1 Faculty of Medicine and Health Sciences Upper airways Research Laboratory Department of Otorhinolaryngology and Head-Neck Surgery Innate and adaptive immunity in upper airway disease: identification of chronic sinusitis subgroups by innate and adaptive mediators of inflammation. Sofie CLAEYS Thesis submitted as partial fulfillment of the requirements for the Degree of PhD in Medical Sciences 2005 Promoters: Prof. Dr. Paul Van Cauwenberge Prof. Dr. Claus Bachert
Transcript
1
�Faculty of Medicine and Health Sciences
Upper airways Research Laboratory Department of Otorhinolaryngology and Head-Neck Surgery
Innate and adaptive immunity
in upper airway disease:
identification of chronic sinusitis subgroups by innate
and adaptive mediators of inflammation.
Sofie CLAEYS
Thesis submitted as partial fulfillment of the requirements for the Degree of PhD in Medical Sciences 2005
Promoters: Prof. Dr. Paul Van Cauwenberge
Prof. Dr. Claus Bachert
2
No part of this work may be reproduced in any form, by print, microfilm, or any other means, without prior written permission of the author. Sofie CLAEYS Upper airways Research Laboratory, Department of Otorhinolaryngology, Ghent University Hospital, De Pintelaan 185, B-9000 Ghent, Belgium, Tel: 0032 9240 2332 Fax: 0032 9240 4993 e-mail: [email protected]
3
Table of contents Acknowledgments
List of publications
List of abbreviations
Summary - Samenvatting - Résumé
5
9
11
13
Chapter I:
Chapter II:
Chapter III:
Chapter IV:
Chapter V:
Chapter VI:
Chapter VII:
Chapter VIII:
Chapter IX:
Chapter X:
Chronic rhinosinusitis: the quest for definitions and disease specification
Introduction to innate immunity
Innate immunity and disease
Aims of the study
Innate immunity in the upper airways
Innate immunity and nasal polyps
Innate and adaptive immunity in cystic fibrosis upper airway disease
Differentiation of nasal polyps in patients with and without cystic fibrosis
A. Characterization of macrophages in nasal polyps from patients with
and without nasal polyps
B. Characterization of chronic rhinosinusitis and nasal polyposis in
patients with and without cystic fibrosis by nasal biomarkers profiles
Discussion
Curriculum vitae
19
25
45
55
59
73
83
91
92
100
115
127
4
5
Acknowledgements
6
Dit werk is opgedragen aan Paul, Morgane en Noémie.
7
Het tot stand komen van een proefschrift is een lange zoektocht, met obstakels, die eindigt in
een bergrit. Bij de start is het punt van aankomst onbekend. Motivatie, inspiratie en de nodige
energie wordt gevonden dankzij hen die je onvoorwaardelijk steunen (Paul, Morgane,
Noémie, ouders, schoonouders en familie). Omdat iemand je steunt, gelooft in je capaciteiten
en een visie heeft over de weg die voor je ligt, durf je de uitdaging aan (Prof. Dr. Paul van
Cauwenberge). Gelukkig is het een ploegsport, met een krachtdadige manager, die zorgt voor
de planning, de navigatie-instrumenten en een kritische duw in de rug bij de moeilijke
beslissingen aan vele kruispunten (Prof. Dr. Claus Bachert). Maar het zijn uiteindelijk je
ploegmaten die er dagdagelijks voor zorgen dat de nodige vooruitgang wordt geboekt en die
door hun positieve inzet, vaardigheden en gevoel voor humor van deze tocht een unieke
ervaring maken (Gaby Holtappels, Tine Debelder, Helen Van Hoecke, Liesbet Vandenbulcke,
Linda Versluys). Bij het zoeken naar nieuwe impulsen, omzeilen van obstakels en
onzekerheden kan je rekenen op medereizigers, die hetzelfde pad bewandelen en met
enthousiasme en vriendschap hun ervaringen delen ( Kristiane Van Lierde, Phillippe Gevaert,
Peter Hellings, Thibaut Van Zele). Onderweg zijn betekent dat je minder aandacht schenkt
aan de uitvalsbasis, wat de werkbelasting voor anderen verhoogd. Gelukkig is het een soliede
basis (Prof. I. Dhooge , Prof. H Vermeersch, Dr. K Bonte, Dr. M Coppens, Dr. JB. Watelet)
waarop je steeds kan steunen. Ervaringen worden leuker als je ze kan delen, het luisterend oor
van velen gaf telkens nieuwe moed (Nathalie L, Mieke B, Tom, Philippe H, Sven, Muriel,
voldoening bij de aankomst wordt bepaald door hen die je opwachten en de vreugde met je
delen (familie, vrienden, kennissen en collega’s) ,waarvoor dank…
8
9
List of publications
• Claeys S, Cuvelier C, Quatacker J, van Cauwenberge P. Ultrastructural investigation of M-
cells and Lymphoepithelial contacts in naso-pharyngeal associated lymphoid tissue (NALT).
Acta Otolaryngol (Stockh), 1996; suppl 523:40-42
• Claeys S, Cuvelier C, van Cauwenberge P. Immunohistochemical analyses of the
lymphoepithelium in human nasopharyngeal associated lymphoid tissue (NALT). Acta
Otolaryngol (Stockh), 1996; suppl 523:38-39
• Vandenbulcke L, Claeys S, Van Cauwenberge P, Bachert C. The innate immune system and
its possible role in allergic disorders. Int Arch Allergyn Immunol. Review, submitted.
� Claeys S, De Belder T, Holtappels G, Gevaert P, Verhasselt B, van Cauwenberge P, Bachert
C. Human β-defensins and toll-like receptors in the upper airway. Allergy, 2003; 58:748-753
� Claeys S, De Belder T, Holtappels G, Gevaert P, Verhasselt B, van Cauwenberge P, Bachert
C. Macrophage mannose receptor in chronic sinus disease. Allergy, 2004 Jun; 59(6): 606-12
• Claeys S, Van Hoecke H, Holtappels G, Gevaert P, De Belder T, Verhasselt B, van
Cauwenberge P, Bachert C. Nasal polyps in patients with and without cystic fibrosis: a
differentiation by innate markers and inflammatory mediators. Clin Exp Allergy, 2005;
35(4):467-72
• Claeys S, Van Hoecke H, Holtappels G, Van Zele T, van Cauwenberge P, Bachert C.
Macrophage typing in nasal polyps from patient with and without cystic fibrosis. Submitted.
• Claeys S, Van Zele T, Gevaert P, Holtappels G, van Cauwenberge P, Bachert C. A paradigm
shift in chronic sinus disease: chronic rhinosinusitis and nasal polyposis can be differentiated
by inflammatory mediators. Submitted.
10
11
List of abbreviations
BALF: bronchial alveolar lavage fluid
BALT: bronchial associated lymphoid tissue
CD: cluster of differentiation
CF: Cystic fibrosis
CF-NP: nasal polyposis in patients with cystic
fibrosis
CFTR: cystic fibrosis transmembrane
conductance regulator
CO: control group
CpG motifs: cytosine phosphate guanine motifs
CR : cysteine rich domain
CRDs : C-type lectin carbohydrate recognition
domains
CRS: chronic rhinosinusitis
ECP: eosinophil cationic protein
FAE: follicle associated lymphoid tissue
FNII: fibronectin type II domain
GPI-linked: glycosylphosphatidylinositol- linked
HBD: human beta defensin
ICAM: intercellular adhesion molecule
IFN-γ: interferon gamma
Ig: immunoglobulin
IL: interleukin
LPS: lipopolysaccharide
LRR: leucine-rich repeat
LT: leukotrienes
MALT: mucosal associated lymphoid tissue
MAPK: mitogen-activated protein kinase
MHC: major histocompatibility complex
M-cells: membranous or microfold cells
MMR: macrophage mannose receptor
MPO: myeloperoxidase
NALT: nasal associated lymphoid tissue
NFκB: nuclear transcription factor κB
NOD: nucleotide oligomerigation domain
NP: nasal polyposis
PAMP: pathogen associated molecular pattern
PBGD: porphobilinogen deaminase
PCD : primary ciliary dyskinesia
PGN: peptoglycan
PMN: polymorphonuclear cells
PP: Peyer’s patches
PPR: pathogen recognizing receptor
RT-PCR: reverse transcriptase polymerase chain
reaction
SLPI: secretory leukoprotease inhibitor
STAT: signal transducers and activators of
transcription
TGF-β1: transforming growth factor-beta 1
Th: T helper cell
TIR domain: toll interleukin-1 receptor domain
TLR: Toll-like receptor
TNF-α: tumor necrosis factor-alpha
VAS: visual analogue scale
12
13
Summary Innate and adaptive immune defense mechanisms collaborate to protect the delicate mucosal lining of
nose and sinuses. Failure and dysregulation of inflammatory mechanisms however occur frequently in
the upper airways, leading to symptoms of chronic rhinosinusitis in 15 % of the general population.
Especially in upper airway inflammation in cystic fibrosis patients and in patients with nasal polyps,
exaggerated inflammation can lead to visible tissue deformation often resistant to medical therapy and
recurrent after surgical intervention.
Better insight in the pathophysiological background of chronic upper airway inflammation and the
identification of different disease entities in the heterogeneous group of chronic sinus disease are
crucial for the development of a more specific therapeutical approach.
The expression of innate immunity mediators was determined in upper airway inflammation to assess
the possible role of innate defence in different disease states. Furthermore we investigated adaptive
immune mediators in order to obtain a total inflammatory mediator profile. This gives the opportunity
to identify upper airway respiratory disorders as separate disease entities.
In this work we were the first to evaluate expression of human beta defensins and toll like receptors in
upper airway tissue in different disease states. Especially in tonsils, known to be highly exposed to a
the large variety of microbes, the presence of inducible defensins (HBD2 and HBD3) is pronounced.
The overall expression of TLR in upper airway tissue indicates the role of TLR as important immune
sensors of the upper airway.
In nasal polyps (NP) we discovered a significant up regulation of an innate pathogen recognizing
receptor: macrophage mannose receptor (MMR). This up regulation was absent in chronic
rhinosinusitis patients without nasal polyp formation (CRS) and in nasal polyps from patients with
cystic fibrosis (CF-NP). In the latter we found another PPR to be up regulated: CD14, which is
possibly an indicator of disease activity and at least partly explains the increased pro-inflammatory
responses that are seen in cystic fibrosis airway disease. The ligand-receptor interaction by these
macrophage receptors may be important in influencing the further progression of the inflammation.
We established a phenotypic heterogeneity of macrophages in different upper airway inflammatory
conditions (CRS, CF-NP, NP) which indicates a role for the phagocytotic and inflammatory signaling
capacity of macrophages during the early phase of inflammation.
To support a better classification of chronic sinus disease we extended our findings to adaptive
inflammatory mediators. We identified a “cytokine profile” for each selected disease entity (CRS, NP,
CF-NP and controls CO) and determined values for critical markers which are able to predict disease
diagnosis. We show for the first time that CRS is characterized by a Th1 response, with IFN-γ as
distinctive marker and with T-regulatory and fibrogenic potential indicated by increased TGF-β1. NP
have been confirmed to demonstrate a TH2 cytokine pattern (IL-5), inducing abundant eosinophils and
14
IgE formation, but lacking an adequate regulatory T-cell activity. Comparing NP with CRS subjects
demonstrated that NP can be differentiated from CRS using markers of eosinophilic inflammation (IL-
5, ECP and eotaxin), as well as IgE and CRS can be differentiated from NP using IFN-�, TGF-�, IL1-
� and TNF-� as markers. We could also differentiate CF-NP from NP by ECP, IL-5, IgE, IL1-�, MPO
and IL-8. With these results we show that chronic rhinosinusitis represents different disease entities
with specific cytokine and mediator profiles, which enable the differentiation of upper airway diseases
based on pathomechanisms.
Our findings support the need for the introduction of new disease definitions which will have a
substantial impact on the conduction of better focused epidemiological, clinical and
immunopathological studies in chronic rhinosinusitis.
15
Samenvatting
De “aangeboren”, zogenaamde “innate” immuniteit beschermt samen met de “adaptieve” immuniteit
het delicate slijmvlies van neus en sinussen. Het onvoldoende of niet functioneren van deze
verdedigingsmechanismen kan inflammatie induceren, welke bij 15 % van de bevolking in de
bovenste luchtwegen leidt tot het ontstaan van chronische rhinosinusitis (CRS). In patiënten met
mucoviscidose en in patiënten met neuspoliepen (NP) zal een sterke lokale inflammatie van de
bovenste luchtwegen leiden tot zichtbare weefseldeformatie. Wegens het wisselende resultaat na
medicamenteuze behandeling en het groot aantal recidieven na chirurgisch ingrijpen bij de
behandeling van neuspoliepen, zowel bij patiënten met (CF-NP) als zonder mucoviscidose, is het
noodzakelijk om betere inzichten te verwerven betreffende de fysiopathologie van deze aandoeningen.
Vooral de identificatie van verschillende subgroepen binnen de chronische sinusitis patiëntengroep is
hierbij cruciaal.
Voor identificatie van de “innate” verdedigingsmechanismen in de bovenste luchtwegen zijn we
gestart met het meten van innate mediatoren in de verschillende patiëntengroepen. Het inflammatoire
profiel werd vervolgens aangevuld met adaptieve parameters.
Naast de identificatie van anti-microbiële peptiden (human beta defensins) en Toll-like receptoren ter
hoogte van verschillende lokalisaties in de bovenste luchtwegen, beschreven we als eerste de
aanwezigheid van een unieke innate merker in NP, namelijk de macrofagen mannose receptor (MMR).
We detecteren voor het eerst accumulatie van MMR positieve macrofagen in NP in associatie met IgE
positieve plasmacellen zonder de aanwezigheid van andere antigen presenterende cellen (dendritische
cellen) of B-cellen. De mogelijke rol van MMR-ligand binding in de pathogenese van NP was de
aanzet tot verder onderzoek naar macrofagen en hun innate receptoren in chronische inflammatie van
de sinussen. In CF-NP was een andere innate macrofagen receptor dominant: CD14. Vooral jonge,
recent gerekruteerde macrofagen dragen deze receptor en CD14 positieve macrofagen zijn
vermoedelijk parameters van ziekteactiviteit en verhoogde gevoeligheid voor microbiële stimulatie.
Uiteindelijk detecteren we een belangrijke heterogeniteit van macrofagenpopulaties in de
verschillende subgroepen van chronische rhinosinusitis patiënten.
Om deze subgroepen (CRS, NP, CF-NP) verder te definiëren, maken we gebruik van adaptieve
inflammatoire mediatoren, voornamelijk cytokines. We tonen aan dat CRS gekenmerkt wordt door een
T1 helpercel (Th1) gemedieerde inflammatie (IFN-γ) met T regulatoire controle (TGF-β), terwijl NP
gekenmerkt wordt door een Th2 gemedieerde inflammatie (IL-5) met vermoedelijk een inadequate T
regulatoire controle en een belangrijke eosinophilie (eotaxin, ECP) met verhoogd IgE. CF-NP is
eerder gekenmerkt door een neutrofiele inflammatie (IL-1β, MPO, IL-8). Voor alle mediatoren werden
kritische waarden berekend om kwantitatief de verschillende subgroepen te onderscheiden.
16
Onze bevindingen tonen aan dat in de overkoepelende groep van chronische rhinosinusitis patiënten
verschillende subgroepen kunnen gedifferentieerd worden op basis van fysiopathologische parameters.
Hierdoor wordt het duidelijk dat voor epidemiologische, klinische en diagnostische studies nieuwe
ziektecriteria vereist zijn om tot een meer gerichte therapeutische benadering te komen.
17
Résumé
Les mécanismes de défense immune innée et adaptative contribuent à la protection des surfaces
délicates du nez et des sinus. L’échec et la disrégulation des mécanismes inflammatoires sont
fréquents au niveau des voies respiratoires supérieures, entrainant dans environ 15% de la population
générale une symptomatologie de rhinosinusite chronique.
Particulièrement dans l’inflammation des voies respiratoires supérieures chez les patients atteints de
mucovisidose et chez les patients avec des polypes naso-sinusiens, une inflammation exagérée
résulte en une déformation visible des tissus, souvent résistante au traitement médical et récurrente
après intervention chirurgicale.
Une meilleure vision des bases physiopathologiques de l’inflammation chronique des voies
respiratoires supérieures et l’identification des paramètres par lesquels les entités pathologiques
peuvent être caractérisées chez un grand nombre de patients avec sinusite chronique sont cruciales
pour le développement d’approches thérapeutiques plus spécifiques.
L’expression des médiateurs de l’immunité innée ont été déterminés dans les voies aériennes
supérieures pour évaluer le rôle possible joué par l’immunité innée dans ces différentes conditions
pathologiques. De plus, nous avons investigé les médiateurs de l’immunité adaptative afin d’obtenir
un profil total des médiateurs inflammatoires. Ceci nous donne l’opportunité d’identifier les
maladies des voies aériennes supérieures comme des entités pathologiques différentes.
Dans ce travail, nous avons été les premiers à évaluer l’expression des β-defensins humaines et les
toll-like receptors (TLR) dans les tissus des voies respiratoires supérireures dans différentes
situtations pathologiques. Specifiquement dans les amygdales, probablement à cause d’une grande
variété de pathogènes dans les cryptes, la présence des defensins inductibles (HBD2 et HBD3) est
marquée. L’expression généralisée des TLR dans le tissu des voies respiratoires supérieures indique
un rôle essentiel de type ‘détecteur’ dans les voies respiratoires supérieures.
Dans les polypes naso-sinusiens (PNS), nous avons découvert une augmentation significative de
l’expression d’un certain récepteur inné de reconnaissance de pathogènes: le macrophage mannose
receptor (MMR).
Nous n’avons pas trouvé la même augmentation chez les patients atteints de sinusite chronique (SC)
sans formation polypeuse ou dans les polypes naso-sinusiens chez les patients atteints de
mucovisidose (PNS-M). Dans les polypeux mucoviscidosiques, un autre récepteur inné est
augmenté: CD14, traduisant probablement un signe d’activité de maladie et expliquant, en tout cas
partiellement, la réponse inflammatoire rhinosinusienne exagérée visible chez les patients avec
mucovisidose.
18
L’interaction entre ligand et récepteur sur les macrophages est probablement importante pour guider
l’évolution de l’inflammation.
Nous avons découvert une hétérogéïnité phénotypique parmi les populations de macrophages
investigés dans les différentes situations de la maladie sinusienne (SC, PNS, PNS-M) ce qui indique
un rôle pour les capacités de signal de phagocytose et d’inflammation dans la phase précoce de
celle-ci.
Pour contribuer à une meilleure classification des rhinosinusites chroniques, nous avons étendu nos
recherches sur les médiateurs inflammatoires de l’immunité adaptive. Nous avons identifié un profil
cytokinique pour chaque maladie (SC, PNS, PNS-M et muqueuse normale) et determiné les valeurs
critiques pour prédire le diagnostic de la maladie.
Nous avons montré pour la première fois que la SC est caracterisée par une réponse Th1, avec l’IFN-
γ comme facteur distinct et un potentiel fibrogénique indiqué par une augmentation de TGF-β1.
Nous avons confirmé que la formation des polypes naso-sinusiens est caracterisée par un profil
cytokinique Th2 (Il-5) influençant une inflammation dominée par les éosinophiles et une formation
d’IgE mais manquant d’une activité régulatoire adéquate par les Treg. Comparant les PNS aux SC,
nous avons démontré que es PNS peuvent être différentiés des SC en utilisant des marqueurs de
l’inflammation éosinophilique (IL-5, ECP et éotaxine) et IgE, tandis que la SC se distingue des PNS
en utilisant l’IFN-�, TGF-�, IL1-� et TNF-� . Nous pouvions également différentier la PNS-M de la
PNS par ECP, IL-5, IgE, IL1-�, MPO et IL-8. Sur base de ces résultats, nous démontrons que la SC
représente différentes entités pathologiques avec un profil spécifique de cytokines et de médiateurs,
qui permet la différentiation des maladies des voies respiratoires supérieures basée sur les
pathomécanismes.
Nos découvertes soutiennent la nécessité d’introduire de nouvelles définitions qui auront un impact
substantiel sur la conduite de recherches épidemiologiques, cliniques et immunologiques mieux
focalisées.
Chapter I __________________________________________________________________________
19
Chapter I
Chronic rhinosinusitis:
the quest for definition
and disease specification
“ The cause is hidden. The effect is visible to all.”
Ovid (43BC – 17 AD), Roman poet.
Chapter I __________________________________________________________________________
20
Chronic rhinosinustis: current approach.
Chronic rhinosinusitis (CRS) is one of the most common health care problems and is increasing in
prevalence. The incidence of CRS has been estimated to affect approximately 31 million patients in
the United States and in a country like Germany acute and chronic sinusitis were diagnosed
respectively 6.3 and 2.6 million times over the course of one year. Epidemiological data on CRS are
however scarce, which can be explained by the heterogeneity of the disorder and ill defined
diagnostic criteria used in publications.
Chronic rhinosinusitis (CRS) is defined as a group of disorders characterized by inflammation of the
nose and paranasal sinuses. The diagnosis is based upon symptoms and clinical findings with
disregard of pathomechanisms. The assessment of CRS with or without nasal polyps is currently
only descriptive and it is not understood whether CRS is preceded by acute recurrent rhinosinusitis,
whether nasal polyps develop from CRS or if these disease states develop independently from each
other.
Epidemiologists and clinical researchers need a better definition and classification of chronic upper
airway diseases, not only to evaluate the impact of CRS on general health and health care costs but
also to be able to enhance evidence based diagnosis and treatment. Recently, position papers on CRS
were set to asses better diagnosis and treatment of rhinosinusitis with and without nasal polyps (1,2).
The current clinical definition of CRS is based on symptoms, duration and severity of the disease,
ENT examination, endoscopy and CT findings (Table 1). For research purposes, additional patients’
conditions, co-morbidities (Table 2), and prior surgery (Table 3) are also taken into account. But
none of these definitions implicate insight in the pathophysiological mechanisms.
In addition to the importance of ostiomeatal complex obstruction other causative factors for CRS
have been identified (Table 4), indicating that CRS with or without nasal polyps is momentarily
approached as an multifactorial condition.
Chapter I __________________________________________________________________________
21
Table 1: Clinical definition
Severity of the disease
The disease can be divided into MILD and MODERATE/SEVERE based on total severity visual analogue scale (VAS) score (0-10 cm):
MILD = VAS 0-4 MODERATE/SEVERE = VAS 5-10
Clinical definition of rhinosinusitis/nasal polyps
Rhinosinusitis (including nasal polyps) is defined as: • Inflammation of the nose and the paranasal sinuses characterised by two or more symptoms: - Blockage/congestion - Discharge: anterior/post nasal drip - Facial pain/pressure, - Reduction or loss of smell; • Endoscopic signs: - Polyps - Mucopurulent discharge from middle meatus - Oedema/mucosal obstruction primarily in middle meatus • CT changes: Mucosal changes within ostiomeatal complex and/or sinuses.
Duration of the disease
Acute/Intermittent < 12 weeks Complete resolution of symptoms. Chronic/Persistent >12 weeks symptoms No complete resolution of symptoms.
Table 2: Conclusion for sub-analysis and exclusion from general purposes Conditions for sub-analysis
The following conditions should be considered for sub-analysis: 1. aspirin sensitivity based on positive oral, bronchial or nasal provocation or an obvious history; 2. asthma/bronchial hyper-reactivity /COPD based on symptoms, respiratory function tests; 3. allergy based on specific serum IgE or skin prick tests; 4. finding of purulent discharge/pus.
Exclusion from general studies
Patients with the following diseases should be excluded from general studies on chronic rhinosinusitis and/or nasal polyposis: 1. cystic fibrosis based on positive sweat test or DNA alleles; 2. gross immunodeficiency (congenital or acquired); 3. congenital mucociliary problems eg primary ciliary dyskinesia (PCD); 4. non-invasive fungal balls and invasive fungal disease; 5. systemic vasculitic and granulomateus diseases.
Table 3: Definition for research
Definitions when no earlier sinus surgery has been performed Polyposis : bilateral, endoscopically visualised in middle meatus Chronic rhinosinusitis : bilateral, no visible polyps in middle meatus, if necessary following decongestant This definition accepts that there is a spectrum of disease in CRS which includes polypoid change in the sinuses and/or middle meatus but excludes those with polypoid disease only presenting in the nasal cavity to avoid overlap.
Definitions when sinus surgery has been performed: Once surgery has altered the anatomy of the lateral wall, the presence of polyps is defined as pedunculated lesions as opposed to cobblestoned mucosa > 6 months after surgery on endoscopic examination. Any mucosal disease without overt polyps should be regarded as CRS.
Chapter I __________________________________________________________________________
22
Table 4: Causitive factors in CRS
1. persistent infection; 2. allergy and other disorders of immunity; 3. intrinsic factors of the upper airway; 4. superantigens from Staphylococcus aureus in CRS with nasal polyps; 5. colonizing fungi that induce and sustain eosinophilic inflammation; 6. metabolic disturbances, such as aspirin sensitivity.
Table 1, 2, 3 and 4 are taken from the European Position Paper on Rhinosinusitis and Nasal Polyps.
Fokkens W, Lund V, Bachert C, Clement P, Hellings P et al. Allergy, 2005; 60(5):583-601.
Nasal polyposis: current approach.
Nasal polyps (NP) and CRS are often approached as one disease entity but a the strong tendency of
recurrent nasal polyp formation after medical treatment and surgery may reflect a distinct condition
of the mucosa in NP patients. Studies which have tried to differentiate nasal polyps from chronic
rhinosinusitis base on inflammatory mediators so far only pointed towards a spectrum of
inflammatory disease, rather than distinct disease entities.
The enigma of NP formation is of particular interest for clinicians and researchers. With a
prevalence of 4% in the general population (3), and of 15% in asthmatics (4,5) and because of the
repeated need for medical and surgical treatment, NP has an important impact on health care.
Moreover in cystic fibrosis patients, nasal polyps (CFNP) occur in more then 30% of the patients (6),
which represents an important co-morbidity to an already challenged population of young patients .
Nasal polyposis in the general population is a chronic inflammatory condition, mostly characterised
by local infiltration of eosinophils linked to tissue markers of eosinophilic survival and
differentiation (IL-5) and eosinophilic activation (ECP, eotaxin) (7). Nasal polyposis is often linked
to severe, difficult to treat, aspirin-sensitive asthma (8) and superantigens (entertoxins),
predominantly derived from Staphylococcus aureus, seems to have a role in modulating the severity
of upper and lower airway disease (9). Superantigens are potent activators of T-cells, induce the
synthesis of IgE in B-cells, and have direct effects on pro-inflammatory cells, such as eosinophils.
IgE antibodies to S. aureus enterotoxins have been described in polyp tissue, linked to a local
polyclonal IgE production and an aggravation of eosinophilic inflammation (10). This presence of
specific IgE to staphylococcal enterotoxins A and B points to a possible role of bacterial
superantigens in the pathophysiology of nasal polyposis.
The question remains however why only in some rhinosinusitis patients (with or without cystic
fibrosis) “ballooning” of the mucosa occurs and whether and how we can differentiate nasal
polyposis from chronic rhinosinusitis.
Chapter I __________________________________________________________________________
23
Nasal polyposis in cystic fibrosis
In cystic fibrosis patients more then 90% of the patients develop chronic rhinosinusitis (11). The
management of chronic rhinosinusitis in CF patients remains a challenge because of the poor
response to standard medical therapies. Rhinologic characteristics for sinus disease in CF patients
involve extended nasal polyposis, dilated base of the nose, frontal and maxillary sinus hypoplasia,
and medialization of the lateral nasal wall. Studies indicate a frequency of nasal polyp formation
ranging from 32 to 89% (12, 13) with a higher prevalence when patients were examined with an
endoscopic technique.
The respiratory mucosal surface of CF patients shows changes that undoubtedly contribute to an
ideal environment for microbial growth and consecutive chronic sinus inflammation. Dysfunction of
the cystic fibrosis transmembrane conductance regulator (CFTR) protein which acts as a chloride
channel, causes changes in the mucous composition with the production of thick viscous secretions,
impaired mucociliary clearance and microbial colonization. (14,15)
However, no evidence has been produced so far that links nasal polyp formation in CF patients to a
specific genetic mutation or to a CF-specific sinonasal pathogen (S. aureus, H. influenzae, Ps.
aeruginosa).
The inflammatory pattern in chronic sinusitis in CF patients is similar to that seen in the lower
airway of these patients: infiltrates of neutrophils and macrophages in the presence of MPO and IL-8 (16) and no differences have been found in inflammatory mediators between CF patients with or
without nasal polyposis. The different inflammatory pattern seen in diseased sinus specimens of
patients with CF compared to chronic rhinosinusitis patients without cystic fibrosis may explain the
relatively poor response to nasal steroids in CF patient group. To elucidate pathomechanisms of
nasal polyp formation both in non-cystic fibrosis and cystic fibrosis patients, comparative studies on
inflammatory characteristics between both groups will be necessary.
Tools for disease specification:
In this work we wanted to identify new tools for better identification of inflammatory processes in
upper airway disease. The relatively recent introduction of innate immunity has brought new insights
in immune regulation and immunomodulation by environmental factors (microbial triggering). We
started the work with measurements on innate immunity mediators in upper airway inflammation to
assess the possible role of innate defense in different disease states. When innate receptor expression
could be linked to a clinical diagnosis we further investigated adaptive immune mediators in order to
obtain a total inflammatory mediator profile by which we can identify upper airway respiratory
disorders as separate disease entities.
Innate and adaptive immune defence mechanisms collaborate to avoid penetration of potential
harmful foreign material in the human organism. The inflammatory reaction of the host determines
Chapter I __________________________________________________________________________
24
whether sinusitis will occur and whether it will progress to a chronic state of sinus inflammation. A
better insight in innate and adaptive inflammatory responses is necessary to differentiate disease
entities within the “umbrella” of chronic rhinosinusitis. This will lead to a more adjusted
therapeutical approach with a probable reduced disease recurrence and less necessity for surgical
(re)intervention.
References (1) Fokkens W, Lund V, Bachert C, Clement P, Hellings P et al. EAACI, European position paper on
for clinical research and patient care. J Allergy Clin Immunol. 2004 Dec; 114(6 Suppl):155-212 (3) Hedman J, Kaprio J, Poussa T, Nieminen MM. Prevalence of asthma asperin intolerance, nasal polyposis
and chronic obstructive pulmonary disease in a population-based study. Int J Epidmiol 1999; 28(4):717-22 (4) Larsen K. The clinical relationship of nasal polyps to asthma. Allergy Asthma Proc 1996; 17(5):243-9 (5) Settipane GA, Chafee FH. Nasal Polpys in asthma and rhinitis. A review of 6,037 patients. J Allergy Clin
Immunolog 1977; 59(1):17-21 (6) Schramm VL, Jr., Effron MZ. Nasal polyps in children. Laryngoscope 1980; 90 (9):1488-1495 (7) Bachert C, Gevaert P, Cuvelier C, van Cauwenberge P. Nasal polyps: from cytokines to growth. Am J
Rhinol 2000; 14(5):279-90 (8) Settipane GA: Epidemiology of nasal polpys, Allergy Asthma Proc. 1996 Sep-Oct; 17(5):231-6 (9) Bachert C, Gevaert P, Howarth P, Holtappels G, van Cauwenberge P, Johansson SG. IgE to
Staphylococcus aureus enterotoxins in serum is related to severity of asthma. J Allergy Clin Immunol 2003 May; 111(5):1131-2
(10) Bachert C, Gevaert P, Holtappels G, Johansson SG, van Cauwenberge P. Total and specific IgE in nasal
polyps is related to local eosinophilic inflammation. J Allergy Clin Immunol 2001 Apr; 107(4):607-14
(11) Ramsey B, Richardson MA. Impact of sinusitis in cystic fibrosis. J Allergy Clin Immunolog 1992; 90(3,
pt2):547-552 (12) Henriksson G, Westrin KM, Karpati F et al. Nasal polyps in Cystic fibrosis: a clinical endoscopy study
with nasal lavage fluid analysis. Chest 2002; 121:40-47 (13) Endoscopic and CT-scan evaluation of cystic fibrosis patients. Rhinology 1995; 33:36-40 (14) Smith JJ, Travis SM, Greenberg EP, and Welsh MJ: Cystic fibrosis airway epithelia failed to kill bacteria
because of abnormal airway surface fluid. Cell 1996; 85:229-236.
(15) Knowles MR, Robinson JM, Wood RE, Pue CA, Boucher RC. Ion Composition of Airway Surface Liquid of Patients with Cystic Fibrosis as Compared with Normal and Disease -control Subjects. J. Clin. Invest., Volume 100, Number 10, November 1997, 2588-2595
(16) Sobol SE, Christodoulopoulos P, Manoukain JJ et al. Cytokine profile of chronic sinusitis in patients with
cystic fibrosis. Arch Otolaryngol Head Neck Surg 2002; 128 :1295-1298
Chapter II __________________________________________________________________________
25
Chapter II
Introduction to innate immunity
“When we thought that we had all the answers,
suddenly all the questions changed.”
Mario Benedetti (1920), Uruguayan writer.
Chapter II __________________________________________________________________________
26
Chapter II __________________________________________________________________________
27
Introduction
The origin of immunology research is relatively recent and has been attributed to the discovery of
the protective effect of vaccinia against the fatal disease, human smallpox (Edward Jenner, 1796).
During centuries before that time, human disease was approached as an attack of “higher powers”
against the human body and the final outcome of the disease, recovery or often dead, was
determined by the fate attribute to each patient.
Late in the 19th century, it was for the first time recognized that microorganisms are the cause of
infectious diseases (Robert Koch).
The therapeutic strategies, pursued during the first decades of immunology and microbiology
research, are illustrated in the work of Louis Pasteur. In the 1880s he developed a rabies vaccine
which he successfully used in a first human trial on a boy bitten by a rabid dog. Before that time he
introduced changes in hospital practices to control the spread of disease by microbes and he
developed “pasteurisation” in order to protect food and surgical instruments from contagion. He
confirmed that each disease is caused by a specific microbe and that these microbes are foreign
elements.
The attempt for eradication of microbes and for manipulation of the human defence strategies
against pathogens have lead to the development of the two most widely used therapeutics in medical
history: antibiotics and vaccines.
But failure of these therapeutic devices has confronted us with two important challenges of modern
medicine: resistance to antibiotics and AIDS.
Although huge steps have been made in microbiology and immunology research during the last
decades of the twentieth century a different approach was needed to better understand the failure of
human defence against foreign microorganical attacks. The opposite position between pathogen and
human organisms has been changed by the introduction of innate immunity. Due to continuous
environmental pressure and natural selection, multiorganical species have learned to evolve in a
dominant microbial surrounding. It was Alexander Fleming who illustrated for the first time in 1922
that human secretions (nasal secretions of a patient with common cold) were perfectly capable,
without chemical adjuvant, to “dissolve certain bacteria” (ref: Fleming, A. 1922. On a remarkable
bacteriolytic element found in tissues and secretions Proc.R. Soc. Lond. B. Biol. Sci. 93,306-317).
This illustrates the activity of an effective (surface) defense without the onset of disease.
Unfortunately is took until the 1990s, due to improved technology to characterize proteins and their
genes, that natural innate first line defense mechanism were further explored. It soon became clear
that microbial agents and human innate defense work together to maintain an homeostasis viable to
all species and that microbial-human interactions are not always counteractive. The enormous
proliferation of studies on immune regulation in the last decade, have revealed a partnership between
microbial organisms and innate immune defense to obtain a protective immune status at all time.
Chapter II __________________________________________________________________________
28
Because of the complete dependence of adaptive immunity on information delivered by the innate
immune system it is in fact opportune to approach innate immunity as “decision maker” on the
disease status of human organism.
The large surface of the upper airway, an interface with the bacterial environment and easy
reachable for biopsies, is the ideal locus for innate immunity investigations.
