of 5
7/31/2019 Individual Members of the Cab Gene Family Differ Widely in Fluence Response
1/5
Plant Physiol. (1 995) 107: 161-1 65
Individual Members of the Cab Gene Family DifferWidely in Fluence Response'Michael j. White*, Lon S. Kaufman, Benjamin A. Horwitz, Winslow R. Briggs, and William F. Thompson
Departme nt of Biology, Saint Mary's U niversity, Halifax, No va Scotia, B3 H 3C3 Canada (M.J.W.);Laboratory for Mo lecu lar Biology, Departme nt of Biolo gical Sciences, University of l l l i no is at Chicago,P.O. Box 4348, Chicago, l l l in ois 60680 (L.S.K.); Dep artme nt o f Biology, Technion , Ha ifa 32000, Israel (B.A.H.);Departme nt of Plant Biology, Carnegie lnstitute of Washington, Stanford, Ca lifornia 94305 (W.R.B.); andDepartments o f Botany and Genetics, No rth Carolina State University, Raleigh, No rth Carolina 27695 (W.F.T.)
Chlorophyll dbbinding protein genes (Cab genes) can be ex-tremely sensitive to light. Transcript accumulation following a redlight pulse increases with fluence over 8 orders of magnitude (L.S.Kaufman, W.F. Thompson, W.R. Briggs [1984] Science 226: 1447-1449 ). W e have constructed fluence-response curves for individualCab genes. At least two Cab genes (Cab-8 and AB96) show a verylow fluence response to a single red light pulse. In contrast, twoother Cab genes (AB80 and AB66) fail to produce detectable tran-script following a single pulse of either red or blue light but areexpressed in continuous red light. Thus, very low fluence responsesand high irradiance responses occur in the same gene family.
Plants respond to light in many different ways, includingmorphological, physiological, and molecular responses.These responses may be qualitative or quantitative in na-ture and often possess minimum fluence thresholds. Flu-entes below this threshold will not activate the response.Many such responses are characterized as low fluence re-sponses, since they occur following a light treatment in thelow fluence range (21pmol mP2). Some pIant responsesare extremely sensitive to light and occur in the VLF rangewith a threshold of approximately 10P4 pmol m-'. Re-sponses to red light in the low fluence and VLF ranges arebelieved to be mediated by the photoreceptor phyto-chrome. However, VLF responses require very little activephytochrome (Pfr); it has been estimated that inductionthresholds may require only 0.003% of the phytochromedimers in the Pr:Pfr state (De Petter et al., 1988). Conse-quently, VLF responses are not reversible by far-red lighttreatments that normally result in about 3% Pfr.A single low fluence irradiation given to dark-grownseedlings is sufficient to elicit transcript accumulation for anumber of higher plant genes. However, the Cub genes alsopossess a response to red light in the VLF range (Kaufmanet al., 1984; Nagy et al., 1986; Horwitz et al., 1988). The Cubgenes in pea (Pisum sutivum) collectively show a biphasicpattern of transcript accumulation in response to increas-' This work was funded by a National Science Foundation grant
to W.F.T. and in part by an Izaak Walton Killam postdoctoralfellowship to M.J.W. This article is Carnegie Institution of Wash-ington, Department of Plant Biology publication No. 1220.* Corresponding author; fax 1-902-420-5261.
ing light fluence (Horwitz et al., 1988). This biphasic re-sponse consists of the VLF response described above andadditional accumulation in the low fluence range. Thisadditional low fluence-induced transcript accumulation isregulated by phytochrome and is reversible by far-redlight, unlike the VLF response, which is not reversed byfar-red light. In the case of the wheat Cub-1 gene, the settingor timing of the circadian clock that regulates transcriptlevels appears to be regulated by a VLF response that canbe initiated with far-red light (Nagy et al., 1993). Experi-ments with other wavelengths suggest that blue and UVlight receptors also affect Cu b transcript accumulation, atleast under certain light regimes (Oelmiiller et al., 1989;Warpeha et al., 1989; Eskins and Beremand, 1990; Warpehaand Kaufman, 1990; Wehmeyer et al., 1990; Jordan et al.,1991).
