Accepted Manuscript Title: Industrial PE-2 strain of Saccharomyces cerevisiae: from alcoholic fermentation to the production of recombinant proteins Author: Andrea Soares-Costa Darlan Gonc ¸alves Nakayama Let´ ıcia de Freitas Andrade Lucas Ferioli Catelli Ana Paula Guarnieri Bassi Sandra Regina Ceccato-Antonini Flavio Henrique-Silva<ce:footnote id="fn1"><ce:note-para id="npar0010">Andrea Soares-Costa and Darlan Gonc ¸alves Nakayama contributed equally to this study.</ce:note-para></ce:footnote> PII: S1871-6784(13)00104-0 DOI: http://dx.doi.org/doi:10.1016/j.nbt.2013.08.005 Reference: NBT 635 To appear in: Received date: 28-2-2013 Revised date: 13-8-2013 Accepted date: 15-8-2013 Please cite this article as: Soares-Costa, A., Nakayama, D.G., Andrade, L.F., Catelli, L.F., Bassi, A.P.G., Ceccato-Antonini, S.R., Henrique-Silva, F., Industrial PE-2 strain of Saccharomyces cerevisiae: from alcoholic fermentation to the production of recombinant proteins., New Biotechnology (2013), http://dx.doi.org/10.1016/j.nbt.2013.08.005 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Transcript
Accepted Manuscript
Title: Industrial PE-2 strain of Saccharomyces cerevisiae:from alcoholic fermentation to the production of recombinantproteins
Author: Andrea Soares-Costa Darlan Goncalves NakayamaLetıcia de Freitas Andrade Lucas Ferioli Catelli Ana PaulaGuarnieri Bassi Sandra Regina Ceccato-Antonini FlavioHenrique-Silva<ce:footnote id="fn1"><ce:note-paraid="npar0010">Andrea Soares-Costa and Darlan GoncalvesNakayama contributed equally to thisstudy.</ce:note-para></ce:footnote>
Received date: 28-2-2013Revised date: 13-8-2013Accepted date: 15-8-2013
Please cite this article as: Soares-Costa, A., Nakayama, D.G., Andrade,L.F., Catelli, L.F., Bassi, A.P.G., Ceccato-Antonini, S.R., Henrique-Silva, F.,Industrial PE-2 strain of Saccharomyces cerevisiae: from alcoholic fermentationto the production of recombinant proteins., New Biotechnology (2013),http://dx.doi.org/10.1016/j.nbt.2013.08.005
This is a PDF file of an unedited manuscript that has been accepted for publication.As a service to our customers we are providing this early version of the manuscript.The manuscript will undergo copyediting, typesetting, and review of the resulting proofbefore it is published in its final form. Please note that during the production processerrors may be discovered which could affect the content, and all legal disclaimers thatapply to the journal pertain.
Industrial PE-2 strain of Saccharomyces cerevisiae:from alcoholic fermentation to the production of recombinant proteins.
Andrea Soares-Costa a*, Darlan Gonçalves Nakayama a Letícia de Freitas Andradea, Lucas Ferioli Catellia, Ana Paula Guarnieri Bassib, Sandra Regina Ceccato-Antoninib, and Flavio Henrique-Silvaa
aLaboratory of Molecular Biology, Department of Genetics and Evolution, Federal University of São Carlos, Rodovia Washington Luis km 235, 13565-905, São Carlos, SP, Brazil.
bDepartment of Agro-Industrial Technology and Rural Socio-Economy, Agricultural Science Center, Federal University of São Carlos, Via Anhanguera 174, 13600-970, Araras, SP, Brazil
Andrea Soares-Costa and Darlan Gonçalves Nakayama contributed equally to this study.
*Corresponding author: Andrea Soares Costa - Laboratory of Molecular Biology, Department of Genetics and Evolution, Federal University of São Carlos, Rod. Washington Luis km 235, 13565-905 São Carlos, SP, Brazil -Telephone number: +55 16 33518378, fax number: +55 16 33518377. e -mail: [email protected]
Page 2 of 32
Accep
ted
Man
uscr
ipt
2
Abstract
Saccharomyces cerevisiae is the most important microorganism used in the
ethanol fermentation process. The PE-2 strain of this yeast is widely used to produce
alcohol in Brazil due to its high fermentation capacity. The aim of the present study was
to develop an expression system for recombinant proteins using the industrial PE-2
strain of Saccharomyces cerevisiae during the alcoholic fermentation process. The
protein chosen as a model for this system was CaneCPI-1, a cysteine peptidase
inhibitor. A plasmid containing the CaneCPI-1 gene was constructed and yeast cells
were transformed with the pYADE4_CaneCPI-1 construct. To evaluate the effect on
fermentation ability, the transformed strain was used in the fermentation process with
cell recycling. During the 9-hour fermentative cycles the transformed strain did not have
its viability and fermentation ability affected. In the last cycle, when the fermentation
lasted longer, and the protein was expressed probably at the expense of ethanol once the
sugars were exhausted. The recombinant protein was expressed in yeast cells, purified
and submitted to assays of activity that demonstrated its functionality. Thus, the
industrial PE-2 strain of S. cerevisiae can be used as a viable system for protein
expression and to produce alcohol simultaneously. The findings of the present study
demonstrate the possibility of producing recombinant proteins with biotechnological
applications during the ethanol fermentation process.