1. Surface protection.
Multi-cellular organisms have been driven to develop defense mechanisms in order to survive, grow
and multiply in a environment dominated by unicellular life forms. Surface protection in primitive
species is essential for their survival and procreation, and because of the short duration of their life
cycles this defense needs to be fast, always in stand-by and able to recognize a wide diversity of
pathogens. Eukaryotic ancestors developed the innate immune system, next to the coagulation
system, which is a mechanism evolved to limit the loss of vital elements from the internal milieu
following mechanical injury. Through fast and selective detection and clearance of microbial
invaders, innate immunity mechanisms protect the integument of multi-cellular organisms. Only
recent developments in molecular genetics made it possible to detect these mechanisms by which
small species (e.g. insects) sense infection, discriminate between various classes of microorganisms
and produce effector molecules, among which antimicrobial peptides are the best known. The
unexpected discovery that most of the genes involved in the Drosophila host defense are
homologous or very similar to genes implicated in mammalian innate immune defenses, accelerated
recent progress in research of mammalian innate immunity. (1)
2. New approach of mucosal immunity: history of thinking
Although human skin and mucosal linings are continuously exposed to microbes, these microbes
rarely induce disease. Because the first line defense by skin and mucosa beholds more than a
mechanical barrier of specialized epithelial cells, an important interest has grown to better
understand the complex interplay between microbes and host surfaces.
Despite an intensive interaction between host and pathogen, surface homeostasis is maintained and
innate immunity has a crucial role in this process. The innate immune response is a complex
multilayered system of mechanical and secreted defenses that consists firstly of effector molecules
with antimicrobial and inflammatory signaling functions and secondly of rapidly recruited cellular
defenses. Surprisingly innate immunity is rather a new concept in immunology.
Chapter II __________________________________________________________________________
29
At the turn of the twentieth century immunologists already approached immunity from two sides:
humoral defense, mediated by soluble substances and responsible for adaptive immunity, or cellular
defense through phagocytosis mediating innate immune response.
Throughout the twentieth century, because of the identification of lymphocytes and the discovery of
how antibody and T-cell receptor diversity were generated, the interest for innate immune defense
was pushed to the background.
Innate immunity was described as an unspecific primitive response delivering enough protection
during infection until the sophisticated adaptive mechanisms were ready to act.
The exploration of the role of mucosal (and skin) surfaces in immune defense has touched, during
several decades, different areas of expertise.
In the 1970s, the epithelium was viewed primarily as an independent entity, providing a mechanical,
chemical and microbiological barrier to infection (Table 1), and in that way protector of the integrity
of the organisms. Morphological studies focused on structural characteristics of the epithelial layer
using histological and ultrastructural investigative techniques. (2) Advancement in biochemical
research made it possible to better understand epithelial differentiation (3) and re-epithelialization
during woundhealing.(4)
Table 1: Intrinsic epithelial barriers to infection
Mechanical Epithelial cells joined by tight junctions Longitudinal flow of air or fluid across epithelium Movement of mucus by cilia
Toll-like receptors are PRRs that have been conserved from insects to humans and have a unique
and important role in signalling the presence of infection. A human homologue of the Toll gene,
originally identified in Drosophila and required for dorsoventral axis formation and antifungal
immunity (17), projected the mechanisms of PAMP recognition by toll-like receptors to mammals (18).
The structure of TLR explains their important role in pathogen detection and signal transduction (Fig
2). TLRs are transmembrane receptors with an extracellular leucine-rich repeat (LRR) domain and
an intracellular Toll domain: interleukin IL-1 receptor (TIR) domain. The LRR mediates ligand-
binding specificity, while the TIR domain is responsible for initiating signalling pathways through
protein-protein interactions. In general ligand-TLR binding induces a downstream nuclear
transcription factor κB (NFκB) activation with the ultimate upregulation of different sets of genes
that regulate inflammatory responses. To date, 10 TLRs have been identified in mammals, each with
different binding affinity for a diverse array of PAMP (bacteria, viruses, protozoa, fungi). Probably
due to redundancy in TLR recognition and overlap of ligand affinity (Fig 3) it is difficult to assess an
unique functional role for each TLR in animal disease models. Multiple TLR knockout mice models
failed to find a susceptibility to infection.
TLR are expressed on epithelial cells, endothelial cells, muscle cells and antigen presenting cells
(macrophages and dendritic cells) by which they control the activation pathogen specific T-cell
effector responses through the release of cytokines and the expression of co-stimulatory molecules
(e.g. CD80 and CD86 on dendritic cells). The recently acknowledged possibility that regulatory T-
cells themselves express TLRs illustrates the significant role of innate PRR’s in T-cell regulation.
Whether a direct TLR-mediated activation by bacterial pathogens occurs in human T-cells remains
to be proven.
The interaction of TLR and PAMP is influenced by co-receptors (CD14, MyD88) and the signalling
pathway depends on additional signalling molecules.
Recent insights on the downstream signalling components have shown pathway specificity
mediated by different TLR (19,20) and explain TLR mediated (self)regulation. (21,22) So the immune
Chapter II __________________________________________________________________________
34
response initiated by TLR-ligand interaction is specific, well regulated and submitted to inhibitory
feedback.
To eventually explain the different innate immune responses and their effect on adaptive immune
mechanisms, the distribution of individual TLR on the cell surface, the molecular basis of TLR
signal transduction and the exploration of individual TLR gene regulation need to be explored in
further studies.
Fig 2a Fig 2b
TLR IRAK-1 IRAK-4 IRAK-M MyD88 TRAF6
Toll-like receptor Interleukin 1 receptor-associated protein kinase 1 Interleukin 1 receptor-associated protein kinase 4 Interleukin 1 receptor-associated protein kinase M: negative regulation of inflammatory signaling adapter molecule tumor neciosis factor receptor-associated factor 6
PGN LPS P. gingivalis L. interogans CpG DNA bLP MALP-2 Taxol dsRNA F protein Hsp60 GPI-linked proteins T. bruceii
peptoglycan lipopolysaccharide Porphyromonas gingivalis Leptospira interogans unmethylated bacterial deoxy-cytidylate-phosphate-deoxygranylate-DNA bacterial lipopeptide mycoplasma-associated lipoprotein-2 plant diterpene structurally unrelated to LPS but possessing potent LPS-mimeric activities double-stranded RNA fusion protein (major viral surface glycoprotein) heath shock protein 60 glycosylphoshatidylinositol-linked glycoprotein Trypanosoma bruceii
CD14
The CD14 receptor, the main LPS receptor, is a pattern recognition molecule in the immediate
innate immune response against microorganisms and other exogenous and endogenous stress factors (22,23). CD14 is present as a 55-kDa glycosylphosphatidylinositol-linked (GPI) protein (membrane
CD14 (mCD14)) on the surface of macrophages and neutrophils (23) and as a soluble protein (sCD14)
in serum (24). Because of the lack of a cytoplasmic domain and the inability of GPI to activate
Adapted from Jefferies et al, Mod Asp Immunobiol, 2002
Chapter II __________________________________________________________________________
35
signaling pathways directly, CD14 needs a signaling co-receptor in order to activate the NF-κB
inflammatory pathway. The most important CD14 signalling co-receptor is toll-like receptor 4
(TLR4) (25). mCD14 and sCD14 together with LPB, are the first line screeners of microbial antigens
and present them to the more pathogen specific signaling receptor TLR4-MD2. If cells are devoid of
membrane CD14, LPS has no effect on TLR4 membrane expression.
Macrophage mannose receptor (MMR)
Innate receptors can be primarily divided into two classes: those that mediate phagocytosis and those
that lead to activation of pro-inflammatory pathways. CD14 and TLR are examples of the latter
while among the former, MMR is probably best characterized in a structural way (Fig 3).
MR is expressed on subsets of macrophages, dendritic cells and a population of endothelial cells.
MR expression appears to be restricted to certain vascular beds, such as the sinus-lining cells of the
liver, spleen, and lymph nodes. We focused our interest on the macrophage bound mannose receptor
(MMR) and we tried firstly to identify expression of the mannose receptor in upper airway tissue
and secondly to determine the immunological background in which changes in mannose receptor
expression can be found (Chapter VI).
Fig 3a: characteristics of MMR o MR is member of the c-type lectin family o 180 kDA type I transmembrane protein. o calcium dependent recognition o intracellular region bearing signals for endocytosis and phagocytosis
Fig 3b: Schematic representation of MMR large extracellular region with 3 domains: NH2-terminal cysteine rich domain (CR) A fibronectin type II domain (FNII) 8 C-type lectin carbohydrate recognition domains ( CRDs) transmembrane domain (TM) short cytoplasmic carboxy terminal domain (CT) (26)
epithelial cells (TLR), and gene products expressed inside the epithelial cells (NF-κB). (31)
The discovery of innate receptors on epithelial cells as devices for interaction between mucosa,
microbes and mucosal immune cells in the gastrointestinal, respiratory and urogenital tract is a giant
step in further definition of regulatory mechanisms in these tissues.
Phagocytes: neutrophils and macrophages
Phagocytosis of extracellular organisms is the first-line of host defense against pathogens. Two types
of cells play a predominant role in phagocytosis: neutrophils and macrophages. Neutrophils are the
earliest (short-lived) phagocytes to enter the inflamed areas where they will be phagocytized by
macrophages after exerting their phagocytotic function and their programmed cell death. Blood-
borne monocytes and tissue-resident macrophages are long-lived cells and phagocytose and kill
bacteria. But they also function in a wider context within the immune response. Macrophages
function as antigen-presenting cells and as major sources of pro-inflammatory (TNF-�, IL-1, IL-6)
or immunomodulatory (IL-10, IL-12) cytokines. The duality of macrophages as innate and adaptive
cell is illustrated (Fig 4) by the presence of innate receptors (MMR, TLR, CD14) and the allergen
specific CD23 receptors. (32)
Neutrophils have a faster onset of action and are more and more effective in the phagocytic function
than macrophages, whereas macrophages are more efficient in the secretion of cytokines.
Chapter II __________________________________________________________________________
38
Fig 4: after Reed and Milton (2001) JACI.
Dendritic cells
The central role of dendritic cells in the interplay between innate and adaptive immunity is
illustrated by their capacity of T-cell priming. T-cell activation requires interaction with major
histocompatibility complex (MHC) and co-stimulatory molecules (B7 family members), both
provided by mature DC. The transition from immature to mature DCs represent a powerful decision
to initiate an adaptive immune response and must be tightly regulated. This regulation comes from
innate immune signals. (33) Immature dendritic cells in the tissues are highly phagocytic, but are poor
antigen presenting cells. Upon stimulation (i.e. exposure to microbial products), dendritic cells
mature and express specific activation cell surface markers and co-stimulatory molecules (e.g.
CD40, B7.1, B7.2). Mature dendritic cells are highly efficient antigen presenting cells, but are less
phagocytic. Mature dendritic cells migrate to the regional lymph nodes where they present antigen to
naïve lymph node T-cells. Engagement of TLR proteins is sufficient to lead to dendritic cell
maturation, the pattern of cytokines expressed by dendritic cells depends on the activated TLR. This
TLR agonist function acts as adjuvant: they augment the potency of the antigen-specific response
without affecting the specificity of the antigen being recognized by T-cells. TLR agonists appear to
be capable of influencing whether T-cells adopt a Th1 or a Th2 pattern.
Mast cells
Mast cells contribute significantly to innate immunity. Substantial evidence indicates that mast cells
play a critical role in host immune defence against Gram-negative bacteria. Mast cells are capable of
phagocytosis and they release a number of inflammatory mediators including interleukin (IL)-4,
IL-6, IL-10, TNF-�, and leukotrienes in response to bacterial challenge. Mast cell-derived TNF-�
and leukotrienes are important for bacterial clearance and early recruitment of phagocytic help at the
site of infection (34). Mast cells can interact directly (FimH-CD48) (35) or indirectly (opsonin-
Chapter II __________________________________________________________________________
39
dependent, C3-C3R) (36) with microbes. Although the exact mechanism(s) of how mast cell-
dependent inflammatory responses are regulated is currently not known, recent studies have shown
that the complement receptor CD11�/CD18 (Mac-1), the protein tyrosine kinase JAK3, and TLR4 (37) are all important for the full expression of mast cell-dependent innate immunity in mice.
NK cells
These large granular lymphocytes are the innate counterparts of cytotoxic T-cells. NK cells play an
important role in vivo for innate immunity against tumors and viral infections and for linkage to
adaptive immunity. They exert cell-mediated cytotoxicity particularly for cells infected with
intracellular pathogens. NK-cells recognize and kill target cells that express altered or abnormally
low levels of self-MHC molecules. NK-cells can be activated by IL-12 and are important sources of
IFN-�, a cytokine that activates both macrophages and T-cells (Th1).
γγγγ/δδδδ T-cells
In humans, γ/δ T-cells are found in a relatively large proportion among the epithelium cells of the
colon and the small intestine. Unlike conventional T-cells, γ/δ T-cells directly recognize unprocessed
target antigens without the requirement of peptide/MHC complex recognition.
γ/δ T-cells share many cell surface proteins with alpha beta T-cells and are able to secrete
lymphokines and express cytolytic activities in response to antigenic stimulation. The recognition of
pathogens, damaged tissues and even B- and T-cell, and the direct induction of cellular immune
responses without a requirement for antigen degradation or specialized antigen-presenting cells by
γ/δ T-cells gives these T-cells greater flexibility than the more classical type of alpha beta T-cell-
mediated cellular immunity. (38)
B-1 cells
B-1 cells are a minor population of B cells that express CD5. B-1 cells are a distinct lineage of
conventional B-cell that can renovate themselves in the periphery and do not require antigen-specific
T-cells for pathogen recognition. Therefore, the potent response of B-1 cells appears within 48 hours
after ligand binding with low affinity. Ig M is the predominant Ig isotype produced by B-1 cells and
due to the absence of significant class switching and somatic hypermutation of Ig-variable regions
this T-cell independent specific response does not esthablish important immunologic memory. (39)
“A deeper understanding of the complex role of innate immune cells as sensors of the environment
and regulators of pathogen responses will probably influence the current models of immune regu-
lation, particularly those centered on the role of the environment in shaping immune responses”. (40)
Chapter II __________________________________________________________________________
40
3. Innate and adaptive defense in inflammation.
a. Innate versus adaptive immunity.
In order to understand the strategies of innate immune defense we can compare its characteristics to
the adaptive defense mechanisms (Table 2).
The adaptive immune system is only present in vertebrates and cartilaginous fish and relies on the
clonal expension of antigen-specific effector cells (T- and B-cells) selected by receptor gene
rearrangement. The adaptive immunity builds up a somatic memory with the capacity of fast and
efficient protection against reinfection.
Innate immunity, a teleologically ancient system (present in all species), delivers an early defense
immediately after recognition of structural components of microorganisms and viruses by a fixed
number of germ-line-encoded receptors.
Although these two “methods” of immune response evolved independently, innate immune signals
have an important role in initiating and regulating the development of adaptive effector mechanisms.
Table 2 Innate Adaptive
present in normal individuals at all times
defense system that acts early in the immune response
recognition of certain microbial structures
non-clonal response that does not involve gene
rearrangements
no increase upon re-exposure (no memory response)
acquired
delayed
recognition of unlimited antigen
Ag recognition involves gene rearrangement
of the T- and B-cell receptor
builds up immunologic memory (subsequent
exposure leads to responses that are
stronger/ faster)
b. Innate regulation of the adaptive response: the “integrated” response.
The adaptive immune system can not initiate a response without the “permission” of the innate
immune system. The important interplay between innate and adaptive defense mechanisms
determines how the inflammatory response will proceed.
With the discovery of the Toll-like receptor (TLR) crucial insights in the inflammatory process have
been provided through a better understanding of innate immune regulatory methods. TLR pathogen
selection (41) and transfer of information to the adaptive defense system (42,43) are important topics in
prior and present research. In addition immune regulation by self-limitation mechanisms (44,45) and
immune maturation are important assets of TLR innate immune regulation.
Important carriers of innate pathogen recognizing receptors are the antigen presenting cells (APC).
Macrophages and dendritic cells (DC), present at portals of entry of microorganisms throughout the
Chapter II __________________________________________________________________________
41
body, are specialized phagocytes which play an important role in clearance of foreign molecules and
effected host cells. Due to their capacity to mediate initial capture and processing of potential
antigens and activate specific T and B lymphocyte effector mechanisms, they conduct a pivotal role
in innate-adaptive interaction. In addition to their efficient phagocytic activities, APC are potent
secretory cells that induce and regulate local and systemic inflammatory responses.
Extensive research on the regulation of the “APC pathway of activity”, from innate PRR-ligand
binding to adaptive cellular (T and B cell) and secretory (e.g.cytokines) immune regulation, will be
necessary to gain better insight in inflammatory pathomechanisms.
c. Th1/Th2 balance in inflammation.
The pivotal role of T-helper cells in amplifying immune responsiveness is well established. T-helper
cells can be classified based on the cytokines they release: Th1 cells are dependent on IFNγ and to a
lesser extent Il-2 (interleukin-2) and IL-12, Th2 cells are most heavily reliant on Il-4 and IL-5. The
cytokines they produce serve as their own growth factors and are able to cross-regulate each other’s
development and activity. Th1 cells drive a “cellular immunity “pathway to fight viruses and other
intracellular pathogens and eliminate cancerous cells, Th2 cells drive a “humoral immunity”
pathway and up-regulate antibody production to fight extracellular organisms.
Overactivation of either pathway can cause disease. An overactive Th1 pathway is aggressive and
can generate organ-specific autoimmune disease. The Th2 pathway underlies allergy and IgE related
disorders and predisposes to systemic autoimmune disease. However in general, characterization of
human disease by one Th pattern usually fails.
Both the Th1 and Th2 subsets are produced from a non-committed population of precursor T-cells
which are polarized upon contact with APC. This emphasizes the role of APC in supervising the
immune responses.
Furthermore, other cells have recently been identified as important mediators in the Th1/Th2
balance: T regulatory cells (Treg=CD25+ cells.) Activated Treg secrete IL-10 and TGF-β which are
powerfull immunosuppressants inhibiting Th1cellular immunity and Th2 mediated antibody
production and therefore induce tolerance. Recent studies point to Treg as a central link between
innate and adaptive immunity: pathogen-specific T regulatory type 1 (Tr1) cells have been identified (46), toll-like receptor mediated interactions between pathogen - stimulated innate immune cells and
Treg result in release of suppression by Treg (47) and one publication suggests the selective
expression of Toll-like receptors on Treg in mice (48). This threefold interaction between innate
immunity, T regs and effector Tcells is a “hot” item in immunology today and will introduce more
sophisticated models of the hygiene hypothesis that go beyond the Th1/Th2 paradigm with focus on
the environment as “shaper” of immune responses.
Chapter II __________________________________________________________________________
42
In order to investigate inflammatory processes in the upper airway we approached local tissue
inflammation as three essential steps in fighting infection: the first “innate” step though the delivery
of local protector molecules (e.g. defensins), the second “innate-adaptive” step through macrophage
activity (phagocytosis, presenting antigen and effector molecules release) and the third “adaptive”
step through the local release of cytokines and inflammatory mediators.
References (1) Hoffmann JA. The immune response of Drosophila. Nature 2003 nov 6; 426 (6962): 33-8 (2) Hartman PF, Zimny ML, Cassingham RJ. A scanning electron microscopic study of healing of free
gingival grafts. J Periodontol 1977 aug; 48(8):435-9 (3) Fuchs E, Green H. The expression of keratin genes in epidermis and cultured epidermal cells. Cell 1978
nov; 15(3): 887-97 (4) Sciubba JJ, Waterhouse JP, Meyer JJ. A fine structural comparison of the healing of incisional wounds in
(7) Mackenzie IC, Hill MW. Connective tissue influences on patterns of epithelial architecture and
keratinization in skin and oral mucosa of the adult mouse. Cel Tissue Res 1984; 235:551-559 (8) Sun TT, Eicher R, Nelson WG, Tseng SC, Weiss RA, Jarvinen M et al. Keratin classes: molecular markers
for different types of epithelial differentiation. J Invest Dermatol 1983; 81:(1 suppl):109s-155s (9) dale BA, Holbrook KA, Fleckman P, Kimball JR et al. Heterogenecity in harlequin ichthyosis, an inborn
error of epidermal keratinization: variable morphology and structural protein expression and a defect in lamellar granules. J Invest Dermatol 1990; 94:6-18
(10) Schonwetter BS, Stolzenberd ED, Zasloff MA. Epithelial antibiotics induced at sites of inflammation.
Science 1995; 267: 1645-1648 (11) Krisanaprakornkit K, Kimball, Weinberg, Darveau, Bainbridge, Dale. Inducible expression of human
beta-defensin by Fusobacterium nucleatum in oral epithelial cells: multiple signaling pathways and the role of commensal bacteria in innate imunity and the epithelial barrier. Infect Immun 2000; 68: 2907-2915
(12) Jung HC, Eckman L, Yang SK et al. A distinct array of proinflammatory cytokines is expressed in human
colon epithelial cells in response to bacterial invasion. J Clin Invest 1995; 95:55-65
(13) Shibahara T, Wilcox JN, Couse T et al Characterization of epithelial chemoattractants for human intestinal intraepithelial lymphocytes. Gastroenterology 2001; 120:60-70
(14) Winter A, Comis S, Osborne M, Tarlow MJ, Stephen J, Andrew PW, Hill J. A role for pneumolysin but
not neuraminidase in the hearing loss and cochlear damage induced by experimental pneumococcal meningitis in guinea pigs. Infect Immun 1997; 65:4411-8
(15) Gennaro R, Zanetti M. Structural features and biological activities of the cathelicidin-derived
antimicrobial peptides. Biopolymers 2000; 55: 31-49 (16) Chertov, Yang D, Howard, Openheim. Leucocyte granule proteins mobilize innate host defenses and
adaptive immune responses. Rev. 2000; 177:68-78.2
Chapter II __________________________________________________________________________
43
(17) Lemaitre B, Nicolas E, Michaut L, 1996. The dorsoventral regulatory gene spatzle: Toll/cactus controls
the potent antifungal response in Drosophila adults. Cell 86; 973-983 (18) Medzhitov R, Preston-Hurlburt P, Janeway CA Jr (1997). A human homologue of the Drosophila toll
protein signals activation of adaptive immunity. Nature; 388: 394-397 (19) Fitzgerald KA, Palsson-McDermott EM, Bowie AG, et al. Mal (MyD88-adapter-like) is required for Toll-
like receptor 4 signal transduction. Nature 2001; 413:78-83 (20) Horng T, Barton GM, Flavell RA, Medzhitov R. The adaptor molecule TIRAP provides signalling
specificity for Toll-like receptors. Nature 2002; 420: 329-333 (21) Suzuki N, Suzuki S, Duncan GS et al. Severe impairment of interleukin-1 and Toll-like receptor signalling
in lice lacking IRAK-4. Nature 2002; 416:750-756 (22) Kobayashi K, Hernandez LD, Galan JE, et al. IRAK-M is a negative regulator of Toll-like receptor
signalling. Cell 2002; 110:191-202. (23) Ulevitch RJ, Tobias PS. Recognition of gram-negative bacteria and endotoxin by the innate immune
14(3):121-5 (25) Moreno C, Merino J, Ramirez N, Echeverria A, Pastor F, Sanchez-Ibarrola A. Microbes
Lipopolysaccharide needs soluble CD14 to interact with TLR4 in human monocytes depleted of membrane CD14. Infect 2004 Sep; 6(11):990-5
(26) Martinez-Pomares L, Linehan SA, Taylor PR, Gordon S. Binding properties of the mannose receptor.
Immunobiol 2001 Dec; 204(5):527-35 (27) Ogura Y, Bonen D, Inohara N, Nicolae DL, Chen FF, Ramos R. A frameshift mutation in NOD2
associated with susceptibility to Crohn’s disease. Nature 2001; 411: 603-606 (28) Adler KB, Fischer BM, Wright DT, Cohn LA, Becker S. Interactions between respiratory epithelial cells
and cytokines: relationships to lung inflammation. Ann NY Acad Sci 1994 May; 28;725:128-45 (29) Diamond G, Douglas E, Charles Bevins. Airway epithelial cells are the site of expression of a mammalian
antimicrobial peptide gene. Proc Natl Acad Sci USA May 1993; vol 90: 4596-4600 (30) Schroder JM, Harder J. Human beta-defensin-2. Int J Biochem Cell Boil 1999; 31(6): 645-651 (31) Ramis I, Bioque G, Lorente L, Jares P, Quesada P et al. Constitutive nuclear factor-κB activity in human
upper airway tissues and nasal epithelial cells. Eur Respir J 2000; 15:582-589 (32) Reed Ch, Milton DK. Endotxin-stimulated innate immunity: a contributing factor for asthma. L Allergy
Clin Immunol 2001; 108:157-66 (33) Eisenbarth S, Cassel S, Bottomly K. Understanding asthma pathogenesis: linking innate and adaptive
immunity. Curr Opin Pediatr 2004; vol 16(6): 659-666 (34) Malaviya R, Ikeda T, Ross E, Abraham SN. Mast cell modulation of neutrophil influx and bacterial
clearance at sites of infection through TNF-α. Nature 1996; 381(6577):77-80 (35) Malaviya R, Gao Z, Thankavel K, Merwe PA, Abraham SN. The mast cell tumor necrosis factor alpha
response to FimH-expressing Echerichia coli is mediated by the glyco-sylphosphatidylinositol-anchored molecule CD48. Proc Natl Acad Sci USA 1999 July; vol.96, issue 14: 8110-8115
Chapter II __________________________________________________________________________
(37) Supajatura V, Ushio H, Nakao A, Okumura K, Ra C, Ogawa H. Protective roles of mast cells against
enterobacterial infection are mediated by Toll-like receptor 4. J Immunol. 2001 Aug 15; 167(4):2250-6 (38) Chien YH, Jores R, Crowley MP. Recognition by gamma/ delta T-cells. Annu Rev Immunol.
1996;14:511-32. (39) Murakami M, Honjo T. Involvement of B-1 cells in mucosal immunity and autoimmunity. Immunol
Today 1995 Nov; 16(11):534-539. (40) Vercelli D. Innate immunity: sensing the environment and regulating the regulators. Curr Opin Allergy
Clin Immunol. 2003 Oct; 3(5):343-6
(41) Zarember KA, Godowski PJ. Tissue expression of human-toll-like receptors and differential regulation of Toll-like receptor mRNA in leukocytes in response to microbes, their products, and cytokines. J Immunol 2002;168:554-561
(42) Eisenbarth SC, Piggott DA, Huleatt JW, et al. Lipopolysacchairde-enhanced, toll-like receptor 4-
dependent T helper cell type 2 responses to inhaled antigen. J Exp med 2002; 196:1645-1651 (43) Boonstra A, Asselin-Paturel C, Gilliet M, et al. Flexibility of mouse classical and Plasmacytoid-derived
dendritic cells in directing t helper type 1 and 2 cell development: dependency on antigen dose and differential toll-like receptor ligation. J exp Med 2003;197:101-109
(44) Kobayashi K, Hernandez LD, Galan JE, et al. IRAK-M is a negative regulator of Toll-like receptor
signaling. Cell 2002;110:191-202 (45) Nakagawa R, Naka T, Tsutsui H, et al. SOCS-1 participates in negative regulation of LPS responses.
Immunity 2002; 17:677-687 (46) McGuirk P, McCann C, Mills KH.Pathogen-specific T regulatory 1 cells induced in the respiratory tract
by a bacterial molecule that stimulates interleukin-10 production by dendritic cells: a novel strategy for evasion of protective T helper type 1 responses by Bordetella Pertussis. J Exp Med. 2002 Jan 21;195(2):221-31.
(47) Pasare C, Medzihitov R. Toll pathway-dependent blockade of CD4 + CD25 + T-cell-mediated
suppression by dendritic cells. Science, 2003; 299:1033-1036. (48) Caramalho I, Lopes-Carvalho T, Ostler D, et al. Regulatory T cells selectively express Toll-like receptors
and are activated by lipopolysaccharide. J Exp Med 2003 Feb 17; 197(4): 403-411.
Chapter III _________________________________________________________________________
45
Chapter III
Introduction to the innate-adaptive link
in upper airway disease
Content: Introduction
Review The Innate Immune System and its Possible Role in Allergic Disorders. Vandenbulcke L, Claeys S, van Cauwenberge P, Bachert C. Int Arch Allergy Immunol, submitted.
Chapter III _________________________________________________________________________
46
Introduction
Treatment and prevention of upper airway disease require the detailed understanding of disease
pathogenesis and in particular the identification of factors that influence the Th1 (T-helper cell) -Th2
balance.
In the upper airway both nasal polyposis and allergic rhinitis are important examples of Th2
dominated inflammation. The factors that initiate this Th2 driven inflammation are presently ill
defined in both diseases.
Discoveries in innate immunity have added to our knowledge of how adaptive immune responses are
initiated and recently these principles have been applied to allergic disease. In the review of this
chapter we wanted to approach the disturbed immune regulation in allergic disorders from an innate
point of view with emphasis on innate-adaptive immune regulation. To elucidate the relationship
between innate-adaptive immune signalling and disease occurrence/progression both environmental
and genetic factors have to be taken into account.
Environmental approach:
Through pathogen recognizing receptors (PRR), innate immunity is able to “read” the ever changing
environment and to “inform” the powerful adaptive immune system about the need for defence
measures.
Because of the phylogenetic ancient origin of innate immunity defense, PRR have reached a
maximum efficacy in recognizing and handling of self and non-self. Especially in the upper airway,
this dynamic interplay between innate receptors and the continuous influx of microbial flora from
inhaled ambient air is important for homeostasis of the mucosal surface. Although microbial
containment is permanent, in healthy people respiratory infections rarely occur and no adaptive
immune response need to be evoked.
However, in modern medicine important challenges are generated by changes in our environment
(increased air pollution, more indoor activities, strict hygiene measures) and due to therapeutic
measures widely used in the previous decades (broad-spectrum antibiotics, chemotherapy, organ
transplants..) a more susceptible host population is created and microbial virulence increases (HIV,
tuberculosis, malaria). Also induced immune hyperresponsiveness gives rise to increasing
prevalence of modern health problems: asthma, allergy, autoimmune disorders, chronic
inflammatory bowel disease.
It appears that environmental challenges related to modern lifestyle have disrupted the delicate
equilibrium of innate and adaptive immune regulation.
Chapter III _________________________________________________________________________
47
Genetical approach.
Naturally occurring variations in the innate immunity genes have an important role in human
susceptibility. An infectious agent alone is not enough to determine the development of a disease.
The same pathogens (e.g. Streptococcus pneumoniae) can induce colonization, a common infectious
disease or a rare lethal opportunist infection depending on the degree of immunological reaction. All
individuals carry hereditary immune deficits, illustrated by their vulnerability to at least one
infectious agent and the genetic variability that determines the resistance of the host reflects the
genetic variability that determines the virulence of the aggressor.
Current innate research is firstly focused on the discovery and description of human genetic
variations in innate immune genes and secondly on examining disease risk associated with these
variations. (1)
Allergy
The prevalence of allergic disorders has risen to true epidemic proportions over the last three
decades and is most prominent in countries with a ‘Western lifestyle’, especially among children and
adolescents. Both environmental and genetical components are responsible for the increase (2,3) of
allergy related disease. (4,5)
It is well established that allergic diseases tend to occur within families and have a genetic basis but
the recent increase in prevalence of allergy cannot be explained by genetic factors alone. Several
environmental and lifestyle factors (e.g. prenatal maternal influences, allergen exposure, active and
passive smoking, viral and other respiratory infections, early life microbial exposure, indoor air
quality/house dampness, outdoor air pollution, farming environment, socio-economic status, dietary
factors) have been identified as influential factors. Further assessment of the complex interactions
among and between genetic and environmental determinants is required.
In the following review we aimed to discuss the current insights on innate immune impact on
allergic disorders. Allergy is mainly approached as an allergen specific adaptive immune response,
but recent knowledge emphasizes that the innate immune system intervenes both in the onset and in
the later manifestation of allergic diseases. Depending on the time, the type and the intensity of
innate triggering and the underlying genetic susceptibility of an individual, innate response can both
suppress and enhance allergic inflammation and clinical expression…
Chapter III _________________________________________________________________________
48
References
(1) lecture by Jean-Laurent Casanova, Laboratoire de Génétique Humaine des maladies Infectieus, INSERM,
Paris: The human model: a genetic dissection of immunity in natural conditions (2) Aberg N, Sundell J, Eriksson B, Hesselmar B, Aberg B. Prevalence of allergic diseases in schoolchildren in
relation to family history, upper respiratory infections, and residential characteristics. Allergy 1996; 51:232-7
(3) Ciprandi G, Vizzaccaro, Cirillo I, Crimi P, Canonica GW. Increase of asthma and allergic rhinitis
prevalence in young Italian men. Int arch Allergy Immunology 1996;111:278-83 (4) Sibbald B. Epidemiology of allergic rhinitis. In: ML B, editor. Epidemiology of clinical allergy.
Monographs in allergy. Basel:karger;1993. p. 61-9 (5) Strachan D, Sibbald B, Weiland S, Ait-Khaled N, Anabwani G, Anderson HR, et al. Worldwide variations
in prevalence of symptoms of allergic rhinoconjunctivitis in children: the international Study of asthma and allergies in childhood (ISAAC). Pediatric Allergy Immunology 1997; 8: 161-76
Chapter III _________________________________________________________________________
49
Review
The Innate Immune System and its Possible Role in Allergic Disorders
Abstract BACKGROUND: There is an increasing prevalence of allergic diseases in Western world over the last decades. The hygiene hypothesis has been proposed as possible explanation for this epidemical trend in allergy. A key role in this theory is assigned to the reduced microbial stimulation of the Toll-like receptors in early life, which could lead to a weaker Th1 response and a stronger Th2 response to allergens. The individual immunological response is determined by the interplay between the dose and timing of exposure to endotoxins, other environmental factors and genetic predisposition. In the development and progression of allergic disorders, an important role is played by the innate immune system. OBJECTIVE: In this review we discuss the paradoxical effects that may appear by triggering the innate immune components. We review the influence of changes in the gene sequence and Toll-like receptor expressions in relation to the overall pattern of commensals and pathogens. We explore the possibility of alternative stimulations of the immune system by CpG oligodeoxynucleotides and probiotics as therapeutic devices against this endemic disease in the Western society. METHODS: Selection of papers was based on their importance to contribute to the understanding of innate immunity and its implications. RESULTS AND CONCLUSION: The innate immune system plays an important role in both the protection against and the enhancement of allergic disorders, but the mechanisms are still unclear. Nevertheless, gene polymorphisms and triggers of the innate immune system provide therapeutic targets for protection against and treatment of allergic disorders.
