Influence of different nitrogen inputs on the membersof ammonium transporter and glutamine synthetase genes in tworice genotypes having differential responsiveness to nitrogen

Vikram Singh Gaur • U. S. Singh •

Alok Kumar Gupta • Anil Kumar

Received: 9 August 2011 / Accepted: 16 April 2012 / Published online: 25 April 2012

� Springer Science+Business Media B.V. 2012

Abstract Two aromatic rice genotypes, Pusa Basmati 1

(PB1) and Kalanamak 3119 (KN3119) having 120 and

30 kg/ha optimum nitrogen requirement respectively, to

produce optimal yield, were chosen to understand their

differential nitrogen responsiveness. Both the genotypes

grown under increasing nitrogen inputs showed differences

in seed/panicle, 1,000 seed weight, %nitrogen in the bio-

mass and protein content in the seeds. All these parameters

in PB1 were found to be in the increasing order in contrast

to KN3119 which showed declined response on increasing

nitrogen dose exceeding the normal dose indicating that

both the genotypes respond differentially to the nitrogen

inputs. Gene expression analysis of members of ammo-

nium transporter gene family in flag leaves during active

grain filling stage revealed that all the three members of

OsAMT3 family genes (OsAMT1;1–3), only one member

of OsAMT2 family i.e., OsAMT2;3 and the high affinity

OsAMT1;1 were differentially expressed and were affected

by different doses of nitrogen. In both the genotypes, both

increase and decline in seed protein contents matched with

the expressions levels of OsAMT1;1, OsGS1;1 and

OsGS1;2 in the flag leaves during grain filling stage

indicating that high nitrogen nutrition in KN3119 probably

causes the repression of these genes which might be

important during grain filling.

Keywords Ammonium transporter � Nitrogen use

efficiency � Gene expression

Introduction

Plants can extract and use a wide range of inorganic and

organic forms of nitrogen (N) from soils. However, in

agricultural systems fertilized with urea, nitrate (NO3-) and

ammonium (NH4?) are believed to provide the bulk of the N

resource available to the plants [1]. Of these various sources

of nitrogen the NH4? form of nitrogen is of particular

importance as it is firstly, a direct source of N for plant

growth and its more constant availability in soils in both

time and space than that of NO3-, which can easily be

leached following rainfall and is often undetectable in the

soil solution [2] although NH4? may be lost through nitri-

fication. Secondly, NH4? is also used efficiently by plants. It

is generally taken up at higher rates than NO3- when both

ions are present at similar external concentrations, and its

assimilation requires little energy compared with that of

NO3– [3]. Thirdly, NH4

? strongly inhibits NO3- uptake [4].

Finally, it is well documented that NH4? constitutes the

preferred N source for many plant species. In rice, the major

form of nitrogen that is available for growth of rice plants in

paddy fields is NH4?, requiring NH4

? transport systems at

the root plasma membrane. The first step in ammonium

assimilation is the uptake of ammonium into root cells from

the soil solution which is mediated by ammonium trans-

porters that have been isolated and partially characterized in

several plant species [5–8].

V. S. Gaur � A. K. Gupta � A. Kumar (&)

Department of Molecular Biology and Genetic Engineering,

College of Basic Sciences and Humanities, G. B. Pant University

of Agriculture and Technology, Pantnagar, Uttarakhand, India

e-mail: anilkumar.mbge@gmail.com

U. S. Singh

Department of Plant Pathology, College of Agriculture,

G. B. Pant University of Agriculture and Technology, Pantnagar,

Uttarakhand, India

U. S. Singh

International Rice Research Institute, IRRI-India Office,

NASC, New Delhi, India

123

Mol Biol Rep (2012) 39:8035–8044

DOI 10.1007/s11033-012-1650-8

\AMTs are classified into two types: high-affinity transport

system (HAT) and low affinity transport system (LAT) [2]. At

low NH4? concentration, uptake is mediated by HATs and

exhibits sensitivity to metabolic inhibitors. At high NH4?

concentration (between 1 and 40 mM), uptake is mediated by

LATs and is less responsive to metabolic inhibitors [9]. There

are four AMT families in rice, i.e. OsAMT1, OsAMT2,

OsAMT3 and OsAMT4. Except OsAMT4 each of the three

family contains three members [10]. The OsAMT1s (Os

AMT1;1, OsAMT1;2 and OsAMT1;3) share high sequence

similarity to each other and are very dissimilar to the other

three OsAMT families [11]. The expression pattern of

OsAMT1s (OsAMT1;1–1;3) have been reported to be dis-

tinct and regulated at least in part by the N source, such as

NH4? and N starvation [10].

Most of the NH4? taken up by the roots is assimilated

within the roots, however, NH4? taken up by the roots is

also translocated to the shoots. Using positron emitting

tracer imaging Loque and von Wiren 2004 [2] showed that13N from root-applied 13N labelled ammonium was found

in the shoot tissue within less than 2 min indicating that the

root-to-shoot translocation of ammonium or of ammonium-

derived nitrogen is rapid. Also, in N-deficient rice roots 13N

translocation from 13N-labelled ammonium decreased with

increasing root demand [12] suggesting that the root serves

first before surplus ammonium-N is translocated further to

the shoot. In both roots and shoots, NH4? is assimilated by

the reaction catalysed by Glutamine synthetase (GS) to

yield the amino group of Gln [13]. Another enzyme, Glu-

tamate synthase (GOGAT) transfer the amide group of

glutamine to carbonyl carbon of a-ketoglutaric acid,

thereby forming two molecules of glutamic acid or gluta-

mate. Besides forming glutamate, glutamine can also

donate its amide group to aspartic acid to form asparagines.

This reaction is catalyzed by Asparagine synthetase. These

four amino acids are precursor of all nitrogen containing

organic biomolecules. The translocation from source to

sinks occurs in this form [14]. The fourth major enzyme in

nitrogen assimilation is Glutamate dehydrogenase (GDH).

