+ All Categories
Home > Documents > Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from...

Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from...

Date post: 01-Mar-2021
Category:
Upload: others
View: 2 times
Download: 0 times
Share this document with a friend
18
The world leader in serving science Incorporating SeqStudio™ Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017
Transcript
Page 1: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

The world leader in serving science

Incorporating SeqStudio™ Genetic Analyzer and Sanger sequencing into genome editing workflows Stephen Jackson, Ph.D 27 May 2017

Page 2: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

2

• To study gene function • To target gene mutation • To target transgene addition for

heritable modification

• To label endogenous genes • Stable integration • For tissue & cell engineering to

produce novel functions

Key Applications for Genome Editing Research

Transgenic crop research

Gene therapy research

Stem cell research

Tissue disease research

Animal disease model research

Page 3: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

3

CRISPR/Cas Overview

Types of genomic changes possible: • Single nucleotide changes (SNPs) • Precise deletions and insertions • Imprecise deletions (for knock-outs) • Deletions at multiple loci

Page 4: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

4

Genome Editing Workflow & Thermo Fisher Products

Design Guide RNA

Transfect Cells

Determine Editing

Efficiency (Population)

Establish Single Cell

Clones

Screen Clones for

Edit

Characterize Successful

Edits

• GeneArt CRISPR Search and Design Tool

• GeneArt TALEN search and design tool

• Gibco Transfection Reagents

• Gibco Cell Growth media

• GeneArt CRISPR-Cas9 molecular tools

• GeneArt Enzymatic Cleavage Detection kit

• TOPO cloning & Sanger sequencing

• Sanger Sequencing & TIDE

• IonTorrent NGS Sequencing

• qPCR/dPCR

• Gibco Media • TOPO cloning & Sanger sequencing

• Sanger Sequencing + MVF

• IonTorrent NGS Targeted Sequencing

• qPCR/dPCR

• IonTorrent NGS Whole Genome Sequencing

• Any other phenotypic analyses

Page 5: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

5

• The new SeqStudio™ Genetic Analyzer provides an integrated experience to put you back in control of your lab life

• all-in-one cartridge for easy set up and reduced hands-on time

• with the flexibility for both sequencing and fragment analysis in a single run.

• cloud-based connectivity options for remote monitoring, data transfer and analysis.

• run time of as little as 1 hour with fast turnaround time

• Get an all-new, state of the art experience in an incredibly affordable package.

Experience the New SeqStudio™ Genetic Analyzer

Page 6: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

6

Thermo Fisher Scientific – Facilitating Genome Editing Designs

Pre-defined KO libraries Custom gRNA libraries (KI and others: gRNA per target)

Single targets or 96 well format Single targets or 96 well format

Custom GCD primer design

Identify the gene; place orders through the CRISPR/TAL design tool

Pre-designed GCD primer database

CRISPR cloud design-to-order tool

Proof-of Concept experiment – knockout mutations in HPRT gene • Designed guide RNA to human HPRT and other genes • Transfected HEK293 cells with gRNA and Cas9, grew primary culture. CE Sequenced to

determine efficiency of editing. • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out single HEK293 colonies, CE sequenced DNA from single colonies

Page 7: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

7

CRISPR Workflow with Sanger Sequencing – Primary Screen

Sequencing cultures or colonies with more than one sequence confirms edit, but difficult to confirm sequence of edit

Page 8: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

8

CRISPR Workflow with Sanger Sequencing – Primary Screen

Brinkman et al., Nucl. Acids Res. (2014)

Page 9: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

9

SeqStudio is compatible with TIDE software

HPRT Forward strand RELA Forward strand

HPRT Reverse strand RELA Reverse strand

Efficiency of editing: around 80% Efficiency of editing: around 20%

Mixed culture containing unpurified edited cells sequenced around site of edit

Page 10: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

10

SeqStudio results are equivalent to legacy platforms

RELA Forward - 3130

RELA Forward - 3500

RELA Forward - SeqStudio

HPRT Forward - 3130

HPRT Forward - 3500

HPRT Forward - SeqStudio

Page 11: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

11

CRISPR Workflow with Sanger Sequencing – Primary Screen

2.

4.

CRISPR/Guide

RNA Complex

1.

3.

5.

Transfect cells with editing complex Establish primary culture

Extract DNA from primary culture, PCR amplify locus and subclone

Extract DNA from individual subclones

Sanger sequence individual subclones

Page 12: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

12

SeqStudio sequencing data is equivalent to legacy platforms

SeqStudio traces

3130 traces

Data analyzed using Sanger QC application in the Thermo Fisher Cloud

Page 13: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

13

Examples of Edits in Primary Transformant Culture

GTAAACATTGAAGGGAGATGGAAGAAGGAACTCTAGCCAGAGTCTTGCATTTCTCAGTCCTAAACAGGGTAATGGACTGGGGCTGAATCACATGAAGGCAAGGTCAGATTTTTATTATTA

Page 14: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

14

CRISPR/Cas Workflow – Examples from Secondary Screen

Sequence is homogeneous and monoclonal

Sequence is heterogeneous and not derived from a single clone

Page 15: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

15

SNP Detection in a Secondary Clone

Page 16: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

16

Minor Variant Finder: a key innovation for detecting rare variants

Minor Variant Finder software: 1. Determines background peaks in control sample run concurrently with test sample 2. Compares and removes background peaks from the test sample 3. Looks for variants at identical position in forward and reverse sequencing reactions 4. Calculates area under the peak to determine allele frequency

Page 17: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

17

Conclusions

• Sanger sequencing by capillary electrophoresis can be used to determine efficiency of successful genome edits in primary transformation cultures.

• Sanger sequencing is an efficient method used to confirm successful genome edits in transformed cultures, as well as screening secondary clones for successful editing events.

• Minor variant finder software can be leveraged to determine frequency of SNP changes in clones isolated from secondary cultures

• Thermo Fisher Scientific has integrated the tools necessary for genome editing and downstream analysis

Page 18: Incorporating SeqStudio™ Genetic Analyzer and Sanger … · 2020. 9. 7. · • Cloned DNA from primary culture into TOPO bacterial plasmids, CE sequenced • Diluted to grow out

18

Namritha Ravinder, Ph.D and her team Kamini Varma, Ph.D

Acknowledgements

The GeneArt™ CRISPR design tool, Invitrogen™ reagents, Gibco™ reagents, and TOPO™ cloning kit described in this Presentation are for research use only. Not for use in diagnostic procedures. © 2016 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.


Recommended