Severa1 interpretations of the biphasic Cu b fluence-response curve for red light are possible. There are at leastseven Ca b genes in pea that encode polypeptides of themajor light-harvesting complex, LHCII (White et al., 1992;Falconet et al., 1993). We do not know whether these genesdiffer in their fluence response characteristics, since previ-ous fluence response studies did not discriminate amongthe transcripts produced by the seven LHCII genes.
Five of the LHCII genes in pea are classified as type Igenes, based on their high degree of sequence homologyand the lack of an intron in those genomic clones that havebeen sequenced (summarized by White et al. [1992]).Asixth gene, Cub-215 (Lhcb2.1 in the nomenclature of Janssonet al. 119921) contains an intron and is a type I1 gene(Falconet et al., 1991), whereas the seventh gene, Cub-315(Lhcb3*1 in the nomenclature of Jansson et al. [1992]), con-tains two introns and is a type 111 gene (Falconet et al.,1993). In an earlier study (White et al., 1992) we examinedlight responses of a11 seven genes and found a wide rangeof variation among the type I genes. Two of the type I genes(Cub-8 and AB96 = LhcbZ-4 and Lhcbl'l) showed significanttranscript accumulation 24 h after a red light pulse suffi-cient to saturate phytochrome photoconversion, whereasthe other three type I genes (Cub-9, AB80, and AB66 =Lhcb15, Lhcb1'2, and Lhcb13, respectively) showed little or
Abbreviations: Cub, Chl u/b-binding protein; Fed-1, ferredoxin I;LHCII, light-harvesting complex 11 VLF, very low fluence.161
7/31/2019 Individual Members of the Cab Gene Family Differ Widely in Fluence Response
2/5
162 White et ai. Plant Physiol. Vol. 107, 1995
no response to this same treatment. Although the type I1and type I11 LHCII genes did respond to red light, they hadLower transcript levels than the abundantly expressed type1genes, Cab-8 and A B 9 6 .
From these and other considerations it can be concludedthat the type I genes Cab-8 and A B 9 6 account for the bulkof Ca b transcripts induced by red light in the low fluencerange, with possibly a small contribution from the type I1gene, Cab-215. Experiments described in this paper weredesigned to determine whether a11 three genes possess botha VLF and a low fluence response or whether significantdifferences in fluence response exist among these genes. Toaddress this question, we used a highly sensitive and gene-specific technique to construct replicate fluence-responsecurves for each gene. The data show that at least two Cabgenes possess a VLF response.
MATERIALS AND METHODSRlant Crowth Conditions
Pea seedlings (Pisum sativum cv Alaska) used for the redlight fluence response curves were grown and irradiated asdescribed by Horwitz et al. (1988). Plants grown in com-plete darkness for 5.5 d were given a red light pulse ofdefined fluence and returned to the dark for 24 h. Budswere then harvested and frozen in liquid nitrogen prior toRNA extraction. The fluence used to illuminate each set ofseedlings is indicated on the horizontal axis of the fluence-response curves. The highest fluence used saturates Cabtranscript accumulation. Differing fluences were achievedby using the same light source in combination with neutra1density filters.Blue light experiments (Fig. 2) were as described byWarpeha and Kaufman (1990).Seedlings were grown in thedark for 6 d, given a single blue light pulse (fluence= 1000pmol m-), and then returned to the dark for 24 h prior toharvesting buds and extracting RNA.