This enzyme can catalyze both forward and backward

biochemical reactions; the amination of a-oxoglutarate into

glutamate (anabolic reaction) and/or the deamination of

glutamate into ammonia and 2-oxoglutarate (catabolic

reaction). These organic nitrogen compounds assimilate in

leaves and stem of plants in the form of protein, amino

acids, nucleotides and chlorophyll [15].

The GS/GOGAT cycle is now widely accepted as the

major route of ammonium assimilation in higher plants. In

many plants including rice, there are two isoforms of GS in

leaves: one located in the cytosol (GS1) and the other in the

chloroplast stroma (GS2). The physiological function of

GS2 is considered to be the reassimilation of ammonium

released during photorespiration and in plant such as rice

where the rate of photosynthesis is similar to that of pho-

torespiration in leaves throughout the life span, the loss of

GS activity during the natural senescence is due to the loss

of GS2 isoform. In rice, it was found that GS1 polypeptide

remained constant throughout the senescence period while

the GS2 declined. Immunoblotting assays have shown that

contents of other chloroplastic enzymes, such as ribulose-

1,5-biphosphate carboxylase/oxygenase and FdGOGAT,

declined in parallel with GS2 [16]. During this period there

was a marked decrease in content of glutamate (glutamate

is the major form of free amino acid in the rice leaves) and

increase in glutamine content which is the major trans-

ported amino acid. Therefore, it was suggested that GS1 in

senescence is responsible for the synthesis of glutamine

which is then transferred to the growing tissues in rice

plants [16]. Furthermore, the role of GS during the grain

filling is well documented. It has been shown that GS

activity in the flag leaves has a direct relation to the amount

of protein accumulating in the developing seed. Transgenic

rice lines having dysfunctional GS gene shows no grain

filling [17]. Therefore it can be stated that GS has got very

important roles during the grain filling.

In this study, along with the yield and physicochemical

parameters, the gene expression patterns of the members of

AMT gene family and cytosolic GS genes were studied in

two rice genotypes which differ in their optimum nitrogen

requirement to produce maximum yield. We tried to

address the reasons behind low grain filling in low nitrogen

requiring genotype when grown under high nitrogen doses.

Materials and methods

Selection and growth of rice genotypes

Two rice genotypes Pusa Basmati 1 (PB1) and Kalanamak

3119 (KN3119) were chosen based on their differential

response to nitrogen. Their agronomic traits are shown in

the Table 1. KN3119 is a low nitrogen requiring genotype

with optimum nitrogen dose of 30 kg/ha. The other geno-

type, PB1 is a high nitrogen requiring genotype having

optimum nitrogen dose of 120 kg/ha. The experiment was

carried out with three replications in the glass house of

Department of Plant Pathology, G. B. Pant University of

Agriculture & Technology, Pantnagar. Twenty-one day old

seedlings of PB1 and KN3119 were transplanted in 15 kg

buckets. The treatments comprised of five levels of nitro-

gen (in the form of urea) (30, 60, 120, 150 and 180 kg/ha).

The nitrogen was applied in three split doses i.e., half as

basal and other two at the active tillering and panicle ini-

tiation stage respectively. A uniform dose of 50 kg Phos-

phorus (P), 50 kg Potash (K) and 25 kg Zinc sulphate

(ZnSO4) per hectare was applied as basal dose. Seeds/

8036 Mol Biol Rep (2012) 39:8035–8044

123

plants produced from each replicate were harvested at

maturity and were stored in separate bags for further

analysis.

Selection of stages for RNA isolation

Total RNA was isolated from the flag leaves of the indi-

vidual replicate plants growing on different nitrogen inputs.

The stage for RNA isolation from the flag leaves was

chosen at the time of grain filling of both the genotypes and

when approximately 50 % of the developing grains in the

panicle were at milky stage.

RNA isolation and cDNA synthesis

Total RNA was isolated using concert plant RNA purifi-

cation reagent (Invitrogen) followed by on column DNA

digestion using RNeasy plant minikit and RNase free DNA

digestion kit (Qiagen, Germany). The quality of RNA was

checked by running on 1 % agarose gel and was quantified

using a spectrophotometer. Minimum of three plant

replicates of each stage were selected for RNA isolation.

The quantified individual total RNA replicate were further

used to prepare cDNA. 2 lg of total RNA was used to

prepare cDNA. The reaction condition was as follows, for

20 lL reaction, 2 lg total RNA, 1 lL (200 U) MMLV

reverse transcriptase (Invitrogen), 5X (4 lL) first strand

buffer, 2 lL DTT, 0.4 lL dNTP mix (100 mM), 1 lL

Superase RNase inhibitor (Ambion) (20 U/lL) and 0.5 lg

oligo dT primer (Qiagen) for 60 min at 37 �C and a final

denaturation step at 70 �C for 15 min.

Primer designing

mRNA sequences of members of rice AMT gene family

and cytosolic glutamine synthatase were downloaded from

NCBI and their gene specific primers were designed using

Lasergene DNASTAR software. The list of primers used to

study the expression profiles of rice AMT genes and GS

genes is given in the Table 2.

RT-PCR and cloning of RT-PCR products

RT-PCR using individual cDNAs sets obtained from each of

the three replicates of the pot experiment was performed for

generating the expression profiles of cytosolic glutamine

synthatase and members of OsAMT genes. Before generat-

ing the expression profiles for densitometry analysis in order

to avoid plateau of PCR reaction cycles, the PCR was

optimized by analyzing the PCR products of 10, 20, 30, 35

and 40 cycles. Thirty PCR cycles was found to be optimum.