Introduction The innate immune system is an important first line defense against potential pathogens [1]. It consists principally of physical, chemical and cellular elements [2]. To provide an immediate response in the setting of danger, rapid detection of pathogens is necessary [3]. This occurs by Toll-like receptors (TLRs), which are the sensors of innate immunity [4]. Activation of the system leads to effector functions through antibacterial peptides, such as defensins, that are considered as natural broad spectrum antibiotics [5]. However, activation also leads to signalling to the adaptive immune system, modifying the shaping of the Th1/Th2 balance [3]. The allergic response was always thought to be a typical adaptive immune response, involving an abnormally strong Th2 response. However, experimental evidence has shown that innate immune components may also play a role in the development of allergy. The possible role of the innate immune system in the development and progression of allergic diseases and in their increasing prevalence in the developed world will be discussed in this paper. How triggering of the innate immune system protects against allergy
The hygiene hypothesis tries to explain the association between the increasing prevalence of allergy and the Western life [6]. It says that “the apparent rise (in the prevalence of allergic diseases)… could be explained if allergic diseases were prevented by infection in early childhood, transmitted by unhygienic contact with older siblings, or acquired prenatally… Over the past century declining family size, improved household amenities and higher standards of personal cleanliness have reduced opportunities for cross-infection in young families. This may have resulted in more widespread clinical expression of atopic disease. (Strachan 1989) In the search for the immunological basis of the hygiene hypothesis, and in suggesting that a reduced microbial stimulation of the TLRs on the innate immune cells in early life leads to stronger Th2 responses to allergens, the terms ‘missing immune deviation’ and ‘reduced immune suppression’ have been introduced [7]. The critical period for the establishment of the Th1/Th2 balance is the early life period [6]. Whereas the immune system of humans in early childhood is thought to have a Th2 bias [8], this Th2 skew gradually diminishes during the first two years of life in non-allergic individuals. In allergic infants, this does not occur [8]. Interaction of pathogen associated molecular patterns (PAMPs) with TLRs results in the
Chapter III _________________________________________________________________________
50
release of several Th1 cytokines, such as IFN-γ and interleukin (IL) -12, and Th2 cytokines, such as IL-4 and IL-5. These cytokines are mainly responsible for driving the T cell polarization [9]. Missing immune deviation from Th2 to Th1 is thought to be caused by a decreased production of Th1 cytokines, as a result of a reduced stimulation of TLRs in a Western lifestyle [7]. Whereas experimental evidence, both in vitro and in vivo, supports the role of reduced shifting from Th2 to Th1 responses as a possible explanation for the increased prevalence of allergy, also other immune cell types can intervene to block either Th1 or Th2 activity or both, namely the regulatory T (Treg) cells, leading to the concept of ‘immune suppression’ [9]. Treg cells selectively express several TLRs, and are able to suppress both Th1 and Th2 responses by producing suppressive cytokines, such as IL-10 and TGF-β [3,9,10]. Some evidence suggests that exposure to lipopolysaccharide (LPS) enhances the suppressive functions of Treg cells [10]. However, the exact relationship between microbial stimulation of the TLR pathway and Treg cells is still unclear and the exact role of Treg cells in regulating allergen-specific Th2 responses is controversial [3,7]. Numerous environmental factors associated with rural and urban living have been studied in an attempt to give an explanation for the increasing prevalence of allergic disorders in the developed world [6]. TLRs are transmembrane receptors with an extracellular leucine-rich repeat (LRR) domain and an intracellular Toll/IL-1 receptor (TIR) domain. The LRR mediates ligand-binding specificity, while the TIR domain is responsible for initiating signaling pathways through protein-protein interactions. The bacterial endotoxin or LPS, a component of the outer membrane of Gram-negative bacteria, is recognized by TLR4. In general LPS-TLR4 binding induces a downstream nuclear transcription factor �β (NF�β) activation with the ultimate upregulation of different sets of genes that regulate inflammatory responses leading to the release of cytokines, chemokines and cells and thus also to the activation of the adaptive immune system. [11] Early life exposure to LPS seems to stimulate directly or indirectly the Th1 activity, which could lead to a possible protective effect against the development of allergy [7,12,13]. In a farming environment, the endotoxin levels are found to be higher than in an non-farming environment [10,13]. Children growing up on a farm or those having regularly contact with farm animals have less susceptibility to develop allergic disorders [14,15]. In the blood samples of farmer’s children, elevated levels of CD14, another primary receptor for LPS which has no cytoplasmic domain and is thus linked to other pattern recognition receptors (PRRs), were found [16]. An increased level of TLR2, a PRR mainly specific for gram-positive bacteria, was also present [7,14]. In a recent study, the administration in vivo of a TLR4 or TLR2
agonist (lipid A and peptidoglycan respectively) at allergen sensitization or challenge showed a decrease in the allergic response [17]. The house dust endotoxin level in farm homes is found to be higher than in urban homes [18]. Early life exposure to endotoxin was also found to be protective against asthma [19]. LPS induces the production of defensins and IL-10, which are important protective Th1 mediators in the pathophysiology of asthma [19,20,21], but also of IL-12, which is important in the orchestration of cell-mediated immune responses and in the protection against bacterial pathogens [22,23]. The farming environment is associated with a lower prevalence of both atopic and nonatopic asthma [15], but exposure to indoor endotoxin was found to be only protective against the development of atopic asthma [24]. These findings suggest that also other contributing factors than endotoxin may play a role in the up-regulation of innate receptors [14] and in the association with asthma [10,19]. Gene-environment interactions determine eventually the individual immunological response. Stimulation of the innate immune system by LPS seems to be important in the ontogeny of the normal individual immune system [25]. However, although farmer’s children seem less likely to have allergic disorders, and mutations and polymorphisms in genes encoding for innate components seem to modify the risk for the development of asthma and allergy, the question remains if this is mediated by the innate immune system. To obtain a clear answer, more well performed studies are needed. Because asthma and other allergic disorders are not occurring in early life alone, these studies should go over a longer lifespan than only the early life childhood. Although the hygiene hypothesis is promoted as the most plausible explanation for the increasing allergy prevalence, it can not be denied that there are lots of confounding factors in the study designs, which need to be taken into account [26]. How can triggering of the innate immune system enhance allergic disorders? As mentioned above, exposure to endotoxin may provide protection against allergic disorders. There is, however, evidence that endotoxins may have a dual opposing effect. Triggering of the innate immune system through endotoxin exposure can be both protective and harmful in allergy and asthma [20]. This depends on the dose of the endotoxin [6]. Whereas high doses in early life promote Th1 responses, low doses in later life favour Th2 responses [7,27,28]. In asthmatic patients, higher house dust endotoxin levels are associated with more pronounced symptoms, an increased use of medication, a more important degree of airway obstruction and in the first year of life more wheezing [20,29,30,31,32]. Exposure to LPS after sensitization aggravates the allergic inflammatory response [33]: e.g. endotoxin
Chapter III _________________________________________________________________________
51
exposure in later life adversely affects patients with asthma by increasing the severity of the airway inflammation and the susceptibility to rhinovirus-induced colds and by causing irreversible airway obstruction after chronic exposure [34]. This is because LPS induces the production of cytokines (IL-12, IL-10), chemokines (IL-8, activating neutrophils), adhesion molecules (ICAM-1), and other products, causing inflammation [34,35,36]. Thus, innate immunity may play a deleterious role in asthma [34]. Nevertheless, whether the immune response and modulation will result in an allergic sensitisation not only depends on the exposure itself to endotoxin, but also on the timing of exposure, the dosage of endotoxin, environmental factors, and genetic predisposition [20]. The genetic background and implications of innate immunity As mentioned above, gene-environment interactions will eventually determine the individual immunological response. Changes in the gene sequence can alter the immune responsiveness of a person to environmental stress either negatively or positively. There is much variability between individuals in the response to inhaled toxins, suggesting that these different polymorphisms act in concert with each other [37]. A genetic polymorphism encoding TLR2 (TLR2/-16934) was found to be associated with a reduced susceptibility to asthma and allergy in farmer’s children [10]. Only those farmer’s children with this TLR2 polymorphism were significantly less likely to have asthma and current asthma symptoms [10].
Mutations in the extracellular domain of the TLR4 receptor (Asp299Gly and Thr399Ile) were found to be associated with a significant hypo-responsiveness to inhaled LPS in humans [37]. The TLR4 (Asp299Gly) polymorphism was found to be associated with a higher prevalence of asthma in school-aged children, especially of atopic asthma, but no correlation was found with allergic rhinoconjunctivitis or skin prick test positivity [38]. The reduced capacity to produce IL-12 and IL-10 in response to LPS in children with the TLR4 polymorphism (Asp299Gly) suggests an aberrant function of the innate immune system [38]. However, the exact mechanism through which this happens and the physiologic and biologic implications are still unclear or not yet investigated [37,39]. A CD14 polymorphism (CD14/-159) was found to be associated with low levels of total serum IgE and a decreased prevalence of a positive skin prick test and self-reported hay fever and allergic rhinitis in adults [40]. Positive skin prick test results in children have been associated with increased soluble CD14 levels and low levels of total serum IgE [41]. Other studies found no association between the CD14/-159 genotype and asthma [38,42], allergic rhinoconjunctivitis or skin prick test positivity [38]. Thus, the TLR4 polymorphism may be associated with the susceptibility of atopic children to develop asthma, but not with the development of atopic reactivity and IgE production. The CD14 polymorphism seems to have a more modest clinical importance. Nevertheless, these polymorphisms can provide key therapeutic targets to modulate LPS signalling in humans, and can perhaps modify protection against allergic disorders.
Chapter III _________________________________________________________________________
52
Therapeutic challenges related to innate immunity The gastrointestinal microflora provides a possible intervention site for therapeutic strategies in allergy prevention and treatment. It might be an important counterregulator of the Th2 skewed immune system in early life because of its potentially anti-allergic processes like the promotion of Th1 immunity, the generation of TGF-β and the induction of oral tolerance and IgA production [43]. The gastrointestinal tract, which is sterile at birth, becomes colonized in the first months and years of life. This is determined by an interplay between genetic factors, environmental factors, diet and disease [44]. Moreover, the maturation of the immune system depends on the stimulus by the intestinal microbiota [44]. It was shown that the intestinal epithelial cells constitutively express TLRs [45,46]. Changes in the overall pattern of commensals and pathogens in the intestinal microbial flora might be responsible for the increasing prevalence of allergic and inflammatory disorders [47,48]. An altered bacterial colonization in young babies may lead to a persistent predominant Th2 immunity and later to the development of allergic diseases [49]. The development of atopic disorders is preceded by a reduced rate of the intestinal colonization (in the neonatal intestinal microbiota of atopic patients the ratio of bifidobacteria to clostridia was reduced as compared to non-atopic patients) [43,50]. The question arises if manipulation of the intestinal microbiota can play a role in improving the health of the host or even in preventing atopic disorders. Probiotics are live microbial feed supplements which beneficially affect the host by improving its intestinal microbial balance [51,52]. They are able to stimulate our immune system and to augment the production of TGF-β and IL-10. They can also restore alterations in allergic individuals, such as an increased intestinal permeability, defective gut-specific IgA responses, and an insufficient normal gastrointestinal barrier function. [43] They have already proven to be safe at an early stage and to be effective in several non-allergic diseases [52,53]. Some studies also point to a possible beneficial effect in allergic disorders [54,55], e.g. in the treatment of atopic dermatitis in children [56]. Perinatal administration of the probiotic strain Lactobacillus GG is effective in the primary prevention of atopic eczema in at-risk children [43,57]. These beneficial effects are strain-specific [44], and extend beyond infancy [58]. However, no conclusions can be made on the effect of probiotics administration in respiratory allergic diseases presenting typical at an older age. Furthermore, the long-term effects and the exact mechanisms by which probiotics work remain unclear. Another therapeutic target in the prevention and treatment of allergic disorders is the use of CpG oligonucleotides. Bacterial DNA differs from human DNA by its unmethylated CpG sequences and interacts in a highly specific way with TLR9 present
in humans on B cells and plasmacytoid dendritic cells [20,59]. Activation of these cells by CpG leads to maturation, differentiation and proliferation of natural killer cells, T cells, monocytes and macrophages. This leads to the secretion of pro-inflammatory and Th1 cytokines and chemokines (IL-1, 6, 18, TNF, IFN-γ and IL-12) and contributes to the survival of humans [59]. CpG oligodeoxynucleotides (ODN) resemble bacterial DNA and are capable of stimulating our innate immune system by eliciting IFN-γ and IL-12 and reducing the production of IL-4. Studies have shown that administration of CpG ODN during or even after the sensitization phase reduced or eliminated allergic asthma [60]. These effects were long-lasting and even more pronounced if CpG ODN was directly coupled to the allergen [59,61]. While these findings point to a valuable use of CpG DNA in the understanding of the innate immune system and in the immunotherapy of allergy, still many questions remain unanswered, such as the safety profile of CpG administration. Conclusion The hygiene hypothesis has been postulated as a possible explanation for the increasing prevalence of allergic disorders in the Western society. Gene-environmental interactions determine the individual immunological response. A change of one or several of these factors seems to lead to a different immunological pattern and may consequently be responsible for the increase of allergic diseases. It seems likely that the innate immune system plays an important role in both the protection against and the enhancement of allergic disorders, but the mechanisms are still unclear. Nevertheless, gene polymorphisms of innate receptors as well as triggers of the innate immune system (LPS, CpG DNA and probiotics) may provide key therapeutic targets for protection against and treatment of allergic disorders. References 1. Check W. Innate immunity depends on Toll-like receptors. ASM News. 2004;70(7):317-22. 2. Basset C, Holton J, O’Mahony R, Roitt I. Innate immunity and pathogen-host interaction. Vaccine. 2003;21 Suppl 2:S12-23. 3. Abreu MT, Arditi M. Innate immunity and Toll-like receptors: clinical implications of basic science research. J Pediatrics. 2004;144(4):421-9. 4. Beutler B. Toll-like receptors: how they work and what they do. Curr Opin Hematol. 2002;9(1):2-10. 5. Boman HG. Antibacterial peptides: basic facts and emerging concepts. J Intern Med. 2003;254(3):197-215. 6. Kim DS, Drake-Lee AB. Infection, allergy and the hygiene hypothesis: historical perspective. J Laryngol Otol. 2003;117(12):946-50. 7. Romagnani S. The increased prevalence of allergy and the hygiene hypothesis: missing immune deviation, reduced immune suppression, or both? Immunology. 2004;112(3):352-63. 8. Wills-Karp M, Santeliz J, Karp CL. The germless theory of allergic disease: revisiting the hygiene hypothesis. Nat Rev Immunol. 2001;1(1):69-75.
Chapter III _________________________________________________________________________
53
9. Kidd P. Th1/Th2 Balance: The hypothesis, its limitations, and implications for health and disease. Altern Med Rev. 2003;8(3):223-46. 10. Eder W, Klimecki W, Yu L, von Mutius E, Riedler J, Braun-Fahrländer C, Nowak D, Martinez FD, and the ALEX Study Team. Toll-like receptor 2 as a major gene for asthma in children of European farmers. J Allergy Clin Immunol. 2004;113(3):482-8. 11. Beutler B. Innate immunity: an overview. Mol Immunol. 2004;40(12):845-59. 12. Martinez FD. The coming-of-age of the hygiene hypothesis. Respir Res. 2001;2(3):129-32. 13. von Mutius E, Braun-Fahrländer C, Schierl R, Riedler J, Ehlermann S, Maisch S, Waser M, Nowak D. Exposure to endotoxin or other bacterial components might protect against the development of atopy. Clin Exp Allergy. 2000;30(9):1230-4. 14. Lauener RP, Birchler T, Adamski J, Braun-Fahrländer C, Bufe A, Herz U, von Mutius E, Nowak D, Riedler J, Waser M, Sennhauser FH, and the ALEX study group. Expression of CD14 and Toll-like receptor 2 in farmers’ and non-farmers’ children. Lancet. 2002;360(9331):465-6. 15. Riedler J, Braun-Fahrländer C, Eder W, Schreuer M, Waser M, Maisch S, Carr D, Schierl R, Nowak D, von Mutius E, and the ALEX Study Team. Exposure to farming in early life and development of asthma and allergy: a cross-sectional survey. Lancet. 2001;358(9288):1129-33. 16. Diamond G, Legarda D, Ryan LK. The innate immune response of the respiratory epithelium. Immunol Rev. 2000;173:27-38. 17. Velasco G, Campo M, Manrique OJ, Bellou A, He H, Arestides RS, Schaub B, Perkins DL, Finn PW. Toll-like receptor 4 or 2 agonists decrease allergic inflammation. Am J Respir Cell Mol Biol. 2005;32(3):218-24. 18. Gereda JE, Leung DY, Thatayatikom A, Streib JE, Price MR, Klinnert MD, Liu AH. Relation between house-dust endotoxin exposure, type 1 T-cell development, and allergen sensitisation in infants at high risk of asthma. Lancet. 2000;355(9216):1680-3. 19. Liu AH. Endotoxin exposure in allergy and asthma: reconciling a paradox. J Allergy Clin Immunol. 2002;109(3):379-92. 20. Becker MN, Diamond G, Verghese MW, Randell SH. CD14-dependent lipopolysaccharide-induced beta-defensin-2 expression in human tracheobronchial epithelium. J Biol Chem. 2000;275(38):29731-6. 21. Stampfli MR, Cwiartka M, Gajewska BU, Alvarez D, Ritz SA, Inman MD, Xing Z, Jordana M. Interleukin-10 gene transfer to the airway regulates allergic mucosa sensitization in mice. Am J Respir Cell Mol Biol. 1999;21(5):586-96. 22. Wysocka M, Robertson S, Riemann H, Caamano J, Hunter C, Mackiewicz A, Montaner LJ, Trinchieri G, Karp CL. IL-12 suppression during experimental endotoxin tolerance: dendritic cell loss and macrophage hyporesponsiveness. J Immunol. 2001;166(12):7504-13. 23. Trinchieri G. Interleukin-12: a cytokine at the interface of inflammation and immunity. Adv Immunol. 1998;70:83-243. 24. Braun-Fahrländer C, Riedler J, Herz U, Eder W, Waser M, Grize L, Maisch S, Carr D, Gerlach F, Bufe A, Lauener RP, Schierl R, Renz H, Nowak D, von Mutius E, for the Allergy and Endotoxin Study Team. Environmental exposure to endotoxin and its relation to asthma in school-age children. N Engl J Med. 2002;347(12):869-77. 25. Weiss ST. Eat dirt. The hygiene hypothesis and allergic diseases. N Engl J Med. 2002;347(12):930-1. 26. van Schayck CP, Knottnerus JA. Can the ‘hygiene hypothesis’ be explained by confounding by behaviour? J Clin Epidemiol. 2004;57(5):435-37. 27. Eisenbarth SC, Piggott DA, Huleatt JW, Visintin I, Herrick CA, Bottomly K. Lipopolysaccharide-enhanced, toll-like receptor 4-dependent T helper cell type 2 responses to inhaled antigen. J Exp Med. 2002;196(12):1645-51. 28. Lawton JA, Ghosh P. Novel therapeutic strategies based on toll-like receptor signaling. Curr Opin Chem Biol. 2003;7(4):446-51. 29. Rizzo MC, Naspitz CK, Fernandez-Caldas E, Lockey RF, Mimica I, Sole D. Endotoxin exposure and symptoms in asthmatic children. Pediatr Allergy Immunol. 1997;8(3):121-6.
30. Michel O, Ginanni R, Duchateau J, Vertongen F, Le Bon B, Sergysels R. Domestic endotoxin exposure and clinical severity of asthma. Clin Exp Allergy. 1991;21(4):441-8. 31. Michel O, Kips J, Duchateau J, Vertongen F, Robert L, Collet H, Pauwels R, Sergysels R. Severity of asthma is related to endotoxin in house dust. Am J Respir Crit Care Med. 1996;154(6 Pt 1):1641-6. 32. Park JH, Gold DR, Spiegelman DL, Burge HA, Milton DK. House dust endotoxin and wheeze in the first year of life. Am J Respir Crit Care Med. 2001;163(2):322-8. 33. Tulic MK, Wale JL, Holt PG, Sly PD. Modification of the inflammatory response to allergen challenge after exposure to bacterial lipopolysaccharide. Am J Respir Cell Mol Biol. 2000;22(5):604-12. 34. Reed CE, Milton DK. Endotoxin-stimulated innate immunity: A contributing factor for asthma. J Allergy Clin Immunol. 2001;108(2):157-66. 35. Lauw FN, ten Hove T, Dekkers PE, de Jonge E, van Deventer SJ, van der Poll T. Reduced Th1, but not Th2, cytokine production by lymphocytes after in vivo exposure of healthy subjects to endotoxin. Infect Immun. 2000;68(3):1014-8. 36. Kamochi M, Kamochi F, Kim YB, Sawh S, Sanders JM, Sarembock I, Green S, Young JS, Ley K, Fu SM, Rose CE Jr. P-selectin and ICAM-1 mediate endotoxin-induced neutrophil recruitment and injury to the lung and liver. Am J Physiol. 1999;277(2 Pt 1):L310-9. 37. Arbour NC, Lorenz E, Schutte BC, Zabner J, Kline JN, Jones M, Frees K, Watt JL, Schwartz DA. TLR4 mutations are associated with endotoxin hyporesponsiveness in humans. Nat Genet. 2000;25(2):187-91. 38. Fageras Bottcher M, Hmani-Aifa M, Lindstrom A, Jenmalm MC, Mai XM, Nilsson L, Zdolsek HA, Bjorksten B, Soderkvist P, Vaarala O. A TLR4 polymorphism is associated with asthma and reduced lipopolysaccharide-induced interleukin-12(p70) responses in Swedish children. J Allergy Clin Immunol. 2004;114(3):561-7. 39. Schwartz DA. Inhaled endotoxin, a risk for airway disease in some people. Respir Physiol. 2001;128(1):47-55. 40. Koppelman GH, Reijmerink NE, Colin Stine O, Howard TD, Whittaker PA, Meyers DA, Postma DS, Bleecker ER. Association of a promotor polymorphism of the CD14 gene and atopy. Am J Respir Crit Care Med. 2001;163(4):965-9. 41. Baldini M, Lohman IC, Halonen M, Erickson RP, Holt PG, Martinez FD. A polymorphism in the 5’-flanking region of the CD14 gene is associated with circulating soluble CD14 levels and with total serum immunoglobulin E. Am J Respir Cell Mol Biol. 1999;20(5):976-83. 42. Heinzmann A, Dietrich H, Jerkic SP, Kurz T, Deichmann KA. Promotor polymorphisms of the CD14 gene are not associated with bronchial asthma in Caucasian children. Eur J Immunogenet. 2003;30(5):345-8. 43. Kalliomaki M, Salminen S, Arvilommi H, Kero P, Koskinen P, Isolauri E. Probiotics in primary prevention of atopic disease: a randomised placebo-controlled trial. Lancet. 2001;357(9262):1076-9. 44. Isolauri E, Salminen S, Ouwehand AC. Microbial-gut interactions in health and disease. Probiotics. Best Pract Res Clin Gastroenterol. 2004;18(2):299-313. 45. Cario E, Rosenberg IM, Brandwein SL, Beck PL, Reinecker HC, Podolsky DK. Lipopolysaccaride activates distinct signaling pathways in intestinal epithelial cell lines expressing toll-like receptors. J Immunol. 2000;164(2):966-72. 46. Fusunyan RD, Nanthakumar NN, Baldeon ME, Walker WA. Evidence for an innate immune response in the immature human intestine: toll-like receptors on fetal enterocytes. Pediatr Res. 2001;49(4):589-93. 47. Matricardi PM, Rosmini F, Riondino S, Fortini M, Ferrigno L, Rapicetta M, Bonini S. Exposure to foodborne and orofecal microbes versus airborne viruses in relation to atopy and allergic asthma: epidemiological study. BMJ. 2000;320(7232):412-7. 48. Cario E, Podolsky DK. Differential alteration in intestinal epithelial cell expression of toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease. Infect Immun. 2000;68(12):7010-7. 49. Strannegard O, Strannegard IL. The causes of the increasing prevalence of allergy: is atopy a microbial deprivation disorder? Allergy. 2001;56(2):91-102.
Chapter III _________________________________________________________________________
54
50. Kalliomaki M, Kirjavainen P, Eerola E, Kero P, Salminen S, Isolauri E. Distinct patterns of neonatal gut microflora in infants in whom atopy was and was not developing. J Allergy Clin Immunol. 2001;107(1):129-34. 51. Fuller R. Probiotics in man and animals. J Appl Bacteriol. 1989;66(5):365-78. 52. Matricardi PM. Probiotics against allergy: data, doubts, and perspectives. Allergy. 2002;57(3):185-7. 53. Fooks LJ, Fuller R, Gibson GR. Prebiotics, probiotics and human gut microbiology. International Dairy Journal. 1999;9(1):53-61. 54. Isolauri E, Arvola T, Sutas Y, Moilanen E, Salminen S. Probiotics in the managment of atopic eczema. Clin Exp Allergy. 2000;30(12):1804-8. 55. Majamaa H, Isolauri E. Probiotics: a novel approach in the management of food allergy. J Allergy Clin Immunol. 1997;99(2):179-85. 56. Rosenfeldt V, Benfeldt E, Nielsen SD, Michaelsen KF, Jeppesen DL, Valerius NH, Paerregaard A. Effect of probiotic Lactobacillus strains in children with atopic dermatitis. J Allergy Clin Immunol. 2003;111(2):389-95.
57. Rautava S, Kalliomaki M, Isolauri E. Probiotics during pregnancy and breast-feeding might confer immunomodulatory protection against atopic disease in the infant. J Allergy Clin Immunol. 2002;109(1):119-21. 58. Kalliomaki M, Salminen S, Poussa T, Arvilommi H, Isolauri E. Probiotics and prevention of atopic disease: 4-year follow-up of a randomised placebo-controlled trial. Lancet. 2003;361(9372):1869-71. 59. Klinman DM. Immunotherapeutic uses of CpG oligodeoxynucleotides. Nat Rev Immunol. 2004;4(4):249-58. 60. Klinman DM, Yi AK, Beaucage SL, Conover J, Krieg AM. CpG motifs present in bacterial DNA rapidly induce lymphocytes to secrete interleukin 6, interleukin 12, and interferon gamma. Proc Natl Acad Sci. 1996;93(7):2879-83. 61. Kline JN, Waldschmidt TJ, Businga TR, Lemish JE, Weinstock JV, Thorne PS, Krieg AM. Modulation of airway inflammation by CpG oligodeoxynucleotides in a murine model of asthma. J Immunol. 1998;160(6):2555-9.
Chapter IV __________________________________________________________________________
55
Chapter IV
Aims of the study
“Wie naar de zon reist, geraakt nooit meer terug.”
Morgane Janssens, 7 jaar.
Chapter IV __________________________________________________________________________
56
Chapter IV __________________________________________________________________________
57
Chapter V:
� To select reproducible techniques for investigating innate markers in human biopsy
tissue.
�
To measure antimicrobial peptides and pathogen recognizing receptor tissue expression by
quantitative RT-PCR in upper airway mucosal biopsies .
� To locate PRR and defensin expression in upper airway tissue with
immunohistochemistry.
Chapter VI:
� To differentiate upper airway disease by measurement of innate markers.
Chapter VII:
� To correlate innate immune patterns to the adaptive immunological background in
upper airway inflammation of patients with and without cystic fibrosis.
Chapter VIII:
� To characterize macrophages in nasal polyp tissue by innate receptors and surface
proteins in patients with and without cystic fibrosis in order to identify
changes/disorders in first line cellular innate defence related to the different
immunological background of nasal polyps depending on lower airway co-morbidity.
� To characterize chronic rhinosinusitis by nasal biomarker profiles in order to support
the introduction of new definitions.
Chapter IV __________________________________________________________________________
58
Chapter V __________________________________________________________________________
59
Chapter V
Innate immunity
in the Upper Airway
Content: Introduction
Original article: Ultrastructural investigation of M.-cells and Lymphoepithelial contacts in naso-pharyngeal associated lymphoid tissue (NALT). Acta Otolaryngol (Stockh), 1996, suppl 523:40-42. S.Claeys, C.Cuvelier, J.Quatacker, P.van Cauwenberge.
Original article: Immunohistochemical analyses of the lymphoepithelium in human nasopharyngeal associated lymphoid tissue (NALT). Acta Otolaryngol (Stockh), 1996, suppl 523:38-39. S.Claeys, C.Cuvelier, P.van Cauwenberge.
Original article: Human β-defensins and toll-like receptors in the upper airway. Allergy, 2003, 58: 748-753. S.Claeys, T.de Belder, G.Holtappels, P.Gevaert, B.Verhasselt, P.van Cauwenberge, C.Bachert.
Chapter V __________________________________________________________________________
60
Introduction
Upper respiratory tract infections occur with a extreme high frequency and are responsible for a
large part of commonly used anti-microbial agents. The refractory nature of an increasing amount of
these infections, caused by the appearance of drug-resistant bacteria, represents a major health
problem. The interest for natural defence mechanisms in the human organism is therefore increasing.
The upper airway mucosa is considered as an important interface between the environment and the
underlying immune system with a significant role in immune homeostasis.
Before 1996 we approached the immune functions of the mucosal membranes and mucosal
associated lymphoid tissue by their functional anatomy. The human palatine tonsils and the
nasopharyngeal tonsil are described as mucosal associated lymphoid tissue (MALT) located in
strategic areas of the oropharynx and nasopharynx. Mucosal infections are prevented by the
mucociliary defence system containing mucus and cilia for pathogen clearance and enzymes
(lactoferrin, lysozyme) and peroxidases with the ability to inhibit and kill pathogens.
The presence of B-cells in the MALT, with the capacity to produce specific secretory
immuunglobulins (sIgA sIgM), and a vast amount of sub- and intraepithelial dendritic cells and
macrophages with antigen presenting capacity, indicate an important role for a regionalized acquired
immune defense. Our interest for the mucosal epithelium as active participant in immune regulation
started with the ultrastructural investigation of M-cells and immunohistochemical analyses of the
lymphoepithelium in human nasopharyngeal associated lymphoid tissue (NALT).
In that period of time the concept was introduced that respiratory secretions are broadly
antimicrobial. Both nasal and lung secretions showed to be antimicrobial due to cationic
components: lysozyme, lactoferrin, SLPI (secretory leukoprotease inhibitor), neutrophil and
epithelial defensins .(1,2,3)
The concentration of epithelial defensins in respiratory fluid is highly dependent on inflammatory
triggers, which makes them interesting markers for upper airway tissue inflammation. However, the
concentration of human beta defensins (HBD1 and HBD2) in inflamed nasal fluid and BALF (~ 1 µ
/ml) are about a thousand fold lower than those of lysozyme and lactoferrin.(4) Since the epithelial
fluid layer is very thin under resting conditions, it is necessary to subject the epithelium to
mechanical or chemical stimulation in order to collect sufficient volume of respiratory fluid for
research on human donors. These measures however unavoidably modify the secretions. Therefore,
in our attempt to identify the influence of upper airway disease states on hBD metabolism, we used
RT-PCR on tissue biopsies to quantify the expression of these peptides.
Chapter V __________________________________________________________________________
61
Table: Antimicrobial polypeptides in respiratory secretions in human Polypeptide size source Activity against Lysozyme (6) 14 kD enzyme
Phagocytotic and secretory granules from neutrophils Monocytes/macrophages Epithelial cells
Peptoglycan (G+species)
Lactoferrin (7) 80 kD Specific granules of neutrophils Epithelium
Inhibits microbial growth by sequestering iron essential for microbial respiration N-terminal cationic fragment (Lactoferricin is directly microbicidal)
Secretory leukoprotease inhibitor SLPI
12 kD contains two similar domains
Epithelial cell Macrophages (secretory and cytosol component)
N-terminal domain: modest antimicrobial activity against G+ and G- bacteria (8) C-terminal domain: acts as inhibitor of neutrophil elastase and macrophage responses to LPS (9)
Human defensins (10)
3-5 kD peptides
αααα defensins human neutrophil peptides (HNP 1-4): azurophil granules of neutrophils human defensins (HD 5-6): Paneth cells (11) ββββ-defensins (12) human beta defensins (HBD1-4) (13)(14)(15)(16) epithelial organs
Gram positive and gram-negative bacteria, yeast, fungi, enveloped viruses
In order to understand regulation of beta defensins, HBD-2 is regarded as prototype. The regulation
of HBD2 is probably dependent on two circuits: firstly a direct epithelial response to LPS (high
threshold) most likely mediated by CD14/TLR/NF-κB (5) and secondly an indirect cytokine-
mediated epithelial response triggered by the encounter of microbes with local macrophages (lower
threshold). The latter then produce IL-1α/β and other cytokines which act on epithelial cytokine
receptors to increase defensin synthesis. (4) This dual scheme prevents promiscuous activation by low
concentration of inhaled non-invasive microbes and maintains the ability to activate local host
defences in response to larger boluses of microbes or after epithelial penetration by a small amount
of invasive microbes.