Yeasts have been widely used in production of recombinant proteins of human,
animal or plant origin since the early 1980s [1]. In the field of applied research, the
yeasts S. cerevisiae and Pichia pastoris are the most commonly used eukaryotes for this
purpose [2]. In recent years, different types of proteins have been produced in S.
cerevisiae, such as cellobiohydrolase II from Trichoderma reesei [3], transferrin, the
iron-binding protein in human plasma responsible for the regulated delivery of iron to
the cells [4], membrane-bound pyrophosphatases from protozoa and bacteria [5],
sulphate transporters from Arabidopsis thaliana, K+ transporter from Arabidopsis
thaliana and Triticum aestivum, hexose transporters from Vitis vinifera [6], the major
surface glycoprotein of Pneumocystis jirovecii that plays an important role in host-
parasite interactions by mediating adherence of this opportunist pathogen to host
alveolar epithelial cells and macrophages in humans [7], a cationic antibacterial peptide
(CecropinXJ) isolated from the larvae of Bombyx mori [8] and human Aquaporin-1, an
important integral membrane protein involved in a number of pathophysiological
conditions including renal disorders and tumor angiogenesis [9].
S. cerevisiae has several properties that make it an important host for the
expression of recombinant proteins. It is easy to grow and manipulate genetically. It has
the ability to perform post-translational modifications, such as proteolytic processing,
folding, disulphide bridging and highest glycosylation capacity [10]. Moreover, S.
cerevisiae enjoys the status of being a GRAS (Generally Recognized As Safe)
organism, which is of paramount importance to the production of biopharmaceuticals
through genetic engineering [11]. Others recombinant protein expression systems are
emerging with various advantages, while S. cerevisiae is still the predominant host used
Page 4 of 32
Accep
ted
Man
uscr
ipt
4
for metabolite production, as well as being a model organism for the study of human
proteins linked to genetic and degenerative diseases [1].
On the industrial scale, S. cerevisiae has been widely used for ethanol
production [12] due to characteristics that are favourable for the transformation of
sugars into alcohol, such as its ability to ferment carbohydrates with high performance,
high-speed fermentation, osmotolerance, ethanol tolerance, ability to produce high
concentrations of ethanol, tolerance to acidic media, high cell viability after recycling
and resistance to high temperatures [13].
The production of ethanol as a renewable fuel is currently one of the largest
industrial activities in Brazil [14]. This process is based on the activity of yeast
fermenting carbohydrates derived from agricultural feedstock. The Brazilian system
uses substrates of sugarcane (juice and molasses), which are rich in sucrose, without
enzymatic pre-treatment for ethanol production [15].
Selected yeasts are commonly used to increase the fermentative efficiency in
production of ethanol [16-17] and the fermentation process is highly influenced by the
type of yeast employed. The fermenting agent should ensure high efficiency regarding
ethanol production, low production of glycerol and high tolerance to different pH
values, temperatures, concentrations of sugars and alcohol [18]. A number of strains of
S. cerevisiae are widely used on an industrial scale for ethanol production. It is therefore
of interest to use an industrial strain for the production of recombinant proteins on a
large scale during the fermentation process. As yeasts are discarded at the end of the
process, the production of heterologous proteins does not imply any additional
production cost.
In the present study, an industrial strain of S. cerevisiae, denominated PE-2, was
used as a system for heterologous protein production. This strain combines high
Page 5 of 32
Accep
ted
Man
uscr
ipt
5
fermentation efficiency with prolonged persistence in the system and is one of the most
successful examples of isolated wild yeasts [10]. S. cerevisiae PE-2 is currently used in
approximately 30% of Brazilian distilleries, producing around 10% of the world’s
supply of bioethanol [19].
The recombinant protein CaneCPI-1 was chosen as a model for standardisation
of the production of recombinant proteins in the PE-2 strain of S. cerevisiae. CaneCPI-
1, formerly denominated Canecystatin, is a sugarcane cystatin of about 13 kDa and
possesses typical cystatin domains, including motifs for interaction with the proteolytic
enzyme [20]. It is a reversible inhibitor of cysteine peptidases and its action mechanism
is based on competitive inhibition through the blocking of proteolytic activity. A
number of studies have demonstrated that cystatins can be used to protect plants from
insect attacks [21].
In the present report, we explored the capacity of the industrial PE-2 S.
cerevisiae strain as the host for heterologous protein expression, using His-tagged
CaneCPI-1 protein as the model, during the alcoholic fermentation process. The work
has shown the biotechnological innovation of using industrial PE-2 S. cerevisiae for
dual purposes, first in alcoholic fermentation to produce ethanol and simultaneously to
produce a recombinant protein. It is the first report in the literature of the use of an
industrial yeast combining both characteristics.
Investigation of the fermentation ability of the transformed yeast was also
performed in a batch system with cell recycling, aiming to evaluate the viability of its
utilisation in ethanol production and to see whether the CaneCPI-1 production would
affect the fermentation process.
Material and Methods
Page 6 of 32
Accep
ted
Man
uscr
ipt
6
Strains
The diploid strain of Saccharomyces cerevisiae denominated PE-2 (kindly
provided by Fermentec – Piracicaba – São Paulo – Brazil), isolated from a fermentation
process, and the DH5-α strain of Escherichia coli were used.