RT-PCR reaction was performed using aliquots of 1 lL of

Table 1 Detail of the two rice genotypes [21]

Genotype

Agronomic characteristics Pusa Basmati 1 Kalanamak 3119

Plant height (cm) 90–110 121

Total duration (days) 130–135 154

Average yield (t/ha) 4.5 0.8

Optimum nitrogen dose 100–120 kg/ha 30 kg/ha

Table 2 List of gene specific primers used for the study of expression profiles of members of rice ammonium transporter family and two

cytosolic GS genes (OsGS1;1 and OsGS1;2) involved in nitrogen uptake and assimilation

S. no. Gene name Primer sequences forward 50–30 Primer sequences reverse 50–30 Amplicon

size (in bp)

Tm (�C)

1 OsAMT1;1 (AAL05612) TTTTGCTGGGCTTCTCTTGT ACCATTCCACCACACCCTTA 171 58

2 OsAMT1;2 (AAL05613) CTTCATCGGGAAGCAGTTCT TGAGGAAGGCGGAGTAGATG 170 58

3 OsAMT1;3 (AAL05614) CGGCTTCGACTACAGCTTCT GACCAGATCCAGTGGGACAC 165 58

4 OsAMT2;1 (BAB87832) CTGGCTCCTCCTCTCCTACA CAGGATGTTGTTCGGTGAGA 196 58

5 OsAMT2;2 (NM_190445) GCCTCGACGTCATCTTCTTC TTGTGGAGGATCATCATGGA 172 58

6 OsAMT2;3 (NM_190448) GCCTCGACGTCATCTTCTTC GGAAGGTGGATTTCTTGTGC 186 58

7 OsAMT3;1 (BAC65232) ACCAAGGACAGGGAGAGGTT AAGATGACGTCGAGGCAAGT 197 58

8 OsAMT3;2 (AAO41130) GCACAGAAGGACAGGGAGAG GCAGATGTTGGTGTTGAGGA 156 58

9 OsAMT3;3 (AK108711) CGAGCATCACCATCATCATC ATGACACCCCACTGGAAGAG 154 58

10 OsAMT1;1 (AAL05612) TTTTGCTGGGCTTCTCTTGT ACCATTCCACCACACCCTTA 171 58

11 OsAMT1;2 (AAL05613) CTTCATCGGGAAGCAGTTCT TGAGGAAGGCGGAGTAGATG 170 58

12 OsGS1;1 (914245) GAGCCCTGGTACGGTATTGA TCAACAATATCACGCCCAAA 158 58

13 OsGS1;2 (914244) CCCCTACTTCGCTATCCACA TGAATGAGCAAGATGCAAGC 158 58

14 Actin GQ183546 CCCCCATGCTATCCCTCGTCTC CTCGGCCGTTGTGGTGAATGA 103 58

Mol Biol Rep (2012) 39:8035–8044 8037

123

the cDNA and 12.5 pmol of gene specific primer in a 50 lL

reaction volume containing 0.2 mM of each dNTPs, 2 mM

MgCl2 and 1 U GoTaq Flexi DNA polymerase (Promega)

which is provided with a green buffer containing gel loading

dye so that the PCR products can be loaded directly onto the

gels. The temperature profiles used for the PCR were 95 �C

for 2 min initial denaturation followed by 30 cycles of

95 �C for 20 s, 58 �C for 30 s (primer anneling), 72 �C for

30 s and final extension for 10 min. The PCR products were

separated on 1 % agarose gels and the single specific band of

PCR product obtained was cloned into the pGEM-T easy

vector (Promega) for sequencing.

Quantitative real-time PCR

Real-time PCR was done using the 5 Prime Real Master Mix

SYBR ROX (Eppendorf India Limited, Chennai, India)

according to manufacturer’s instructions. The thermocycler

used was eppendorf thermocycler ep-realplex-4. The primers

for OsAMT genes and actin genes used were same as earlier

described. The reverse transcription efficiencies of AMT, GS

and actin genes were almost equal as analyzed by comparing

the CT values at different dilutions of cDNA [18]. PCR

conditions were set according to the manufacture instruc-

tions. The following amplification program was used: 95 �C

for 2 min, 40 cycles at 95 �C for 30 s, 58 �C for 30 s, 72 �C

for 30 s; 58 �C for 15 s and 95 �C for 15 s. All samples were

amplified in triplicate, and the mean and standard error values

were calculated. Completely randomized design (CRD) was

used for analyzing the gel data and real time data.

Densitometry analysis of gel for semi-quantitative

analysis of expressed genes

Densitometry analysis was done with the help of Gene

Profiler software, Alpha Innotech Corporation, USA.

Briefly, individual gels were scored by placing the curser

over individual band and recording the relative densitom-

etry values of at least three independent gels representing

three different plants used for the expression analysis.

Statistical analysis

Three independent determinations for each parameter were

recorded and mean ± SE values were calculated for sta-

tistical analysis. CRD was used for analyzing the enzy-

matic and gel data respectively. For comparing two data

sets paired ‘t’ test was used.

%Nitrogen estimation

The %nitrogen content in the straw and the grains was

determined by Micro-Kjeldhal method. Protein content in

the grains was obtained by multiplying the %nitrogen

content in the grains with the factor 6.25 [19].

Enzyme assays of glutamine synthetase

The extraction buffer included, 10 mM—Tris HCl (pH 7.6),

1 mM—MgCl2, 1 mM—EDTA and 1 mM—2 mercap-

toethanol. Leaves (2 g) were grinded using liquid N2 in the

presence of cover slips followed by centrifugation at

15,0009g for 30 min at 4 �C. Supernatant was collected

and stored at -20 �C in aliquot of 150 lL for future use.

The assays were carried out by continuous spectrophoto-

metric rate determination method [20]. All the readings

were taken at 37 �C, pH 7.1, A340nm, light path = 1 cm.

Results

Effect of different doses of nitrogen on yield attributes

Different yield attributes like 1,000 grain weight, %pro-

tein content, dry weight, seed/panicle, chaff/panicle and

%nitrogen in the straw was calculated in both the geno-

types raised on different nitrogen conditions. However, in

KN3119, the 180 kg/ha nitrogen dose was so detrimental

that almost no seed setting was observed. A few seeds

however (just 5–6 seeds/panicle per plant) obtained was

used for RNA isolation to carry out the gene expression

analysis. Therefore, while analyzing the data statistically,

the data obtained up to 150 kg/ha nitrogen dose in both the

genotypes was considered.