In our initial work we were the first to evaluate expression of human beta defensins and toll like
receptors in upper airway tissue in different disease states. Especially in tonsils, probably due to
colonization with a the large variety of microbes in the crypts, the presence of inducible defences
Chapter V __________________________________________________________________________
62
(HBD2 and HBD3) is pronounced. The absent upregulation of HBD in adenoids or sinuses indicate
a probable insufficient local tissue inflammation or an efficient clearence of colonizing microbial
material. No correlation could be found with TLR expression changes, but the overall expression of
TLR in upper airway tissue indicate the role of TLR as important immune sensors of the upper
airway. Common upper airway disease is apparently not capable of disorganizing the innate immune
References (1) Travis SM, Conway BA, Zabner J, Smith JJ, Anderson NN, Singh PK, Greenberg EP, Welsh MJ. Activity
of abundant antimicrobials of the human airway. Am J respir Cell Mol Biol. 1999; 20: 872-879 (2) Cole AM, Dewan P, Ganz T. Innatae antimicrobial activity of nasal secretions. Infect Immun 1999; 67:
3267-3275
(3) Cole AM, Liao H, Stuchlik O, Tilan J, Pohl J, Ganz T. Cationic polypeptides are requied for antibacterial activity of human airway fluid. L. Immunol 2002; 169: 6985-6991
(4) Singh PK, Jia HP, Wiles K, Hesselberth J, Liu L, Conway BD, et al. Production of b-defensins by human
defensin 2-expression in human tracheobrochial epithelium. J Biol Chem 2000; 275: 29731-29736 (6) Laible NJ, Germaine GR. Bactericidal activity of human lysozyme, and cationic polypeptides against
Streptococcus sanguis and streptococcus faecalis; inhibition by chitin oligosaccharides. Infect Immun 1985; 48: 720-728
(7) Ellison RT, Giehl TJ. Killing of gram-negative bacteria by lactoferrin and lysozyme. J Clin Invest 1991;
(9) Zhu J, Nathan C, Ding A. Suppression of macrophage responses to bacterial lipopolysaccharide by non-secretory form secretory leucocyte protease inhibitor. Biochim. Biophys Acta 1999; 1451:219-223
(10) Lehrer RI, Lichtenstein AK, Ganz T. Defensins: antimcrobial and cytotoxic peptides of mammalian cells
Annu Rev Immunol 1993; 11:105-128 (11) Jones DE, bevins CL. Paneth cells of the human small intestine express an antimicrobial peptide gene. J
Biol Chem 1992; 267: 23216-23225 (12) Harder J, Bartels J, Christophers E, Schroder JM. A peptide antibiotic from human skin. Nature 1997; 387:
861-862 (13) Zhao CQ, Wang I, Lehrer RI. Widespread expression of beta-defensin HBD-1 in human secretory glands
and epithelial cells. FEBS lett 1996; 396: 319-322 (14) Bals R, Wang X, Wu Z, Freeman T, Bafna V, Zasloff M, Wilson JM. Human beta-defensin 2 is a salt-
sensitive peptide antibiotic expressed in human lung. J Clin Invest 1998;102: 874-880 (15) Harder J, Bartels J, Christohers E, Schroeder JM. Isolation and characterization of human beta-defensin 3,
a novel human inducible peptide antibiotic. J Biol Chem 2001; 276: 5707-5713 (16) Garcia JR, Krause A, Schulz S, Rodriguez-Jimenez FJ, Kluver E, Adermann K et al. Human beta-defensin
4: a novel inducible peptide with a specific salt sensitive spectrum of antimicrobial activity. FASEB J 2001; 15: 1819-1821
(17) Turner J, ChoY, Dinh NN, Waring AJ, Lehrer RI. Activities of LL-37, a cathelicidin-associated
antimicrobial peptide of human neutrophils. Antimicrob Agents Chemother 1998; 42: 2206-2214
Chapter V __________________________________________________________________________
63
Original article Ultrastructural Investigation of M-cells and Lymphoepithelial Contacts in Naso-pharyngeal Associated Lymphoid Tissue (NALT) S. CLAEYS,1 C. CUVELIER,2 J. QUATACKER,2 and P. VAN CAUWENBERGE
1
From the Department of 1 Otorhinolaryngology and 2Pathology, University Hospital Ghent, Belgium
Claeys S, Cuvelier C, Quatacker J, van Cauwenberge P. Ultrastructural investigation of M-cells and lymphoepithelial contacts in naso-pharyngeal associated lymphoid tissue (NALT). Acta Otolaryngol (Stockh) 1996; Suppl.523: 40-42. The nasopharyngeal and palatine tonsil, two lymphoepithelial structures situated at the entrance of respiratory and gastrointestinal tracts, show striking similarity with lymphoid tissue of bronchus and gut (BALT, GALT). The information obtained by previous investigations in our laboratory on M-cells in the lymphoepithelium of the Peyer's patches (PP) served as a guidance in our search for M-cells in adenoids and tonsils. Key words: M-cells, adenoid, tonsil, lymphoids. INTRODUCTION The epithelial barrier in PP, separating the luminal content from the underlying lymphoid tissue, contains mem-branous epithelial cells (M-cells) which allow uptake of different-sized molecules (bacteria, virus, mycobacteria) through an intact intestinal epithelium. In the follicle-associated epithelium (FAE) of PP, M-cells are nicely aligned next to enterocytes. The regular microvillous pattern formed by enterocytes is interrupted by the irregular microfolds of the M-cells. Its nucleus is usually found in the basal part of the cytoplasm underneath the central hollow caused by intercellular mononuclear cells. Because of the flexibility of the M-cells, the underlying lymphoid cell can reach the lumen up to 3�, only separated from it by a thin rim of cytoplasm. M-cells rest on a discontinuous basal membrane. Their cytoplasm contains abundant endocytotic vesicles and mitochondria in the apical part of the M-cell, few lysosomes and the epithelial character is confirmed by interepithelial contacts (desmosomes and tight junctions). Hithereto reliable identification of M-cells is possible only with electron microscopy. With conventional light microscopy, M-cells are only suspected by the presence of superficial intraepithelial groups of lymphoid cells. M-cells in the epithelium of the nasopharyngeal tonsil were first discribed by Karchev & Kabakchiev (2) in 1984. Even so, information and illustration of M-cell like structures in NALT are scarce in literature. The aims of this study were first to positively identify M-cells in the NALT and secondly to evaluate the possible role of the M-cells in antigen uptake and transport to underlying lymphoid cells by demonstrating lymphoepithelial contacts. MATERIAL AND METHODS Biopsy of 17 dissected adenoids and 14 tonsils from 24 patients undergoing adenotomy, tonsillectomy or both were immediately fixed in 0.8% paraformaldehyde and 2.5% glutaraldehyde in 0.2 M-sodiumcacodylate buffer
pH 7.2. After fixation the tissue was washed in buffer, dehydrated and embedded in Epon. Semi-thin sections (1 �) mounted on glass slides and stained with toluidin blue allowed us to select areas with superficial lymphoid cells where M-cells were suspected. Ultrathin sections were mounted on uncoated slim bar 200 mesh copper grids and stained with uranyl acetate and led citrate and examined under a Zeiss EM 900 electron microscope. RESULTS Adenoids M-cells were regularly found as interruptions of the pseudostratified ciliary epithelium. The surface was characterized by the presence of microfolds instead of microcilli. The cytoplasm contained elaborate endocytotic vesicles and mitochondria and in a basal or basolateral hollow mononuclear lymphoid cells were found. The connection between M-cells and neighbouring epithelial cells was demonstrated by tight junctions and desmosomes (Fig. 1). M-cells were found to be in close contact with active lymphoid cells (Fig. 2). Areas where we found large amounts of superficially localised active lymphoid cells were clearly more covered with M-cells than areas where lymphoid cells were less superficially localised and contained fewer activated organelles. Tonsils Because of the more complex structure of the crypt epithelium in palatine tonsils, M-cell identification was less obvious. We succeeded in demonstrating presumed M-cell and lymphoepithelial contacts (Fig. 3). DISCUSSION M-cells were undeniably identified in adenoids, and their morphological characteristics were similar to those of the M-cells found in PP.
Chapter V __________________________________________________________________________
64
In the gut, antigen (e.g. Vibrio cholera (3), Salmonella typhimurium (4) Reovirus (5), Yersinia Enterocolotica (6), HIV I (7)) uptake and transport to underlying lymphoid cells was confirmed by experiments in animals. In adenoids, lymphoepithelial contacts were demonstrated which favours the hypothesis that the M-cell function comprises more than passive antigen transmission to underlying lymphocytes. The association of activated lymphoid cells and M-cells and the absence of M-cells in areas with few lymphocytes is another argument for elaborate interaction. Massive antigen-handling by M-cells in the NALT might eventually result in lymphocyte activation and hence hyperplasia of tonsils and adenoids.
REFERENCES 1. Cuvelier CA, Quatacker J, Mielants H, De Vos M, Veys E, Roels HJ. M-cells are damaged and increased in number in inflamed human ileal mucosa. Histopathol-ogy 1994; 24: 417-26. 2. Karchev T, Kabakchiev P. M-cells in the epithelium of the nasopharyngeal tonsil. Rhinology 1984; 22: 201-10. 3. Owen RL, Pierce NF, Apple RT, Cray W. M-cell transport of Vibrio Cholera from the intestinal lumen into Peyer's patches: a mechanism for antigen sampling and for microbial transepithelial migration. J Infect Dis 1986; 1153: 1108-18. 4. Clarck MA, Jepson MA, Sommons NL, Hiest BH. Res Microbiol 1994; 145: 543-52. 5. Wolf JL, Kauffman RS, Finberg R, Dambrauskas R, Fields BN, Trier J. Determinants of reovirus interaction with the intestinal M-cells and absorptive cells ofmurine intestine. Gastroenterology 1983; 85: 291-300. 6. Grutzkau A, Hanski C, Hahn H, Riecken EO. Involvement of M-cells in the bacterial invasion of Peyer's patches: a common mechanism shared by Yersinia Ente-rocolitica and other enteroinvasive bacteria. Gut 1990; 31: 1011-5. 7. Amerongen M, Weltzin M. Transepithelial transport of HIV I by intestinal M-cells: a mechanism for transmi-sion of AIDS. Cell Tissue Res 1987; 248: 645-51
Fig. 1. The microvillar pattern of the adenoid epithelium is interrupted by the microfolds of the M-cell. Two lymphoid cells are trapped in the cytoplasm of the M-cell and are only separated from the lumen by a thin rim of cytoplasm. Intercellular contacts between M-cell and respiratory cell show the epithelial character of the M-cell.
Fig. 2. Cytoplasmatic folds of the lymphoid cell reach for the superficial M-cell. Both cells are in an activated stage (many mitochondria).
Fig.3. M-cell in tonsil overlying an activated lymphoid cell.
Chapter V __________________________________________________________________________
65
Original article Immunohistochemical Analyses of the Lymphoepithelium in Human Nasopharyngeal Associated Lymphoid Tissue (NALT) Preliminary Results S. CLAEYS1, C. CUVELIER2 and P. VAN CAUWENBERGE1 From the Departments of' Otorhinolaryngology1 and Pathology2, University Hospital, Ghent, Belgium Claeys S, Cuvelier C, van Cauwenberge P. Immunohistochemical analyses of the lymphoepithelium in human nasopharyngeal associated lymphoid tissue (NALT). Acta Otolaryngol (Stockh) 1996; Suppl 523: 38-39. M-cells and their lymphoepithelial contacts were studied in a morphological study by using electron microscopy. To get insight into lymphoepithelial interactions and inflammatory processes in the NALT we compared M-cell rich areas (established by electron microscopy) in adenoids and tonsils, with areas lacking M-cells and intraepithelial lymphoid cells. Immunohistochemical techniques were used. Key words: adenoid, M-cells, VCAM-1, ICAM-l, Ki 67, differentiation markers. INTRODUCTION Electron microscopic investigation of M-cells in adenoids and tonsils confirmed the similarity in morphological characteristics of M-cells in nasopharyngeal associated lymphoid tissue (NALT) and gut associated lymphoid tissue (GALT) (1). To assess the function of M-cells in NALT three arguments have to be taken into account: First there is the specific localisation of M-cells in Peyer's patches (PP) (2) in the gut and in adenoids and tonsils, both areas with considerable immunological activity and both very important for obtaining information from external agents (alimentary and airborne). Secondly, M-cells are typically found in lymphocyte-rich areas in NALT and are absent in areas devoid of lymphoid cells (1). Thirdly there is a close association between M-cells and active lymphoid cells, the latter being trapped in a basolateral hollow of the former (1, 2). We used different cell markers and adhesion molecules of inflammation to learn more about specific lympho-epithelial interactions and to study the functional status of the M-cells immediate environment (3, 4). MATERIAL AND METHODS Biopsies of 30 dissected adenoids and tonsils from 25 patients (aged 3 to 22 years) undergoing ade-notomy and tonsillectomy because of recurrent tonsillitis or hypertrophy of tonsils or adenoids were used. Specimens were partly frozen or paraffin embedded. Frozen 6 fi-thick sections were air-dried, acetone fixed and processed for immunohistochemistry with a series of monoclonal antibodies recognizing various adhesion molecules (VCAM-1, ICAM-l, P-Selectin). For examination of proliferation (Ki 67) and differentiation (UCHL-1, MLA, CD-20, CD68) markers, we used 5-p. -thick paraffin sections. RESULTS Differentiation markers With UCHL-1, CD-20 and CD68 cell markers we examined the subepithelial lymphoid population. Our goal
was to make a qualitative examination only, though the difference in lymphoid population between M-cell rich and M-cell poor areas was mainly quantitative; especially B-cells and macrophages were found in larger amounts, more grouped and more superficially localized in the subepithelium of M-cell rich areas. In these zones, T-cells appeared more dispersed, though the number was also clearly larger than in M-cell-poor areas. Proliferation markers We found no Ki 67 present in the surface epithelium and only slight expression in the crypt epithelium. However, in germinal centres and in epithelium overlying the germinal centres, there was clearly increased expression of this proliferation marker. Cell adhesion molecules From the immunoglobulin superfamily we used ICAM-l and VCAM-1. ICAM-l was positive in lymphoid cells at the periphery of the germinal centres, in the crypt epithelial cells, and in the endothe-lium of vessels. VCAM-1 was strongly expressed in the germinal centres and focally in the crypt epithelial cells. In the subepithelial zone as well as in the basal layer of the crypt, epithelial cells VCAM-1 were irregularly expressed. P-selectin (CD62 P, PADGEM) was used, representing the selectin group. It was clearly expressed in the high endothelial venules and only weakly in the subepithelial capillaries. There was no P-selectin expression in germinal centres. VLA-2 alpha chain (CDw49b, VM1) was chosen as a member of the integrin family. Whereas its expression was pronounced in the crypt epithelial cells, it was completely negative in surface epithelium. DISCUSSION The difference in lymphoid population found in M-cell-rich and M-cell-poor areas was confirmed by
Chapter V __________________________________________________________________________
66
inflammatory activation markers. In the M-cell rich epithelium there was not only an increase of inflammatory cells but also augmented expression of ICAM-1 and VCAM-1 (locally) and VLA2. ICAM-1, UCHL-1 and P-selectin were more expressed in the subepithelial layer of the crypts than under the surface epithelium. Proliferative activity was largely confined to the germinal centres. CONCLUSION The crypt epithelium shows a high activation status, especially where it is in contact with the germinal centres and in areas strongly infiltrated by inflammatory cells. It differs from the surface epithelium in that the latter contains no inflammatory cells and exhibits no lymphoepithelial activity. This is reflected by the absence of cell adhesion molecule expression.
REFERENCES 1. Claeys S, Cuvelier C, Quatacker J, Van Cauwenberge P. Ultrastructural investigation of M-cells and lymphoepithelial contacts in naso-pharyngeal associated lymphoid tissue (NALT) Acta Otolaryngol (Stockh) 1996; Suppi 523: 40-2. 2. Cuvelier C, Quactacker J, Mielants H, De Vos M, Veys E, Roels H. M-cells are damaged and increased in number in inflamed human ileal mucosa. Histopathology 1994; 24: 417-26. 3. Springer T. Traffic signals for lymphocyte recirculation and leucocyte emigration: the multistep paradigm. Cell 1994; 76: 301-14. 4. Fujimura Y, Kihara T. Immunohistochemical localisation of intercellular adhesion molecule-1 in follicle associated epithelium of Peyer's patches. Gut 1994; 34: 46-5
Chapter V __________________________________________________________________________
67
Original article
Human β-defensins and Toll-like Receptors in the Upper Airway. Background: Measurement of innate markers in nasal mucosa, tonsils and adenoids might lead to new views about the role of innate immunity in the upper airway. In this study, the expression of human β-defensins (HBD) 2 and 3 and Toll-like receptors (TLR) 2 and 4 in various upper airway diseases was investigated. Methods: Surgical samples from patients with tonsillar disease (n=18), hypertrophic adenoids (n=10) and sinonasal disease (n=30) (chronic sinusitis, nasal polyps, turbinate mucosa as controls) were investigated by immunohistochemistry. Quantification of HBD-2 and 3 mRNA, TLR-2 and 4 mRNA expression was performed by real-time PCR. Results: Immunohistochemistry revealed a strong expression of HBD-2 in tonsillar tissue. Quantification of HBD-2 and HBD-3 mRNA showed a more than tenfold higher expression in tonsillar tissue than in adenoids, whereas in nasal biopsies, only negligible defensin expression could be measured. No significant differences were found for TLR-4 between the various tissues, whereas TLR-2 expression in adenoids was significantly lower compared to other tissues. Conclusion: These results demonstrate a strong defensin expression in tonsillar tissue compared to nasal and paranasal mucosa and adenoids. Toll-like receptor expression in all these tissues illustrates a possibly important immunological sentinel function of upper airway mucosa.
S. Claeys1; T. de Belder1; G. Holtappels1; P. Gevaert1; B. Verhasselt2; P. Van Cauwenberge1; C. Bachert1 1Department of Otorhinolaryngology, Ghent University, Belgium 2Department of Clinical Chemistry, Microbiology and immunology, Ghent University, Belgium Keywords: adenoids; chronic sinusitis; β-defensins; innate immunity, lymphoid tissue; nasal polyps; polymerase chain reaction (PCR); toll-like receptor; tonsils.
Allergy 2003
The upper airway has an important role in the first encounter of antigens and pathogens with the body. It is well known that adaptive immunity functions through specialized structures like tonsils and adenoids, with a characteristic mucosal-lymphoid association (nasal associated lymphoid tissue: (NALT)) (1). Also the delicate undifferentiated epithelial lining of the nose has developed several mechanisms for protection against microorganisms. These are unspecific mechanical factors such as mucociliary clearance, triggering of sneezing and surface phagocytic clearance, contributing to the prevention of microorganical invasion (2, 3). Antimicrobial peptides, of which the β-defensins are constitutively or inducibly expressed in human epithelia and mucosal surfaces, cooperate with these mechanical factors to give an immediate protection against bacterial overgrowth (4-6). Defensins are bactericidal and fungicidal peptides on the body surfaces of invertebrates and vertebrates and in phagolysosomes of circulating phagocytes. Defensins can also induce and enhance an appropriate local and systemic adaptive answer through their signalling function (7). Human β-defensin (HBD)-2 exhibits a potent antimicrobial activity against gram-negative bacteria (Escheria coli, Pseudomonas aeruginosa) and Candida, and only a bacteriostatic activity against Staphylococcus aureus (8). HBD-3 shows bactericidal activity against gram-negative as well as gram-positive bacteria, including S. aureus, probably due to its capacity to form __________ Abbreviations: HBD: Human beta defensin; TLR: Toll-like receptor; NALT: Nasal associated lymphoid tissue; M-cells: Membranous epithelial cells; BAL: Bronchoalveolar lavage; LPS: Lipopolysaccharide
an amphipathic dimer structure and its increased positive surface charge compared to HBD-2 (8). In contrast to HBD-1, which is constitutively expressed in epithelial surfaces (9), HBD-2 and HBD-3 expression is more variable and inducible (8). HBD-2 represents the first human defensin shown to be produced following stimulation of epithelial cells with microorganisms (gram-negative, gram-positive bacteria and Candida Albicans) or cytokines such as tumour necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) (8). HBD-3 expression is induced by the same external stimuli, but also upon stimulation with IFN-γ (10, 11).
The promotor regions of HBD-2 genes contain several sequences recognized transcription factors, including NF-κB (12-14). Upstream of the coding sequence of HBD-3, there are no NF-κB response elements suggesting that the expression of HBD-2 and HBD-3 genes is differently regulated (15, 16). The HBD-2 and HBD-3 gene and proteins are locally expressed in inflammatory skin lesions such as psoriasis (8, 17). HBD-2 has been found in the infected lung epithelia of patients with cystic fibrosis (18). Expression of HBD-3 has been localized in heart, skeletal muscle, placenta, oesophagus, trachea, oral mucosa and skin tissues (11, 15).
However, although a specific spectrum of activity and a selective induction mechanism for every defensin has been proposed, the influence of the micro-environment on local defensin expression and production is still poorly understood. Studies of these peptides in tissue samples obtained from patients with different physiopathological influences will elucidate the possible (therapeutic) value of natural innate antimicrobial molecules. In this study, the expression of HBD-2 and HBD-3 mRNA was evaluated in tonsillar tissue in two
Chapter V __________________________________________________________________________
68
disease states (idiopathic hypertrophic tonsils versus recurrent tonsillitis), in hypertrophic adenoids and in the sinonasal tissue, in chronic sinusitis, nasal polyps and turbinate mucosa.
The internal epithelial surface of the upper airway provides not only a barrier but also site of active interaction between pathogens and the innate and adaptive immune systems. Tonsils and adenoids, which are located at a critical position for immunological detection of airborne or ingested antigens, possess differentiated membranous epithelial cells (M-cells) (19). It is suggested that these specialized M-cells with their microvillous surface, abundant organelles, micropinocytotic vesicles and close relation to underlying lymphoid cells, play an important role in antigen sampling (20). However, M cells represent only a small percentage (< 5%) of follicle associated epithelial cells and, in addition, are not found in non-lymphoid associated mucosa (e.g. epithelial lining of the nose) (21). The ability of monocytes/ macrophages or granulocytes to recognize foreign microbial matter is well known since long, however the discovery of Toll like receptors (TLRs), a specific recognition mechanism for micro-organisms, on epithelial cells suggests a role for the surface epithelium in the frontline of the mucosal immune system (22, 23). This also suggests a possible recognition by the underlying immune system of antigen without prior damage to the epithelial barrier. TLR expression has been detected on different cells of the immune system (monocytes, macrophages, dendritic cells, γδ Tcells, Th1 and Th2 αβ T cells and B cells) illustrating their role in modulating inflammatory responses (24). TLR expression on intestinal epithelial cells (25,26), human oral epithelial cells (23) and airway epithelia (27) supports their sentinel role at the interface with the environment. Currently, no studies have measured TLR expression in various upper airway tissues (in tonsils, adenoids as well as in nasal mucosa) and in different disease states.
In this study we attempted to determine the role of nasal mucosa and NALT as sentinels for the innate immunity by the measurement of TLR-2 and TLR-4 expression in tonsillar disease, hypertrophic adenoids and sinonasal disease. Material and Methods Tissue samples were collected during surgery and immediately snap frozen in liquid nitrogen. Three specific tissues were investigated in this study: tonsils, adenoids and nasal mucosa. In the tonsil group we distinguished two groups: (1) 8 patients (6 male, 2 females, age 2-5 year) who underwent a tonsillectomy under general anaesthesia because of idiopathic tonsillar hypertrophy (substantial enlarged tonsils, no history of recurrent tonsillitis) and (2) 10 patients (1 male, 9 female, age 2-37 year) who underwent a tonsillectomy under general anaesthesia because of recurrent tonsillitis (small or substantial enlarged tonsils, history of recurrent tonsillitis). In the adenoid group, 10 patients (8 males, 2 females, age 2-14 year) were included, who underwent an
adenoidectomy because of enlarged adenoids causing nasal obstruction. In the nasal mucosa group, 30 patients who underwent functional endoscopic sinus surgery were divided into three groups: (1) 10 patients with nasal polyps (5 male, 5 female, age 21-81 year) (2) 10 patients with chronic sinusitis (5 male, 5 female, age 23-71 year) and (3) 10 control patients without mucosal disease (inferior turbinate mucosa) (8 male, 2 female, age 14-63 year). Immunohistochemistry Cryostat sections (6 µm) were prepared and mounted on SuperFrost Plus glass slides (Menzel Glaeser, Braunschweig, Germany). Specimens were fixed in 4% buffered formaldehyde and washed with PBS containing 15% sucrose. Endogenous peroxidase was blocked for 20 minutes with 0,3% H2O2, 0,1 % sodium azide in TBS. Slides were incubated for 30 minutes in 10% milk powder to block non specific binding. For the detection of HBD-2, sections were incubated for 60 minutes with the primary antibody (goat anti-human HBD-2, Peprotech, London, UK). As negative control, normal goat IgG (Peprotech) was used. After washing, the expression of HBD-2 was visualized using the LSAB technique conjugated with peroxidase according to the manufacture’s instructions (labelled streptavidine-biotin, Dako Cytomation, Heverlee, Belgium). Sections were incubated with AEC-chromogen, which results in a red-stained precipitate. Finally, sections were counterstained with Haematoxylin and mounted. RNA preparation and Real-Time-Quantitative RT-PCR Snap frozen tissue samples were placed in liquid nitrogen and thoroughly grinded with a mortar and pestle and homogenized using QIAshredder (Qiagen, Hilden, Germany). Total RNA was purified using Rneasy (Qiagen) as recommended by the manufacture. One µg of total RNA was reverse transcribed to generate cDNA with SuperScriptTMII (Invitrogen, Merelbeke, Belgium) in the presence of oligo(dT), random primer, DTT and dNTPs. Primers and probes used for PCR amplification were purchased from Eurogentec (Liège, Belgium) and sequences are listed in Table 1. Real-time PCR was performed in a 25 µl reactions mix-ture (composed of 5µl cDNA (equivalent to 25 ng total RNA), 10 pM (final concentration) oligonucleotide primers, 2.5 pM probe, 5 mM MgCl2, 200 µM dNTPs, and 0.025U/µl Hot GoldStar enzyme (Eurogentec)) measured with a Perkin Elmer ABI Prism 7700 Sequence Detection System (Applied Bio- systems, Foster City, CA, USA). Reactions were incubated for 10 minutes at 95°C, followed by 45 cycles of a two-step amplification-procedure composed of annealing/ extension at 60°C for 1 minute and denaturation for 15 seconds at 95°C. In each run, dilution series of pooled cDNA from donor adenoids were amplified to serve as a standard curve for calculation of relative quantities.
Chapter V __________________________________________________________________________
69
Table 1. Sequences of primers and probes used for PCR amplification (1) human HBD-2: sense, 5’-TGATGCCTCTTCCAGGTGTTT-3’; antisense, 5’-GGATGACATATGGCTCCACTCTT-3’;
Statistical analysis Data are expressed as median and interquartile range (IQR). When comparisons were made between groups, significant between-group variability was first established using the Kruskal-Wallis test. The Mann Whitney U-test was then used for between-group (unpaired) comparison. Spearman rank correlation coefficient (r) was used to assess the relationships between the parameters. P-values less than 0.05 were considered statistically significant. Results HBD-2 and HBD-3 Immunohistochemistry demonstrated staining for HBD-2 peptide in most tonsils, both in the surface epithelium and in the crypt epithelium of the tonsil (Fig 1). In adenoids, HBD-2 staining could be detected only in two selected cases which had borderline positive HBD-2 mRNA expression. In the mucosa of the turbinates and in patients with chronic sinusitis or nasal polyposis, immunohistochemistry remained negative for HBD-2.
Quantification of HBD-2 and HBD-3 expression by real-time PCR confirmed a strong expression of HBD-2 and HBD-3 mRNA in tonsillar tissue in with no significant difference between the idiopathic hypertrophic tonsillar disease and recurrent tonsillitis. Furthermore, HBD-2 and HBD-3 showed a significant correlation in mRNA expression in tonsillar disease (r = 0.64; p = 0.002). HBD-2 and HBD-3 mRNA was below detection level in adenoids and in sinonasal mucosa of patients with chronic sinusitis, nasal polyps or turbinate mucosa of controls. Taken together, HBD-2 and HBD-3 was significantly
more expressed (p = 0.02; p < 0.001 respectively) in tonsillar tissue compared to adenoids and sinonasal mucosa (Fig.2). TLR-2 and TLR-4 Real time PCR showed a constant expression of TLR-2 and TLR-4 mRNA in all tissues examined. In tonsillar disease, there was no significant difference of expression for both TLRs between the different patient groups. A statistically significant (p = 0.04) lower expression of TLR-2 in adenoids was measured compared to all tonsillar tissue. TLR-2 and TLR-4 mRNA expression in sinonasal mucosa was clearly shown, but no difference in the selected patient groups could be assessed. Yet, TLR-2 and TLR-4 mRNA expression in nasal tissues were significantly correlated (r = 0.57, p = 0.001) (Fig.3) A correlated expression for defensins and TLR mRNA was difficult to assess, yet we measured a significant inverse correlation between HBD-3 and TLR-4 (r =-0.517; p = 0.02) in tonsillar tissue. Fig.1: Staining for HBD-2 in tonsils (original magnification) A. surface epithelium B. crypt epithelium
A
B
Chapter V __________________________________________________________________________
70
HBD-3
6
5
4
3
2
1
0
TC TCH AO NP CS CO
HBD-2
10
9
8
7
6
5
4
3
2
1
0
TC TCH AO NP CS CO
TLR-2
2,5
2,0
1,5
1,0
0,5
0,0
TC TCH AO NP CS CO
TLR-4
1,6
1,4
1,2
1,0
0,8
0,6
0,4
0,2
TC TCH AO NP CS CO
Discussion The concept, that the mucosa of the respiratory tract acts as an immunological organ is now widely accepted. It was proposed that in the airway epithelia both HBD-2 and HBD-3 respond to pro-inflammatory stimuli with an increase in mRNA expression and peptide abundance (9, 28). It has also been demonstrated that HBD-2 is present in higher levels in bronchoalveolar lavage (BAL) or plasma specimens from patients with inflammatory lung disease such as cystic fibrosis (28), pneumonia (29) and atypical mycobacterial infections (30) than in healthy persons. We have shown here that in sinus disease, environmental triggering was apparently not sufficient to induce HBD-2 and HBD-3 expression or production. There was no baseline detection of HBD-2 and HBD-3 in any sinus sample and no upregulation could be measured for HBD-2 and HBD-3 in paranasal mucosa in patients with chronic sinusitis or nasal polyposis compared to turbinate mucosa of the control group.
In human palatine tonsils the expression of HBD-2 has been shown before (31). We tried to establish whether the disease state of the tonsil was related to the expression of HBD-2. No significant difference in HBD-2 mRNA expression could be established between both patient groups (idiopathic hypertrophic tonsils versus recurrent tonsillitis). Furthermore, the absence of HBD-2 and HBD-3 mRNA in adenoids and (para)nasal mucosa emphasizes that normal bacterial triggering in this tissue is insufficient to stimulate defensin expression and production or that other defence mechanisms take over this task.
Possibly, the intensive mechanical clearance in the nose and nasopharynx helps to diminish the contact time with environmental microorganisms, which could mean that defensin induction needs a more intensive and prolonged microorganical triggering.
Chapter V __________________________________________________________________________
71
The deep crypts and the excessive microorganical load and bacterial diversity in tonsils (32) could explain the more pronounced presence of inducible antimicrobial peptides in this tissue.
The ancient co-existence between micro-and multi-organical lives probably made it possible to coexist without exhausting defence resources. In physiologic circumstances, innate defence mechanisms might be less important, and its fast, powerful and specific defence mechanisms are preserved until the mechanical barrier function fails. Singh et al. (9) suggested that airway epithelia might wait for a second response signal, such as IL-1 release from macrophages, before responding by inducing expression and secretion of HBD-2. Indeed, they found that the induction of the HBD-2 gene expression in well-differentiated primary cultures of human airway epithelia was much more responsive to LPS when the epithelia were exposed to bacterial products in the presence of alveolar macrophages. Additional research is needed to determine the relative importance of multiple bacterial products and cytokines in the direct regulation of β-defensin expression in airway epithelia. Another question remains: what are the relevant receptors and ligands that determine the expression of antimicrobial peptides in human?
Common molecular repeating patterns on pathogens are recognized directly by pattern-recognizing receptors (PRRs) like TLRs and a cellular response is induced mediated by a transmembrane signal transduction (33). Triggering of the intracellular signalling pathway of TLRs does not only initiate innate immunity responses, it can also lead to the induction of adaptive immunity due to induction of cytokines, chemokines and co-stimulatory molecules (CD80 and CD86 on macrophages and dendritic cells) (34). Currently ten distinct TLRs have been described, each with different binding capacity. Both TLR-2 and TLR-4 have been identified as signalling receptors activated by bacterial cell wall components (35). TLR-4 signals the presence of LPS by associating with CD14 (14) in macrophages, while TLR-2 signals the presence of different microbial constituents like proteoglycans or lipoteichoic acid of the gram-positive bacteria (36,37). Therefore it has been suggested that the expression of TLR 2 confers responsiveness to Staphylococcus aureus and Streptococcus pneumoniae, gram-positive bacteria of important clinical significance in upper airway disease and that TLR-4 may be more specific for gram-negative bacteria (38, 39). In our investigation with real-time PCR, a clear expression of TLR-2 and TLR-4 mRNA in all tissues was shown. Ligand binding of TLRs induces signal transduction via NF-κB dependent pathways (39) and genomic analysis of the 5’ flanking region of the β-defensin gene shows consensus sequence sites
for regulators of transcription like NF-κB (13). This might imply a role for microbial stimulation via TLRs in β-defensin expression but the exact involvement of TLR ligand binding in β-defensin regulation in human remains to be determined (40). In our study, no correlation between β-defensin and TLR expression could be demonstrated.
However, we show an in vivo correlation between TLR-2 and TLR-4 expression in all tissue evaluated, which is in corroboration with Kawai and coworkers (41), who mention the in vitro induction of TLR-4 in epidermal keratinocytes by stimulation with pepto-glycan from gram-positive bacteria, suggesting TLR-4 expression regulation through TLR-2 ligand binding. In vitro it has also been shown in human monocytes that mRNA of TLR-2 and TLR-4 were downregulated by the same cytokine (IL-4), whereas IL-10 and glucocorticoid dexamethasone, also deactivators of human monocytes, respectively did not influence and up-regulated TLR 2 and TLR 4 expression (42). This suggests a parallel regulation of TLR 2 and TLR 4.
We found no significant difference of expression for both TLRs between the different patient groups in tonsillar and sinonasal disease. Apparently, microbial or inflammatory triggering in these upper airway conditions provokes the same TLR-2 or TLR-4 expression pattern. With the knowledge that triggering of the innate immune response can present a possible risk for the human organisms (e.g. toxic shock syndrome) (42), it is reasonable to presume that only invasive pathogens, the stimulation by microbial components simultaneously or certain inflammatory conditions (43) could set of the innate response by influencing the TLR-expression. Further studies are needed to determine regulation mechanisms of TLR to better understand innate immunity mechanisms in pathological conditions. Conclusion In this study we showed at least indirect evidence for the active participation of upper airway epithelium and mucosal-lymphoid tissue in innate host defence. Although the exact mechanism of regulation and induction of both, human defensins and toll-like receptors remains to be elucidated, we can conclude that inducible defensin production is concentrated in lymphoid tissue rather than in airway mucosa. Toll-like receptor expression in nasal mucosa, adenoids and tonsils, illustrates an important immunological sentinel function of upper airway mucosa.
Chapter V __________________________________________________________________________
72
References 1. WONG DT, OGRA PL. Immunology of tonsils and adenoids-
an update. Int J Pediatr Otorhinolaryngol 1980; 2: 181-191 2. LUND VJ. Nasal physiology: neurochemical receptors, nasal
cycle and ciliary action. Allergy Asthma Proc 1996; 17: 179-184
3. KALINER MA. Human nasal host defense and sinusitis. J Allergy Clin Immunol 1992; 30: 424-430
4. COLE A, DEWAN P, GANZ T. Innate antimicrobial activity of nasal secretions. Inf immune 1999; 67: 3267-3275
5. LEE SH, KIM JE, LIM HH. Antimicrobial defensin peptides of the human nasal mucosa. Ann Otol Rhinol laryngol 2002; 111: 135-141
7. YANG D, CHERTOV O, OPPENHEIM JJ. The role of mammalian antimicrobial peptides and proteins in awakening of innate host defense and adaptive immunity. CMLS 2001; 58: 978-989
8. SCHIBLI DJ, HUNTER HN, AEYEV V et al. The solution structures of human β-defensin 3 lead to better understanding of the potent bactericidal activity of HBD-3 against Staphyloccoccus aureus. J Biol Chem 2002; 277: 8279-8289
9. SINGH PK, JIA HP, WILES K et al. Production of β-defensin by human airway epithelia. Proc Natl Acad Sci 1998; 95: 14961-66
10. HARDER J, BARTELS J, CHRISTOPHERS E, SCHRODER JM. Isolation and characterization of Human β defensin 3, a novel human inducible peptide antibiotic. J Biol Chem 2001; 276: 5707-5713
11. GARCIA JR, JAUMANN F, SCHULZ S et al. Identification of a novel multifunctional beta-defensin (HBD-3) with specific antimicrobial activity. Its interaction with plasma membranes of Xenopus oocytes and the induction of macrophage chemoattraction. Cell Tissue Res 2001; 306 (2): 257-64
12. HARDER J, BARTELS J, CHRISTOPHERS E, SCHRODER JM. A peptide antibiotic from human skin. Nature 1997; 387: 861-862
13. LUI L, WANG L, JIA HP et al. Structure and mapping of the human β-defensin gene and its expression at sites of inflammation. Gene 1998; 222: 237-244
15. JIA HP, SCHUTTE BC, SCHUDY A, et al. Discovery of a new human beta defensins using genomics-based approach. Gene 2001; 263: 211-18
16. SCHUTTE BC, MC CRAY PB JR. β-defensin in lung host defense. Annu Rev Physiol 2002; 64:709-48
17. ALI RS, FALCONER A, IKRAM M et al. Expression of peptide antibiotic human β defensin-1 and human β defensin-2 in normal human skin. J Invest Dermatol 2001; 117: 106-111
18. SCHRODER JM, HARDER J. Human beta-defensin-2. Int J Biochem Cell Biol 1999; 31: 645-651
19. CLAEYS S, CUVELIER C, QUATACKER J, VAN CAUWENBERGE P. Ultrastructural investigation of M-cells and lymphoepithelial contacts in naso-pharyngeal associated lymphoid tissue (NALT). Acta Otolaryngol Suppl. 1996; 523: 40-42
20. KRAEHENBUHL JP, NEUTRA MR. Epithelial M cells: differentiation and function. Annu Rev Cell Dev Biol. 2000; 16: 301-332
22. UEHARA A, SUGAWARA S, TAKADA H. Priming of human oral epithelial cells by interferon-γ �to secrete cytokines in response to lipopolysaccharides, lipoteichoic acids and peptoglycans. J Med Microbiol 2002; 51: 626-634
23. ASAI Y, OHYAMA Y, GEN K et al. Bacterial fimbriae and their peptides activate human gingival epithelial cells through Toll-like receptor 2. Infect Immun 2001; 69(12): 7387-7395
24. KRUTZIK SR, SIELING PA, MODLIN RL. The role of Toll-
like receptors in host defense against microbial infection. Curr Opin Immunol 2001; 13: 104-108
25. CARIO E, ROSENBERG IM, BRANDWEIN SL et al. Lipopolysaccharide activates distinct signaling pathways in intestinal epithelial cell lines expressing toll- like receptors. J. Immunol 2000; 164: 966-972
26. CARIO E, PODOLSKY DK. Differential alteration in intestinal epithelial cell expression of toll-like receptor 3 (TLR 3) and TLR 4 in inflammatory bowel disease. Infect Immunol 2000; 68: 7010-7017
27. WANG X, MOSER C, LOUBOUTIN JP et al. Toll-like receptor 4 mediates innate immune responses to Haemophilus influenzae infection in mouse lung. J Immunol 2002; 168: 810-815
28. HARDER J, MEYER-HOFFERT U, TERAN LM et al. Mucoid Pseudomonas aeruginosa, TNF-alpha, and IL-1beta, but not IL-6, increase in bacterial pneumonia. Biochem Biophys Res Commun. 1998; 249(3): 943-947
29. HIRATSUKA T, NAKAZATO M, DATE Y et al. Identification of human beta-defensin-2 in respiratory tract and plasma and its induce human beta-defensin-2 in respiratory epithelia. Am J Respir Cell Mol Biol 2000; 22: 714-21 30. ASHITTANI J, MUKAE H, HIRATSUKA T et al. Plasma and BAL fluid concentrations of antimicrobial peptides in patients with Mycobacterium Avium-intracellular infection. Chest 2001; 119:1131-37
31. WEISE JB, MEYER JE, HELMER H et al. A newly discovered function of palatine tonsils in immune defence: the expression of defensins. Otolaryngol Pol 2002; 56: 409-413
32. BROOK I, YOCUM P, SHAH K. Surface versus core-tonsillar aerobic and anaerobic flora in recurrent tonsillitis. JAMA 1980; 244:1696-1698
33. MEDZHITOV R, JANEWAY CA JR. Innate immune recognition: mechanisms and pathways. Immunol Rev 2000; 173: 89-97
34. JANEWAY CA JR, MEDZHITOV R. Innate immune recognition. Annu Rev Immunol 2002; 20: 197-216
35. LIEN E, INGALLS RR. Toll-like receptors. Crit Care Med 2002; 30: S1-S11
37. SCHWANDNER R, DZIARSKI R, WESCHE H et al. Peptidoglycan- and lipoteichoic acid-induced cell activation is mediated by toll-like receptor 2. J Biol Chem. 1999; 274(25): 17406-17409.