Construction of expression vector
The open reading frame coding for the cysteine peptidase inhibitor protein of
sugarcane contained in the clone SCCCRZ2001G09 (GenBank accession number
AY119689), originating from the Sugarcane Genome Project-SUCEST (FAPESP), was
obtained through amplification using the primers Forward Cane_CPI-1
(5´ATGGCCGAGGCACACAACGG 3`) and Reverse Cane_Cla I (5´
ATCGATTTAATGATGATGATGATGATGGGCGTCCCCGACCGGCTG 3´), which
contain a His-tag coding sequence. The reverse primer contained a site for the
restriction enzyme Cla I. Briefly, 10 ng of template DNA (CaneCPI-1 ORF cloned in
pET28a), 200 µM of each dNTP (Invitrogen), 1 x PCR buffer [20 mM of Tris-HCl (pH
8.4), 1.5 mM of MgCl2 and 50 mM of KCl], 20 pmol of each primer and 1 U of Taq
DNA polymerase (Invitrogen) were used in a 100-µl reaction. The PCR protocol began
with a heating temperature of 94 °C for 2 min, followed by 35 cycles of 30 sec at 94 °C,
30 sec at 48 °C and 1 min at 72 °C. The amplification product was purified, digested
Cla I and inserted into pYADE4 plasmid [22] previously digested with the same
enzyme. This is a yeast shuttle vector. The E. coli components of this yeast shuttle
vector include ampicillin resistance marker (AMP) and pBR322 origin replication. The
yeast components include an autonomously replicating sequence (ARS) and a selectable
marker, a gene that encodes an enzyme for tryptophan synthesis (TRP1). Moreover, this
is an episomal vector that contains the ADH2 promoter, that is repressed in the presence
Page 7 of 32
Accep
ted
Man
uscr
ipt
7
of glucose (Figure 1). The reaction was used to transform E. coli DH5α competent cells
using the calcium chloride method [23].
The recombinant clone pYADE4_CaneCPI-1 was selected and sequenced by the
dideoxy method in the MegaBaceTM1000 DNA sequencer, using the DYEnamic ET
Terminator kit (GE Healthcare). The recombinant clone was transformed into the S.
cerevisiae PE-2 competent cells through electroporation using a Bio-Rad GenePulser II.
The culture was plated on YPD medium containing ampicillin (100 g/ml) and
incubated at 30 C for approximately five days. For screening of recombinant clones, a
polymerase chain reaction (PCR) was performed with transformed yeast colonies. The
colonies were lifted with a sterile toothpick from the growth plate and transferred to a
tube containing autoclaved water, which was used as template to PCR under the same
conditions used for the initial gene amplification, as described above. A total of 300
transformed colonies were tested by PCR to verify the presence of the CaneCPI-1
fragment. The recombinant colony was selected by PCR and used in fermentation
assays.
Fermentation assays
Assays were performed in triplicate for both the transformed strain of S.
cereviseae PE-2 with the expression vector pYADE4_caneCPI-1 and the non-
transformed strain (control). First, inocula were prepared with 10 mL of clarified
sugarcane broth, 200 rpm, at 30 °C for 24 hours (corresponding to a concentration of
108cells/mL). The percentage of soluble solids was maintained in 4° Brix
(approximately 4 g/100 mL of total reducing sugars). Brix is defined as the percentage
of soluble solids in solution measured on a numerical scale of refractive index. The
inoculum were transferred to 500mL-Erlenmeyer flasks, to which was added 50 mL of
Page 8 of 32
Accep
ted
Man
uscr
ipt
8
clarified sugarcane broth 12° Brix (approximately 12 g/100mL of total reducing sugars)
and 20% inoculum (v/v). Tests were conducted in four fermentation cycles for nine
hours each, at 30 0C, 200 rpm. A 36-hour cycle was also performed with the expectation
of producing the recombinant protein. The fermentation broth was centrifuged at 10,000
rpm for 10 minutes at 4 °C after each fermentation cycle and the biomass was re-
suspended in 50 mL of a new fermentation medium. The supernatants were collected
and stored at -20 °C.
Purification of recombinant protein CaneCPI-1 by affinity chromatography
Yeast cells obtained from the fifth fermentation cycle were lysed mechanically
using glass beads (425 to 600 µm – SIGMA) and 500 µL of breaking buffer [50 mM of
sodium phosphate (pH 7,4), 1 mM of EDTA and 5% glycerol] and homogenised with
the aid of ‘Precellys 24’ for eight 30 s homogenisation cycles, followed by 30 s of
cooling. The mixture was centrifuged at 10,000 rpm for 10 minutes to remove the cell
debris and glass beads. CaneCPI-1 protein present in the crude protein extracts was
purified by passing the crude yeast extracts through an affinity chromatography Ni-
NTA superflow nickel column (Qiagen). The column was previously equilibrated with
buffer containing 10 mM of Tris-HCl, 100 mM of NaCl and 50 mM of NaH2PO4, pH
8.0. The protein was eluted with the same buffer containing increased imidazole
concentrations (10, 25, 50, 75 100 and 250 mM). The purified protein was analysed in
15% SDS-PAGE. The protein concentration was determined using the Bradford method
[24].
Immunodetection of CaneCPI-1 throughout fermentation cycles
Page 9 of 32
Accep
ted
Man
uscr
ipt
9
The production of polyclonal antibodies was performed using a purified
CaneCPI-1 protein expressed in E. coli Rosetta (DE3). Standard procedures were
followed for antibody production [25]. For Western blotting analysis, the yeast extract
and recombinant purified proteins were submitted to electrophoresis in 15% SDS-
PAGE and transferred to a polyvinylidene fluoride membrane by electroblotting in
buffer containing 200 mM of Tris-HCl, 50 mM of glycine and 20% methanol. The
membranes were incubated for one hour in a blocking buffer [5% skim milk in Tris
buffered saline (TBS) (50 mM of Tris-HCl, pH 8.0, and 150 mM of NaCl)], washed
four times with TBS, incubated with anti-CaneCPI-1 antibody (1:10,000) and with
commercial monoclonal anti-His-Tag antibody (GE Healthcare) (1:10,000) for 90 min,
and washed as described above. The membranes were then incubated with anti-mouse
IgG conjugated to alkaline phosphatase (Sigma) for 90 min, washed with TBS and
revealed with NBT-BCIP substrate for alkaline phosphatase (Pierce).