Effect of different dosages of nitrogen on 1,000 grain

weight

Both the genotypes showed significant increase in 1,000

grain weight with increase in level of nitrogen (Fig. 1a).

In KN3119, maximum increase in the 1,000 gain weight

reached at a lower nitrogen dose than PB1. In KN3119,

maximum 1,000 grain wt of 12.88 g (3.95 % increase over

control) was obtained when the plants were grown on

60 kg/ha N dose. Further increments in the nitrogen dose

significantly declined (P \ 0.05) the 1,000 grain weight.

Minimum 1,000 grain weight was recorded when the

plants were grown on 150 kg/ha nitrogen. In PB1, the

1,000 grain weight was found to be in the increasing order

with the increase in the level of nitrogen dose. Significant

increase in 1,000 grain weight was obtained only above

30 kg/ha nitrogen dose. Maximum 1,000 grain weight of

17.13 g (10.21 % increase over the control) was therefore

recorded when the plants were grown at 150 kg/h nitrogen

dose.

8038 Mol Biol Rep (2012) 39:8035–8044

123

Effect of different dosages of nitrogen on protein

content in the seeds

In KN3119, increase in the nitrogen dose to higher levels

had a negative effect on the protein content while in PB1

the trend was positive and in the increasing order i.e.

increasing the nitrogen dose increased the protein content

of the seeds (Fig. 1a). In KN3119, maximum protein

content of 8.86 % was recorded when the plants were

grown under 30 kg/ha nitrogen supply which was a

10.06 % increase over the control. However, as compared

to control, 60 and 120 kg/ha nitrogen dose also increased

the protein content in the seeds but the percent increases

were significantly lower (P \ 0.05) than the maximum. At

150 kg/ha the drop in the %protein content (-0.62 %) was

even lower than the control. In contrast, in PB1, the

increase in the nitrogen content successively increased the

protein content but significant increase in the protein con-

tent was achieved only at 150 kg/ha nitrogen dose. This

maximum protein content of 9.60 % found when the plants

were grown at 150 kg/ha nitrogen supply was 6.66 %

increase over the control. It can be noted here that the

percent increase in the protein content of the seeds was

higher (10.06 %) in KN3119 than PB1 but the over all

protein content in all the nitrogen doses of PB1 was higher

than that of KN3119 i.e., protein content of PB1 seeds are

higher than KN3119.

Effect of different dosages of nitrogen on dry weight

The dry weight of the two genotypes increased progres-

sively with the increase in the nitrogen dose (Fig. 1b). In

KN3119, maximum dry weight of 17.92 g was recorded

when the plants were grown under high nitrogen conditions

i.e., 150 kg/ha which was 102.48 % increase when com-

pared to the control. This increase in dry weight was not

significant (P [ 0.05) up to 60 kg/ha but was significant

(P \ 0.05) at 120 and 150 kg/ha. Similar trend was

observed in PB1 which also showed maximum dry weight

of 9.52 g at 150 kg/ha nitrogen dose. But the percent

increase in the dry weight of PB1 (66.72 %) was much

lower than that of KN3119 at the same nitrogen dose. The

increase in dry weight at all the nitrogen doses of PB1 was

significantly higher (P \ 0.05) than the control.

Effect of different dosages of nitrogen on %nitrogen

in the straw

Figure 1b shows the %nitrogen in the straw of PB1 and

KN3119 grown on different nitrogen inputs. The %nitro-

gen in the straw of both the genotypes increased as the

nitrogen dose was increased. The increase was much more

prominent in case of KN3119 where at 150 kg/ha there was

a 83.33 % increase in %nitrogen as compared to the con-

trol. The increase in %nitrogen up to 30 kg/ha was non

significant but it was significant (P \ 0.05) at higher

nitrogen doses. In PB1 the effect was non significant

(P [ 0.05).

Effect of different dosages of nitrogen on seed/panicle

and chaff/panicle (unfilled grains)

The effect of nitrogen on seed/panicle and chaff/panicle

was differential among the two genotypes (Fig. 1c). In

KN3119 increase in nitrogen dose was detrimental as the

seed/panicle was severely compromised. Hardly any seed

was obtained when the plants were grown under higher

nitrogen dose i.e., at 180 kg/ha almost all the spikelet were

chaff. Maximum seed/panicle in KN3119 was obtained

when the plants were grown under 30 kg/ha nitrogen

supply which was 22.60 % increase over the control.

However, nitrogen dose of 60 kg/ha also produced higher

seed/panicle than control but was less than that of 30 kg/ha.

In fact, the seed/panicle was found to decline significantly

(P \ 0.05) as the nitrogen dose applied was increased

above 30 kg/ha. At 150 kg/ha there was a 67.74 %

decrease in the seed/panicle as compared to the control. In

case of PB1 the effect of increasing the nitrogen dose was

0 30 60 120 15010

12

14

16

18

20

7

8

9

10

11

KN3119 (1000 Gr. Wt.)PB1 (1000 Gr. Wt.)KN3119 (% Protein)PB1 (% Protein)

Nitrogen Doses (in Kg/ha)

1000

gra

in w

eig

ht

(in

gra

ms)

% P

rotein

con

tent in

the G

rain 0 30 60 120 1500

50

100

150

200

250

0

50

100

150

200

250

KN3119 (Seed/Panicle)PB1 (Seed/Panicle)KN3119 (Chaff/Panicle)PB1 (Chaff/Panicle)

Nitrogen Doses (in Kg/ha)

See

d/p

anic

le

Ch

aff/pan

icle

0 30 60 120 1500

5

10

15

20

0.0

0.2

0.4

0.6

0.8

1.0

KN3119 (Dry Wt.of Biomass)PB1 (Dry Wt of Biomass.)KN3119 (% N in Biomass)PB1 (% N in Biomass)