38. LAFLAMME N, RIVEST S. Toll-like receptor 4: the missing link of the cerebral innate immune response triggered by circulating gram-negative bacterial cell wall components. FASEB J 2001; 15: 155-163
39. SHUTO T, XU H, WANG B. Activation of NF-κβ by nontypeable Hemophilus influenza is mediated by toll-like receptor 2-TAK1-dependent NIK-IKKα/β-Iκbα and MKK3/6-p38 MAP kinase signaling pathways in epithelial cells. PNAS 2001; 98: 8774-8779
40. DIAMOND G, RUSSELL JP, BEVINS CL. Inducible expression of an antibiotic peptide gene in lipopolysaccharide-challenged tracheal epithelial cells. Proc Natl Acad Sci 1996 93: 5156-5160
41. KAWAI K, SHIMURA H, MINAGAWA M et al. Expression of functional toll-like receptor 2 on human epidermal keratinocytes. J Dermatol Sci 2002; 30(3): 185-194
42. BEUTLER E, GELBART T, WEST C. Synergy between TLR-2 and TLR-4: a safety mechanism. Blood Cells Mol Dis 2001; 27 (4): 728-730
43. HAUSMANN M, KIESSLING S, MESTERMANN S, ROGLER G. Toll-like receptors 2 and 4 are upregulated during intestinal inflammation. Gastroenterology 2002; 122(7): 1987-2000
Chapter VI __________________________________________________________________________
73
Chapter VI
Innate immunity and nasal polyps
Content: Introduction
Original article: Macrophage mannose receptor in chronic sinus disease. S. Claeys, T. de Belder, G. Holtappels, P. Gevaert, P. van Cauwenberge, C. Bachert. Allergy 2004 jun; 59(6):606-12.
Chapter VI __________________________________________________________________________
74
Introduction
Nasal polyposis is a chronic inflammatory disease of the paranasal sinuses which occurs in
approximately 4% of the general population. Nasal polyps (NP) are benignant growths, mainly situated
in the middle meatus but with the capacity to enlarge en fill up the whole nasal cavity. NP patients have
complaints varying from limited nasal obstruction to complete blockage of the nose with loss of smell,
headache, massive nasal secretions (postnasal drip and coughing) and with a reduced general-well
being. The adaptive immune mechanisms of this example of local chronic tissue inflammation have
been well described (eosinophil dominanted, Th2 cytokine mediated) but the exact pathogenesis of this
therapy resistant disease remains enigmatic.
The trigger of onset of NP formation is still unknown and the role of co-morbidities like asthma and
atopy is still questionable. Staphylococcus aureus has been suggested as disease modifier, inducing a
severe eosinophilic inflammation and polyclonal Ig E formation in about 60 % of the NP.
To provide information about the missing first step in NP pathogenesis we focused our interest to the
macrophage associated mannose receptor (MMR), an innate pattern recognizing receptor with the
capacity of phagocytosis, modulation of antigen presentation an signal transduction.
The important discovery of the significant up regulation (Fig 1) of this MMR only in nasal polyp tissue
(this chapter, original article) delivered us a tool to further investigate the role of microbial–innate
interaction in this exaggerated upper airway inflammation.
The central role of the mannose receptor in first line defence but also in adaptive immune regulation can
be illustrated through its morphological and functional characteristics (Fig 1 of Chapter II and Table 1).
The MR exemplifies the dual ligand binding properties of a pattern recognition receptor: dichotomie
between a role in immunity and in homeostasis (clearance of potential auto-antigens and injurious self
molecules from plasma and extracellular compartments) can be observed. Therefore, to avoid
autoimmunity, MR expression on antigen presenting cells should be reduced after ligand binding. Two
control mechanisms have been proposed: firstly the generation of negative regulatory signals after MR
ligation (1) and secondly the retention of MR high affinity ligands in the early endocytotic
compartment.(2)
As for toll-like receptors, due to their complex role in immuno-modulation, it is (still) impossible to
assign a directive pattern of activity to the mannose receptor (homeostasis, immunosuppression or -
activation). (3) MR expression is upregulated by IL4/13 and Il-10 and is down-regulated by IFN-
γ . Surface expression is also affected by proteolytic cleavage of the extracellular domain, which
generates a functional soluble form of MR (sMR). Therefore it will be a challenge to assign a
signification to MMR up regulation in NP. MR expression is modulated by cytokines, pathogens and
their products, therapeutics and depends on the activation state of the macrophage. We therefore further
explored tissue macrophage behaviour and cytokine profiles (Chapter VIII A en B) in upper airway
Chapter VI __________________________________________________________________________
75
tissue (especially NP) to better understand the cause and consequence of MMR up regulation in NP
related inflammation.
Table 1: Role of MMR
1. Endocytosis Clearance of lysosomal hydrolases, tissue plasminogen activator and neutrophil-derived myeloperoxidase during the resolution phase of inflammation. MR recycles constitutively from the cell surface through the endocytotic apparatus, binding ligands at neutral pH and dissociating at lower pH found in the endosomes. (4)
2. Phagocytosis Opsonin-independent, less well understood: the cytoplasmic tail is crucial to both endocytotic and phagocytotic functions of the receptor, but little is known about the signals that lead to phagocytosis. (6)
3. Possible signal transducing receptor
Secretion of mediators, modulation of other cell surface receptors. (5) Induction by MUC (mannan conjugated antigens) of Th2 type immune response (IL-4, Il-10) under reducing conditions, and Th1 type immune response (IL-12, IFN-γ stray CD8CTL responses) under oxidizing conditions.
4. Processing of antigen
a. intracellular: Observed in dendritic cells (DC): uptake of mannosylated antigens which results in enhancement of classII restricted presentation. Mannosylated peptides and proteins are able to stimulate HLA class II restricted specific T-cell clones with 200-10000 fold higher efficiency compared to non-mannosylated peptides and proteins. Further more uptake via the MR by DC results in 100-fold enhanced presentation of soluble antigens to T-cells compared to antigens internalized via fluid phase. Observed in macrophages: MR delivers lipoglycan antigens to endosomes for presentation to T-cells by CD1b molecules. As MR and CD1b are co-localized it is speculated that the MR delivers glycolipids to the CD1b molecule. CD1 proteins are MHC class I like molecules which have been shown to have antigen presentation function. Because MR facilitates endocytosis and subsequent delivery of antigens to MHC compartments, MR plays an important role in the immune response against pathogens like Mycobacterium tuberculosis, Pneumocystis carinii, Candida albicans, Leishmania promastigotes and Trypanosoma cruzi. It has been shown that reduced mannan-MUC (mannan conjugated antigen) is preferentially presented by MHC II pathway, whereas oxidized mannan-MUC1 was preferentially presented by MHC I pathway and stimulation of CD8+ T-cells. b. extracellular A cleaved soluble form of the receptor (sMR) can direct antigen, bound to their CRD, to appropriate effector cells. Cells in lymphoid organs recognize the CR region of the MR. This suggests the transport of sugar-bearing molecules and/or particles to sites of humoral immune responses. sMR production is showed in culture by constitutive cleavage of pre-existing full-length protein. It has been suggested that DCs, expressing ligands for the CR domain, may serve to transport antigens via surface-sMR. Such DCs have been traced migrating from sites of immunization to B cell areas in secondary lymphoid tissues. (6)
Chapter VI __________________________________________________________________________
76
References (1) Nigou J, Zelle-Rieser C, Gilleron M, Thurnher M, Puzo G. Mannosylated lipoarabinomannans inhibit IL-12
production by human dendritic cells: evidence for a negative signal delivered through the mannose receptor. J Immunol 2001; 166:7477-7485
(2) Hiltbold EM, Vlad AM, Ciborowski P, Watkins SC, Finn OJ. The mechanism of unresponsiveness to circulating
tumor antigen MUC1 is a block in intracellular sorting ans processing by dendritic cells. J Immunol 2000; 165: 3730-3741
(3) Raveh D, Kruskal BA, Farland J, Ezekowiz RA. Th1 and Th2 cytokines cooperate to stimulate mannose-
receptor-mediated phagocytosis. J Leuk Biol 1998; 64: 108-113 (4) Stahl PD, Ezekowitz RA. The mannose receptor is a pattern reconition recepotr involved in host defense. Current
Opinion Immunol 1998; 10:50-55 (5) Shibata, Myrvik. Chitin particle-induced cell-mediated immunity is nhibited by soluble mannan. Mannose
receptor-mediated phagocytosis initiates IL-12 production. Journal of immunology 1997; 159:2462-2467 (6) Martínez-Pomares L, Mahoney JA, Káposzta R, Linehan SA, Stahl PD, Gordon SG. A functional soluble form of
the murine mannose receptor is produced by macrophages in vitro and is present in mouse serum. Journal of biological chemistry 1998; Vol 273, Issue 36:23376-23380
Chapter VI __________________________________________________________________________
77
Original article Macrophage mannose receptor in chronic sinus disease
Background: The role of infectious agents in the onset and maintenance of chronic sinus disease is still not fully understood. Macrophage mannose receptor (MMR), an innate pattern recognizing receptor, capable of phagocytosis of invaders and signal transduction for proinflammatory mechanisms, might be of importance in immune interactions in chronic sinus disease. Objective: We examined the MMR in sinonasal airway mucosa to evaluate its possible role in chronic rhinosinusitis (CS) and nasal polyposis (NPs). Methods: Surgical samples from patients with sinonasal disease were investigated with real-time RT-PCR for quantification of MMR mRNA expression, and the presence and location of MMR-positive cells was analysed by immunohistochemistry. Results: Quantification of MMR mRNA showed a statistically significant higher expression in NPs compared to CS without NP and controls. Immuno-histochemistry revealed expression of MMR in all tissue samples; however, in NP we found an enhanced positive cellular staining including cell aggregates. Conclusions: We could demonstrate for the first time that the expression of MMR is significantly upregulated in NP compared to patients with CS without NP or turbinate tissue of controls. Macrophages expressing MMR, accumulated in cell aggregates in NPs, play a possible key role in pathogen macrophage interaction in NP disease.
S. Claeys1, T. De Belder1, G. Holtappels1, P. Gevaert1, B. Verhasselt2, P. Van Cauwenberge1, C. Bachert1
1Department of Otorhinolaryngology; 2Department of Clinical Chemistry, Microbiology and Immunology, Ghent University, Ghent, Belgium Key words: chronic sinusitis; immuno-histochemistry; innate immunity; macrophages; mannose receptor; nasal polyps; real time RT-PCR.
Allergy 2004 jun; 59(6): 606-12
Nasal polyposis (NPs) is a chronic disease of the nose and sinuses with severe predominantly eosinophilic tissue (I) inflammation and a high recurrence rate after medical or surgical treatment (2), often leading to a substantial impairment of the quality of life of the patient (3). Nasal polyps may specifically occur in patients with cystic fibrosis, primary ciliary dyskinesia or allergic fungal sinusitis. In the general population, however, the prevalence of NPs ranges from 1 to 4% and the precise mechanism underlying the pathogenesis of NPs is unknown and probably multifactorial. The predominant type of nasal polyp disease is bilateral, eosinophilic and frequently linked to asthma and aspirin intolerance (4, 5). In previous investigations we showed a significantly higher concentration of IL-5, eotaxin, ECP, and leukotrienes (LT) C4/D4/E4 (6), in nasal polyp tissue compared to nonpolyp sinus tissue. Specific IgE to Staphylococcus aureus enterotoxins and polyclonal IgE formation is found to be increased in nasal polyp tissue and correlates with markers of eosinophilic inflammation, which points to a possible role of bacterial superantigens in the pathophysiology of NPs (5). In contrast, no IgE antibodies to enterotoxins have been found in chronic sinusitis (CS) (un-published data). Micro-organisms that cross the epithelial barrier are almost immediately recognized by macrophages that reside in the tissue of the host. Macrophages, which mature continuously from circulating monocytes leaving the circulation, migrate in large numbers into the connective ____________ Abbreviations: CS, chronic sinusitis; MMR, macrophage mannose receptor; NP, nasal polyposis; PRR, pattern recognizing receptor; TLR, toll-like receptor.
tissue. In the submucosal lining of the gastro-intestinal and respiratory tracts these phagocytetic cells have a key role in innate immunity because they can recognize, ingest and destroy many pathogens without support of the adaptive immune response. The mannose receptor, a pattern recognizing innate receptor (PRR) expressed on subsets of macrophages, immature dendritic cells and a population of endothelial cells is a key molecule in antigen recognition (7, 8). The macrophage mannose receptor (MMR) is a 175-kDA transmembrane glycoprotein containing three types of characterizing domains, two of which have distinct carbohydrate recognizing properties. The amino-terminal cystein-rich domain plays a critical role in binding sulphated glyco-proteins. The C-type leclin domains facilitate carbohydrate-dependent uptake of mannosylated protein antigens on micro-organisms including bacteria, yeast, enveloped viruses and protozoans (9). The MMR shows high affinity for mannose and fucose, intermediate affinity for N-acetylglucosamide and glucose and low affinity for galactose (10). Because these terminal sugars are rarely found on mammalian cell-surface, the MMR could be responsible for recognition of self and non-self antigens (11). It also plays a key role in pathogen-related acquired host defence by mediating antigen internalization and delivery to MHC class II compartments for antigen presentation (11, 12).
The MMR is not only responsible for immediate recognition and elimination of pathogens but also functions as a signal transducing receptor, triggering cytokine production (13, 14) and modulating cell surface receptors (15-17). MMR expression and the functional capacity of this receptor is modulated by cytokines (18-24), pathogens and their products (25,
Chapter VI __________________________________________________________________________
78
26), but also depends on the phenotype of the macrophage. Indeed, the MMR is not found on circulating monocytes, but is abundantly expressed on differentiated macrophages (10).
Accumulation of macrophages expressing the phagocytotic MMR in inflamed tissue, on the one hand, and the ability of MMR to recognize micro-organisms and to activate secretion of inflammatory products by the MMR ligand binding, on the other hand, may represent key factors of pathogen-macrophage interactions in chronic upper airway mucosal inflammation. Therefore, we aimed to investigate MMR expression in sinonasal airway disease in patients with CS with and without nasal polyps.
Materials Sinonasal tissue samples were collected during surgery and immediately snap frozen in liquid nitrogen. Thirty patients who underwent functional endoscopic sinus surgery or septal surgery, for reasons unrelated to the study, were divided into three groups: (i) ten patients with nasal polyps (NPs, five males, five females, 21-81 years); (ii) ten patients with CS without nasal polyps (CS, five males, five females. 23-71 years) and (iii) ten control patients without mucosal disease (interior turbinate mucosal biopsies) (eight males, two females, 14-63 years).
Chronic sinusitis was diagnosed according to the clinical criteria by Lund and Kennedy (27) on the basis of history, clinical examination, nasal endoscopy and sinus computed tomography scanning. In the CS patient group, no nasal polyps were found by endoscopic evaluation prior or during surgery. Patients with endoscopically diagnosed nasal polyp tissue prior or during surgery were registered in the NP group.
A history of asthma was registered in six patients with NPs, with one subject also demonstrating a history of aspirin sensitivity. None of the patients with CS had a history of asthma or another predisposing disease. Skin prick test was positive for at least one inhalant allergen in three patients with NP and in two patients with CS. Medical management strategy was identical in both sinusitis groups. Three patients with CS and two patients with NP were treated with oral corticoids 6 months prior to surgery. No patient used oral corticoids within the last 4 weeks prior to surgery.
As positive controls we examined MMR expression in tonsillar tissue from 20 patients who underwent tonsillectomy for chronic tonsillitis (28).
The ethical committee of the Ghent University Hospital approved the study, and informed consent was obtained from all subjects prior to inclusion in the study. Methods
Immunohistochemistry Cryostat sections (6 µm) were prepared and mounted on Super-Frost Plus glass slides (Menzel Glaeser, Braunschweig, Germany). Specimens were fixed in acetone. Endogenous peroxidase was blocked for 20 min with 0.3% H2O2, 0.1% sodium azide in TBS. Specimens were incubated for 1 h with the primary antibody: MMR(clone: 15-2-2, TNO, Leiden. The Netherlands), CD68(clone: EBM 11, Dako Cytomation. Heverlee; Belgium) and CDla (clone: NA 1/34, Dako Cytomation). The detection was performed using the LSAB method (labelled streptavidine-biotin, Dako Cytomation) according to the manufacture's instruction. Sections were incubated with AEC-chromogen, which results in a red-stained precipitate. Finally, sections were counterstained with haematoxylin and mounted.
RNA preparation and real-time RT-PCR Snap frozen tissue samples were placed in liquid nitrogen and thoroughly ground with a mortar and pestle and homogenized using QIAshredder (Qiagen, Hilden, Germany). Total RNA was purified using Rneasy (Qiagen) as recommended by the manu-facture. One microgram of total RNA was reverse transcribed to generate cDNA with Superscript™ II (Invitrogen, Merelbeke, Belgium) first strand synthesis kit, used as instructed by the sup-plier in the presence of oligo(dT), random primer, DTT and dNTPs. Primers and probes used for polymerase chain reaction (PCR) amplification were purchased from Eurogentec (Liege, Belgium) (the sequences are listed in Table I). Real-time PCR was performed in a 25-µl reaction mixture [comprising 5 µl cDNA (equivalent to 25 ng total RNA), 10 µM (final concentration) oligonuclcotide primers, 2.5 nM probe, 5 mM MgCl2, 200 µM dNTPs, and 0.025 U/µl Hot GoldStar enzyme (Eurogentec)] measured with a Perkin Elmer ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City, CA). Reactions were incubated for 10 min at 95°C, followed by 45 cycles of a two-step amplification procedure consisting of annealing/ extension at 60°C for 1 min and denaturation for 15s at 95°C. In each run. dilution series of pooled cDNA from donor adenoids were amplified to serve as a standard curve for the calculation of relative quantities. Table 1. Sequences of primers and probes used for PCR amplification. PBGD (porphobilinogen deaminasel): housekeeping gene, constitutively expressed
Probe: 5'-6FAM-CATCTTTGGGCTGTTTTCTTCCGCT-TAMRA-3' __________________________________________ Statistical analysis Data are expressed as median and interquartile range. When com-parisons were made between groups, significant between-group variability was first established using the Kruskal-Wallis test. The Mann-Whitney U-test was then used for between-group (unpaired) comparison. Spearman rank correlation coefficient (r) was used to assess the relationships between the parameters. Values of P< 0.05 were considered statistically significant. Results Expression of MMR mRNA in biopsies obtained during surgery from patients with chronic sinus disease and controls was quantitatively assessed by real-time RT-PCR.
In sinonasal mucosa of patients with CS, the MMR mRNA expression was significantly higher (Fig. 1) in tissue of patients with NPs compared to tissue obtained from CS patients without nasal polyps and inferior turbinate tissue of controls. No statistically significant difference was found between CS and controls (Fig. 1). Furthermore, quantitative evaluation with real-time RT-PCR for MMR mRNA on tonsils from patients with chronic tonsillitis showed a constant expression of MMR mRNA in all samples, at similar levels as in CS and controls (Fig. 1).
Chapter VI __________________________________________________________________________
79
Cryostat sections were immunostained to detect and compare the presence and location of the MMR in NPs, CS and controls. Most nasal tissue samples showed staining for MMR on scattered cells in the subepithelium and lamina propria, although in nonpolyp sinus tissue (Fig. 2) and in turbinate tissue (Fig. 3) staining was low. In contrast, we found perivascular and subepithelial accumulations of MMR-positive cells in NPs (Fig. 4A). Staining of serial slides with CD68 showed accumulation of macro-phages matching with the
Relative expression level
Mannose receptor
16
14
12
10
8
6
4
2
0
TCH NP CS CO
*
Figure 1. Quantification of MMR mRNA with real-time RT-PCR (box blot graph) in NP, nasalpolyps; CS, chronic sinusitis; CO, controls (inferior turbinate): TCH, chronic tonsillitis. Rel-ative expression level: in relation to PBGD (housekeeping) gene
Figure 4. Immunohistochemistry: expression of MMR in nasal polyps (original magnification 200x) (A) is co-localized to CD68 macro-phages (B), which form a cell aggregate together with CD3 T-cells (C) and CD38 plasma cells (D).
A C
B D
Chapter VI __________________________________________________________________________
80
predominant expression of the MMR in nasal polyps (Fig. 4B). These cell aggregates consisted of MMR-positive macrophages, CD3-positive T-cells (Fig. 4C) and CD38-positive plasma cells (Fig. 4D), but lacked staining for CD la (dendritic cells) and CD20 (B-cells) (data not shown). Immunohistochemical investigations on tonsils revealed scattered MMR expression on cells in the connective tissue and endothelium. However, we could not detect positive staining for MMR in the lymphoid follicles of tonsils (data not shown). Discussion In this study, quantitative RT-PCR and immunohisto-chemical staining for MMR expression was performed for the first time in chronic sinus disease. MMR mRNA expression was significantly higher in NPs compared to CS and controls. Further examination of cryostat sections showed an accumulation of MMR-positive macrophages in the subepithelium of NP tissue, co-localized to T-cells and plasma cells. These findings suggest that the MMR in nasal polyps serves to facilitate phagocytosis of a particular micro-organism by macrophages, leading to T-cell interaction and activation as well as the generation of a humoral immune response. Although much controversy still exists about the role of viruses, bacteria and fungi in the aetiology of sinusitis, the role of bacteria like Streptococcus pneumoniae, Haemophilus influenzae and Moraxella catarrhalis in acute sinusitis is commonly accepted. More conflicting reports are published on the microbiology aspect of CS and the involvement of the normal flora in chronic upper airway disease (29).
The cellular events of CS or polyp formation that appear to be the result of a continuous, mainly eosinophil-mediated (30) inflammatory reaction, are so far not directly related to the presence of a single micro-organism. Recently, a potential role for fungi was supposed in CS and NP (31) and in a recent study we investigated nasal tissue from patients with bilateral nasal polyps, which are characterized by a severe eosinophilic inflammation (5), in which we found increased levels of total IgE and S.aureus enterotoxin specific IgE antibodies as well as a polyclonal IgE response related to the severity of the eosinophlic inflammation. This suggests that these enterotoxins may act as superantigens in NP. The suggestion of a possible bacterial triggering as a disease modifying mechanism leading to chronic sinonasal inflammation and especially to nasal polyp disease can also be evaluated through the role of macrophages in these inflammatory processes. The contribution of macrophages in the regulation of immunological events in mucosal inflammation is evaluated by their role in clearance of pathogens, antigen presentation, lymphocyte activation, tissue repair and their ability to produce inflammatory cytokines and lipid inflammatory mediators (32). Macrophages are capable of rapid recognition and
clearance of pathogens, which explains the overall low incidence of clinically significant bacterial infections in the largely colonized respiratory tract, without the initiation of extensive immunological resources. The most thoroughly studied direct mode of recognition, termed lectinophagocytosis, involves the interaction of specific surface glycoconjugates on one cell with corresponding lectins expressed on the other (33). On tissue macrophages, the MMR is probably the most abundant macrophage lectin. This MMR is a PRR on which innate immunity relies to recognize repeated patterns on microbial surfaces and debris. MMR interacts with polysaccharide compo-nents of fungal cell walls such as yeast mannan, bacterial cell wall components of Gram-negative and Gram-positive bacteria and lipoarabinomannan. Although MMR message and proteins were expressed in all tissues examined, in nasal polyp tissue an impressive increase of MMR expression was found compared to controls and CS (Figs 2 and 3). Interestingly, even in samples of chronic tonsillitis as representatives of chronically inflamed lymphatic tissue only baseline expression of MMR was measured (Fig. 1). Previous investigations on other innate PRRs (34) such as toll-like receptor (TLR)-2 and TLR-4 (35) in upper airway tissues showed TLR-2 and TLR-4 mRNA expression in sinonasal mucosa, but no statistically significant difference in expression of mRNA of these receptors in selected patient groups (CS with and without nasal polyps) could be assessed compared to controls. MMR is so far the only innate PRR known to be significantly upregulated in nasal polyps. These findings suggest a crucial role of MMR in the physiopathology of this form of CS, and differentiate NPs from CS without polyp formation. In vitro evaluation shows that the expression of MMR on macrophages is dependent on the maturation of the macrophage: freshly isolated monocytes do not express MMR, but expression appears after several days of differentiation (32). The increase of MMR expression in nasal polyp tissue could be due to increased migration of differentiated macrophages into the tissue or due to over-expression of the receptor by resident macrophages. Probably, both mechanisms play a role, but this needs further studies. Immunohistochemical staining of nasal polyp tissue for MMR added further evidence and showed the accumulation of MMR-positive cells in NP samples but not in CS, chronic tonsillitis or controls. In NP, the expression of MMR could be matched to macrophages, either as single cells or accumulating to cell aggregates lying in connection with the epithelium. Further analysis of the cell aggregates revealed MMR-positive macrophages co-localized to CD3 + T-cells and plasma cells (Fig. 4C,D), partially IgE positive, but they lacked dendritic cells and B-cells (data not shown). These findings suggest a pathogen-driven immune response, leading to an activation of T-cells and an immunoglobulin switch to
Chapter VI __________________________________________________________________________
81
IgE without the presence of antigen-presenting cells. The identification of a microbial or molecular substance that may trigger these processes could be of significant therapeutic value. Also, further study on MMR expression regulation in nasal polyp tissue will be needed to determine which mediators influence MMR and macrophage accumulation in this environment. So far the most important cellular difference shown between nasal polyps and CS tissue (without nasal polyps) is the eosinophilic infiltration in NP. No evidence of a higher number of macrophages in nasal polyps compared to CS (without nasal polyps) has been established until now. Surely, the distinction between increased migration of MMR-positive macrophages and the possible upregulation of MMR in different disease states needs to be further investigated. Cytokines in inflammatory tissue [e.g. IL-lβ and TNF-α (32)] may not only prolong survival of recruited monocytes and maintain them in an inflammatory state with an increased potency for releasing inflammatory mediators, but they might also be involved in MMR-expression regulation (32). After ligand binding, the MMR can function as a signal-transducing receptor triggering a variety of responses including secretion of mediators (36), lysosom-al enzyme secretion (37), cytokine production (13, 14) and modulation of other cell surface receptors (16-18), which emphasizes the role for MMR as being a link between innate and adaptive immunity. Since the MMR is an innate receptor capable of interaction with pathogen-associated molecular patterns, the increased expression of the MMR in nasal polyps can suggest an increased direct pathogen-macrophage interaction in this tissue. This might be a possible explanation for the onset or main-tenance/recurrences described in nasal polyp disease. References 1. BACHERT C, WAGENMANN M, RUDACK C, HOPKEN K,
HILLEBRANDT M, WANG D et al. The role of cytokines in infectious sinusitis and nasal polyposis. Allergy 2003;58:748-753.
2. BACHERT C, HORMANN K, MOSGES R, RASP G, RIE-CHELMANN H, MUELER R et al. An update on the diagnosis and treatment of sinusitis and nasal polyposis. Allergy 2003:58:176-191.
3. RADENNE F, LAMBLIN C, VANDEZANDE LM. TILLIE-LEBLOND I, DARRAS J, TONNEL AB, et al. Quality of life in nasal polyposis. J Allergy Clin Immunol 1999.104:79-84.
4. MOLONEY JR, COLLINS J. Nasal polyps and bronchial asthma. Br J Dis Chest 1977;71:1-6.
5. BACHERT C, GEVAERT P, HOLTAPPELS G, JOHANSSON SG, VAN CAUWENBERGE P. Total and specific IgE in nasal polyps is related to local eosinophilic inflammation. J Allergy Clin Immunol 2001:107:607-614.
6. BACHERT C, WAGENMANN M, HAUSER U, RUDACK C. IL-5 synthesis is upregulated in human nasal polyp tissue. J Allergy Clin Immunol 1997:99 (6 Pi 1):837-842.
7. APOSTOLOPOULOS V, BARNES N, PIETERSZ GA, MCKENZIE IF. Ex vivo targeting of the macrophage mannose receptor generates anti-tumor CTL responses. Vaccine 2000:18:3174-3184.
8. AVRAMEAS A, McILROY D, HOSMALIN A, AUTRAN B,
The possibility of MMR being an important receptor that initiates/maintains inflammation after binding with otherwise harmless bacteria (nonpathogenic microbes) needs to be further examined. Interactions between innate and adaptive defence pathways need to be further clarified to better understand microbial influences in chronic upper respiratory inflammation. Conclusions
In this study, MMR tissue expression was demonstrated for the first time in upper airway mucosa. Quantitative real-time RT-PCR revealed statistically significant increased MMR mRNA expression in nasal polyps compared to CS and was supported by immunohistochemistry, which further revealed MMR-positive macrophage cell aggregates consisting of macrophages, T-lymphocytes and plasma cells in nasal polyp tissue.
These elements suggest a direct interaction between micro-organisms and their products and local immune cells in sinus tissue, illustrating a possible role of MMR-positive macrophages in initiating or maintaining the formation of nasal polyps.
Further investigations are needed to determine the nature of the interaction between innate and adaptive immune responses in this chronic inflammatory disease. Acknowledgments
This study was supported with grants from the fund Alphonse and Jean Forton and the Belgian Society against Cystic Fibrosis.
DEBRE P, MONSIGNY M et al. Expression of a
mannose/fucose membrane lectin on human dendritic cells. EurJ Immunol 1996:26:394- 400.
9. READING PC, MILLER JL, ANDERS EM. Involvement of the mannose receptor in infection of macrophages by influenza virus. J Virol 2000:74:5190-5197.
10. STAHL PD, EZEKOWITZ RA. The mannose receptor is a pattern recognition receptor involved in host defense. Curr Opin Immunol 1998,10:50-55.
11. ENGERING AJ, CELLA M, FLUITSMA DM, HOEKSMIT EC, LANZAVECCHIA A, PIETERS J. Mannose receptor mediated antigen uptake and presentation in human dendritic cells. Adv Exp Med Biol 1997:417:183-187.
12. TAN MC, MOMMAAS AM, DRIJFHOUT JW, JORDENS R, ONDERWATER JJ, VERWOERD D, et al. Mannose receptor mediated uptake of antigens strongly enhances HLA-class II restricted antigen presentation by cultured dendritic cells. Adv Exp Med Biol 1997:417:171-174.
13. SHIBATA Y, METZGER WJ, MYRVIK QN. Chitin particle-induced cell-mediated immunity is inhibited by soluble man-nan: mannose receptor-mediated phagocytosis initiates IL-12 production. J Immunol 1997:159:2462-2467.
14. YAMAMOTO Y, KLEIN TW, FRIEDMAN H. Involvement of mannose receptor in cytokine interleukin-lbeta (IL-lbeta), IL-6. and granulocyte-macrophage colony-stimulating factor responses, but not in chemokine macrophage inflammatory
Chapter VI __________________________________________________________________________
82
protein Ibeta (MIP-1 beta), MIP-2, and KC responses, caused by attachment of Candida albicans to macrophages. Infect Immun 1997:65:1077- 1082.
15. BERNARDO J, BILLINGSLEA AM, BLUMENTHAL RL, SEETOO KF, SIMONS ER, FENTON MJ. Differential responses of human mononuclear phagocytes to mycobacterial lipoarabinomannans: role of CD14 and the mannose receptor. Infect Immun 1998:66:28-35.
16. MURAI M, ARAMAKI Y, TSUCHIYA S. Contribution of mannose receptor to signal transduction in Fc gamma receptor-mediated phagocytosis of mouse peritoneal macrophages induced by liposomes. J Leukoc Biol 1995;57: 687-691.
17. MURAI M, ARAMAKI Y, TSUCHIYA S. Alpha 2-macroglo-bulin stimulation of protein tyrosine phosphorylation in macro-phages via the mannose receptor for Fc gamma receptor-me-diated phagocytosis activation. Immunology 1996:89:436-441.
18. DEFIFE KM, JENNEY CR, MCNALLY AK, COLTON E, ANDERSON JM. Interleukin-13 induces human monocyte/ macrophage fusion and macrophage mannose receptor expression. J Immunol 1997:158:3385-3390.
19. DOYEE AG, HERBEIN G, MONTANER LJ, MINTY AJ, CAPUT D, FERRARA P, et al. Interleukin-13 alters the activation state of murine macrophages in vitro: comparison with interleukin-4 and interferon-gamma. Eur J Immunol 1994:24:1441-1445.
20. EZEKOWITZ RA, GORDON S. Down-regulation of mannosyl receptor-mediated endocytosis and antigen F4/80 in bacillus Calmette-Guerin-activated mouse macrophages. Role of T lym-phocytes and lymphokines. J Exp Med 1982:155:1623-1637.
21. MARODI I, SCHREIBER S, ANDERSON DC, MACDERMOTT RP, KORCHAK HM, JOHNSTON RB. Jr. Enhancement of macrophage candidacidal activity by interferon-gamma. Increased phagocytosis, killing, and calcium signal mediated by a decreased number of mannose receptors. J Clin Invest 1993;91:2596-2601.
22. SCHREIBER S, PERKINS SL, TEITELBAUM SL, CHAPPEL J, STAHE PD, BEUM JS. Regulation of mouse bone marrow macrophage mannose receptor expression and activation by prostaglandin E and IFN-gamma. J Immunol 1993: 151:4973-4981.
23. SHEPHERD VL, COWAN HB, ABDOLRASULNIA R, VICK S. Dexamethasone blocks the interferon-gamma-mediated downregulation of the macrophage mannose receptor. Arch Biochem Biophys 1994:312:367-374.
24. STEIN M. KESHAV S, HARRIS N. GORDON. S. Interleukin 4 potently enhances murine macrophage mannose receptor activity: a marker of alternative immunologic macrophage activation. J Exp Med 1992:176:287-292.