Inhibitory activity of purified CaneCPI-1
The inhibitory activity of the recombinant protein CaneCPI-1 was determined
through the inhibition of papain activity, which was measured spectrofluorometrically,
based on the procedure using the fluorogenic substrate carbobenzoxy-Leu-Arg-7-amido-
4-methylcoumarin (Z-Leu-Arg-MCA) (Calbiochem, La Jolla, CA, USA). Fluorescence
was measured in a Hitachi F-2500 spectrofluorometer at ex = 380 nm and em = 460
nm. Inhibitory activity of CaneCPI-1 was determined by measuring the residual
hydrolytic activity of cysteine peptidase after pre-incubation with different inhibitor
concentrations. The enzyme was added to 100 mM of sodium acetate buffer, pH 5.5,
containing 2.5 mM of dithiothreitol (final volume: 0.5 ml) and incubated for 5 min at
37°C. The substrate Z-Leu-Arg-MCA (2µM) was then added and the residual cysteine
Page 10 of 32
Accep
ted
Man
uscr
ipt
10
peptidase activity was determined. The inhibition constant (Ki) was calculated following
Morison’s procedure using the GraFit program [26].
Fermentation analysis
Fermentation analyses were carried out when starting a fermentation cycle, i.e. when a
fermentation process is initiated, an inoculum is added in sugarcane broth closing the
fermentation cycle. After 9 hours of growth, these cells are reused and put into a new sugarcane
broth, initiating a new fermentation cycle.
Cell viability was determined at the beginning of the first fermentative cycle and
at the end of the fifth cycle by counting in a Neubauer chamber under the microscope
[27], using a methylene blue solution with sodium citrate (0.01 g of methylene blue and
2.0 g of citrate sodium in 100 ml of distilled water) as the dye. Viability was determined
from the ratio (percentage) between viable cells and the total number of cells (living and
dead). To determine the alcohol content, 10 mL of each supernatant sample were
distilled and the density of the hydro-alcoholic solution was measured using an Anton-
Paar digital densimeter (DMA-45). The pH was measured with a digital potentiometer.
Soluble solids were determined by refractometry and expressed in °Brix.
Determination of total residual reducing sugars (TRS) was performed using the
3,5-dinitrosalicylic acid method following the method described by Miller [28]. The
samples were first subjected to acid hydrolysis of the sucrose present in the culture
medium with HCl (2N), based on Silva [29]. Fermentation efficiency (percentage) was
calculated based on the alcohol content of the medium and the total reducing sugar
consumption using fermentation stoichiometry, in which 0.511 is the conversion factor
of sugar to ethanol based on the theoretical maximal yield.
Statistical analysis
Page 11 of 32
Accep
ted
Man
uscr
ipt
11
The results obtained in the fermentation analysis were evaluated by analysis of
variance (ANOVA), in order to determine statistical significance among the treatments
(fermentative cycles) and between the strains (transformed and non-transformed). In
cases where significant differences were found, Scott-Knott test [30] (p ≤ 0.05) was
carried out. This approach allows evaluation of the significance of differences between
resulting groups by minimising variation within and maximising variation between the
groups. The results are easily interpreted because of the lack of ambiguity. Thus this
procedure results in greater clarity and objectivity when compared to other procedures
for multiple comparisons, such as Tukey-test and t-student.
Identification of the pYADE4_CaneCPI-I plasmid in transformed S. cerevisae.
This experiment was performed to demonstrate that the pYADE4-CaneCPI-1
plasmid was present in transformed S. cerevisae. Initially, a total DNA extraction with
transformed and non-transformed yeast was performed using a rapid extraction protocol
by homogenization with glass beads in the presence of breaking buffer (2% Triton X-
100, 1% SDS, 100 mM of NaCl, 10 mM of Tris HCl, pH 8, and 1 mM of EDTA),
phenol, chloroform and isoamyl alcohol [23]. The lysed cells were centrifuged and 5 µL
of the supernatant of each cell containing DNA extracted from transformed and non-
transformed yeast cells were used to transform chemically competent E. coli DH5α cells
[23]. The cells were plated on LB agar containing antibiotic ampicillin (100 µg/mL).
From this plate containing colonies from E. coli DH5α cells transformation with DNA
extracted from transformed S.cerevisiae cells, a colony PCR was performed. The
colonies from transformed E. coli DH5α cells were lifted with a sterile toothpick from
the growth plate and placed in a tube containing autoclaved water. PCR was conducted
under the same conditions used for the initial amplification, as described above. In
Page 12 of 32
Accep
ted
Man
uscr
ipt
12
addition, pYADE4_CaneCPI-1 plasmid was isolated from transformed E. coli DH5α
cells and re-sequenced by the dideoxy method in the MegaBaceTM 1000 DNA sequencer
using the DYEnamic ET Terminator kit (GE Healthcare).
