkei, R., Petersson, M., Ohlum, T., Ichihara, F., Glimelius,B., Frodin, J.E., Masucci, G., Kiessling, R., 2002. A short-term dietarysupplementation of high doses of vitamin E increases T helper 1cytokine production in patients with advanced colorectal cancer. Clin.Cancer Res. 8, 1772–1778.

Meisel, C., Vogt, K., Platzer, C., Randow, F., Liebenthal, C., Volk, H.D., 1996.Differential regulation of monocytic tumor necrosis factor-alpha andinterleukin-10 expression. Eur. J. Immunol. 26, 1580–1586.

Mosmann, T.R., 1992. T lymphocyte subsets, cytokines, and effectorfunctions. Ann. N.Y. Acad. Sci. 664, 89–92.

Pinelli-Saavedra, A., 2003. Vitamin E in immunity and reproductiveperformance in pigs. Reprod. Nutr. Dev. 43, 397–408.

Pinelli-Saavedra, A., Calderon de la Barca, A.M., Hernandez, J., Valenzuela,R., Scaife, J.R., 2008. Effect of supplementing sows’ feed with alpha-tocopherol acetate and vitamin C on transfer of alpha-tocopherol topiglet tissues, colostrum, and milk: aspects of immune status ofpiglets. Res. Vet. Sci. 85, 92–100.

Sabat, R., Kolleck, I., Witt, W., Volk, H., Sinha, P., Rustow, B., 2001.Immunological dysregulation of lung cells in response to vitamin Edeficiency. Free Radic. Biol. Med. 30, 1145–1153.

Szabo, S.J., Sullivan, B.M., Peng, S.L., Glimcher, L.H., 2003. Molecularmechanisms regulating Th1 immune responses. Annu. Rev. Immunol.21, 713–758.

Tan, P.H., Sagoo, P., Chan, C., Yates, J.B., Campbell, J., Beutelspacher, S.C.,Foxwell, B.M., Lombardi, G., George, A.J., 2005. Inhibition of NF-kappa B and oxidative pathways in human dendritic cells by anti-oxidative vitamins generates regulatory T cells. J. Immunol. 174,7633–7644.

Tasinato, A., Boscoboinik, D., Bartoli, G.M., Maroni, P., Azzi, A., 1995. D-alpha-tocopherol inhibition of vascular smooth muscle cell prolifera-tion occurs at physiological concentrations, correlates with proteinkinase C inhibition, and is independent of its antioxidant properties.Proc. Natl. Acad. Sci. U.S.A. 92, 12190–12194.

Venkatraman, J.T., Chu, W.C., 1999. Effects of dietary omega-3 and omega-6 lipids and vitamin E on serum cytokines, lipid mediators and anti-DNA antibodies in a mouse model for rheumatoid arthritis. J. Am. Coll.Nutr. 18, 602–613.

Wang, X., Allen, C., Ballow, M., 2007. Retinoic acid enhances the produc-tion of IL-10 while reducing the synthesis of IL-12 and TNF-alphafrom LPS-stimulated monocytes/macrophages. J. Clin. Immunol. 27,193–200.

Wang, Y., Huang, D.S., Wood, S., Watson, R.R., 1995. Modulation ofimmune function and cytokine production by various levels of vita-min E supplementation during murine AIDS. Immunopharmacology29, 225–233.

Webel, D.M., Mahan, D.C., Johnson, R.W., Baker, D.H., 1998. Pretreatmentof young pigs with vitamin E attenuates the elevation in plasmainterleukin-6 and cortisol caused by a challenge dose of lipopolysac-charide. J. Nutr. 128, 1657–1660.

Zhang, P., Smith, R., Chapkin, R.S., McMurray, D.N., 2005. Dietary (n-3)polyunsaturated fatty acids modulate murine Th1/Th2 balancetoward the Th2 pole by suppression of Th1 development. J. Nutr.135, 1745–1751.