25. LEFKOWITZ DL, LINCOLN JA, LEFKOWITZ SS, BOLLEN A, MOGUILEVSKY N. Enhancement of macrophage-mediated bactericidal activity by macrophage-mannose receptor-ligand interaction. Immunol Cell Biol 1997;75:136-141.
26. SHEPHERD VL, LANE KB, ABDOLRASUL-NIA R. Ingestion of Candida alhicans down-regulates mannose receptor expression on rat macrophages. Arch Biochem Biophys 1997:344:350-356.
27. LUND VJ, KENNEDY DW. Staging for rhinosinusitis. Otolaryngol Head Neck Surg 1997,117 (3 Pt 2):S35-S40.
28. LINEHAN S, MARTINEZ-POMARES L, STAHL P, GORDON S. Mannose receptor and its putative ligands in normal murine lymphoid and no-lymphoid organs: in situ expression of mannose receptor by selected macrophages, endothelial cells, perivascular microglia, and mesangial cells, but not dendritic cells. J Exp Med 1999;189:1961-1972.
29. VAN CAUWENBERGE PB, INGELS KJ, BACHERT C, WANG DY. Microbiology of chronic sinusitis. Acta Otorhinolaryngol Belg 1997:51:239-246.
30. BACHERT C, GEVAERT P, HOLTAPPELS G, CUVELIER C, VAN CAUWENBERGE P. Nasal polyposis: from cytokines to growth. Am J Rhinol 2000:14:279-290.
31. PONIKAU JU, SHERRIS DA, KITA H, KERN EB. Intranasal antifungal treatment in 51 patients with chronic rhinosinusitis. J Allergy Clin Immunol 2002;110:862-866.
32. Hou FF, BOYCE J, ZHANG Y, OWEN WF, Jr. Phenotypic and functional characteristics of macrophage-like cells differentiated in pro-inflammatory cytokine-containing cultures. Immunol Cell Biol 2000:78:205 213.
33. OFEK I. GOLDHAR J, KEISARI Y, SHARON N. Nonopsonic phagocytosis of microorganisms. Annu Rev Microbiol 1995:49:239-276.
34. Muzio M, MANTOVANI A. The Toll receptor family. Allergy 2001:56: 103-108.
35. CLAEYS S, DE BELDER T, HOLTAPPELS G, GEVAERT P, VERHASSELT B, VAN CAUWENBERGE P et al. Human β defensins and Toll-like receptors in the upper airway. Allergy 2003;58:748-753.
36. GARNER RE, RUBANOWICE K, SAWYER RT. HUDSON JA. Secretion of TNF-alpha by alveolar macrophages in response to Candida albicans mannan. J Leukoc Biol 1994:55:161-168.
37. OHSUMI Y, LEE YC. Mannose-receptor ligands stimulate secretion of lysosomal enzymes from rabbit alveolar macrophages. J Biol Chem 1987:262:7955-7962.
Chapter VII __________________________________________________________________________
83
Chapter VII
Innate and adaptive immunity
in cystic fibrosis
upper airway disease
Content : Introduction Original article:
Nasal polyps in patients with and without cystic fibrosis: a differentiation by innate markers and inflammatory mediators. S. Claeys, H. Van Hoecke, G. Holtappels, P. Gevaert, B. Verhasselt, P. Van Cauwenberge, C. Bachert. Clin Exp Allergy. 2005 Apr;35(4):467-72.
Chapter VII __________________________________________________________________________
84
Introduction
Cystic fibrosis (CF) upper airway disease is the ultimate example of failure of respiratory host defense.
Whether the exacerbated inflammation is part of a genetic defect or a response to persistent infection
remains unclear.
Arguments for disturbances of both innate and adaptive mechanisms are available. A defect in the CF
gene product, the cystic fibrosis transmembrane conductance regulator (CFTR), leads to elevated salt
levels of the airway surface fluid with inactivation of HBD 1 and HBD 2 (1) and the elevation of pro-
inflammatory cytokines in early stages of CF associated respiratory disease. (2) Khan TZ et al suggest
that inflammation is present early in the course of CF lung disease before colonization and infection
with potentially pathogenic bacteria occurs. (3)
In our study we compared for the first time the innate and adaptive immune mediators in upper airway
inflammation (nasal polyps) in patient with and without cystic fibrosis in order to unravel the
immunologcal background of this inflammatory imbalance. (Chapter VII, original article).
We extended our findings to a larger study group and a wider variety of cytokines in order to define
and distinct sinonasal disease by their inflammatory profile. (Chapter VIII B)
References (1) Goldman MJ, Anderson M, Stolzenberg ED, Prasd Kari U, Zasloff M, Wilson JM. Human β-defensin-1 is a
salt sensitive antibiotic in lung that is inactivated in cystic fibrosis. Cell. 1997;88:553-560 (2) Balough K, McCubbin M, Weinberger M, Smits W, Ahrens R, Fick R. The relationship between infection
and inflammation in the early stages of lung disease from cystic fibrosis. Pediatr Pulmonol. 1995;20(2):63-70 (3) Khan TZ, Wagener JS, Bost T, Martinez J, Accurso FJ, Riches DW. Early pulmonary inflammation in infants
with cystic fibrosis. Am J Respir Crit Care Med. 1995;151(4):1075-1082.
Chapter VII __________________________________________________________________________
85
Original article Nasal polyps in patients with and without cystic fibrosis: a differentiation by innate markers and inflammatory mediators S. Claeys, MD1; H. Van Hoecke MD1; G. Holtappels1 ; P. Gevaert, MD1; T. De Belder, MD1 ; B. Verhasselt, MD, PhD2; P. Van Cauwenberge, MD, PhD1; C. Bachert, MD, PhD1 1 Upper airways Research Laboratory, Department of Otorhinolaryngology, Ghent University, Belgium 2 Department of Clinical Chemistry, Microbiology and Immunology, Ghent University, Belgium This study was supported with grants from the fund Alphonse and the Belgian Society against Cystic Fibrosis. List of abbreviations CF: cystic fibrosis, NP: nasal polyps, CF-NP: cystic fibrosis nasal polyps, Non-CF-NP: non-cystic fibrosis nasal polyps, CO: controls, CFTR: cystic fibrosis transmembrane conductance regulator, IL: interleukin, ECP: eosinophilic cationic protein, MPO: myeloperoxidase, Ig: immunoglobulin, TLR: toll-like receptor, MMR: macrophage mannose receptor, HBD: human beta defensin, PAMP: pathogen associated molecular pattern, PRR: pathogen recognizing receptor Key words nasal polyps, cystic fibrosis, toll-like receptor, macrophage mannose receptor, human beta defensin, inflammatory mediators Clin Exp Allergy. 2005 Apr;35(4):467-72 Abstract Background: The dysfunction of the mucosal interface of the upper respiratory tract in cystic fibrosis patients is clinically visible by the development of nasal polyps at a young age. Innate defence markers and inflammatory mediators in nasal polyps from patients with cystic fibrosis were compared to non-cystic fibrosis nasal polyps to determine a possible different immunological background in macroscopically similar tissue. Methods: Surgical samples were obtained from patients with non-cystic fibrosis nasal polyps (non-CF-NP), cystic fibrosis patients with nasal polyps (CF-NP) and control patients (CO). With real time PCR, the mRNA expression of human beta defensins (HBD) 2 and 3, Toll-like receptors (TLR) 2 and 4 and the macrophage mannose receptor (MMR) were measured. On homogenates of the surgical samples eotaxin, myeloperoxidase (MPO), IL-5 and IL-8 protein content was measured using commercial ELISA kits; IgE and eosinophilic cationic protein (ECP) were measured by the Unicap system. Results: In CF-NP we found a statistically significant higher mRNA expression of HBD 2 compared to non-CF-NP and controls and of TLR 2 compared to non-CF-NP. In the non-CFNP group, MMR mRNA expression was significantly elevated compared to CO and CF-NP. For TLR 4 mRNA expression no statistically significant differences were found between groups. IL-5 was below detection level in all CO and CF-NP, but was measurable in 80% of the non-CF-NP. MPO and IL-8 concentrations were significantly higher in CF-NP compared to controls and non-CF-NP, whereas ECP, eotaxin and IgE were significantly higher in the non-CF-NP group. Conclusions: We here demonstrate that CF-NP and non-CF-NP not only differ in terms of inflammatory mediator profile, but also in terms of innate markers. Introduction The incidence of nasal polyps is much higher in cystic fibrosis patients (CF) than in the general population and chronic rhinosinusitis, with or without nasal polyps, is now recognized as one of the major otolaryngological manifestations of CF. The genetic base of CF is clearly established but no particular CFTR mutation, correlating with the phenotype of nasal polyp formation in cystic fibrosis patients (CF-NP), has been found until now1. Nasal polyps are also described in adult patients without CF (non-CF-NP), and although many clinical similarities exist, careful analysis of the literature points to differences in
histopathology and inflammatory characteristics 2. The respiratory mucosal surface of CF patients shows changes that undoubtedly contribute to an ideal environment for microbial growth and consecutive chronic sinus inflammation. Dysfunction of the CFTR protein, which acts as a chloride channel, causes changes in the mucous composition with production of thick viscous secretions and impaired mucociliary clearance 2. Although bacterial infection is widely accepted to be a major factor in the pathogenesis of acute exacerbations and chronic progression of lung disease
Chapter VII __________________________________________________________________________
86
in CF 3, it remains unclear if the CF-specific sinonasal pathogens, of which S. aureus, P. aeruginosa, H. influenzae and anaerobes are the most common 1, play a particular role in the pathogenesis of CF-NP. In patients without CF however, bacterial colonization seems to play a pivotal role in NP formation. The pathogenesis of non-CF-NP is not yet fully understood, but recent insights emphasize a local eosinophilic tissue inflammation with increased prevalence of colonization with S. aureus and in severe cases associated with asthma and aspirin sensitivity 4. Eotaxin and IL-5 are key mediators in this eosinophilic inflammation, due to their role in eosinophil chemotaxis, activation and survival, whereas an increased release of ECP could induce exudation and polyp growth 5. Furthermore, non-CF-NP are characterized by a prominent local IgE synthesis irrespective of skin test results, but related to eosinophilic inflammation 6. Whether similar mechanisms hold true in CF is currently unclear. However, in CF patients, a predominant neutrophil infiltration of the lower respiratory tract seems to be present with increased MPO and IL-8 levels in sputum of CF patients compared to chronic bronchitis patients7. An increased expression of IL-8 is also found in sinonasal tissue of CF patients with chronic rhinosinusitis, compared to non-CF patients with chronic rhinosinusitis 8. As the upper airway is continuously exposed to and challenged by external matter, innate and adaptive defence mechanisms have to cooperate to maintain immunological homeostasis. Upper airway mucosa expresses innate antimicrobial peptides, including Human Beta Defensins 2 and 3 (HBD 2 and HBD 3) 9; innate pattern recognition receptors (PRR) such as Toll Like Receptors 2 and 4 (TLR 2 and 4) 9 and Macrophage Mannose Receptor (MMR) 10; and inflammatory mediators 11 that activate the innate and adaptive immune system. A previous study of our group showed a significant increase of MMR expression in non-CF-NP compared to CRS tissue, suggesting a local PAMP (Pathogen Associated Molecular Pattern)- PRR interaction with sustained inflammation in non-CF-NP 10. To evaluate specific features of innate and adaptive defence mechanisms, associated with persistent therapy resistant NP formation in the upper airways, we measured expression of innate markers and inflammatory mediators in CF-NP and non-CF-NP, with normal nasal mucosa samples serving as controls. For the assessment of innate defence in the upper airways, we measured tissue expression of HBD 2, HBD 3, TLR 2, TLR 4 and MMR, whereas inflammatory signalling was determined by the expression of IL-5, IL-8, eotaxin, ECP, MPO and IgE concentrations. Materials Sinonasal samples were obtained from patients with or without CF undergoing functional endoscopic
sinus surgery for nasal polyposis. Control samples were obtained during septal�surgery from the inferior turbinate of patients without sinonasal disease. The reasons for surgical procedure were unrelated to the study. Tissue samples were immediately snapfrozen in liquid nitrogen. The ethical committee of Ghent University Hospital approved the study; an informed consent was obtained from all subjects prior to inclusion in the study. The patients were divided into three groups. First: controls (CO), second: non-CF nasal polyps (non-CF-NP), third: cystic fibrosis nasal polyps (CF-NP). In patients with CF-NP and non-CF-NP, polyp formation was visualized in the nasal cavity and middle meatus by nasal endoscopy and in the sinuses by CT scan prior to surgery, whereas control patients were free of polyps also demonstrated by nasal endoscopy and on CT scan. We collected 39 sinonasal surgical samples, from 39 different patients, (10 CO: 8 male/2 female, 14-63 years old; 15 non-CF-NP: 10 male, 5 female, 23-71 years old; 14 CF-NP: 11 male, 3 female, 4-29 years old). A history of asthma was registered in 7/15 patients with non-CF-NP, with one patient also demonstrating a history of aspirin sensitivity. None of the patients of the CF-NP group and none of the patients of the CO group had a history of asthma or aspirin sensitivity. Skin pick test was positive for at least one inhalant allergen in 3/15 patients with non-CF-NP, in 2/14 patients with CF-NP and was negative in all CO patients. None of the patients were treated with oral corticosteroids within 4 weeks prior to surgery. 4/15 patients of the non-CF-NP group, 2/14 patients of the CF-NP group and none of the CO group used nasal corticosteroids within 4 weeks prior to surgery. All 39 samples were analyzed for IL-5, IL-8, eotaxin and MPO with commercially available ELISA kits and for ECP and IgE by the Unicap system. On 28 sinonasal surgical samples (6 CO, 9 non-CF-NP, 13 CF-NP), which were available for analysis, quantitative real time RT-PCR for HBD 2 and 3, TLR 2 and 4 and MMR mRNA expression was performed. Methods RNA preparation and real-time RT-PCR Snap frozen tissue samples (50 – 100 mg) were placed in liquid nitrogen and thoroughly grounded with a mortar and pestle. 1 ml of TRI Reagent (Sigma, Bornem; Belgium) was added to the tissue and further homogenized by repeated pipeting. Total RNA was purified according to the instruction of the manufacture. One µg of total RNA was first incubated with Dnase I (1U, Invitrogen, Merelbeke; Belgium) and then reverse transcribed to generate cDNA with SuperScriptTMII (Invitrogen) in the presence of oligo(dT), random primer, DTT and dNTPs. Primers and probes used for PCR amplification were purchased from Eurogentec (Liège, Belgium). Sequences were previously published 9, 10.
Chapter VII __________________________________________________________________________
87
Real-time PCR was performed in a 25 µl reactions mixture composed of 5µl cDNA (equivalent to 25 ng total RNA), 1 µM (final concentration) oligonucleotide primers, 250 nM probe, 5 mM MgCl2, 200 µM dNTPs, and 0.025U/µl Hot GoldStar enzyme (Eurogentec) and measured with a Perkin Elmer ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City, CA). Reactions were incubated for 10 minutes at 95°C, followed by 45 cycles of a two-step amplification-procedure composed of annealing/extension at 60°C for 1 minute and denaturation for 15 seconds at 95°C. In each run, dilution series of pooled cDNA from donor tonsils were amplified to serve as a standard curve for calculation of relative quantities, normalized for PBDG (porphobilinogen deaminase) house keeping gene expression. Preparation of nasal tissue for ELISA measurements Nasal tissue specimens were weighed and 1 ml of 0,9% NaCl solution, supplemented with protease inhibitor cocktail (complete protease inhibitor cocktail, Roche Diagnostic, Vilvoorde; Belgium) was added to every 0,1 g of tissue. The samples were then homogenized for 5 minutes at 1000 rpm on ice with a mechanical homogenizer (B. Braun Melsungen, Melsungen; Germany) as described previously4. After homogenization, the suspensions were centrifuged at 1500xg for 10 minutes at 4°C and supernatants were separated and stored at –20°C until analysis. The samples were analysed for IL-5, IL-8, MPO, eotaxin with commercially available ELISA kits according to the manufacture’s instructions (all kits were purchased from R&D Systems, except MPO from Oxis Research, Immunosource, Zoersel; Belgium). ECP and IgE were measured by the Unicap system (Pharmacia, Uppsala; Sweden). Statistical analysis Data are expressed as median and inter-quartile ranges (IQR). When comparisons were made between groups, significant between-group variability was first established using the Kruskal-Wallis test. The Mann Whitney U-test was then used for between-group (unpaired) comparison. Differences between the paired data were calculated by using the Wilcoxon test. Spearman rank correlation coefficient (r) was used to assess the relationship between the parameters. P-values <0.05 were considered statistically significant. Results With real time RT-PCR we measured HBD 2 and 3, TLR 2 and 4 and MMR mRNA in surgical samples from non-CF-NP, CF-NP and CO. Quantification of HBD 2, TLR 2, TLR 4 and MMR is presented in figure 1a-d. HBD 3 was below detection level in all samples. We found a statistically significant higher mRNA expression for HBD 2 in CF-NP compared to
non-CF-NP (p=0.001) and CO (p=0.001). TLR 2 mRNA expression was significantly elevated in the CF-NP group compared to the non-CF-NP group (p=0.045). In non-CF-NP, we found a significantly higher gene expression of MMR compared to CF-NP (p=0.021) and to CO (p=0.01). For TLR 4, no statistically significant differences were found between groups. In sinonasal mucosa homogenates of patients with non-CF-NP, CF-NP and CO patients, the protein content of ECP, MPO, IL-5, IL-8, eotaxin and IgE was measured using ELISA and UniCAP techniques. The results are presented in figure 2a-f. IL-5 was below detection level in all CO and CF-NP samples, but was measurable in 12/15 non-CF-NP samples. In the non-CF-NP group, IgE was significantly elevated compared to the CO group (p<0.001). No significant increase of IgE could be measured in CF-NP compared to CO. In both non-CF-NP and CF-NP samples ECP, MPO, IL-8 and eotaxin expression was significantly higher compared to CO tissue (p value for MPO in non-CF-NP versus CO =0.008, p<0.001 in all other comparisons). Comparing the cytokine profile and IgE antibody levels in non-CF-NP and CF-NP, we found a statistically higher expression of ECP (p<0.001), IgE (p<0.001) and eotaxin (p=0.021) in the non-CF-NP group, whereas MPO (p<0.001) and IL-8 (p=0.003) expression was significantly higher in the CF-NP group. Furthermore, HBD 2 mRNA expression and IL-8 protein content showed a significant correlation in the CF-NP group (r=0.718, p=0.0129), whereas in the non-CF-NP group, a correlation between MMR gene expression and the protein content of IgE antibodies was found (r=0.770, p=0.0209). No other significant intra-group correlations were found between and among innate markers and inflammatory mediators. Discussion In bilateral eosinophilic nasal polyps in non-cystic fibrosis patients, IL-5 and eotaxin, belonging to the Th2 cytokine repertoire, have been described as key mediators for the accumulation and activation of eosinophils, and an increased release of ECP in non-CF-NP could possibly induce plasma exudation and polyp growth. 5 Furthermore, nasal polyposis is characterized by a prominent local polyclonal IgE synthesis related to the eosinophilic inflammation. 6 We recently also described an up-regulation of the MMR mRNA in non-CF-NP 10, a finding which was confirmed in this study, and extended with respect to the correlation between MMR gene expression and total IgE content. MMR is a 175kDA transmembrane glycoprotein which facilitates the binding to bacteria and mediates phagocytosis of non-self and antigen delivery to MHC class II compartments. 12 MMR also functions as a signal transducing receptor, triggering production of cytokines IL-1, IL-6 and IL-12 13, 14 and modulating cell surface receptors. 15, 16 The correlation
Chapter VII __________________________________________________________________________
88
of MMR mRNA expression and local IgE levels in non-CF-NP leaves us to speculate about a possible role of MMR in the uptake of bacterial matter and the initiation or/and maintenance of the IgE formation and eosinophilic inflammation in this disease. Furthermore, we here show that neither MMR mRNA expression nor polyclonal IgE formation, nor IL-5 and eotaxin release, are typical features of CF-NP. In contrast, the innate pathogen recognizing receptor (PRR) TLR 2 gene was expressed significantly higher in CF-NP compared to non-CF-NP and controls. For TLR 4 no differences in gene expression were found between groups. Recently, research has focussed on the regulation TLR expression, however, the physiological relevance of TLR up-regulation is not yet determined. TLR expression has been studied in relation to glucocorticosteroids, LPS, TNF-α, IL-1, IFNγ, IL-2, IL-15 17-19. Additionally, a clear difference in TLR 2 and 4 mRNA expression, both in vivo 20 and in vitro
17,18, has been shown and can be explained by their different promotor sequences (NF-κB-binding site) 21,23. However, in a previous study of our group we could not demonstrate a significant difference for TLR 2 and TLR 4 mRNA expression in tonsils, adenoids and nasal mucosa of healthy subjects and patients with chronic upper airway inflammation9. The singular up-regulation of TLR 2 (and not TLR 4) in CF-NP suggests an important role for TLR 2 in the orchestration of host-defence in CF-NP. This observation enhances the necessity for further evaluation of the influence of bacterial infection, cytokine biology and therapeutic measures (corticosteroids) on the sentinel function of PRRs in the upper airway. The different PRR pattern (MMR and TLR) in NP of both patients groups might also depend on the “host genetics” and /or the maturation status of the immune cells. The hypothesis that TLR 2 may have an important sentinel function in the CF upper airway epithelium and its possible role in modulating the immune response can be supported by the capacity of TLR 2 to mediate induction of HBD 224 and IL-825 in response to Gram positive or Gram negative bacterial components. In this study we found the mRNA expression of the human β-defensin HBD 2 to be up-regulated in CF-NP, but not in non-CF-NP subjects. We furthermore describe a correlation between HBD 2 expression and IL-8 levels, which illustrates parallel regulation of HBD 2 and IL-8, also shown by other groups 26,27. The influence of microbial factors or inflammatory cytokines on HBD 2 26,28 and HBD 326,28 expression has been demonstrated previously. In this study HBD 3 expression was below detection level in all samples, also in controls, indicating a difference in constitutive expression and illustrating a different regulation for HBD 2 and HBD 3, which has already been described in vitro 29. The finding that HBD 2 expression is suppressed by Th2 cytokines could explain why the cytokine milieu in non-CF-NP
is probably less favourable for the induction of HBD 2 (lower pro-inflammatory molecules, more Th2 related cytokines 5, 6). The lack of up-regulation of the inducible HBD 2 in non-CF-NP, previously also described in atopic dermatitis 26, a disease sharing many features with non-CF-NP, could induce an increased susceptibility to S. aureus, a pathogen related to the severity of non-CF-NP. 4 To confirm interaction between IL-8 synthesis, HBD 2 expression, and exposure to P. aeruginosa in CF-NP, further study will be needed. However, the up-regulation of TLR 2, HBD 2 and IL-8 in CF-NP illustrates the induction of innate immunity defence mechanisms, consisting of an antimicrobial activity against Gram positive and Gram negative bacteria (HBD 2), and the signal transduction through TLR 2 with consecutive release of IL-8 30, leading to the attraction of neutrophils for phagocytosis On the other hand, we hypothesize that in non-CF-NP, a dysregulated eosinophilic inflammation, with IgE formation, is triggered by products of colonizing bacteria (e.g. enterotoxins of S. aureus), while the innate immune system increases phagocytosis of germs by MMR-positive macrophages. In contrast, in cystic fibrosis, nose and sinus mucosa, colonized with S. aureus and P. aeruginosa, responds with the up-regulation of TLR 2 and HBD2, which in turn induces a dysregulated, insufficient, neutrophilic inflam-mation. This hypothesis needs to be further investigated, especially with focus on the impairment of non-CF nasal polyp tissue to respond by an adequate TLR and HBD response, and the effectiveness of such a response in CF. The significant differences between innate markers and inflammatory mediators in CF-NP and non-CF-NP provide further arguments to understand clinically similar disease manifestations (nasal polyps) as different diseases of the upper airways. Conclusion: We demonstrate here that CF-NP and non-CF-NP not only differ in terms of inflammatory cell and cytokine patterns, but also in terms of the expression of innate markers. CF-NP is associated with the up-regulation of both HBD 2 and TLR 2, while the expression of MMR dominates innate defence in non-CF-NP. Distinct correlations between innate markers and inflammatory markers in both diseases possibly indicate links, which are currently only partially understood and require further research. Acknowledgements This study was supported with grants from the fund Alphonse and the Belgian Society against Cystic Fibrosis.
Chapter VII __________________________________________________________________________
89
Figure legends Figure 1a-d Comparison of HBD 2 (a), TLR 2 (b), TLR 4 (c) and MMR (d) mRNA quantification between controls, non-CF-NP and CF-NP. P values for statistically significant differences between groups are represented. CO: controls, non-CF-NP: non-cystic fibrosis nasal polyps, CF-NP: cystic fibrosis nasal polyps.
Figure 2a-f Comparison of ECP (a), eotaxin (b), IL-5 (c), IgE (d), IL-8 (e) and MPO (f) concentrations between controls, non-CF-NP and CF-NP. P values for statistically significant differences between groups are represented. CO: controls, non-CF-NP: non-cystic fibrosis nasal polyps, CF-NP: cystic fibrosis nasal polyps.
Chapter VII __________________________________________________________________________
90
References [1] Cimmino M, Cavaliere M, Nardone M, et al. Clinical
characteristics and genotype analysis of patients with cystic fibrosis and nasal polyposis. Clin Otolaryngol 2003; 28: 125-32
[2] Rowe-Jones JM, Shembekar M, Trendell-Smith N, Mackay IS. Polypoidal rhinosinusitis in cystic fibrosis: a clinical and histopathological study. Clin Otolaryngol 1997; 22: 167-71
[3] Muhlebach MS, Stewart PW, Leigh MW, Noah TL. Quantification of inflammatory response to bacteria in young cystic fibrosis and control patients. Am J Respir Crit Care Med 1999; 160: 186-91
[4] Gevaert P, Holtappels G, Johansson SGO, Cuvelier C, van Cauwenberge P, Bachert . Organization of secondary lymphoid tissue and local IgE formation to Staphylococcus Claeys S, De Belder T, Holtappels G, et al. Human beta-defensins and toll-like receptors in the upper airway. Allergy 2003; 58: 748-53
[5] Claeys S, De Belder T, Holtappels G, et al. Macrophage mannose receptor in chronic sinus disease. Allergy 2004; 59:606-12
[6] Rudack C, Stoll W, Bachert C. Cytokines in nasal polyposis, acute and chronic sinusitis. Am J Rhinol 1998; 12: 383-8
[7] Tan MC, Mommaas AM, Drijfhout JW, et al. Mannose receptor mediated uptake of antigens strongly enhances HLA-class II restricted antigen presentation by cultured dendritic cells. Adv Exp Med Biol 1997; 417: 171-4
[8] Shibata Y, Metzger WJ, Myrvik QN. Chitin particle-induced cell-mediated immunity is inhibited by soluble mannan: annose receptor-mediated phagocytosis initiates IL-12 production. J Immunol 1997; 159: 2462-7
[9] Yamamoto Y, Klein TW, Friedman H. Involvement of mannose receptor in cytokine interleukin-1 beta (IL-1 beta), IL-6 and granulocyte-macrophage colony-stimulating factor responses, but not in chemokine macrophage inflammatory protein 1 beta (MIP-1 beta), MIP-2 and KC responses, caused by attachment of Candida albicans to macrophages. Infect Immun 1997; 65: 1077-82
[10] Bernardo J, Billingslea AM, Blumenthal RL, et al. Differential responses of human mononuclear phagocytes to mycobacterial lipoarabinomannans: role of CD14 and the mannose receptor. Infect Immun 1998; 66: 28-35
[12] Bachert C, Gevaert P, Holtappels G, Cuvelier C, van Cauwenberge P. From cytokines to growth. Am J Rhinol 2000; 14: 279-90
[13] Bachert C, Gevaert P, Holtappels G, Johansson SGO, van Cauwenberge P. Total and specific IgE in nasal polyps is related to local eosinophilic inflammation. J Allergy Clin Immunol 2001; 107:607-17
[14] Kim JS, Hackley GH, Okamoto K. Sputum processing for evaluation of inflammatory mediators. Ped Pulmonology 2001; 32: 152-8
[15] Sobol SE, Christodoulopoulos P, Manoukian JJ, et al. Cytokine profile of chronic sinusitis in patients with cystic ibrosis. Arch Otolaryng Head Neck Surg 2002; 128: 1295-8
[16] Murai M, Aramaki Y, Tsuchiya S. Contribution of mannose receptor to signal transduction in Fc gamma receptor-mediated phagocytosis of mouse peritoneal macrophages induced by liposomes. J Leukoc Biol 1995; 57: 687-91
[17] Cario E, Rosenberg IM, Brandwein SL, et al. Lipopolysaccharide activates distinct signaling pathways in intestinal epithelial cell lines expressing Toll-like receptors. J Immunol 2000; 164: 966-72
[18] Matsuguchi T, Musikacharoen T, Ogawa T, et al. Gene expressions of Toll-like receptor 2, but not Toll-like receptor 4, is induced by LPS and inflammatory cytokines in mouse macrophages. J Immunol 2000; 165: 5767-72
[19] Imasato A, Debois-Mouthon C, Han J, et al. Inhibition of p38 MAPK by glucocorticoids via induction of MAPK phosphatase-1 enhances nontypeable Haemophilus influenzae-induced expression of toll-like receptor 2. J Biol Chem 2002; 277: 47444-50
[20] Oshikawa K, Sugiyama Y. Regulation of toll-like receptor 2 and 4 gene expression in murine alveolar macrophages. Exp Lung Res 2003; 29:401-12
[21] Musikacharoen T, Matsuguchi T, Kikuchi T, et al. NF-kappa B and STAT5 play important roles in the regulation of mouse Toll-like receptor 2 gene expression. J Immunol 2001; 166: 4516-24
[22] Wang T, Lafuse WP, Zwilling BS. NFkappaB and Sp1 elements are necessary for maximal transcription of toll-like receptor 2 induced by Mycobacterium avium. J Immunol 2001; 167: 6924-32
[23] Haehnel V, Schwarzfischer L, Fenton MJ, et al. Transcriptional regulation of the human toll-like receptor 2 gene in monocytes and macrophages. J Immunol 2002; 168: 5629-37
[24] Wang X, Zhang Z, Louboutin JP, Moser C, Weiner DJ, Wilson JM. Airway epithelia regulate expression of human beta-defensin 2 through Toll-like receptor 2. FASEB J 2003; 17:1727-9
[25] Kurt-Jones EA, Mandell L, Whitney C, et al. Role of Toll-like receptor 2 (TLR2) in neutrophil activation: GM-CSF enhances TLR2 expression and TLR2-mediated interleukin 8 responses in neutrophils. Blood 2002; 100: 1860-8
[26] Nomura L, Goleva E, Howell MD. Cytokine milieu of atopic dermatitis, as compared to psoriasis, skin prevents induction of innate immune response genes. J Immunol 2003; 171: 3262-9
[27] Schaller-Bals S, Schulze A, Bals R. Increased levels of antimicrobial peptides in tracheal aspirates of newborn infants during infection. Am J Respir Crit Care Med 2002; 165: 992-5
[28] Duits LA, Nibbering PH, van Strijen E, et al. Rhinovirus increases human β-defensin-2 and –3 mRNA expression in cultured bronchial epithelial cells. FEMS Immunol Med Microbiol 2003; 38: 59-64
[29] Duits LA, Rademaker M, Ravensbergen B, et al. Inhibition of HBD-3, but not HBD-1 and HBD-2 mRNA expression by corticoids. Bioch Biophys Res Commun 2001; 280: 522-5
[30] DiMango E, Ratner AJ, Bryan R, Prince A. Activation of NF-κB by adherent Pseudomonas aeuginosa in normal and cystic fibrosis respiratory epithelial cells. J Clin Invest 1998; 101: 2598-605
Chapter VIII __________________________________________________________________________
91
Chapter VIII
Differentiation of nasal polyps
in patients with and without
cystic fibrosis
Content: A. Characterization of macrophages in nasal polyps from patients with and without nasal
polyps - Introduction
- Original article:
Macrophage typing in nasal polyps from patient with and without cystic fibrosis. Claeys S, Van Hoecke H, Van Zele T, Holtappels G, Bachert C, van Cauwenberge P. Submitted
B. Characterization of chronic rhinosinusitis and nasal polyposis in patients with and
without cystic fibrosis by nasal biomarkers profiles. - Introduction - Original article:
A paradigm shift in chronic sinus disease:chronic rhinosinusitis and nasal polyposis can be differentiated by inflammatory mediators. S. Claeys, T. Van Zele, P. gevaert, G. Holtappels, P. van Cauwenberge, C. Bachert. Submitted.
Chapter VIII __________________________________________________________________________
92
A. Characterization of macrophages in nasal polyps from patients with and without nasal polyps.
Introduction
In the previous chapter we demonstrate that CF-NP and NP differ in terms of cytokine patterns and
expression of innate markers. The distinct upregulation of the macrophage mannose receptor
(Chapter VI) in nasal polyposis guided us towards the possibility of a role of macrophage immune
regulation in this disease.
Macrophages play an important role in both innate and adaptive cellular immune response. After
antigen recognition, capture and phagocytosis, macrophages release, secretory products (e.g.
cytokines and chemokines) that mobilize and activate other host immune cells (1). The dual function
of macrophages in both innate and adaptive immune defence is illustrated by the expression on their
surface of both innate receptors (MMR, TLR, CD14) and allergen specific receptors (CD23). (2)
Macrophages display marked surface heterogeneity, depending on their differentiation/maturation
stage and response to their tissue environment.
In the study of this chapter we compared in tissue from patients with CRS, CF-NP and NP, the
expression of macrophage innate receptors and surface proteins, which determine the differentiation
and activity status of macrophages, in order to assess possible differences in innate cellular defence
mechanisms. This was the first study in which macrophage heterogeneity was assessed in chronic
rhinosinusitis. Significant differences in expression of innate receptors were found between patients
with CRS, NP and CF with NP. To evaluate the role of a ligand receptor binding on macrophages in
the (onset of) nasal polyp formation, both in patients with and without cystic fibrosis, further
research on innate macrophage signal-transduction will be necessary.