Results and Discussion
Expression and purification of CaneCPI-1 in S. cerevisiae PE-2 cells
The transformed and non-transformed yeast cells obtained from the fifth
fermentation cycle were centrifuged and disrupted. The supernatant of transformed
yeast cells was used for the purification of CaneCPI-1 directly through affinity
chromatography on a Ni-NTA column. Protein was eluted from the column with 250
mM of imidazole buffer. SDS-PAGE analysis revealed the presence of a single band of
about 13 kDa, corresponding to His-tagged CaneCPI-1 (Figure 2A). The yield of
purified protein was approximately 10 mg per liter of culture, which is similar to that
obtained previously for the same protein expressed in an E. coli BL21 (DE3) expression
system [20].
Fermentation assays
Analysis by SDS-PAGE throughout the fermentation assays showed that CaneCPI-1
expression only occurred in the fifth fermentation cycle, lasting 36 hours (Figure 3A).
The explanation for the protein only being expressed in the fifth cycle is associated with
the presence of glucose in the medium. Once the gene is linked to the ADH2 promoter,
its expression occurs only under conditions of low sugar concentration and in the fifth
fermentation cycle the glucose in the medium has been exhausted. Under this condition,
the gene is not expressed during the fermentation process specifically in the initial
cycles, due to the fact that ADH2 is repressed by glucose.
Page 13 of 32
Accep
ted
Man
uscr
ipt
13
No protein expression was detected in the previous fermentation cycles, which
lasted only nine hours. Thus, S. cerevisiae wild-yeast PE-2 cells seem to be a viable
system for producing recombinant proteins. In this expression system, the production
cost of recombinant proteins is minimised, being built into the fermentation process for
ethanol production. The only additional expense regards protein extraction and
purification. Strategies can be developed to reduce downstream processing costs in the
distillery, since the results are satisfactory and do not affect alcohol production.
Alternatively, the yeast cell mass could be sold to other industries that would take
charge of these procedures and the commercialisation of the protein of biotechnological
interest.
Immunodetection of CaneCPI-1
Western blotting revealed that the antibodies were able to detect a protein of an
expected molecular mass (13 kDa) (Figure 2B, 2C). The antibodies proved to be
specific (i.e., no nonspecific bands were observed) and allowed confirmation of the
expression of the protein throughout the fermentation assays only in the fifth cycle
(which lasted 36 hours) (Figure 3B, 3C). CaneCPI-1 protein was not detected in the
extract of non-transformed yeast cells.
Inhibitory activity of purified CaneCPI-1
The results displayed in Figure 4 show that the purified protein CaneCPI-1 was
able to inhibit the action of the enzyme, with a Ki value of 4.27 nM. The ability of
CaneCPI-1 to inhibit the enzyme activity of papain indicates that the recombinant
protein is in its correct conformation and active. In previous studies, CaneCPI-1 protein
Page 14 of 32
Accep
ted
Man
uscr
ipt
14
expressed in E. coli demonstrated inhibitory activity against papain, with a Ki of 3.0
nM, and the presence of the His-tag did not seem to affect inhibitory activity [31].
Fermentation analysis
Both yeast cells transformed with pYADE4_caneCPI-1 and non-transformed
yeast cells exhibited very similar cell viability and persistence throughout the
fermentation cycles, with decrease in viability of around 18% and 16.1%, respectively
(Table 1). Fermentation efficiency in distilleries varies from 70 to 90%, depending on
the type of installation, raw materials and fermentation conditions [32]. In the first four
cycles, transformed and non-transformed strains exhibited fermentation efficiency that
was in agreement with industrial data (Figure 5A).
In the fifth cycle, the non-transformed (control) PE-2 strain exhibited a decrease
in fermentation efficiency to about 68%. This reduction was mainly due to the
prolonged (36 hours) exposure of the yeast cells to the ethanol generated during
fermentation. Ethanol is one of the major stress factors that act upon yeast; the
cytoplasmatic membrane of yeast is profoundly altered in the presence of ethanol, and,
as a result, membrane permeability to some ions (especially ions H+) is significantly
affected. Also affecting yeast membrane composition, there are several other effects of
ethanol upon yeast physiology during fermentation, including growth inhibition and
enzymatic inactivation, which leads to a decreased cell viability [32].
Still in the fifth cycle, the non-transformed (control) PE-2 strain presented a
shortage of fermentable sugars (TRS 0.36 g/100 mL) (Figure 5C), which leads us to
conclude that the non-transformed yeast likely consumed the ethanol generated as a
byproduct of the fermentation process for the production of energy and maintenance of
cell metabolism.
Page 15 of 32
Accep
ted
Man
uscr
ipt
15
In the fifth cycle of the transformed yeast cells, a sharp decline in fermentation
efficiency (51.85%) occurred (Figure 5A), again probably due to the prolonged (36
hours) exposure of the yeast cells to the ethanol generated during fermentation. During
the fermentation process, reduction of glucose concentration in the medium occurred
and the ADH2 promoter ceased to be repressed, allowing the production of CaneCPI-1.
Possibly, the transformed yeast cells used the ethanol as an energy source for the
maintenance of cell metabolism and recombinant protein production. This diversion of
the metabolic pathway of transformed yeast cells explains the difference in alcohol
content values observed between the transformed (2.74 g/100 mL) and non-transformed
(3.61 g/100 mL) PE-2 strain in the last fermentation cycle (Figure 5D) and therefore
explains the sharp decrease in fermentation efficiency in the fifth cycle of the
transformed yeast cells.