Quantitating Transcript AbundanceMethods for isolating RNA and quantitating individual
gene transcripts were described in detail by White et al.(1992). Briefly, full-length cDNA was synthesized using anoligo-dT,, primer and a reverse transcriptase lacking anRNase H domain. The cDNA was then amplified by PCRusing gene-specific primers and a limited number of cyclesto assist in quantitation. An internal standard templatesharing the same primer recognition sites was included ina11 PCR reactions. Oligodeoxynucleotidesequences of a11 ofthe Ca b PCR primers are given in figure 1 of White et al.(1992). Oligodeoxynucleotides used to amplify pea Fd I(Fed-1) cDNA were AAACACAAAACAGTGTTTGTT forthe 5 (sense) primer and GAAACAAACATAACAT-GATATCATA for the 3 (antisense) primer. Conditions foramplification of Fed-2 cDNA were identical with those forCa b cDNA amplification except that the thermal cycleswere 94C for 2 min, 55C for 2.5 min, and 72C for 3 min.The PCR product resulting from amplification of pea Fed-lcDNA was 544 bp in length.
The Fed-1 internal PCR standard was obtained by delet-ing a 297-bp 1?glII ragment from the full-length PCR prod-uct. Following BglII digestion, the flanking BglI1 fragmentswere ligated together and amplified using PCR. A BclIdigestion cutting within the deleted 297-bp BgKI fragmentwas used to remove any residual full-length PCR productfrom the standard. In addition, the resulting 247-bp stan-dard was purified by successive rounds of cgarose gelelectrophoresis alternating with PCR amplification.
Biotin-11-dUTP was incorporated during amplificationso that PCR products could be visualized using strepta-vidin-alkaline phosphatase and a chemiluminescent sub-strate. Blots were then exposed to x-ray filrn, and theresulting images were quantitated using laser densitome-try. This technique provides an extremely sens itive, quan-titative, and gene-specific method of transcript measure-ment (White et al., 1992). The fluence-response curvespresented in Figure 1 are an average of three experimentswith independent populations of seedlings.
RESULTS AND DISCUSSIONFluence-response curves were constructed f 33: four red
light-regulated genes (Fig. 1) using a single pulse of redlight given to dark-grown pea plants (see M,iterials andMethods for details). Three individual genes account forthe bulk of Ca b transcript under these conditioris (White etal., 1992). These genes are the type I Ca b genes, Cab-8(Alexander et al., 1991) and A B 9 6 (Coruzzi et a1 ,1983), andthe type I1 Cab gene Cab-215 (Falconet et a[., 1991). Afluence-response curve was also constructed lor a fourthphytochrome-regulated gene, Fed-1 (Dobres et al., 1987;Elliott et al., 1989).
A11 four light-regulated genes showed a measurable levelof expression in complete darkness (Fig. 1). Cab-8, A B 9 6 ,and even Fed-1 showed a response to red light in the VLFrange ( l O P 4 to 1pmol m?). The fluence-responsecurves inFigure 1 were constructed by averaging individual curvesnormalized to the transcript level at the highest fluence. Todetermine the statistical significance of the measured VLFresponse for each gene, t tests were performed using theraw fluence response data (Table I). These t te& comparemean transcript levels in the dark with mea n transcriptlevels at log fluence = 0.3 pmol m-. This jluence waschosen because it marks the upper boundary of the VLFresponse and occupies the edge of the plateaii precedingthe low fluence response in the collective Cab g-ne fluence-response curve (Horwitz et al., 1988). C a b d , A B 9 6 , andFed-1 a11 possessed a statistically significant V ,F response(Table I) when transcript levels at log fluence = 0.3 pmolm- were compared to the dark transcript levels. However,it is not possible to conclude definitely that (ab-215 pos-sesses a VLF response (Table I). Cab-215 is expressed atlower levels than C a b d or A B 9 6 (White et al, 1992) andappears to be induced by red light to a lesser extent thanthe other genes in Figure 1,making it difficult to detect anyVLF response that might exist for Cab-215. The results ofthe t tests for a11 four genes (Table I) fit well with a visualinspection of the fluence-response curves (Fig 1).