References (1) Taylor PR, Martinez-Pomares L, Stacey M, Lin H-H, Brown GD, Gordon. Macrophage receptors and
immune recognition. Annual Review Immunol 2005; 23:901-44 (2) Reed Ch, Milton DK. Endotoxin-stimulated innate immunity: a contributing factor for asthma. L Allergy
Clin Immunol 2001; 108:157-66
Chapter VIII __________________________________________________________________________
93
Original Article
Macrophage typing in nasal polyps from patient with and without cystic fibrosis
Claeys S1, Van Hoecke H1, Van Zele T1, Holtappels G1, Van Cauwenberge P1, Bachert C1 1 Upper airways Research Laboratory, Department of Otorhinolaryngology, Ghent University, Belgium Keywords: nasal polyps, cystic fibrosis, macrophages, pattern recognition receptor, surface proteins Abstract Background: Up to 4% of the general population is diagnosed with nasal polyps (NP), but the prevalence is much higher in children with cystic fibrosis (CF). In order to assess dysfunction in the early phase of immunological surveillance and regulation in different chronic sinonasal disorders we characterized and compared macrophage subsets in situ in NP tissue from patients with CF and without CF and in sinonasal mucosa of patients with chronic rhinosinusitis. Methods: Surgical samples were obtained from non-cystic fibrosis patients with nasal polyps (NP), CF patients with nasal polyps (CF-NP), patients with chronic rhinosinusitis (CRS) and patients without inflammatory sinonasal pathology (CO). We semiquantitatively evaluated the expression of the macrophage surface proteins CD68, CD14, CD163, RFD7 and MMR by immmunohistochemistry and we measured the mRNA expression of CD14, CD163 and MMR by real time RT-PCR. Results: Comparing NP and CF-NP tissue, NP tissue demonstrated a significantly stronger staining for RFD7, whereas CF-NP tissue demonstrated a significantly stronger expression for CD14 both by staining and quantitative RT-PCR. Both cell counts for MMR positive cells and MMR mRNA expression showed the highest levels in NP, but no significance was calculated compared to CF-NP. Conclusions: The upper airway macrophage population shows phenotypic heterogeneity in clinically similar inflammatory disease states, indicating a possible functional difference in phagocytic and inflammatory signalling capacity of macrophages in chronic sinus inflammation. List of abbreviations CD: cluster of differentiation CF: cystic fibrosis CRS: chronic rhinosinusitis CO: controls Ig: immunoglobulin LPS: lipopoysaccharide MMR: macrophage mannose receptor NP: nasal polyps RT-PCR: reversed transcriptase polymerase chain reaction TLR: Toll like receptor
Chapter VIII __________________________________________________________________________
94
Introduction Nasal polyp formation remains an enigmatic
aspect of chronic upper airway disease. Nasal polyps (NP) emerge as blue-grey protuberances in the area of the ethmoid bone, middle meatus and middle turbinate of the nose and is clinically characterized by increasing nasal blockage, often with purulent hypersecretion and/or hyposmia. The treatment of NP remains a challenge in rhinology: medical treatment is not always satisfactory and because of frequent recurrences, repeated surgical interventions are often necessary. NP are diagnosed in up to 4% of the general population, but the incidence is significantly higher in cystic fibrosis (CF) patients [1,2]. Although the exact etiology of NP formation is still not established, the influence of bacterial colonization in this ultimate manifestation of chronic upper airway inflammation has been acknowledged. In relevant subgroups of NP, colonization with S. aureus has been linked to polyclonal hyper-immunoglobulinemia E, locally formed IgE antibodies to staphylococcal enterotoxines and increased eosinophilic inflammation [3]. In sinonasal disease of patients with CF, however, mucus hypersecretion and disturbed mucociliary clearance is associated with persistent bacterial infection and a predominant neutrophilic inflammation [4].
The immune surveillance in nasal mucosal tissue of both non-CF and CF patients with NP is apparently insufficient to suppress bacterial growth, and the immune regulatory mechanisms are unable to restrain the aggressive, unbalanced and hypertrophic inflammation, characterizing NP formation.
Macrophages are in the front line of host defence and by expressing pattern recognition receptors (PRR), they are able to recognize foreign ligands during early phases of the immune response. Macrophages interact with a wide range of antigens and their capacity to produce inflammatory cytokines and lipid inflammatory mediators, together with their ability to present antigens to T- and B-cells, illustrates their central role during inflammation. Monocytes/macrophages display important differences in morphology, phenotype and functional capabilities, depending on multiple factors such as their origin, maturation status and tissue environment. To investigate such heterogeneity the detection of surface proteins with monoclonal antibodies (mAbs) has shown to be a particularly useful method.
In a previous study we have found a significant upregulation of the macrophage mannose receptor (MMR) gene expression in nasal polyp tissue in non-cystic fibrosis patients (NP) compared to chronic rhinosinusitis (CRS) tissue and to nasal polyp tissue from patients with CF (CF-NP) [5]. MMR is a 175kDA transmembrane glycoprotein which facilitates the binding to bacteria and mediates phagocytosis of non-self and antigen delivery to MHC class II compartments [6]. After
ligand binding, MMR can function as signal transducing receptor triggering a variety of responses including secretion of mediators [7], lysosmal enzyme secretion [8], cytokine production (IL-1, IL-6, Il-12) [9, 10] and modulation of other cell surface receptors [11-14], which emphasizes the role for MMR as a link between innate and adaptive immunity. It has already been demonstrated that MMR
expression depends on the maturation status of the macrophage. In addition, MMR expression is also regulated by specific pro- or anti-inflammatory signals, such as the environmental cytokine profile [15]. The presence of MMR positive macrophages in nasal tissue indicates a tissue response to external stimuli. In order to investigate the role of macrophages in early immunologic surveillance and regulation in inflammatory sinonasal disease, we characterized and compared macrophage subsets through immunohistochemistry in situ in nasal polyp tissue from patients with and without CF, in sinus mucosal tissue from patients with chronic rhinosinusitis (CRS) and in inferior turbinate tissue from patients without inflammatory sinonasal disease (control, CO).
We stained the tissue with monoclonal antibodies against two innate receptors (MMR, CD14) and three additional surface proteins (RFD7, CD163, CD68). Furthermore, we measured mRNA tissue expression of MMR, CD14 and CD163 by real time RT-PCR.
CD14 is an innate LPS surface receptor [16], which is part of the receptor/signalling complex [17] that consists of TLR4, CD14 and MD2, and is known to be of importance in macrophage associated phagocytosis. CD163 and RFD7 are surface proteins, whose expression and level of activity is determined by both the maturation status and the origin of the macrophage. CD163 is a group B cysteine rich scavenger receptor expressed exclusively by cells of the monocyte-macrophage lineage [18]. Although this 130 kDa transmembrane receptor has been indirectly associated with anti-inflammatory activity, in particular with the resolving phase of inflammatory response, a ligand-receptor-effector pathway has not yet been described [19]. RFD7 is a 77-kDa antigen expressed by mature tissue macrophages [20]. Staining for CD68, a transmembrane protein expressed in mononuclear phagocytic cells and tissue resident macrophages, was used to identify differences in overall macrophage population in the selected sinonasal tissue. Materials Patients were selected for this study at the
Department of Otorhinolaryngology, Ghent University Hospital. The ethical committee of Ghent University Hospital approved the study and informed consent was obtained from all subjects prior to inclusion in the study. Nasal polyps were collected from patients with (CF-NP) or without cystic fibrosis (NP) during functional endoscopic sinus surgery. Nasal polyposis was defined as the presence of endoscopically visible bilateral polyps, growing from the middle meatus into the nasal cavities. CT-scan of the paranasal sinuses confirmed in
Chapter VIII __________________________________________________________________________
95
these patients one or more affected ethmoidal or maxillary sinuses.
Sinonasal samples were also collected from patients diagnosed with chronic rhinosinusitis (CRS), according to the definition of the American Academy of Otorhinolaryngology – Head and Neck Surgery. Patients were included in this group, based on the persistence of the typical symptoms for 12 weeks or more, confirmed by a positive CT-scan and without visible nasal polyp formation on nasal endoscopy, prior to surgery. As control samples (CO), we collected biopsies from inferior turbinates from patients without inflammatory sinonasal pathology, undergoing septal surgery. All tissue samples were immediately snap-frozen in liquid nitrogen.
For macrophage typing through semi-quantitative cell count and quantitative real time PCR, we collected 46 sinonasal surgical samples, from 46 different patients (11 CO: 8 males, 3 females, aged 26-50 years old; 11 CRS: 6 males, 5 females, aged 18-69 years old; 10 NP: 7 males, 3 females, aged 35-69 years old; 14 CF-NP: 10 males, 4 females, aged 3-29 years old).
A history of asthma was registered in 4/10 patients with NP, with one patient also demonstrating a history of aspirin sensitivity. None of the patients of the CF-NP, CRS and CO groups had a history of asthma or aspirin sensitivity. Skin prick tests were positive for at least one inhalant allergen in 3/10 patients with NP, in 2/14 patients with CF-NP, in 4/11 patients with CRS and in 1/11 CO patients. None of the patients were treated with oral corticosteroids within 4 weeks prior to surgery. 1/11 patients of the CRS group, 2/14 patients of the CF-NP group and none of the NP and CO groups used nasal corticosteroids within 4 weeks prior to surgery. Methods Immunohistochemistry
Cryostat sections (6 µm) were prepared and mounted on SuperFrost Plus glass slides (Menzel Glaeser, Braunschweig, Germany) packed in aluminium paper and stored at –30° C until staining. Specimens were fixed in acetone. Endogenous peroxidase was blocked for 20 minutes with 0.3% H2O2, 0.1 % sodium azide in TBS. Specimens were incubated for 1 hour with the primary antibody or a negative control antiserum, consisting of the corresponding isotype control serum: Mannose Receptor (clone: 15-2-2, TNO, Leiden; The Netherlands), CD68 (clone: EBM 11, Dako Cytomation, Heverlee; Belgium), CD163 (clone: Ber-MAC3, Dako Cytomation), CD14 (clone: TÜK 4, Dako Cytomation, Heverlee; Belgium) and anti-macrophage (clone RFD7, Serotec, Oxford; UK). The detection was performed using the LSAB method (labeled streptavidine-biotin, Dako Cytomation) according to the manufactor’s instructions. Sections were incubated with AEC-chromogen, which results in a
red-stained precipitate. Finally, sections were counterstained with Haematoxylin and mounted.
The number of positive cells was analysed using magnification x400 and coded by two independent observers who did not know the diagnosis and clinical data. A grading scale from 0 to 3 was applied, ranging from absent to numerous stained cells. The scoring system was calibrated for each marker separately by examining a representative number of samples. For CD14, CD68 and RFD 7 score 0 represents no positive cells, score 1: <10 positive cells/field, score 2: 10-100 positive cells/field and score 3: >100 positive cells/field. For CD163 and MMR a different scoring system was used. For these markers score 0 represents no positive cells while score 1 was given if less than 20 positive cells were seen per field, score 2 for: 20-200 positive cells per field and score 3 for >200 positive cells per field. The analysis included all areas of the biopsy specimens and for each biopsy 10 fields were scored. Afterwards the mean score was expressed logarithmically. RNA preparation and Real-Time-Quantitative RT-PCR
Snap frozen tissue samples were placed in liquid nitrogen and thoroughly grinded with a mortar and pestle. The resulting tissue powder was resuspended in TriReagent (Sigma, Bornem; Belgium) and total RNA was isolated following the instructions of the manufacture. One µg of total RNA, DNase treated, was reverse transcribed to generate cDNA with iScriptTMcDNA Synthesis Kit (Bio-Rad Laboratories, Eke; Belgium).
Primers and probes used for PCR amplification were purchased from Eurogentec (Liège, Belgium): CD14-forward primer (5’- CGCTCCGAGATGCATGTG -3’), CD14 -probe (FAM-5’-TCCAGCGCCCTGAACTCCCTCA-3’), CD14 -reverse primer (5’- TTGGCTGGCAGTCCTTTAGG -3’), CD163 -forward primer (5’- ACATAGATCATGCATCTGTCATTTG -3’), CD163-probe (FAM-5’-TCTGGTTTGATGATCTTATATGCAACGGAAATG-3’), CD163-reverse primer (5’- ATTCTCCTTGGAATCTCACTTCTA -3’).
Real-time PCR was performed in a 25 µl reaction mixture composed of 5 µl cDNA (equivalent to 25 ng total RNA), 10 pM (final concentration) oligonucleotide primers, 2,5 pM Probe, 5mM MgCl2, 200 µM dNTPs and 0,025 U/µl Hot GoldStar enzyme (Eurogentec) and measured with a Perkin Elmer ABI Prism 7700 Sequence Detection System (Applied Biosystems, Foster City, CA). Reactions were incubated for 10 minutes at 95°C, followed by 45 cycles of a two-step amplification procedure composed of annealing/extension at 60°C for 1 minute and denaturation for 15 seconds at 95°C. In each run, diluted series of pooled cDNA from tonsils were amplified to serve as a standard curve for calculation of relative quantities. Statistical analyses
Data are expressed as median and interquartile range. When comparisons were made between groups,
Chapter VIII __________________________________________________________________________
96
significant between-group variability was first examined using the Kruskal Wallis test. The Mann Whitney U-test was used for between-group (unpaired) comparison. Values of p<0.05 were considered as statistically significant. Results (Fig 1 and 2)
Through semiquantitative evaluation of the tissue expression of the diverse macrophage phenotypic markers we found the highest expression of CD14 in CF-NP, whereas RFD7, CD68, CD163 and MMR showed the highest expression in NP.
Compared to CO and CRS, NP demonstrated a significantly higher expression of RFD7, CD163, CD68 and MMR (NP versus CO respectively p<0.001, p<0.001, p=0.01 and p=0.02; NP versus CRS respectively p<0.001, p=0.004, p=0.05 and p=0.043), whereas CF-NP demonstrated a significantly higher expression of CD14, CD163, RFD7 and CD68 (CF-NP versus CO respectively p<0.001, p=0.001, p=0.01 and p=0.001; CF-NP versus CRS respectively p<0.001, p=0.021, p=0.025 and p=0.038).
In CRS we found a significantly higher expression of CD68, RFD7, MMR and CD163 compared to CO (respectively p=0.01, p<0.001, p=0.02, p<0.001).
Comparing NP and CF-NP, we demonstrated a significantly higher expression of RFD7 in NP compared to CF-NP (p=0.006), whereas CD14 was significantly higher expressed in CF-NP compared to NP (p<0.001).
Real time quantitative RT-PCR was performed to evaluate the gene expression of CD163, CD14 and MMR. Similar to the semiquantitative analysis, we demonstrated a significantly higher gene expression of CD14 in CF-NP compared to CO (p=0.01), CRS (p=0.001) and NP (p=0.03). For CD163 on the other hand, we only found a significantly higher gene expression in CF-NP compared to CO (p=0.01) and CRS (p=0.019). No difference in CD163 expression was found between NP and CF-NP. MMR mRNA expression showed significant higher levels in NP compared to CO (p=0.005) and CRS (p=0.01), but compared to CF-NP no significance was calculated.
Figure 1: Semiquantitative evaluation of CD14, CD163, RFD7, CD68, MMR expression in tissue (box blot graph) in CO, controls (inferior turbinate); CRS, chronic rhinosinusitis; NP, non-cystic-fibrosis nasal polyps and CF-NP, cystic fibrosis nasal polyps. Data are expressed as mean values.
Chapter VIII __________________________________________________________________________
97
Figure 2. Quantification of CD163 mRNA, CD14mRNA and MMR mRNA with real-time RT-PCR (box blot graph) in CO, controls (inferior turbinate); CRS, chronic rhinosinusitis; NP, non-cystic-fibrosis nasal polyps and CF-NP, cystic fibrosis nasal polyps. Relative expression level: in relation to PBGD (housekeeping) gene.
Discussion Nasal polyps represent a chronic form of upper airway inflammation, occurring in a considerable part of the general population. Adult NP formation is frequently linked to co-morbidities such as asthma and aspirin sensitivity, whereas in children systemic diseases such as cystic fibrosis have to be considered. The vast majority (about 80%) of NP in adults are characterized by a predominant infiltration of eosinophils. NP in patients with CF, on the other hand, are marked by an apparent neutrophilic inflammation. These important histomorphological differences could indicate a variable inflammatory background in NP and CF-NP. Through the recognition of foreign ligands by PRR and through phagocytosis, macrophages have a central role in innate immune defense. Furthermore, they are involved in antigen presentation and in the synthesis and release of a range of inflammatory mediators in the immediate tissue environment as well as in the systemic circulation. Therefore, macrophages represent a crucial link between the initiation of an early immune response and the further progression of inflammation [21]. During cellular maturation and differentiation, tissue distribution and exposure to endogenous and exogenous stimuli [22], macrophages show phenotypical changes, corresponding with a diversity in functional potential [23]. In this study we found significant differences in macrophage populations in different chronic inflammatory sinonasal disorders. CD68, a transmembrane glycoprotein, expressed by all cells of the mononuclear phagocyte lineage including all monocytes and tissue resident macrophages was significantly higher expressed in chronic sinus disease (CRS, NP and CF-NP) compared to healthy nasal mucosa. Both NP and CF-NP demonstrated higher counts of CD68 positive cells than CRS, but no significant differences were found between nasal polyp groups. This high level of CD68 expression in NP and CF-NP reflects the role of monocytes/macrophages in both conditions. CD14, expressed on monocytes, macrophages and neutrophils, is a first-line screener for microbial antigens that needs a co-receptor as signal transducer (like TLR4) [24] to initiate a pathogen specific innate
immune response through the NF-kB inflammatory pathway. CD14 is mainly present on monocytes and young freshly recruited monocytoid macrophages. The increased expression of CD14, accompanied by an increased CD68 expression, in CF-NP might be the result of an increased influx of macrophages from the circulation, or of an increased CD14 membrane expression on monocytes/macrophages influenced by microbial triggering and inflammatory mediators in the surrounding tissue environment. Probably both mechanisms have to be taken into account. Upregulation of membrane CD14 expression or recruitment of CD14+ cells into inflamed tissue is possibly an indicator of the disease activity and at least partly explains the increased pro-inflammatory responses that are seen in CF airway disease. CD14 is the main receptor for LPS and increased CD14 expression can be induced by P. Aeruginosa, an important opportunistic pathogen in upper and lower airways of CF patients [25]. It has been shown that the non-opsonic phagocytosis through CD14 of P. aeruginosa, induces distinct gene expression patterns for pro-inflammatory cytokines, surface receptors, transcription factors and proteins depending on the Pseudomonas strain [26]. The macrophage phagocytic and inflammatory response is apparently dependent on the bacterial ligand. We therefore hypothesize that the significant difference in CD14+ cell counts in NP versus CF-NP reflect a different macrophage sensibilisation by microbial products. In previous studies we have found a significant increase of mRNA tissue expression of the macrophage mannose receptor (MMR), another pathogen recognizing receptor, in NP compared to sinonasal tissue of control patients, CRS patients [27] and CF patients with NP [5]. This MMR expression has been matched to macrophages, either as single cells or accumulating in aggregates in connection with the epithelium. MMR positive cell aggregates appeared to be co-localized to CD3+ T-cells and plasma cells, partially IgE positive, and without the presence of dendritic cells and B-cells. Furthermore, a significant correlation between MMR gene expression and the protein concentration of IgE
Chapter VIII __________________________________________________________________________
98
antibodies was found, suggesting a pathogen driven immune response through the innate MMR in non-CF patients with NP. The semiquantitative evaluation of MMR+ cells by cell counts (immunohistochemistry) showed a significant higher count in NP tissue compared to CRS and CO tissue. MMR mRNA expression showed significantly higher levels for both NP and CF-NP compared to CO. Although MMR mRNA and semiquantitative scores were elevated in NP compared to CF-NP, no significant difference could be calculated. We can, however, hypothesize that the specific upregulation of MMR in NP with a probable link to T- cell activation, T-B-cell interaction and immunoglobulin switch towards IgE has less importance in CF-NP. As for CD14 upregulation in CF-NP, further research is necessary to identify the trigger(s) for MMR upregulation in NP. The difference in innate receptor expression in NP and CF-NP illustrates a different pathogen-macrophage interaction, possibly leading to a distinct immune regulation. Other phenotypical differences of mononuclear phagocytes are probably also determinant in the degree of permissiveness to or susceptibility for pathogen at the site of inflammation [28]. In this study we evaluated macrophage phenotypes expressing RFD7 and found a gradually higher expression of RFD7+ macrophages in respectively CO, CRS, CF-NP and NP. More mature macrophage phenotypes express higher levels RFD7. RFD7+ macrophages represent a macrophage population that has undergone several steps of maturation and are expressed by more than 80% of mature macrophages in culture, but on less than 3% of peripheral blood monocytes [29]. According to some authors, expression of RFD7 identifies subsets of macrophages with phagocytic and anti-inflammatory potential. While INF-γ increases RFD7-negative immune stimulatory macrophages, with the capacity to stimulate T-cell proliferation, IL-10 promotes the differentiation of RFD7+ phagocytes and RFD7+ anti-inflammatory cells [29]. Our results show significantly higher counts of RFD7+ cells in NP compared to CO, CRS and CF-NP, which could indicate a balance shift towards phagocytic and/or suppressive macrophages in NP at a certain stage of NP inflammation. The lower RFD7+ cell count in CF-NP compared to NP might reflect a shift to a RFD7-negative pro-inflammatory macrophage pool capable of stimulating T-cell proliferation. Whether this relates to the sustained inflammation of the upper airways in CF patients, however, needs to be further investigated. We also evaluated the expression of scavenger receptor CD163. Differentiation of human blood monocytes into macrophages leads to an increase in CD163 expression [19]. CD163 expression is tightly regulated by pro- and anti-inflammatory mediators. It is downregulated by pro-inflammatory mediators like LPS, IFNγ and TNFα and is strongly up regulated by IL-6, dexamethasone and the anti-inflammatory IL-10 [30, 31]. Furthermore, increased numbers of CD163+ macrophages have been associated with a decreased lymphocyte activation [32]. It has been suggested that in the course of the anti-inflammatory phase CD163+ monocytes are recruited
from the blood, whereas during early inflammation CD163-negative monocytes are found to adhere via different adhesion proteins [33]. Furthermore, the implication of CD163 in the resolution of inflammation has been illustrated by the secretion of IL-10 in response to CD163-ligand binding on human monocyte-macrophages isolated in vitro and in vivo [19]. However, no anti-inflammatory ligand–receptor effector pathway for CD163 has been described yet. Although CD163 showed the highest mRNA expression in NP, no statistical difference was found compared to CD163 mRNA expression in CF-NP. The significant higher levels of CD163 mRNA expression in NP and CF-NP compared to controls and CRS, with no significant difference between the nasal polyp groups, probably illustrates an equal attempt to resolve local inflammation by tissue macrophages.
These results indicate that the difference in inflammatory processes in nasal polyps in non-CF and CF patients can be at least linked partially to a distinct initial step in the inflammatory process, mediated by macrophage-ligand binding through different pathogen recognizing receptors. Therefore, it would be interesting to further evaluate the binding agents and the consequences of macrophage-ligand binding through the investigation of macrophage signaling pathways mediated by pathogen recognizing receptors. Conclusion
An important step in host defense is the phagocytosis of foreign e.g. bacterial material. The specific ligand-receptor interaction through macro-phages may be important in influencing the development and further progression of inflammation.
The upper airway macrophage population shows phenotypic and functional heterogeneity in clinically similar inflammatory disease states. Differences in the expression of the innate receptors CD14 and MMR between NP patients with and without CF indicate a possibly differentiating role with respect to the phagocytic and inflammation-inducing capacity of macrophages in NP formation. A disturbed innate triggering through PPR, like MMR and CD14 during the onset phase of inflammation could be involved in the development of specific inflammatory characteristics.
On the other hand, increased CD163+ and RFD7+ macrophage counts in NP and CF-NP might indicate a similar attempt to resolve inflammation in both diseases. The highest counts of RFD7+ macrophages were found in NP and might reflect a balance shift towards phagocytic and/or suppressive macrophages in NP. Acknowledgements
This study was supported with grants from the fund Alphonse and the Belgian Society against Cystic Fibrosis.
Chapter VIII __________________________________________________________________________
99
References [1] Hedman J, Kaprio J, Poussa T, Nieminen MM. Prevalence of asthma, aspirin intolerance, nasal polyposis and chronic obstructive pulmonary disease in a population-based study. Int J Epidemiol. 1999;28(4):717-22. [2] Yung MW, Gould J, Upton GJ. Nasal polyposis in children with cystic fibrosis: a long-term follow-up study. Ann Otol Rhinol Laryngol. 2002;111(12 Pt 1):1081-6. [3] Bachert C, Gevaert P, Holtappels G, Johansson SGO, van Cauwenberge P. Total and specific IgE in nasal polyps is related to local eosinophilic inflammation. J Allergy Clin Immunol. 2001;107(4):607-14. [4] Sobol SE, Christodoulopoulos P, Manoukian JJ, et al. Cytokine profile of chronic sinusitis in patients with cystic fibrosis. Arch Otolaryng Head Neck Surg 2002; 128: 1295-8 [5] Claeys S, Van Hoecke H, Holtappels G, Gevaert P, De Belder T, Ver. Nasal polyps in patients with and without cystic fibrosis: a differentiation by innate markers and inflammatory mediators. Clin Exp Allergy. 2005; 35(4):467-72. [6] Engering AJ, Cella M, Fluitsma DM, Hoefsmit EC, Lanzavecchia A, Pieters J. Mannose receptor mediated antigen uptake and presentation in human dendritic cells. Adv Exp Med Biol. 1997;417:183-7. [7] Garner RE, Rubanowice K, Swayer RT, Hudson JA. Secretion of TNF-alpha by alveolar macrophages in response to Candida albicans mannan. J Leukoc Biol. 1994;55(2):161-8. [8] Ohsumi Y, Lee YC. Mannose-receptor ligands stimulate secretion of lysosomal enzymes from rabbit alveolar macrophages. J Biol Chem. 1987;262(17):7955-62. [9] Shibata Y, Metzger WJ, Myrvik QN. Chitin particle-induced cell-mediated immunity is inhibited by soluble mannan: mannose-receptor mediated phagocytosis initiates IL-12 production. J Immmunol. 1997;159(5):2462-7. [10] Yamamoto Y, Klein TW, Friedman H. Involvement of mannose receptor in cytokine interleukin-1 beta (IL-1beta), IL-6, and granulocyte macrophage colony-stimulating factor responses, but not in chemokine macrophage inflammatory protein 1 beta (MIP-1beta), MIP-2, and KC responses, caused by attachment of Candida albicans to macrophages. Infect Immun. 1997;65(3):1077-82. [11] Bernardo J, Billingslea AM, Blumenthal RL, Seetoo KF, Simons ER, Fenton MJ. Differential responses of human mononuclear phagocytes to mycobacterial lipoarabinomannans: role of CD14 and the mannose receptor. Infect Immun. 1998;66(1):28-35. [12] Murai M, Aramaki Y, Tsuchiya S. Contribution of mannose receptor to signal transduction in Fc gamma receptor-mediated phagocytosis of mouse peritoneal macrophages induced by liposomes. J Leukoc Biol. 1995;57(4):687-91. [13] Murai M, Aramaki Y, Tsuchiya S. Alpha 2-macroglobulin stimulation of protein tyrosine phosphorylation in macrophages via the the mannose receptor for Fc gamma receptor-mediated phagocytosis activation. Immunology. 1996;89(3):436-41. [14] DeFife KM, Jenney CR, McNally AK, Colton E, Anderson JM. Interleukin-13 induces human monocyte/macrophage fusion and macrophage mannose receptor expression. J Immunol. 1997;158(7):3385-90. [15] Hou FF, Boyce J, Zhang Y, Owen WF Jr. Phenotypic and functional characteristics of macrophage-like cells differentiated in pro-inflammatory cytokine-containing cultures. Immunol Cell Biol. 2000;78(3):205-213. [16] Grunwald V, Fan XL, Jack RS, Monocytes can phagocytose gram-negative bacteria by a CD14-dependent mechanism. J Immunol.1996;157:4119-25.
[17] Means TK, Lien E, Yoshimura A. The CD14 ligands lipoarabinimannan and lipopolysaccharide differ in their requirement for Toll-like receptors. J. Immunolog, 1999;163(12):6748-55. [18] Law SK, Micklem KJ, Shaw JM, Zhang XP, Dong Y, . A new macrophage differentiation antigen which is member of the scavenger receptor superfamily. Eur J Immunol. 1993;23(9):2320-5. [19] Philippidis P, Mason JC, Evans BJ, Nadra I, Taylor KM, Haskard DO, et al. Hemoglobin scavenger receptor CD163 mediates interleukin-10 release and heme oxygenase-1 synthesis: anti-inflammatory monocyte-macrophage responses in vitro, in resolving skin blisters in vivo, and after cardiopulmonary bypass surgery. Circ Res. 2004;94(1):119-26. [20] Poulter JW, Campbell DA, Munro C, Janossy G. Discrimination of human macrophages and dendritic cells by means of monoclonal antibodies. Scand J Immunol. 1986;24(3):351-7. [21] Gordon S. Pattern recognition receptors: doubling up for the innate immune response. Cell. 2002;111(7): 927-930. [22] Lang R, Patel D, Morris J, Rutschman RL, Murray PJ. Shaping gene expression in activated and resting primary macrophages by IL-10. J Immunol 2002;169(5):2253-63. [23] Stout RD, Suttles J. Functional plasticity of macrophages: reversible adaptation to changing microenvironments. J. Leukoc Biol. 2004;76(3):509-13. [24] Moreno C, Merino J, Ramirez N, Ramirez N, Echeveria A, Pastor F, Sanchez-Ibarrola A. Lipopolysaccharide needs soluble CD14 to interact with TLR4 in human monocytes depleted of membrane CD14. Microbes Infect 2004; 6(11): 990-995. [25] Krzeski, Kapiszewska-Dzedzej D, Gorski NP, Jakubczyk I. Cystic fibrosis in rhinologic practice. Am J of Rhinol. 2002;16(3):155-60. [26] Pollard AJ, Currie A, Rosenberger CM, Heale JP, Finlay BB, Speert DP. Differential post-transcriptional activation of human phagocytes by different Pseudomonas aeruginosa isolates. Cell Microbiol. 2004;6(7):639-650. [27] Claeys S, De Belder T, Holtappels G, Gevaert P, Verhasselt B, Van Cauwenberge, et al. Macrophage mannose receptor in chronic sinus disease. Allergy. 2004;59(6):606-12. [28] Sanchez-Torres C, Gomez-Puertas P, Gomez-del-Moral M, Alonso F, Escribano JM, Ezquerra A, et al. Expression of porcine CD 163 on monocytes/macrophages correlates with permissiveness to African swine fever infection. Arch Virol. 2003;148(12):2307-23. [29] Tormey VJ, Faul J, Leonard C, Burke CM, Dilmec A, Poulter LW. T cell cytokines may control balance of functionally distinct macrophage populations. Immunology. 1997;90(4):463-9. [30] Sulahian TH, Hogger P, Wahner AE, Wardwell K, Goulding NJ, Sorg C, et al. Human monocytes express CD163, which is upregulated by IL-10 and identical to p155. Cytokine. 2000;12(9):1312-21. [31] Buechler C, Ritter M, Orso E, Langmann T, Klucken J, Schmitz G. Regulation of scavenger receptor CD163 expression in human monocytes and macrophages by pro- and anti-inflammatory stimuli. J Leukoc Biol. 2000;67(1):97-103. [32] Baeten D, De Keyser F. Association of CD 163+ macrophages and local production of soluble CD163 with decreased lymphocyte activation in sponduylarthropathy synovitis. Arthritis and Rheumatism. 2004; 50(5):1611-23. [33] Wenzel I, Roth J, Sorg C. Identification of a novel surface molecule, RM3/1, that contributes to the adhesion of glucocorticoid-induced human monocytes to endothelial cells. Eur J Immunol. 1996;26(11):2758-63.
Chapter VIII _________________________________________________________________________
100
B. Characterization of chronic rhinosinusitis and nasal polyposis in patients with and without cystic fibrosis by nasal biomarkers profiles.
Introduction
An apparent exaggerated inflammation in the sinonasal cavities, which leads in 4% of the patients to
the development semi translucent nasal polyp formation (NP), indicates failure/deregulation of
mucosal innate and adaptive defence mechanisms.
Whether nasal polyps reflect a severe case of a common upper airway disease, or indicates a
different pathophysiological background has not been established yet. Based on a more profound
insight in the immunological background, it has been acknowledged that nasal polyp formation is
more then just “ballooning” of the mucosa in a rhinosinusitis patient. The reason why polyps
develop in some patients and not in others remains unknown but findings of our previous research
gave us clear indications that, however microscopically identical, not every polyp is the same.
In the present work we assessed a “inflammatory profile” on different disease entities corresponding
with the clinical diagnosis of chronic rhinosinusitis.
A better classification of chronic sinus disease will have an important impact on our ability to study
the epidemiology, to appreciate the impact on the society, to set up appropriate diagnostic measures
and studies, and to identify new therapeutic targets for chronic sinus diseases. The use of
inflammatory cytokine profiles for disease characterization has been challenged before in asthma
and COPD, two conditions with considerable overlap in pathogenesis and clinical features. (1) The
loss of immune homeostasis with chronic inflammation as consequence has been illustrated
elaborately through research on Th1/Th2 cytokine patterns but human disease is rarely characterized
by exclusive Th1 or Th2 cytokine pattern changes.
The distinct inflammatory patterns for CRS, NP and CFNP, assessed in this study, support the
approach of chronic rhinosinusitis as separate disease entities.
The definition of disease subgroups in the large cohort of chronic rhinosinusitis patients has been
made possible by the markers indicated in our manuscript.
To discriminate different disease groups (disease groups were initially selected based on history,
clinical examination, nasal endoscopy and CT-scan of the sinuses) we used Receiver Operating
Characteristic (ROC) curve analysis. The cut-off values corresponding with the highest accuracy
(minimal false negative and false positive results) were selected and the subsequent sensitivity and
specificity were used. Further, comparison of ROC curves was performed to test the statistical
significant difference between the areas under two ROC curves. P-values less than 0.05 were
considered statistically significant.
Chapter VIII _________________________________________________________________________
101
The use of these data will be a crucial step in launching more focused clinical studies and in
delivering more objective results in therapeutical essays.
References (1) Elias J. The relationship between asthma and COPD. Lessons from transgenic mice. Chest.
2004;126:111S-116S.
Chapter VIII _________________________________________________________________________
102
Chapter VIII _________________________________________________________________________
103
Original article
A paradigm shift in chronic sinus disease: chronic rhinosinusitis and nasal
polyposis can be differentiated by inflammatory mediators.
S Claeys*, T Van Zele*, P Gevaert, G Holtappels, P Van Cauwenberge, C Bachert
* These authors contributed equally to this article
Upper Airway Research Laboratory (URL), Department of Oto-Rhino-Laryngology, University Hospital
Ghent, Belgium.
This work was supported by a grant from the Flemish Scientific Research Board, FWO, Nr. A12/5-K/V-K17
and from the fund Alphonse and Jean Forton and the Belgian Society against Cystic Fibrosis.
Abstract: Background: The diagnosis of chronic rhinosinusitis is currently based on clinical history, nasal endoscopy and radiology. A considerable variability in response to treatment and a high recurrence rate after surgical or medical treatment in a large subgroup of patients with chronic sinusitis urges us to better differentiate chronic sinus disease. The main target of this study was to identify a profile of inflammatory mediators for selected disease subgroups. Methods: Nasal and sinus mucosal tissue was obtained from 14 nasal polyp patients (NP), 14 cystic fibrosis patients (CF-NP), 10 chronic rhinosinusitis subjects (CRS), and 10 control patients during routine endonasal sinus surgery and septoplasty, respectively. All subjects were clinically phenotyped, using nasal endoscopy and CT-scan. Samples were homogenized and assayed for eotaxin, IL-1�, IL-2sR�, IL-5, IFN-�, IL-8, TGF-b1, TNF-� and MPO by ELISA. IgE and ECP were measured by the UNICAP system. For each marker, inter-group comparisons were made and the ability of a marker to discriminate two patient groups was evaluated using Receiver Operating Characteristic (ROC) curve analysis. Results: The following markers were found to have significantly higher tissue concentrations compared to all other subgroups including controls: IL-5, ECP, eotaxin and IgE for NP, IFN-� for CRS, and IL-8 and MPO for CF-NP. ROC analysis comparing NP with CRS subjects for the first time demonstrated that NP can be differentiated from CRS using markers of eosinophilic inflammation, IL-5, ECP and eotaxin, as well as IgE and CRS can be differentiated from NP using IFN-�, TGF-�, IL1-� and TNF-� as markers. IL1-�, MPO and IL-8 differentiated CF-NP from CRS while IFN-� and IgE predicted CRS in this comparison. Finally, ECP, IL-5, IgE, IL1-�, MPO and IL-8 differentiated NP from CF-NP with sensitivities and specificities above 60%, respectively. Conclusion: We here show that, based on cytokine and mediator profiles, chronic rhinosinusitis without polyps, nasal polyps and nasal polyps in cystic fibrosis patients can be differentiated as distinct disease entities. This differentiation may have considerable impact on the classification of chronic sinus disease, as well as on epidemiologic, pathophysiologic and therapeutic research. Key words: chronic rhinosinusitis, nasal polyps, cystic fibrosis, ROC analysis, sIL2R-α, TGF-β, INF-γ, TNF-α, IL-5, IL-1β, IL-8, MPO, ECP, eotaxin, IgE.