Nitrogen Doses (in Kg/ha)

Dry

wt.

of

Bio

mas

s (i

n g

ram

s)%

N co

nten

t in th

e Bio

mass

A B C

Fig. 1 a The 1,000 grain weight and percent (%) protein content in grains, b dry weight and %nitrogen content of biomass, c seed/panicle and

chaff/panicle, of the two contrasting rice genotypes PB1 and KN3119 grown under different nitrogen doses

Mol Biol Rep (2012) 39:8035–8044 8039

123

positive. Seed/panicle progressively increased as the

nitrogen dose was increased. The increase in seed/panicle

up to 30 kg/ha was non significant (P [ 0.05) but it was

significant (P \ 0.05) at higher doses. Maximum seed/

panicle of 201.66 was obtained when the plants were

grown under 150 kg/ha which was a 44.73 % increase over

the control. Chaffiness in KN3119 significantly (P \ 0.05)

increased to a very high level when the plants were raised

on nitrogen dose above 60 kg/ha (Fig. 1c). Maximum

chaffiness was recorded when the plants were grown under

150 and 180 kg/ha nitrogen supply. In case of PB1 increase

in nitrogen dose did not significantly affect the chaffiness.

Expression profiling of ammonium transporter genes

in flag leaves of PB1 and KN3119

The expression profiling of ammonium transporters genes

in the flag leaves of the two genotypes is shown in the

Fig. 2a–j. OsAMT1;1 of the OsAMT1 family, OsAMT2;3

of the OsAMT2 family and all the three members of the

OsAMT3 family genes were found to express in the flag

leaves of both the genotypes. The expression profiling

revealed that OsAMT1;1 express differentially in the flag

leaves of both the rice genotypes. In PB1 the expression of

OsAMT1;1 in the flag leaves was strongly induced when

the plants were grown under 120 kg/ha nitrogen dose and

further increase in nitrogen dose increased the expression.

Real time data showed that this induction was a 9.22-fold

increase over the control which went up to 12.87-fold at

180 kg/ha (Fig. 3a). In contrast, OsAMT1;1 in KN3119

flag leaves was induced at a lower nitrogen dose of 30 kg/

ha and reached maximum level of expression at 60 and

120 kg/ha. Real time data showed that this induction in

expression was about 3.94-fold at 30 kg/ha nitrogen dose

which went up to 6.59-fold at 60 kg/ha nitrogen dose

(Fig. 3b). But as the nitrogen dose was further increased to

150 and 180 kg/ha there was a significant decline

(P \ 0.05) in OsAMT1;1 expression. Neither OsAMT2;1

nor OsAMT 2;2 was found to express in the flag leaves of

both genotypes, however very low expression levels of

OsAMT2;3 was detected in the flag leaves of both the

genotypes. The expression levels of OsAMT3;1 in flag

leaves of PB1 was high and increased with increased

nitrogen dose while it was found to be expressed at low

levels in KN3119. Real time data showed that at 180 kg/ha

nitrogen dose OsAMT3;1 expression in PB1 flag leaves

reached to 12.8-fold compared to control (Fig. 3a). How-

ever, in case of KN3119, a slight induction was observed at

60 kg/ha nitrogen dose. The expression levels of OsAMT3;2

was low in both the genotypes and was constitutive i.e.,

neither increased or decreased with increase in nitrogen dose.

OsAMT3;3 expression was high and constitutive in PB1

compared to KN3119. A slight induction was observed at

60 kg/ha nitrogen dose in case of KN3119.

Expression profiling of cytosolic glutamine synthetase

(OsGS1;1 and OsGS1;2) genes in the flag leaves of PB1

and KN3119

The expression profiling of OsGS1;1 and OsGS1;2 in the

flag leaves of both the genotypes is shown in the Fig. 2k–n.

Pusa Basma 1 Kalanamak 3119

AMT2;3

Ac n

AMT1;1

AMT3;1

AMT3;2

AMT3;3

GS 1;1

GS 1;2

Nitrogen Doses in Kg/haLanes 1 2 3 4 5 6

Nitrogen Doses in Kg/ha1 2 3 4 5 6

a b

c d

e f

g h

i j

k l

m n

Fig. 2 Expression profiles of high (AMT1;1) and low (AMT2;3,

AMT3;1, AMT3;2, AMT3;3) affinity ammonium transporter genes

and GS genes (GS1;1 and GS1;2) in the flag leaves of PB1 and KN3119

grown under different nitrogen conditions. (For details please see

‘‘Materials and methods’’) Lane 1 control, Lane 2 30 kg/ha, Lane 360 kg/ha, Lane 4 120 kg/ha, Lane 5 150 kg/ha, Lane 6 180 kg/ha

PB1 Flag leaves

C 30 60 120 150 1800

5

10

15

AMT1;1AMT3;1AMT3;2AMT3;3

Nitrogen Dose (in Kg/ha)

Rel

ativ

e E

xpre

ssio

n

KN 3110 Flag leaves

Contol 30 60 120 150 1800

2

4

6

8

AMT1;1AMT3;1AMT3;2AMT3;3

Nitrogen Dose (in Kg/ha)

Rel

ativ

e E

xpre

ssio

n

A BFig. 3 Relative expression

levels of AMT1;1, AMT2;3,

AMT3;1, AMT3;2 and AMT3;3

genes in the flag leaves of a PB1

and b KN3119, grown under

different nitrogen conditions.