7/31/2019 Individual Members of the Cab Gene Family Differ Widely in Fluence Response
3/5
CabGenes Differ Widely in Fluence Response 163
Cab-8
0 - 5 4 - 3 - 2 . 1 o 1 2 4
muence ( log pmolm-2 )
Cab-215
- 5 4 - 3 - 2 - 1 1 2 4
Ruence ( og pmol )
AB96 light. Nevertheless, Cab-8, AB96, and Fed-1 possess a VLFIn addition to their VLF responses, a11 of the genes show
a further increase in transcript abundance as the fluence isincreased from approximately 1 pmol m-' to more than1000 pmol m-'. Thus, accumulation of Cab-8 and A B 9 6transcripts is sensitive to light fluence over a range span-ning at least severa1 orders of magnitude. The biphasicpattern of the composite Ca b fluence-response curve(Horwitz et al., 1988) is less clear for the individual Cabgenes. However, it appears that the characteristic shape ofthe composite Cab fluence-response curve derives in largepart from that for Cab-8. This is concluded since Cab-8possesses a biphasic light response (Fig. 1) similar to thecomposite curve and also because Cab-8 is the most highlyexpressed Cab gene in pea (White et al., 1992).
In earlier experiments (White et al., 1992) we observedthat transcripts of the pea Cab genes A B 8 0 and A B 6 6(Timko et al., 1985) remained undetectable following asaturating red light pulse. To test the hypothesis that thesegenes respond preferentially to blue light, we carried outexperiments in which a blue light pulse was substituted forlight also failed to induce accumulation of A B 8 0 and A B 6 6transcripts, even though the same seedlings showed signif-
120 response.
'8i 60e 4 02o 1 1O:IIpI: : l i " i
- 5 4 - 3 ~ 2 - 1 1 2 3 4
muence ( log pmolm-2
Fed-I120
'p 60e 4 0T I20 1
o the red pulse used previously. Figure 2 shows that blue- 5 4 . 3 - 2 - 1 o 1 2 3 4nuence ( logpmolm-?
Figure 1. Red l ight f luence-response curves for the LHCll genesCab-8 (Lhcb7*4), AB96 (Lh cbl ' l) , Cab-215 (LhcbZ' l) , and Fd I (Fed-7 ). Pea seedlings were grown in absolute darkness, irradiated with asingle 10-5 pulse of red light (as described b y Ho rw itz et al., 1988),and returned to darkness for 24 h. Buds were harvested and frozen inl iquid nitrogen, and total RNA was extracted. Transcript levels forindiv idual genes were quantitated as described in "Materials andMethods." For the mo re abundant transcripts Cab-8 and AB96, 16thermal cycles were used to amplify 2 ng o f cDNA , whereas fo rCab-215 and Fed-7, 18 a nd 20 thermal cycles were used, respec-t ively. The error bars are SE. All four curves have been normalized sothat the m axim al transcript level (wh ich occurs at the highest f luence)is 100%.
To determine whether a statistically significant VLF re-sponse could be detected at a still lower fluence, we chosea second fluence at the upper end of the VLF range andcalculated t values similar to those in Table I.Cab-8, AB96 ,and Fed-1 also possess statistically significant VLF re-sponses if log fluence = -0.9 pmol m-' is used instead oflog fluence = 0.3 pmol m-' in the t tests (data not shown).This lower fluence (log fluence = -0.9 pmol m-' or 0.13pmol m-') is at the center of the plateau between the VLFand low fluence responses (Horwitz et al., 1988). The lowlevel of noise seen in the Ca b fluence-response curves at logfluence = -0.9 (Fig. 1) may be due partly to the stablenature of the response at this fluence.