The progressive increase in alcohol content (Figure 5D) and the decrease in
residual TRS (Figure 5C) over the first four cycles of fermentation were due to an
adjustment period for both the transformed and non-transformed yeast to the new
fermentation medium (12°Brix), since the inocula were prepared in a culture medium
containing 4°Brix. In general, the standardization of the process and stabilization of
values occurred around the third or fourth cycle, considering the short duration (9 hours
each) of the fermentation. The °Brix values (Figure 5E) were consistent with the
expectations, since the increase in the consumption of total reducing sugars resulted in a
proportional reduction in the soluble solids present in the fermentation medium. Brix
values offer a quick measure of the amount of sucrose present in the medium. However,
other soluble solids are also present in the fermentation medium. Thus, although the
amount of residual sugars was very low at the end of the fifth cycle, the Brix values
remained high (3.5 °Brix for transformed PE-2; 3.77 °Brix for non-transformed PE-2).
Page 16 of 32
Accep
ted
Man
uscr
ipt
16
As the fermentable sugars present in the medium were being consumed, alcohol
levels increased and pH values decreased (Figure 5B). The pH is a significant factor in
industrial fermentation due to its importance in the control of bacterial contamination
and its effect on yeast growth, fermentation rate and the formation of byproducts.
The optimal pH for ethanol production by S. cerevisiae is between 4 and 5. In
industrial sugarcane broths, pH values are generally in the range of 4.5 and 5.5. Thus,
fermentation starts with this low pH values and ends with values between 3.5 and 4.0.
In cases in which yeast is reused, a treatment is made with sulfuric acid at pH 2.0 to 3.2.
This acid cell washing procedure, although stressful to yeast and may reduce cell
viability and consequently the fermentation yield, has the benefit of inhibiting the
growth of bacteria [33].
Statistical analysis
For the first four cycles of fermentation there were no remarkable differences in
fermentation analysis between the transformed and non-transformed yeast (Table 2).
Only was observed a significant difference in total residual reducing sugars of the yeast
transformed in the second cycle as compared to non-transformed yeast in the same
cycle. In the fifth fermentative cycle was observed a significant difference in values of
Brix and Ethanol production (g/100 mL) between the yeast strains used.
Except in the last cycle, the Fermentative Efficiency has showed higher and
without remarkable differences between the transformed and non-transformed yeasts
and among the four first fermentative cycles.
Therefore, the transformed yeast could replace the wild strain in industrial
fermentation processes with no reduction in yield. In the fifth fermentative cycle,
however, in which the recombinant protein was produced by the transformed strain,
Page 17 of 32
Accep
ted
Man
uscr
ipt
17
there was a significant difference in the Fermentative Efficiency. The transformed strain
exhibited lesser fermentation efficiency, lower alcohol content at the end of the cycle
(greater consumption for production of cystatin) and lower residual TRS content
(greater sugar consumption).
Identification of plasmid DNA from transformed yeast
This test confirmed that the recombinant plasmid was not integrated into the
genome of the yeast, as it was possible to transform competent E. coli DH5α cells with
DNA extracted from the transformed yeast. The right side of Figure 6A shows E. coli
DH5α cells transformed with total DNA extracted from S. cerevisiae PE-2 cells
containing the pYADE4_CaneCPI-1 plasmid and the left side shows the results
obtained with the control involving DH5α cells transformed with total DNA extracted
from non-transformed S. cerevisiae PE-2 cells, in which no cell growth was observed.
The presence of the gene that codes the CaneCPI-1 protein was confirmed by PCR
(Figure 6B) and the agarose gel revealed an amplification band of 338 bp,
corresponding to amplified products of the DNA samples from E. coli DH5α cells
transformed with the pYADE4_CaneCPI-1 construction. This study also confirms the
stability of the S. cerevisiae PE-2 strain transformed with pYADE4_CaneCPI-1.This
was verified by making successive cell cultures and identification tests of plasmid DNA
from transformed yeast in each cell culture. The results indicate that the construction it
has been stably maintained in cells, but there is no explication about how it has been
maintained. In a study describing the protein expression using S. cerevisiae PE-2 strain
transformed with pYADE4 vector carrying the GFP gene (Green fluorescent protein)
the author reports that transformed yeast cell showed high stability [34].
Page 18 of 32
Accep
ted
Man
uscr
ipt
18
Conclusions
CaneCPI-1 was expressed efficiently in PE-2 cells and purified by affinity
chromatography on an Ni-NTA column. The purified protein was able to inhibit papain
activity, with a Ki value similar to that of the recombinant protein produced in bacteria.
The transformed strain did not have its fermentation ability affected in a batch
experiment with cell recycle. Thus, the industrial PE-2 strain of S. cerevisiae is a viable
expression system for recombinant protein production. The findings of the present study
demonstrate the possibility of producing proteins with biotechnological applications
during ethanol fermentation.
Acknowledgments
This study was supported by the Brazilian fostering agencies FAPESP (CBME, CEPID
Proc. 98/14138-2) and CNPq Proc. 485225/2007-7. D.G.N. received a grant from
CAPES and F.H.S. is research fellow of CNPq Proc. 305655/2009-4.
Page 19 of 32
Accep
ted
Man
uscr
ipt
19
Table 1. Cellular viability during fermentation alcoholic process for S. cerevisiae PE-2.
Table 2. Comparison of mean values obtained from fermentative analysis among the cycles of fermentation and between the transformed and non-transformed strains.