(For details please see

‘‘Materials and methods’’)

8040 Mol Biol Rep (2012) 39:8035–8044

123

Both the genes were found to express strongly in the flag

leaves of both the genotypes. In PB1, OsGS1;1 expression

was induced 4.3-folds compared to the control at 60 kg/ha

and reached maximum value of 9.2-fold at 180 kg/ha

(Fig. 4a). In KN3119, GS1;1 expression was strongly

induced (7.78-folds compared to control) at 30 kg/ha

nitrogen dose which further increased to 10.29-folds at

60 kg/ha nitrogen dose. Further increase in nitrogen dose to

120 kg/ha decreased the expression up to 180 kg/ha

(Fig. 4b). The expression of OsGS1;2 was differential with

respect to increase in nitrogen dose. In PB1, OsGS1;2

expression in the flag leaves was strongly induced (15.29-

folds compared to the control) at 120 kg/ha nitrogen dose

which further increased and reached maximum level of

expression (19.25-fold compared to the control) 180 kg/

ha.The expression of OsGS1;2 in the flag leaves of

KN3119 was also induced, but unlike PB1 it was induced

at a much lower nitrogen dose. At 30 kg/ha nitrogen dose

this gene was found to express maximally (10.29-fold

compared to the control) which declined sharply as the

nitrogen dose was increased to 180 kg/ha.

GS activity in the flag leaves of PB1 and KN3119

Enzyme activity of GS was assayed in the flag leaves of

both the genotypes at that stage when approximately 50 %

of the seeds in the panicle were at the milky stage. In PB1

the enzyme activity in the flag leaves increased with

increase in nitrogen dose (Fig. 5). Maximum enzyme

activity of 11.8 U/mg of protein was found at 180 kg/ha

nitrogen dose which is approximately three times detected

in the flag leaves of control plants. In KN3119, the GS

activity in the flag leaves was high at lower nitrogen dose

having reaching maximum activity of 11.6 U/mg of protein

at 30 kg/ha nitrogen dose but declined sharply as the

nitrogen dose was further increased. At 180 kg/ha nitrogen

dose GS activity of only 4 U/mg of proteins was detected

in the flag leaves.

Discussion

In the present investigation, attempts were made to study

the expressions of genes involved in nitrogen uptake and

assimilation under different nitrogen inputs in two rice

genotypes differing in their level of optimum nitrogen

requirement i.e. KN3119 and PB1. The nitrogen require-

ment of these two rice genotypes has been experimentally

determined and reported by Singh et al. [21]. They reported

that KN 3119 is a low nitrogen requiring non basmati

scented rice genotype having optimum nitrogen require-

ment of 30 kg/ha while the optimum nitrogen requirement

of PB1 is 120 kg/ha. They further reported that on increasing

KN 3119 Flag leaves

Control 30 60 120 150 1800

5

10

15GS1;1

GS1;2

Nitrogen Dose (in Kg/ha)

Rel

ativ

e E

xpre

ssio

n

PB1 Flag leaves

Control 30 60 120 150 1800

5

10

15

20

25GS1;1

GS1;2

Nitrogen Dose (in Kg/ha)

Rel

ativ

e E

xpre

ssio

n

A B

Fig. 4 Relative expression levels of GS1;1 and GS1;2 genes in flag leaves of a PB1 and b KN3119, grown under different nitrogen conditions.

(For details please see ‘‘Materials and methods’’)

Control 30 60 120 150 1800

5

10

15 PB1

KN3119

Nitrogen Dose (in Kg/ha)

GS

act

ivit

y u

nit

s/m

g o

f p

rote

ins

Fig. 5 The figure shows the activity of the enzyme GS in the flag

leaves of PB1 and KN3119 grown under different nitrogen doses.

Flag leaves samples were excised at the time when around 50 % of

the developing seeds in the panicle were at the milky stage

Mol Biol Rep (2012) 39:8035–8044 8041

123

the nitrogen dose of KN3119 there was a substantial reduc-

tion in the yield thereby making the genotype fit for organic

farming. To further understand the molecular basis of dif-

ferential responsiveness of these two rice genotypes under

different nitrogen inputs, a pot experiment was conducted.

The results of the experiment clearly showed that increasing

nitrogen dose beyond 30 kg/ha nitrogen dose in KN3119

significantly reduced the yield attributes like, %nitrogen

content in the seeds, 1,000 grain weight and seeds per panicle.

The nitrogen dose of 180 kg/ha was detrimental to such an

extent that there was hardly any seed set. However, other

parameters such as biomass and %nitrogen of the biomass

increased with increase in nitrogen dose. On the other hand in

PB1, all the parameters (%nitrogen content in the seeds,

1,000 grain weight and seeds per panicle and biomass) sig-

nificantly increased with increasing nitrogen dose. This data

suggests the nitrogen responsiveness of the two genotypes as

KN3119 as a low nitrogen requiring genotype and PB1 as a

high nitrogen requiring genotype. However, in KN3119, it

can be seen that although the %nitrogen content in the seed,

seed per panicle and 1,000 grain weight are reduced with

increase in nitrogen dose, the %nitrogen in the biomass was

found to be in the increasing order with increasing nitrogen

dose. Several researchers have reported that nitrogen level in

the soil directly affects the yield parameters [22]. The data in

the present study indicates that KN3119 increasingly uptakes

nitrogen from the soil as the nitrogen dose is increased but is

unable to transfer the stored or accumulated nitrogen from the

source (i.e., leaves) to the developing sink (i.e., developing

seeds in the panicle). However, it is worth mentioning here

that, since increase in the protein content in KN3119 is higher

than PB1, hence it appears that although KN3119 is a low

nitrogen requiring but is nitrogen efficient.

In order to investigate this differential nitrogen mobili-

zation, expression analysis of important genes involved in

nitrogen uptake and assimilation were carried out. Since,

rice uses ammonia as a preferred source of nitrogen, all the

members of rice ammonium transporters genes were

studied from root to the flag leaves. And, in order to study

the regulation of grain filling in the two genotypes, the

expressions of cytosolic GSs were studied. We have pre-

viously shown that most of the OsAMT genes express in the

shoots of both of these rice genotypes [23]. In the present

investigation, it was further found that ammonium trans-

porter genes also express in the flag leaves of both the

genotypes. Interestingly, OsAMT1;1 which has been

characterized as a high affinity ammonium transporter gene

was also found to be expressing in the flag leaves and more

interestingly its expression was also affected by different

doses of nitrogen. However, low affinity OsAMT genes

belonging to OsAMT2 and OsAMT3 were also found to

express in the flag leaves and were also affected by applied

nitrogen conditions. The expressions of these genes in flag

leaves are intriguing because the major functions of

ammonium transporters are in the roots for NH4? uptake.