Cab-8 appears to be the most light sensitive of the fourgenes. Cab-8 transcript accumulation is induced by ex-tremely low red light fluences and half-maximal transcriptaccumulation is reached within the VLF range. A B 9 6 andFed-1 also show significant transcript accumulation withinthis same VLF range. Variation in the data (combined intosingle error bars in Fig. 1)makes it impossible to specify aprecise fluence at which each gene begins responding to
icant accumulations of Cab-8, AB96, and Fed-1 transcripts.The accumulation of Cab-8, AB96, and Fed-1 transcriptsdoes not prove involvement of a blue light receptor in theseresponses, since blue light is known to produce smallamounts of Pfr (Briggs and Iino, 1983).However, it is clearthat neither red nor blue light can induce A B 8 0 or A B 6 6when etiolated seedlings are irradiated for short periods oftime.
In contrast, Figure 2 shows that transcripts of both A B 8 0and A B 6 6 do accumulate when seedlings are exposed tocontinuous red light (Fig. 2). Expression after prolongedillumination may reflect a requirement for a high irradi-ance response (White et al., 1992; Mancinelli, 1994) and/orcoupling of gene expression to a developmental event, suchas leaf expansion, that is stimulated by continuous irradi-ation to a much greater extent than by single light pulses.These data suggest that accumulation of A B 8 0 and A B 6 6transcripts under these conditions requires many orders ofmagnitude more red light than the VLF responses of Cab-8and A B 9 6 .
~Table 1. S tat is t ica l s ign i fi can ce o f th e V LF re sp on se m G r e d orCab-8, AB96, Cab-215, an d Fed-1
A ttest was used to compare the m ean transcript levels in the darkwit h mean transcript levels at log f luence = 0.3 (see text for details).The value of t i s g ive n in co lu m n 2 and the statistical significance inco lu mn 3 .
C e n e t Significance
Cab-8A696Cab-215Fed- 1
3.952.771.574.97
%>9 5
9 5>80>99
7/31/2019 Individual Members of the Cab Gene Family Differ Widely in Fluence Response
4/5
164 White et al. Pla n t Physiol. Vol. 107, 1995
AB80 AB66
CDNAstd cDNAstd
0 B CR C
Cab-8
D B CR C
AB96
CDNAstd
cDNAstd
D B CR C
Cab-215
0 B CR C
Fed-7std - * *
CDNA *- *D B CR C
cDNAStd
D B CR CFigure 2. Ef fec ts o f a blue light pu lse or cont inuous re d light on genee x p r e s s i o n . Seedl ings w e r e grown in c o m p l e t e darkness (D) o r w e r egiven a blue l ight pu lse (B ) as descr ibed in "Mater ia ls an d Methods"an d re turned to d ar k nes s for 24 h. A separate group o f seedl ings w asgrown in cont inuous re d light (C R ) . Buds w e r e harvested an d f r o z e nin liquid nitrogen, and to ta l RNA was ext racted . The four th lane ine a c h panel is a c on t r o l (C ) lack ing reverse t ransc r ip tase but contain-ing a PCR standard (std). Six teen thermal c y c l e s were used to ampl i fy1 n g o f c D N A for the more abundant t ransc r ip ts Cab-8 (Lhcbl"4) an dAB96 (Lhcbfl); 1 8 c y c l e s w e r e used fo r Cab-215 (i/icb2"1) and 20w e r e used fo r Fed-1, AB80 (Lhcbl'2), an d AB66 (Lhcbl '3).
The dramatic difference in the light response of AB80and AB66 compared to other Cabgenes can now be con-sidered when interpreting studies on the role of cis-actingelements in gene expression. Previously, studies of indi-vidual Cab gene expression required transgenic tobacco,since the transcripts of the various Cab genes in pea (orother species) could not be distinguished from one another.Therefore, it was not possible to determine whether a trans-gene behaved identically with the native pea gene orwhether the pattern of expression of the frans-gene wastypical of Cabgene responses.AB80 was one of the first plant genes whose light re-
sponse was studied in detail in transgenic plants (Simpson
et al., 1985, 1986). More recent studies have identified twoprotein factors binding to a 247-bp regulatory region ofAB80 (Arguello et al., 1992). One of these factors is foundonly in green tissue but not in etiolated or root tissue,consistent with our previous studies in which the highestlevel of AB80 expression was detected in pea leaves (Whiteet al., 1992) and consistent with the lack of AB80 responseto a red or blue pulse (Fig. 2). Since AB80 transcript accu-mulation can be induced by continuous red light, it wouldbe interesting to determine whether the leaf-specific DNA-binding factor can also be induced by continuous red light.Thus, AB80 could be used as model gene to investigatehigh irradiance response or leaf-induced development. Incontrast, a gene such as Cab-8 would be ideal to study earlylight responses or VLFresponses.