PE-2 YeastFermentative
Cycles1Brix pH Ethanol
Production (g/100mL)
Total Residual Reducing Sugars
(g/100mL)
Fermentative Efficiency (%)
Transformed 1 5,00 a 4,36 a 1,38 d 7,38 a 0,83 aNon-transformed 1 5,00 a 4,33 a 1,51 d 7,36 a 0,90 a
Transformed 2 4,67 b 4,18 a 2,62 c 3,86 c 0,76 aNon-transformed 2 4,80 b 4,15 a 2,52 c 5,05 b 0,88 a
Transformed 3 4,03 c 4,09 a 4,16 a 1,20 d 0,86 aNon-transformed 3 4,00 c 4,07 a 4,18 a 1,34 d 0,88 a
Transformed 4 3,87 d 4,11 a 4,31 a 0,92 d 0,87 aNon-transformed 4 4,00 d 4,12 a 4,34 a 0,86 d 0,87 a
Transformed 5 3,50 e 3,84 b 2,74 c 0,28 e 0,52 cNon-transformed 5 3,77 d 3,82 b 3,62 b 0,36 e 0,68 b
1 Cycles 1 to 4 were 9-hours long; cycle 5 was 36-hours long
Different letters in the columns indicate significant difference at 5% by Scott-knott test.
Yeast strainCellular viability (%) in
the beginning of fermentative assay
Cellular viability (%) in the end of fermentative
assay
S. cerevisiae PE-2 transformed 98.5 80.5
S. cerevisiae PE-2 non-transformed
99.1 83.0
Page 20 of 32
Accep
ted
Man
uscr
ipt
20
Figure legends
Figure 1. Structural map of expression vector pYADE4_Cane-CPI-1. Adapted from [22].
Figure 2. Analysis of expression, purification and immunodetection of recombinant
CaneCPI-1 in S. cerevisiae PE-2 cells. (A) CaneCPI-1 expression and purification: SDS-
PAGE 15% stained with comassie blue. (B) Immunodetection with polyclonal anti-CaneCPI-1
antibody. (C) Immunodetection with monoclonal anti-His-tag antibody. Lane 1: Molecular
weight marker (Invitrogen); lane 2: cell extract of non-transformed PE-2 cells; lane 3: cell
extract of transformed PE-2 cells; lane 4: fraction eluted in 250mM of imidazole (note band of
13 kDa).
Figure 3. Analysis of expression and immunodetection of the recombinant CaneCPI-1 in
transformed Saccharomyces cerevisiae PE-2 cells during the fermentative cycles. (A)
CaneCPI-1 expression along the fermentative cycles: SDS-PAGE 15% stained with
Coommassie blue. (B) Immunodetection with polyclonal anti-CaneCPI-1 antibody. (C)
Immunodetection with monoclonal anti-His-tag antibody. In Lane 1: Molecular weight marker;
lane 2: cell extract of the first cycle of 9 hours; lane 3: cell extract of the second cycle of 9
hours; lane 4: cell extract of the third cycle of 9 hours; lan 5: cell extract of the fourth cycle of 9
hours; lane 6: cell extract of the fifth cycle of 36 hours (note band of 13 kDa).
Figure 4. Papain inhibition by purified caneCPI-1. Papain (0.1 µM) was activated by
incubation with 100 mM sodium acetate buffer, pH 5.5 containing 2.5 mM of dithiothreitol.
Inhibitory activity was determined by measuring the remaining hydrolytic activity at different
inhibitor (caneCPI-1) concentrations in the presence of substrate Z-Phe-Arg-MCA.
reducing sugars (TRS, g/100 mL); D: ethanol production (g/100 mL); E: °Brix; during alcoholic
fermentation, in flasks, at 30 °C, 200 rpm, using clarified sugarcane broth (12° Brix, 12 g/100
mL of TRS), 20% inoculum, with cell recycling, for transformed and non-transformed S.
cerevisiae PE-2 cells.
Page 21 of 32
Accep
ted
Man
uscr
ipt
21
Figure 6. Screening by PCR of E. coli DH5α cells transformed with total DNA extracted
from transformed S. cerevisiae PE-2 cells. A: Left Petri dish is a control (used E. coli DH5α
cells transformed with total DNA extracted from non-transformed S. cerevisiae PE-2 cells) and
right Petri dish with E. coli DH5α cells transformed with total DNA extracted from transformed
S. cerevisiae PE-2 cells. B: 1% agarose gel showing amplified products of DNA samples from
E. coli DH5α cells transformed with pYADE4_CaneCPI-1 construct. M: 1 kb DNA ladder; line
1: negative control; lines 2 to 11: selected bacterial colonies.
Page 22 of 32
Accep
ted
Man
uscr
ipt
22
References
[1] Çelik E, Çelik P. Production of recombinant proteins by yeast cells. Biotechnology Advances. 2012; 30: 1108-1118.
[2]. Romanos MA, Scorer CA, Clare JJ. Foreign Gene Expression in Yeast: a Review. Yeast. 1992; 8:423-488.
[3]. Zurbriggen B, Bailey MJ, Pentilla ME, Poutanen K, Linko M. Pilot scale production of a heterologous Trichoderma reesei cellulase by Saccharomyces cerevisiae. Journal of Biotechnology. 1990; 13:267-278.
[4]. Finnis CJ, Payne T, Hay J, Dodsworth N, Wilkinson D, Morton P, et al. High-level production of animal-free recombinant transferrine from Saccharomyces cerevisiae. Microbial Cell Factories. 2010; 9:87.
[5]. Kellosalo J, Kajander T, Palmgren MG, López-Marqués RL, Goldman A.Heterologous expression and purification of membrane-bound pyrophosphatases. Protein Expression and Purification. 2011; 79: 25-34.
[6]. Yesilirmak F, Sayers Z. Heterelogous Expression of Plant Genes. International Journal of Plant Genomics. 2009; 2009:16.