In the literature till date most of the work on rice AMT

genes has been confined to the roots only therefore it is

unclear in the present study why ammonium transporters

genes express in the uppermost part of the plant. In one

study, Kentro et al. [24] studied the effects of broadcast

urea on ammonia (NH3) exchange between the atmosphere

and rice by investigating the NH3 exchange flux between

rice leaf blades and the atmosphere, xylem sap ammonium

(NH4?) concentration, leaf apoplastic NH4

? concentration

and reported that the xylem sap NH4? concentrations

increased markedly 1 day after nitrogen application, sug-

gesting direct transportation of NH4? from the rice roots to

the above-ground parts. These results indicate the possible

involvement of the ammonium transporters in uptake/

downloading of NH4? from the xylem sap into the leaf

tissues similar to roots for further assimilation through the

cytosolic GS1/GOGAT pathway. In the present study,

OsAMT1;1 was induced in the flag leaves of both the

genotypes under increased nitrogen doses but interestingly

in KN3119 the expression of OsAMT1;1 reached peak at

lower nitrogen condition which was repressed as the

nitrogen dose was increased. Not only in the flag leaves,

using GEO database available at the NCBI, transcripts of

OsAMT1;1 were also detected in the developing seed

suggesting that unlike other AMT genes, the only member

of rice high affinity AMT gene family is highly expressed

throughout the plant and has important functions to carry

out [25]. The high and differential expression of

OsAMT1;1 in the flag leaves is intriguing because the

major functions of OsAMT1;1 ammonium transporter is in

the roots for NH4? uptake. However, in the light of the

above observation and data it is quite probable that the high

affinity OsAMT1;1 present in the flag leaves and further in

the developing seeds, is involved in the transport of NH4?

ions from the source flag leaves or brought from the roots

to the developing sink where ammonium assimilating

enzymes OsGS1;1, OsGS1;2 and the seed specific

OsGS1;3 are present for assimilation of NH4? in the

developing seeds [17, 26]. Parallel study shows a decline in

the expression and activity of cytosolic GS genes, OsGS1;1,

OsGS1;2 and OsAMT1;1 in the flag leaves of KN3119

growing under high nitrogen doses which correlates to the

decline in protein content in the seeds. This clearly indicates

that OsGS1;1, OsGS1;2 and also OsAMT1;1 significantly

contribute to the total protein content of the seed. Many

workers have reported positive coorelation between GS

expression in the flag leaves and grain filling. Sun et al. [27]

reported that GS activity at heading stage was significantly

and positively correlated with total grain number per pani-

cle. Zhu et al. [28] noted that GS activities in flag leaves of

rice varieties with high protein content were higher than

8042 Mol Biol Rep (2012) 39:8035–8044

123

those of the varieties with low protein content. Tang et al.

[29] found that a rice variety Chaofengzao 1 with high yield

and protein content showed high activity of GS in leaves and

grains at the late ripening stage, resulting in improvement in

protein content and grain yield. Since in the present inves-

tigation, the protein content of seeds of both the genotypes

varied with differential nitrogen inputs, the expression pat-

terns of glutelin genes which encodes the rice major seed

storage proteins also must get affected. Indeed, in a separate

study through semi-quantitative RT-PCR we have observed

that as the nitrogen dose is increased beyond normal, one

member of the rice glutelin gene family is down-regulated at

the watery ripe and milky stage of grain filling in KN3119 as

compared to PB1 (unpublished data). Furthermore, since

majority of rice grain content is composed of carbohydrates,

it definitely indicates that high nitrogen condition not only

down regulates nitrogen metabolism but also down regu-

lates carbohydrate metabolism. Probably there appears to be

a genotype specific unique mechanism that senses nitrogen

availability in the developing grains and allocates accumu-

lation of carbon in the form of carbohydrates in the devel-

oping seeds accordingly.

The inherent genetic differences might dictate different

growing parameters at different nitrogen doses, both at

spatial as well as temporal levels. It would be particularly

interesting to further investigate the differential nitrogen

responsiveness of contrasting genotypes in terms of com-

plex regulatory networks involved in nitrogen sensing,

uptake, assimilation and remobilization controlled by some

master regulators like Dof transcription factors. These plant

specific transcription factors are supposed to control the

carbon skeleton synthesis and nitrogen metabolism simul-

taneously and affecting the nitrogen use efficiency.

Acknowledgments The present investigation was a part of the DBT

(Department of Biotechnology), Govt. of India supported JRF pro-

gramme. Financial assistance provided by DBT to Vikram Singh

Gaur and Alok Kumar Gupta is duly acknowledged.

References

1. Camanes G, Cerezo M, Primo-Millo E, Gojon A, Garcıa-AgustınP (2007) Ammonium transport and CitAMT1 expression are

regulated by light and sucrose in Citrus plants. J Exp Bot

58(11):2811–2825

2. Loque0 D, von Wire0n N (2004) Regulatory levels for the trans-

port of ammonium in plant roots. J Exp Bot 55:1293–1305

3. Gazzarrini S, Lejay T, Gojon A, Ninnemann O, Frommer WB,

von Wire0n N (1999) Three functional transporters for constitu-

tive, diurnally regulated, and starvation-induced uptake of

ammonium into Arabidopsis roots. Plant Cell 11:937–947

4. Aslam M, Travis RL, Rains DW, Huffaker RC (1996) Effect of

ammonium on the regulation of nitrate and nitrite transport sys-

tems in roots of intact barley (Hordeum vulgare L.) seedlings.