ACKNOWLEDGMENTSW e especially t h a n k L y n n Dickey, Maria Gallo-Meagher, andLisa Childs fo r advice an d assistance in developing a system toampli fy pea Fed-1 cDNA accurately and for construction of the
Fed-1 PCR standard. W e greatly appreciate th e assistance of BrianFristensky, Denis Falconet, and Lisa Childs in designing specif icC ab gene primers and Katherine M.F. Warpeha fo r prepara-tion of RNAs in the blue light experiments. Fina l ly , w e thankKeith Everett for oligonucleotide synthesis, photography, anddensitometry.Received May 11, 1994; accepted October 10, 1994.Cop yr igh t Clearance Center: 0032-0889/95/107/0161/05.
LITERATURE CITEDAlexande r L , Falconet D, Fristensky B W , White M J, Watson JC ,Roe BA, Thompson W F (1991) Nucleotide sequence of Cab -8 , ane w type I gene encoding a chlorophyll a/b-binding protein ofLHCI I in Pisum. Plant Mol Biol 17 : 523-526Argue l lo G, Garcia-Hernandez E, Sanchez M, Gariglio P,Herrera-Estrella L, Simpson J (1992) Characterization of DNAsequences that mediate nuclear protein binding to the regula-tory region of the Pisum sativum (pea) chlorophyll a /b bindingprotein gene AB80: identification of a repeated heptamer motif.Plant J 2: 301-309Briggs W R , lino M (1983) Blue light-absorbing photoreceptors inp lants. Philos Trans R Soc Lond-BiolSc i B303: 347-359Coruzzi G, Broglie R, Cashmore A, Chua NH (1983) Nucleotidesequences of two pea cDN A clones encoding th e small subunitof ribulose 1,5-bisphosphate carboxylase and the major chloro-p hy l l a/b-binding thylakoid polypeptide. J Biol Chem 258:1399-1402De Fetter E, Wiemeersch L V, Rethy R, Dedonder A, Fredericq H ,De Greet J (1988) Fluence-response curves and action spectra fo rth e very lo w f luence and the low fluence response for theinduct ion of Kalanchoe seed germination. Plant Physiol 88:276-283Dobres M S, Elliot R C, Watson JC , Thompson W F (1987) A phy-t och rom e regulated pea transcript encodes ferredoxin I. PlantMol Biol 8: 53-59Elliott RC , Pedersen TJ , Fristensky B , White M J, Dickey L F,Thompson W F (1989) Characterization of a single copy geneencoding ferredoxin I from pea. Plant Cell 1: 681-690Eskins K , Beremand PD (1990) Light-qualityand irradiance-levelcontrol of light-harvesting complex of photosystem 2 in maizem e s o p h y l l cells. Evidence for a low fluence-rate threshold inblue-light reduction of m R N A and protein. Physiol Plant 78:435-440
7/31/2019 Individual Members of the Cab Gene Family Differ Widely in Fluence Response
5/5
CabGenes Differ Widely in Fluence Response 165Falconet D, Godon C, White MJ, Thompson WF (1993) Se-quence of lhcb3*l, a gene encoding a photosystem I1 chloro-phyll a/b-binding protein in Pisum. Biochim Biophys ActaFalconet D, White MJ, Fristensky BW, Dobres MS, ThompsonWF (1991) Nucleotide sequence of Cab-215, a type I1 gene en-coding a photosystem I1 chlorophyll a/b-binding protein inPisum. Plant Mo1 Biol 17: 135-139Horwitz 8, Thompson W, Briggs W (1988) Phytochrome regula-tion of greening