[7] Kutty G, England KJ, Kovacs JA. Expression of Pneumocystis jirovecii Major Surface Glycoprotein in Saccharomyces cerevisiae. The Journal of Infectious Diseases. 2013; 208: 170-9.
[8] Xia L, Liu Z, Ma J, Sun S, Yang J, Zhang F. Expression, purification and characterization of cecropin antibacterial peptide from Bombyx mori in Saccharomyces cerevisiae. Protein Expression and Purification. 2013; 90: 47-54.
[9] Bomholt J, Hélix-Nielsen C, Pedersen PA. Recombinant Production of Human Aquaporin-1 to an Exceptional High Membrane Density in Saccharomyces cerevisiae. Plos One. 2013; 8:1-9.
[10]. Cereguino PLG, Cregg JM. Applications of yeast in biotechnology: protein production and genetic analysis. Elsevier Science Ltd. 1999; 10:422-427.
[11]. Ostergaard S, Olsson L, Nielsen J. Metabolic engineering of Saccharomyces cerevisiae. Microbiology and Molecular Biology Rewiews. 2000; 64:34-50.
[12]. Querol A, Jimenez M, Huerta T. A study on microbiological and enological parameters during fermentation of must from poor and normal grapes harvested in the region of Alicante (Spain). Journal Food Science. 1990; 55:1603-1606.
[13]. Steckelberg C. Caracterização de leveduras de processos de fermentação alcóolica utilizando atributos de composição celular e características cinéticas. 2001. 215p. Tese (Doutorado em Engenharia Química) – Universidade Estadual de Campinas, Campinas-SP.
Page 23 of 32
Accep
ted
Man
uscr
ipt
23
[14]. Basso LC, Amorim HV, Oliveira AJ, Lopes ML. Yeast selection for fuel ethanol production in Brazil. Federation of European Microbiological Societies. 2008; 8:1155-1163.
[15]. Goldemberg J. Ethanol for a sustainable energy future. Science. 2007; 315:808–810.
[16]. Guerra JB, Araújo RAC, Pataro C, Franco GR, Moreira ESA, Mendonça-Hagler LC, et al. Genetic diversity of Saccharomyces cerevisiae strains during the 24 h fermentative cycle for the production of the artisanal Brasilian cachaça. Letters in Applied Microbiology. 2001; 33:106-111.
[17]. Pataro C, Guerra JB, Petrillo-Peixoto M L, Mendonça-Hagler LC, Linard VR, Rosa VR. Yeast communities and genetic polymorphism of Saccharomyces cerevisiaestrains associated with artisanal fermentation in Brazil. Journal of Applied Microbiology. 2000; 88:1-9.
[18]. Lima UA, Basso LC, Amorim HV. Biotecnologia Industrial: Processos Fermentativos e Enzimáticos. Vol 3. São Paulo: Edgard Blücher; 2001: 616.
[19]. Argueso JL, Carazzolle MF, Mieczkowski PA, Duarte FM, Netto OV, Missawa SK, et al. Genome structure of a Saccharomyces cerevisiae strain widely used in bioethanol production. Genome Research. 2009; 19:2258-2270.
[20]. Soares-Costa A, Beltramini LM, Thiemann OH, Henrique-Silva F. A sugarcane cystatin: recombinant expression, purification, and antifungal activity. BiochemicalBiophysical Research Communications. 2002; 296:1194-1199.
[21]. Haq SK, Atif SM, Khan RH. Protein proteinase inhibitor genes in combat against insects, pests, and pathogens: natural and engineered phytoprotection. Archives of Biochemical Biophysical. 2004; 431:145-159.
[22] Brunelli JP, Pall ML. A series of Yeast Shuttle Vectors for Expression of cDNAS and Other DNA sequences. YEAST. 1993; 9:1299-1308.
[23]. Sambrook J, Russel DW. Molecular Cloning: A laboratory Manual. New York: Cold Spring Harbor Laboratory Press, 1989.
[24]. Bradford MM. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. AnalyticalBiochemistry. 1976; 72:248-254.
[25]. Ribeiro, C. W. Production of a His-tagged Canecystatin in transgenic sugarcane and subsequent purification. Biotechnology Progress.2008; 24:1060-1066.
[27]. Lee SS, Robison FM, Wang HY. Rapid determination of yeast viability. Biotechnologyand Bioengineering. 1981; 11:641-649.
[28]. Miller GL. Use of dinitrosalicylic acid reagent for determination or reducing sugar. Analytical Chemistry. 1959; 31:426-428.
[29]. Silva CLC. Seleção de linhagens de Saccharomyces cerevisiae floculantes e linhagens não produtoras de H2S e sua influência na qualidade da cachaça. Belo Horizonte: Faculdade de Farmácia da Universidade Federal de Minas Gerais, 2003. 99p. (Tese, Mestre em Ciência de Alimentos).
[30]. Scott AT, Knott M. A cluster analysis method for grouping means in the analysis of variance. Biometrics. 1974; 30:507-512.
[31]. Oliva MLV, Carmona AK, Andrade SS, Cotrin SS, Soares-Costa A, Henrique-Silva F. Inhibitory selectivity of canecystatin: a recombinant cysteine peptidase inhibitor from sugarcane. Biochemical Biophysical Research Communications. 2004; 320:1082-1086.
[32]. Dorta C, Oliva-Neto P, De-Abreu-Neto MS, Nicolau-Junior N, Nagashima AI.Synergism among lactic acid, sulfite, pH and ethanol in alcoholic fermentation of Saccharomyces cerevisiae (PE-2 and M-26). World Journal of Microbiology and Biotechnology. 2006; 22:177-182.