Planta 200:58–63

5. Ninnemann O, Jauniaux JC, Frommer WB (1994) Identification of a

high-affinity NH4? transporter from plants. EMBO J 13:3464–3471

6. Pearson CJ, Finnegan PM, Schjoerring JK (2002) Regulation of

the high-affinity ammonium transporter (BnAMT1;2) in the

leaves of Brassica napus by nitrogen status. Plant Mol Biol

49:483–490

7. von WireAn N, Gazzarrini S, Gojon A, Frommer WB (2000) The

molecular physiology of ammonium uptake and retrieval. Curr

Opin Plant Biol 3:254–261

8. Lauter FR, Ninnemann O, Bucher M, Riesmeier JW, Frommer

WB (1996) Preferential expression of an ammonium transporter

and of two putative nitrate transporters in root hairs of tomato.

Proc Nat Acad Sci USA 93:8139–8144

9. Wang MY, Glass ADM, Shaff JE, Kochian LV (1994) Ammo-

nium uptake by rice roots. III. Electrophysiology. Plant Physiol

104:899–906

10. Suenaga A, Sonoda MK, Ikeda Y, von Wiren A, Hayakawa N,

Yamaguchi T, Yamaya T (2003) Constitutive expression of a

novel-type ammonium transporter OsAMT2 in rice plants. Plant

Cell Physiol 44(2):206–211

11. Sonoda Y, Ikeda A, Saiki S, von Wiren N, Yamaya T, Yamag-

uchi J (2003) Distinct expression and function of three ammo-

nium transporter genes (OsAMT1;1–1;3) in rice. Plant Cell

Physiol 44(7):726–734

12. Kronzucker HJ, Schjoerring JK, Erner Y, Kirk GJD, Siddiqi MY,

Glass ADM (1998) Dynamic interactions between root NH4?

influx and long-distance N translocation in rice: insights into

feedback processes. Plant Cell Physiol 39:1287–1293

13. Yamaya T, Oaks A (2004) Metabolic regulation of ammonium

uptake and assimilation. In: Amancio S, Stulen I (eds) Nitrogen

acquisition and assimilation in higher plants. Kluwer Academic

Publishers, Dordrecht/Boston/London, pp 35–63

14. Peoples MB, Gifford RM (1993) Long-distance transport of

carbon and nitrogen from sources to sinks in higher plants. In:

Dennis DT, Turpin DH (eds) Plant physiology, biochemistry and

molecular biology. Wiley, New York, pp 434–447

15. Lea PJ (1993) Nitrogen metabolism. In: Lea PJ, Leegood RC

(eds) Plant biochemistry and molecular biology. Wiley, New

York, pp 155–180

16. Kamachi K, Yamaya T, Mae T, Ojima K (1991) A role for

glutamine synthetase in the remobilization of leaf nitrogen during

natural senescence in rice leaves. Plant Physiol 96:411–417

17. Tabuchi M, Sugiyama K, Ishiyama K, Inoue E, Sato T, Takahashi

H, Yamaya T (2005) Severe reduction in growth rate and grain

filling of rice mutants lacking OsGS1;1, a cytosolic glutamine

synthetase1;1. Plant J 42:641–651

18. Livak KJ, Schmitten TD (2001) Analysis of relative gene

expression data using real-time quantitative PCR and the 2(-delta

delta c(T)) method. Methods 25:402–408

19. Subbaiah BV, Asija CL (1956) A rapid procedure for the deter-

mination of available nitrogen in soils. Curr Sci 25:259–262

20. Kumar R, Taware R, Gaur VS, Guru SK, Kumar A (2009)

Influence of nitrogen on the expression of TaDof1 transcription

factor in wheat and its relationship with photosynthetic and

ammonium assimilating efficiency. Mol Biol Rep 36(8):

2209–2220

21. Singh RK, Singh US, Khush GS, Rohilla R (2000) Genetics and

biotechnology quality traits in aromatic rices. In: Singh RK,

Singh US, Khush GS (eds) Aromatic Rices. Oxford & IBH

Publishing Co. Pvt. Ltd., New Delhi, pp 47–69

22. Manzoor Z, Awan TH, Safdar ME, Ali RI, Ashraf MM, Ahmad

M (2006) Effect of nitrogen levels on yield and yield components

of basmati 2000. J Agri Res 44(2):115–122

23. Gaur VS, Singh US, Gupta AK and Kumar A. 2011. Under-

standing the differential nitrogen sensing mechanism in rice

genotypes through expression analysis of high and low affinity

Mol Biol Rep (2012) 39:8035–8044 8043

123

ammonium transporter genes. Accepted in Molecular Biology

Reports. doi: 10.1007/s11033-011-0972-2

24. Kentaro H, Syuntaro H, Satoru I, Isamu N (2008) Ammonia

exchange between rice leaf blades and the atmosphere: effect of

broadcast urea and changes in xylem sap and leaf apoplastic

ammonium concentrations. Soil Sci Plant Nutr 54:807–818

25. Kaiser BN, Rawat SR, Siddiqi MY, Masle J, Glass ADM (2002)

Functional analysis of an Arabidopsis T-DNA ‘Knockout’ of the

high-affnity NH4? transporter AtAMT1;1. Plant Physiol 130:

1263–1275

26. Tabuchi M, Abiko T, Yamaya T (2007) Assimilation of ammo-

nium ions and reutilization of nitrogen in rice (Oryza sativa L.).

J Exp Bot 58(9):2319–2327

27. Sun GR, Zhu P, Liu WF, Xiao YH (1994) Glutamine synthetase

activity and rice heterosis prediction. J Wuhan Bot Res 12(2):

149–153

28. Zhu HM, Rong XM, Liu Q, Peng JW (2001) Differences in

contents of grain protein of different genotype rice varieties.

J Hunan Agric Univ Nat Sci 27(1):13–16

29. Tang XR, Guan CY, Yu TQ (1999) Studies on matter metabolism

of yield and quality of different genotypic rice. J Hunan Agric

Univ 25(4):279–282

8044 Mol Biol Rep (2012) 39:8035–8044

123