in Pisum. Plant Physiol 86: 299-305Jansson S, Pichersky E, Bassi R, Green BR, Ikeuchi M, Melis A,Simpson DJ, Spagfort M, Staehelin LA, Thornber JP (1992) Anomenclature for the genes encoding the chlorophyll p/b-bind-ing proteins of higher plants. Plant Mo1 Biol Rep 10: 242-253Jordan BR,Chow WS, Strid A, Anderson JM (1991) Reduction incab and psbA RNA transcripts in response to supplementaryultraviolet-B radiation. FEBS Lett 284 5-8Kaufman LS,Thompson WF, Briggs WR (1984) Different red lightrequirements for phytochrome induced accumulation of cabRNA and rbcS RNA. Science 226:1447-1449Mancine lli AL (1994) The physiology of phytochrome action. InGHM Kronenberg, RE Kendrick, eds, Photomorphogenesis inPlants, Ed 2. Kluwer, Dordrecht, The Netherlands, pp 211-269
Nagy F, Fejes E, Wehmeyer B, Dallman G, Schafer E (1993)The circadian oscillator is regulated by a very low fluence re-sponse of phytochrome in wheat. Proc Natl Acad Sci USA 90:Nagy F, Kay SA, Boutry M, Hsu M-Y, Chua N-H (1986) Phyto-chrome-controlled expression of a wheat Ca b gene in transgenictobacco seedlings. EMBO J 5: 1119-1124Oelmiiller R, Kendr ick R, Briggs W (1989) Blue-light mediatedaccumulation of nuclear-encoded transcripts coding for pro-teins of the thylakoid membrane is absent in the phyto-
1173:333-336
6290-6294
chrome-deficient aurea mutan t of tomato. Plant Mo1 Biol 13:Simpson J, Schell J, Van Montagu M, Herrera-Estrella L (1986)Light-inducible and tissue-specific pea lhcp expression involvesan upstream element combining enhancer and silencer likeproperties. Natu re 323: 551-554Simpson J, Timko MP, Cashmore AR, Schell J, Van Montagu M,
Herrera-Estrella L (1985) Light-inducible and tissue-specific ex-pression of a chimaeric gene under control of the 5 flankingsequence of a pea chlorophyll a/b-binding protein gene. EMBO JTimko MP, Kausch AP, Hand JM, Cashmore AR, Herrera-Estrella L, Van d en Broeck G, Van M ontagu MV (1985) Struc-ture an d expression of nuclear genes encoding polypeptides ofthe photosynthetic apparatus. In Molecular Biology of the Pho-tosynthetic Apparatus. Cold Spring Harbor Laboratory Press,Cold Spring Harbor, NY, pp 381-396Warpeha KMF, Kaufman LS (1990) Two distinct blue-light re-sponses regulate the levels of transcripts of specific nuclear-coded genes in pea. Planta 182: 553-558Warpeha KMF, Marrs KA, Kaufman LS (1989) Blue light regula-tion of specific transcript levels in Pisum sativum.Plant PhysiolWehmeyer B, Cashm ore AR, Schafer E (1990) Photocontrol of theexpression of genes encoding chlorophyll a /b binding proteinsand small subunit of ribulose-1,5-bisphosphatearboxylase inetiolated seedlings of Lycopersicon esculen tum (L.) and Nicotianatabncum (L.). Plant Physiol 93:990-997White MJ, Fristensky B, Falconet D, Childs LC, Watson JC,Alexander L, Roe BA, Thompson WF (1992) Expression of thechlorophyll a/b protein multigene family in pea (Pisum sativumL.): evidence for distinct developmental responses. Planta 188:
223-232
11:2723-2729
91: 1030-1035
190-198