Chapter VIII _________________________________________________________________________
104
Introduction Rhinosinusitis remains a significant health problem with a considerable socio-economic burden and is still increasing in prevalence and incidence. US data of 1997 indicate a prevalence of app. 15% of chronic rhinosinusitis (CRS) patients (defined as having ‘sinus trouble’ for more than 3 months in the year before the interview) in the general population. (1) In the period from 1985 to 1992, the number of antibiotic prescriptions for sinusitis rose from 7.2 million to 13 million per year. (2) According to figures from IMS Health, acute sinusitis was diagnosed 6.3 million times and chronic sinusitis 2.6 million times in Germany, a European country with 81 million inhabitants, over the course of one year (7/2000-6/2001), resulting in 8.5 million and 3.4 million prescriptions, respectively. The number of diagnoses of “nasal polyposis” was approx. 221,000. (3) In order to summarize the current knowledge in pathophysiology, as well as guidelines for the therapeutic and diagnostic management of sinus disease, position papers have recently been developed in the US (4) and Europe (5), which also identify deficits in our understanding. (4) Rhinosinusitis is diagnosed based on symptoms and duration of symptoms, clinical examination, nasal endoscopy and CT-scan. However, the pattern of symptoms and signs is overlapping in all patients with chronic sinus inflammation, whether they have formation of nasal polyps or not. As a result, all chronic sinus disease is considered as one disease spectrum, “chronic rhinosinusitis” (CRS). A considerable variability in response to treatment, with disease progression and a high recurrence rate after surgical or medical treatment in a large subgroup of patients, and a paucity in differentiated therapeutic approaches urges us to better differentiate chronic sinus disease. So far, nasal polyp formation in specific conditions such as cystic fibrosis (CF) and allergic fungal sinusitis (AFS) can be differentiated as disease entities, based on genetic defects in CF and a specific IgE-mediated immune response to fungi in AFS respectively. For the majority of chronic sinusitis cases, however, classification awaits further insights into pathomechanisms and the introduction of appropriate disease markers. Such markers could possibly be derived from 1) inflammatory cells, such as eosinophils and neutrophils, which can be found in increased numbers in some forms of CRS, 2) from the Th1/Th2 paradigm, possibly also involving T regulatory cells, and the cytokines released from those cells, 3) from remodelling processes linked to fibrosis or oedema formation, or 4) from innate or adaptive immunity products such as toll-like receptors or immunoglobulins. Differences in some of these markers in sinus disease versus nasal control tissue have been described (6), but these have not proven useful to differentiate disease entities of CRS. For example, interleukin (IL)-5, an eosinophil survival and differentiation factor, and eosinophil-cationic protein (ECP), an indicator for eosinophil activation, have been found to be significantly increased in NP versus controls. (7) Only recently, differences in the expression of metalloproteinases and their inhibitors could be demonstrated in CRS versus NP mucosal tissue. (8) However, a panel of markers covering several of the above mentioned aspects might be necessary to differentiate disease entities within CRS with sufficient power. In the current study we aimed to investigate cytokine and mediator pattern in different subgroups of chronic sinusitis: chronic rhinosinusitis without nasal polyp formation (CRS), patients with nasal polyps (NP), cystic fibrosis patients with nasal polyps (CF-NP) and controls (no sinus disease) (Co). Based on previous studies in CRS with and without NP (10) and comparative studies of NP and CF-NP (11), the following groups of mediators were carefully selected: Pro-inflammatory cytokines (IL-1β, tumour-necrosis-factor (TNF)-�), eosinophil-related mediators (ECP, eotaxin), neutrophil-related mediators (IL-8, myeloperoxidase (MPO)), T-cell and subset markers (sIL-2R�, interferon (IFN)-�, IL-5), a T regulatory marker (transforming growth factor (TGF)-β1) and immunoglobulin E (IgE). For each of these mediators, an analysis on the differentiating capacity between sinus diseases was performed, and a set of markers was finally selected. The main target was to possibly identify a profile of inflammatory mediators for each of the selected disease subgroups. Materials and methods Patients Nasal tissue was obtained from 14 polyp patients (mean age 41,7 years; range 21-69 years; 5 women and 9 men), 14 cystic fibrosis patients (mean age 13,2 years; range 3-25 years; 4 women and 10 men), 10 chronic rhinosinusitis subjects (mean age 49,3 years; range 22-70 years; 5 women and 5 men), and 10 control patients (mean age 33,8 years; range 14-57 years; 3 women and 7 men) at the department of Otorhinolaryngology of the University Hospital of Ghent, Belgium. Nasal polyp, chronic rhinosinusitis and cystic fibrosis samples were obtained during routine endonasal sinus surgery, whereas control samples were obtained from the inferior turbinate during septal surgery. The diagnosis of sinus disease was based on history, clinical examination, nasal endoscopy and CT-scan of the sinuses, the cystic fibrosis patients were diagnosed and referred to our clinic by the paediatric department. Only CF patients with endoscopically visible polyps were included in the CF group. The reasons for surgical procedure were unrelated to the study in all patients. The atopic status was evaluated by skin prick tests to common inhalant allergens, which were positive in 3 controls, 3 CRS patients, 5 NP and 2 CF patients. A history of asthma was reported in 6 out of 14 NP patients, all other subjects were free of asthma symptoms. One patient in the NP group had a history of aspirin
Chapter VIII _________________________________________________________________________
105
intolerance (Table 1) None of the subjects used oral corticosteroids 3 weeks before surgery. All patients gave their written informed consent and the ethics committee of the Ghent University Hospital approved the study. Measurement of cytokines and IgE in tissue homogenates Freshly obtained tissue specimens were weighed, and 1 ml of 0.9% NaCl solution was added per every 0.1g tissue. The tissue was then homogenized with a mechanical homogenizer (B.Braun Melsungen, Germany) at 1000 rpm for 5 minutes on ice as described previously. After homogenization, the suspension were centrifuged at 3000 rpm for 10 minutes at 4°C and the supernatants separated and stored at -80°C until analysis. All samples were assayed for eotaxin, IL-1�, IL-2sR�, IL-5, IFN-�, IL-8, TGF-�1, TNF-� and MPO using commercially available ELISA kits (all R&D Systems, Minneapolis; MPO: Oxis International, Oregon). IgE and ECP were measured by the UNICAP system (Pharmacia, Sweden). Statistical analysis Data are expressed as median and interquartile range (IQR). When comparisons were made, the Kruskal-Wallis test was used to establish the significance between-group variability. The Mann Whitney U-test was then used for between-group comparison. The ability of a test to discriminate two patient groups was evaluated using Receiver Operating Characteristic (ROC) curve analysis. The cut-off values corresponding to the highest accuracy (minimal false negative and false positive results) were selected and the subsequent sensitivity and specificity were used. P-values less than 0.05 were considered statistically significant. Results Results of inter-group comparisons are summarized in Figure 1a and 1b. sIL-2Rα expression, indicating T-cell activation, in the tissue homogenates was significantly higher in NP, CRS and CF-NP compared to controls, and higher in NP compared to CF-NP. TGF-�1 concentrations, indicating T-regulatory activity, were significantly higher in CRS than in controls or NP. IL-5 protein concentrations, reflecting Th2 activity, were higher in NP than in all other groups, whereas the Th1 cytokine IFN-� was found significantly increased in CRS vs. all other groups. The eosinophilic marker ECP and the CC-chemokine eotaxin showed significantly higher concentrations in NP tissue compared to all other groups, with CRS and CF-NP levels being significantly higher compared to controls. In contrast, the neutrophilic markers MPO and IL-8 demonstrated significantly higher concentrations in CF-NP vs. all other groups, with CRS and NP levels being significantly higher compared to controls. The pro-inflammatory mediators IL-1� and TNF-� were abundantly expressed in CF-NP and CRS compared to controls and NP. Finally, in NP tissue homogenates, total IgE concentrations were significantly higher compared to all other groups. To determine the critical markers which would predict disease diagnosis when comparing 2 out of the 3 sinus diseases, ROC curves were generated for all study parameters and each pair-wise comparison. ROC analysis comparing NP with CRS (Table 2a) demonstrated that NP can be differentiated from CRS using the eosinophilic markers IL-5, ECP and eotaxin, and IgE, with both sensitivities and specificities above 60%, and CRS can be differentiated from NP under the same conditions by the markers IFN-�, TGF-�, IL1-� and TNF-�. Corresponding cut-off values are given for each marker. ROC analysis comparing CF-NP and NP resulted in the selection of the following mediators: ECP, IL-5 and IgE to predict NP and IL1-�, MPO and IL-8 to predict CF-NP with sensitivities and specificities above 60% (Table 2b). The same markers, IL1-�, MPO and IL-8 also differentiated CF-NP from CRS, while IFN-� and IgE predicted CRS in this comparative analysis (Table 2c). Please note that cut-off values may differ between comparisons. For all other markers, sensitivity or specificity was below 60% for whatever comparison. Discussion We here show that, based on cytokine and mediator profiles, chronic rhinosinusitis without polyps (CRS), nasal polyps (NP) and nasal polyps in cystic fibrosis patients (CF-NP) can be differentiated as distinct disease entities. We also show for the first time that CRS is characterized by a Th1 response, with T-regulatory and fibrogenic potential as indicated by increased TGF-α1, whereas NP have been confirmed to demonstrate a TH2 cytokine pattern, inducing abundant eosinophils and IgE formation, but lacking an adequate regulatory T-cell activity. Finally, CF-NP can be differentiated from CRS and NP using pro-inflammatory and neutrophil-related markers, which are over-expressed in CF-NP. These findings should lead to a paradigm shift in the understanding and clinical management of chronic sinus diseases, which have been covered by the umbrella term “chronic rhinosinusitis” so far. The comparable up-regulation of sIL-2Rα in CRS, CF-NP and NP vs. controls illustrates a T-cell mediated immune response in all disease groups. (12) Increased serum levels of sIL-2Rα have also been shown to be associated with the severity of acute asthma exacerbations, indicating T-cell activation in acute lower airway
Chapter VIII _________________________________________________________________________
106
disease (13), as well as in flaring chronic disease, namely allergic bronchopulmonary aspergillosis. (14) However, activated Th-cell subsets may differ substantially, as indicated by the clearly different further cytokine signals, namely IFN-γ (Th1-related) in CRS and IL-5 (a Th2 cytokine) in NP. A similar pattern of the Th1-Th2 imbalance has also been described in lower airway inflammation, with IFN-γ characterizing COPD and IL-5 being predominant in asthma.(9) Furthermore, TGF-α1 is up-regulated in CRS, but not in NP, which could be interpreted as either an increased T- regulatory cell activity (15) or an increased fibrogenic potential (16,17). Specifically, it has been shown that TGF-α1(18) is able to abrogate the prolonging effects of hemato-poetin on eosinophil survival, and to induce eosinophil apoptosis, which may explain the association of low TGF-β concentrations in a predominantly eosinophilic disease such as NP. TGF-β also is a potent fibrogenic cytokine that stimulates extracellular matrix formation, and acts as chemo-attractant for fibroblasts. An over-expression of TGF-α has been demonstrated before in CRS vs. NP, confirming our current results (19). NP has repeatedly been characterized as eosinophilic inflammation, with highly increased concentrations of ECP as marker of eosinophil activation, and of eotaxin, a CC-chemokine, which cooperates with IL-5 to recruit and activate eosinophils. (20) Both, ECP and eotaxin have been described to be significantly increased in NP vs. controls (20), and here we show that this also holds true in comparison to CRS. In contrast, no difference between CRS and NP was found for markers of neutrophilic inflammation such as IL-8, a CXC-chemokine, and MPO, an enzyme released by neutrophil granulocytes. However, the pro-inflammatory cytokines IL-1α and TNF-α are significantly up-regulated in CRS vs. NP, and represent candidates for disease differentiation. Recent insights have linked the local eosinophilic tissue inflammation in NP to an increased prevalence of colonization with Staphylococcus aureus and their cell products, enterotoxins, acting as superantigens. (21) Specific IgE to S. aureus enterotoxines and consecutive polyclonal IgE formation has been demonstrated in nasal polyp tissue, which correlates with markers of eosinophilic inflammation, pointing to a possible modifying role of bacterial superantigens in the pathophysiology of NP. (22) In contrast, specific IgE to enterotoxins and polyclonal IgE formation in tissue is a rare finding in CRS and also CF-NP (6), although S. aureus belongs to the usual germ flora esp. in upper airway manifestations of cystic fibrosis. (23) As a result of these observations, CRS can be clearly distinguished from NP through ROC analysis (Table 2a), with 8 of the studied markers discriminating the disease entities with a sensitivity and specificity higher than 60% (ECP, IgE, IL-5 and eotaxin for NP; MPO, TNF-α, IFN-γ and TGF-β for CRS). These markers partially also qualify to distinguish both diseases from CF-NP. CF-NP is characterized by a strong neutrophilic response, with IL-8, MPO and IL-1β surpassing tissue concentrations measured in any other disease group. All 3 markers contribute to differentiate CF-NP from either CRS or NP, using specific cut-off values for each of the three comparisons (Tables 2b, 2c). The differentiation possibilities of disease entities based on such small numbers is intriguing, with the potential of reaching higher sensitivity and specificity by combining specific markers using multiple regression analysis, which however needs considerably greater numbers of samples. Further work will combine an intense clinical phenotyping of patients with chronic sinus disease with the measurement of inflammatory and T-cell markers as shown here, possibly expanding the panel of markers to the areas of infection and remodelling. This could lead to the recognition of several sinus disease entities and subgroups uncovered so far, which will allow to finally introduce new definitions for studies on the epidemiology, diagnostic management, and lower airway co-morbidities, and eventually will open differentiated and new therapeutic approaches. Chronic rhinosinusitis is a major health problem, and treatment strategies still are mainly based on antibiotics (bacterial infection?), corticosteroids (all eosinophilic disease?) and surgery (a ventilation and drainage problem?). However, as detailed here, the broad usefulness of these therapeutic approaches for all sinus disease needs to be questioned. A major problem, which prevents progress in the understanding of chronic rhinosinusitis, is the current concept that all CRS is one disease. This concept is reflected in the most recent European and US guidelines, as cited above. However, this concept applied to the lower airways would mean that all lung diseases, esp. asthma and COPD, would also represent one disease, a misconception that would negatively impact research in this area, as well as the diagnostic and therapeutic management of the patients. Our paper for the first time provides evidence that different pathomechanisms are involved in CRS, which need to be differentiated, comparable to asthma and COPD, in order to ameliorate disease management. In contrast to asthma and COPD, we do not have functional measurements such as mucosal hyper-reactivity or reversibility of airway obstruction to differentiate on a clinical basis between disease entities. In CRS, we only have symptoms and CT signs, which are rather unspecific. As a consequence, we need biochemical determinants, possibly measured in the nasal secretions, to differentiate diseases. What impact such an approach will finally have on the management of chronic sinus diseases, is difficult to estimate today. However, it is highly likely to initiate a process of learning about these diseases, which may considerably change our therapeutic approach in the future.
Chapter VIII _________________________________________________________________________
107
Conclusion According to most recent position statements in chronic sinus disease, chronic rhinosinusitis is considered a disease continuum with “extremes” such as CRS with and without nasal polyps. However, here we show that CRS rather represents unrelated disease entities with specific cytokine and mediator profiles, which enable the differentiation of diseases based on pathomechanisms. A set of markers has been selected for each comparison, with specificity and sensitivity above minimum 60% for each of them, respectively. The clinical possibilities to differentiate diseases by history, nasal endoscopy, and CT-scan seem to be inferior in this respect. Each group of patients, clinically summarized as chronic rhinosinusitis patients, was characterised by a specific set of biomedical markers, characterizing the 3 groups of patients investigated here as separate disease entities. Table 1
Chapter VIII _________________________________________________________________________
110
Table 2c: Chronic rhinosinusitis versus cystic fibrosis
No diagnosis IFN-γ IgE MPO IL-8 IL-1�
� 96,1 pg/ml
� 8,4
kU/l
> 13041,6
ng/ml
> 10407,2
pg/ml
> 478,8
pg/ml
16 CRS 7,37 5295,18 979,15 141,45
17 CRS BDL 11,22 5412,44 1534,06 57,16
18 CRS 942,40 28,05 12012,00 3692,48 310,94
19 CRS BDL 39,71 7030,10 1599,29 56,38
20 CRS BDL 328,90 11500,50 7784,15 108,37
21 CRS 132,88 76,45 212080,00 45293,60 478,79
22 CRS 557,79 64,35 13041,60 10407,21 419,41
23 CRS 211,57 BDL 11500,50 1048,74 52,86
24 CRS 225,64 29,59 23818,30 3409,12 206,86
25 CRS 103,49 BDL 7669,75 1054,54 61,49
36 CF-NP BDL 54,34 19079,50 3910,61 156,57
37 CF-NP BDL 28,38 136598,00 22342,10 1274,35
38 CF-NP 96,05 BDL 17542,80 3009,27 105,86
39 CF-NP BDL BDL 107453,50 85571,75 1321,98
40 CF-NP BDL 83,60 112673,00 42171,80 817,03
41 CF-NP BDL 5,94 350922,00 52807,70 1305,04
42 CF-NP BDL BDL 156392,50 23289,20 104,61
43 CF-NP 88,57 74,03 50875,00 27877,30 617,39
44 CF-NP BDL BDL 21337,80 10557,69 87,26
45 CF-NP BDL BDL 282667,00 40418,40 1246,63
46 CF-NP BDL 8,36 54598,50 18147,80 909,87
47 CF-NP BDL BDL 413589,00 76968,10 1242,01
48 CF-NP BDL 17,27 150067,50 37066,70 1395,79
49 CF-NP BDL 7,92 62551,50 15629,90 182,84
sensitivity 66,7 70 80 80 100
specificity 100 64,3 100 85,7 64,3
Chapter VIII _________________________________________________________________________
111
Figure 1a
CO CRS NP CF-NP
0
2000
4000
6000
8000
10000
12000
14000
IL2s
Ral
fa (p
g/m
l)
p < 0,001
p = 0,015
p = 0,002
p = 0,008
CO CRS NP CF-NP
0
10000
20000
30000
40000
50000
60000
70000
TGFb
eta-
1(pg
/ml)
p = 0,013 p = 0,010
CO CRS NP CF-NP
0,00
200,00
400,00
600,00
800,00
1000,00
IFN
-gam
ma
(pg/
ml)
p = 0,030
p = 0,004
p = 0,007
CO CRS NP CF-NP
0
200
400
600
800
1000
1200
1400
IL-1
beta
(pg/
ml)
p = 0,016
p < 0,001
p = 0,009
p = 0,01 p < 0,001
CO CRS NP CF-NP
0,00
10,00
20,00
30,00
40,00
50,00
60,00TN
Falfa
(pg/
ml)
p = 0,003
p = 0,007
p = 0,031 p = 0,02
Chapter VIII _________________________________________________________________________
112
CO CRS NP CF-NP
0
300
600
900
1200
1500
IL-5
(pg/
ml)
p < 0,001 p = 0,003 p < 0,001
CO CRS NP CF-NP
0
10000
20000
30000
EC
P (µ
g/l)
p = 0,023
p < 0,001 p < 0,001 p = 0,003 p < 0,001
CO CRS NP CF-NP
0
1000
2000
3000
IgE
(kU
/l)
p < 0,001 p = 0,001 p < 0,001
CO CRS NP CF-NP
0
1000
2000
3000
4000
5000
6000
Eot
axin
(pg/
ml)
p < 0,001
p < 0,001 p < 0,001 p = 0,017 p = 0,01
CO CRS NP CF-NP
0
100000
200000
300000
400000
500000
MP
O (n
g/m
l)
p = 0,006 p = 0,004
p < 0,001 p = 0,001
p < 0,001
CO CRS NP CF-NP
0
20000
40000
60000
80000
100000
IL-8
(pg/
ml)
p = 0,01 p < 0,001
p < 0,001 p = 0,002
p = 0,003
Figure 1b
Chapter VIII _________________________________________________________________________
113
Legends
Table 1 Patient characteristics. Figure 1 a and b Measurement of eotaxin, IL-1�, IL-2sR�, IL-5, IFN-�, IL-8, TGF-�1, TNF-�, MPO, IgE and ECP in inferior turbinates (controls), nasal polyps, chronic rhinosinusitis and cystic fibrosis-nasal polyp tissue. Box-and-whisker plots, the central box represents the values from the lower to the upper quartile (25 to 75 percentile). The middle line represents the median. The whiskers represent the maximum and minimum value excluding outliers. Statistical analysis was performed by the Kruskal Wallis test and Mann-Whitney-U two tailed test for unpaired comparisons (CO= controls; CRS= chronic rhinosinusitis; NP= nasal polyps; CF-NP= cystic fibrosis-nasal polyps). Tables 2a-c ROC-analysis for inflammatory markers in controls, chronic rhinosinusitis, nasal polyps and cystic fibrosis-nasal polyps. The mentioned cut-off values (2. line) are selected corresponding to the highest accuracy (minimal false negative and false positive results). Values below the cut-off value are marked in green, values above are in red (BDL= below detection level).
References:
(1) International Rhinosinusitis advisory board. Infectious rhinosinusitis in adults: classification, etiology and management. Ear, nose throat J, 1997; 76:5-22.
(2) Collins JG. Prevalence of selected chronic conditions: United States: 1990-1992. Vital Health Stat 10. 1997 Jan; 194:1-89.
(3) Bachert C, Hormann K, Mosges R, et al. An update on the diagnosis and treatment of sinusitis and nasal polyposis. Allergy 2003;58(3):176-191.
(4) Meltzer EO, Hamilos DL, Hadley JA, et al. Rhinosinusitis: Establishing definitions for clinical research and patient care. J Allergy Clin Immunol. 2004 Dec;114(6 Suppl):155-212 .
(5) Fokken W, Lund V, Bachert C, Clement P, Hellings P et al. EAACI European Position Paper on Rhinosinusitis and Nasal Polyps. Allergy, 2005; 60(5):583-601.
(6) Claeys S, Van Hoecke H, Holtappels G, et al. Nasal polyps in patients with and without cystic fibrosis: a differentiation by innate markers and inflammatory mediators. Clin Exp Allergy. In press.
(7) Bachert C, Wagenmann M, Hauser U, Rudack C. IL-5 is upregulated in human nasal polyp tissue. J Allergy Clin Immunol. 1997;99: 837-842.
(8) Watelet JB, Bachert C, Claeys C, van Cauwenberge P. Matrix metalloproteinases MMP-7, MMP-9 and their tissue inhibitor TIMP-1: expression in chronic sinusitis versus nasal polyposis. Allergy. 2004 Jan;59(1):54-60.
(9) Elias J. The relationship between asthma and COPD. Lessons from transgenic mice. Chest. 2004 Aug;126(2 Suppl),111S-116S.
(10) Bachert C, Wagenmann M, Rudack C, et al. The role of cytokines in infectious sinusitis and nasal polyposis. Allergy. 1198 Jan;53(1):2-13.
(11) Claeys et al. Clinical expiremental allergy. In press. (12) Mathias C, Mick R, Grupp S, et al. Soluble interleukin-2 receptor concentration as a biochemical indicator for acute
graft-versus-host disease after allogeneic bone marrow transplantation. J Hematother Stem Cell Res. 2000 Jun;9(3):393-400.
(13) Kim JT, Kim CK, Koh YY. Serum levels of soluble interleukin-2 receptor at acute asthma exacerbation: relationship with severity of exacerbation and bronchodilator response. Int Arch Allergy Immunol. 1998 Dec;117(4):263-269.
(14) Brown JE, Greenberger PA, Yarnold PR. Soluble serum interleukin 2 receptors in patients with asthma and allergic bronchopulmonary aspergillosis. Ann Allergy Asthma Immunol. 1995 Jun;74(6):484-8.
(15) Nakamura K, Kitani A, Fuss I, et al. TGF-beta1 plays an important role in the mechanism of CD4+CD25+ regulatory T cell activity in both humans and mice. J Immunol. 2004 Jan 15;172(2):834-42.
(16) Cerwenka A, Bevek D, Majdic O, et al. TGF-beta1 is a potent inducer of human effector T cells. J Immunol. 2004;153:4367-4377.
(17) Vignola AM, Chanez P, Chiappara G, et al. Release of transforming growth factor-beta (TGF-beta) and fibronectin by alveolar macrophages in airway diseases. Clin Exp Immunol. 1996 Oct;106(1):114-9.
(18) Alam R, Forsythe P, Stafford S, Fukuda Y. Transforming growth factor beta abrogates the effects of hematopoietins on eosinophils and induces their apoptosis. J Exp Med. 1994 Mar 1;179(3):1041-5.
(19) Watelet JB, Claeys C, Perez-Novo C, Gevaert P, van Cauwenberge P, Bachert C. Transforming growth factor-beta1 in nasal remodeling: differences between chronic rhinosinusitis and nasal polyposis. Am J Rhinol. 2004 Sep-Oct;18(5):267-72.
Chapter VIII _________________________________________________________________________
114
(20) Bachert C, Gevaert P, van Cauwenberge P. Nasal polyposis: from cytokines to growth. Am J Rhinol. 2000 Sep-Oct;14(5), 279-90.
(21) Gevaert P, Holtappels G, Johansson SGO, Bachert C. Organization of secondary lymphoid tissue and local IgE formation to Stahpylococcus aureus enterotoxines in nasal polyp tissue. Allergy. 2005 Jan;60(1):71-9.
(22) Bachert C, Gevaert P, Holtappels G, Johansson SG, van Cauwenberge P. Total and specific IgE in nasal polyps is related to local eosinophilic inflammation. J Allergy Clin Immunol. 2001 Apr; 107(4):607-14.
(23) Muhlebach MS, Stewart PW, Leigh MW, Noah TL. Quantification of inflammatory response to bacteria in young cystic fibrosis and control patients. Am J Respir Crit Care Med. 1999;160:186-91.
Chapter IX _________________________________________________________________________
115
Chapter IX
Discussion
“Believe those who are seeking the truth, doubt those who find it.”
André Gide (1859-1951)
Chapter IX _________________________________________________________________________
116
Chapter IX _________________________________________________________________________
117
Chronic rhinosinusitis with or without nasal polyps , with a prevalence respectively of 4% and 15 %
in the general population, represents a significant health problem with a considerable socio-
economic burden. Classically, inflammation of the upper airway is explored and classified by
history, clinical examination, endonasal endoscopy, skin prick test for allergy, imaging and
functional tests. Chronic rhinosinusitis is clinically defined above all by the duration of the
symptoms. Nasal obstruction and discharge, non-specific headache and an impaired sense of smell
can progress and persist for years. Depending on the authors, a symptom duration of 8 to 12 weeks
and/or more than 4 symptomatic episodes per year are required to apply the diagnosis of chronic
rhinosinusitis.
The therapeutical approach in chronic rhinosinusitis beholds limited possibilities: topical or systemic
corticoids, antibiotics/antimycotics, local and oral decongestants, antihistamines and surgical
interventions, and no medical or surgical treatment guarantees cure. A strong variability in
therapeutic success, with in some cases an aggressive disease progression and a high recurrence rate
after surgical treatment urges us to better differentiate upper airway sinus disease
Recent guidelines and convention papers , have summarized the knowledge on therapeutic and
diagnostic management of chronic sinus disease and delivered a first attempt to subclassify chronic
rhinusinusitis. It has been acknowledged that, especially for research purposes, a minimal
classification depending on the presence or absence of nasal polyps is necessary (JACI paper, EPOS.
But also for epidemiological studies, to appreciate impact on society and to identify new
therapeutical targets, optimal disease specification is necessary.
Whether nasal polyps reflect a severe case of a common chronic rhinosinusitis, or indicate a
different pathophysiological background has not been established yet. The identification of an
eosiniphilic inflammation, mediated by IL-5, in NP has been a first important step in disease
characterization of chronic sinonasal disease with nasal polyps.
The apparent exaggerated upper airway inflammation in patient with chronic rhinosinusitis, with
(NP) or without the development of semi translucent masses in the nasal and paranasal cavitities
indicates failure/deregulation of mucosal innate and adaptive defense mechanisms. The reason why
polyps develop in some patients and not in others remains unknown but findings of our previous
research gave us clear indications that, however microscopically identical, not every polyp is the
same. In specific conditions like in cystic fibrosis (CF) and allergic fungal sinusitis (AFS) NP
formation has been identified as a disease marker linked to respectively a genetic defect and a
specific IgE-mediated immune response to fungi. However for better knowledge on
pathomechanisms and possible classification of chronic rhinosinusitis disease entities the
introduction of appropriate disease markers is necessary. Both innate and adaptive defense mediators
are appropriate candidates for this role.
Chapter IX _________________________________________________________________________
118
Innate markers in upper airway disease
The first line defence by innate mechanisms, previously depicted in a rudimentary form as a passive
system, is apparently highly regulated and very effective in keeping the upper and lower respiratory
tract free of microbes without the help of adaptive mechanisms.
Antimicrobial peptides, constitutively present or locally supplemented by secretion from activated
epithelial or recruited phagocytes, selectively target vital microbial patterns which are structurally
and biochemically different from molecular patterns from the host. The mixture of antimicrobial
peptides work synergistically and decrease the occurrence of microbial resistance. Innate
antimicrobial peptides are multifunctional (signalling molecules) and contribute to tissue
inflammation and tissue repair, indicating their central role in immune regulation.
In our initial work we were the first to evaluate expression of human beta defensins and toll like
receptors in upper airway tissue in different disease states (Chapter V). Especially in tonsils,
probably due to colonization with a the large variety of microbes in the crypts, the presence of
inducible defences (HBD2 and HBD3) is pronounced. The absent upregulation of HBD in adenoids
or sinuses indicate a probable insufficient local tissue inflammation or an efficient clearance of
colonizing microbial material. No correlation could be found with TLR expression changes, but the
overall expression of TLR in upper airway tissue indicate the role of TLR as important immune
sensors of the upper airway.
Common upper airway disease is apparently not capable of disorganizing the innate immune
response.
However, in nasal polyps we discovered a significant upregulation of another innate pathogen
recognizing receptor: macrophage mannose receptor (MMR) (Chapter VI). This macrophage
associated innate receptor has the capacity of phagocytosis, modulation of antigen presentation and
signal transduction. Because of the modulation of MRR expression by cytokines, pathogens and
their products, therapeutics and the activation state of the macrophage, it will be a challenge to
reveal the ultimate trigger of this MMR upregulation. To establish the exact role of this innate
receptor in NP physiopathology more research on the ligand-receptor-signaling pathway will be
necessary. The accumulation of MMR positive cells co-localized to CD3+ T-cells and plasma cells
(original article Chapter VI), partially IgE positive, suggest a pathogen-driven local immune
response, leading to an activation of T-cells and an immunoglobulin switch to IgE. Whether and
how a microbial trigger through MMR ligand binding might influence this IgE switch in NP needs to
be further investigated. We can however hypothesize that the significant upregulation of MMR only
in NP, and not in tissue of chronic rhinosinustis patients without NP, is possible proof of a microbial
triggering of adaptive immune response through an innate receptor in this disease. The identification
of a microbial or molecular substance that may trigger these processes could be of significant
therapeutic value.
Chapter IX _________________________________________________________________________
119
Furthermore, this unique finding challenges us to approach NP disease as a separate disease entity in
the chronic rhinosinusitis pathology group.
CF-NP as separate disease entity
In order to better identify the specific features of immune regulation in eosinophilic mediated NP,
we extended our investigated groups to cystic fibrosis patients with nasal polyp formation (CF-NP)
(Chapter VII). We compared for the first time innate and adaptive immune mediators in CF-NP and
NP and discovered significant differences on both levels of immunity.
Concerning the innate mediators, we found in CF-NP a statistically significant higher mRNA
expression of HBD 2 compared to NP and controls and of TLR 2 compared to NP. In the NP group,
MMR mRNA expression was significantly elevated compared to CO and CF-NP. For TLR 4 mRNA
expression no statistically significant differences were found between groups. The singular up-
regulation of TLR 2 (and not TLR 4) in CF-NP suggests an important role for TLR 2 in the
orchestration of host-defense in CF-NP which can be supported by the capacity of TLR 2 to mediate
induction of HBD 2 and IL-8 in response to Gram positive or Gram negative bacterial components.
We furthermore describe a correlation between HBD 2 expression and IL-8 levels, which illustrates
parallel regulation of HBD 2 and IL-8, also shown by other research groups. Concerning the
adaptive mediators, we have found IL-5 to be below detection level in all CO and CF-NP and
measurable in 80% of the NP. MPO and IL-8 concentrations were significantly higher in CF-NP
compared to controls and NP, whereas ECP, eotaxin and IgE were significantly higher in the NP
group. We therefore concluded that the up-regulation of TLR 2, HBD 2, IL-8 and MPO in CF-NP
illustrates the induction of innate immunity defence mechanisms, consisting of an antimicrobial
activity against Gram positive and Gram negative bacteria (HBD 2), and a signal transduction
through TLR 2. The latter can possibly be responsible for consecutive release of IL-8, leading to the
attraction of neutrophils (high MPO) for phagocytosis. On the other hand; NP is a Th2 mediated (IL-
5) eosinophilc inflammation (ECP, Eotaxin) with local IgE production and a different innate
pathogen receptor expression (MMR) compared to CF-NP.
In order to explain the different PRR expression (MMR and TLR) in NP and CF-NP, further
evaluation of the influence of bacterial infection, cytokine biology and therapeutic measures on the
expression of these receptors in the upper airway will be necessary.
The significant differences between innate markers and inflammatory mediators in CF-NP and NP
provide further arguments to understand clinically similar disease manifestations (nasal polyps) as
different diseases of the upper airways.
Macrophage heterogeneity as tool for disease specification
The distinct upregulation of the macrophage mannose receptor in NP compared to CF-NP guided us
towards the possibility of a role of macrophage immune regulation in NP disease. We therefore tried
Chapter IX _________________________________________________________________________
120
to assess possible differences in innate cellular defence mechanisms through macrophage typing in
nasal polyps from patients with and without cystic fibrosis (Original article Chapter VIIIA).
This was the first study in which macrophage heterogeneity was evaluated in sinonasal
inflammatory disease and the results support in a clear way the need for better disease differentiation
in chronic rhinosinusitis pathology. During cellular maturation and differentiation, tissue distribution
and exposure to endogenous and exogenous stimuli, macrophages show phenotypical changes,
corresponding with a diversity in functional potential. We measured a gradually higher tissue
expression of CD68, a transmembrane glycoprotein, expressed in all cells of the mononuclear
phagocyte lineage (including monocytes and tissue resident macrophages), in respectively CO, CRS,
NP and CF-NP indicating influx of macrophages in every chronic sinus inflammation.
This high level of CD68 expression in CF-NP is accompanied by the highest amount of CD14
positive cells in CF-NP (significantly higher semi-quantitative values compared to NP, CRS and
CO). Up regulation of membrane CD14 expression or recruitment of CD14+ cells into inflamed
tissue is possibly an indicator of disease activity and at least partly explains the increased pro-
inflammatory responses that are seen in cystic fibrosis airway disease.
The significant difference in CD14+ cell counts in NP versus CF-NP reflect a different macrophage
sensibilisation by microbial products. As for MMR in NP, to identify the trigger(s) for CD14 up
regulation in CF-NP further research is necessary. The ligand-receptor interaction on macrophages
may be important in influencing the further progression of the inflammation and the identified
macrophage heterogeneity in upper airway disease indicates, also on the level of innate cellular
defense, a different immunological background in different entities of chronic rhinosinusitis
pathology.
Adaptive inflammatory mediators as tools for disease specification
To support a better classification of chronic sinus disease we extended our findings on innate
receptors and macrophage heterogeneity to adaptive inflammatory mediators (Chapter VIIIB). We
measured a distinct up regulation of ECP, Eotaxin, IgE and IL-5 in NP and a distinct up regulation
of MPO and IL-8 in CF-NP. A defective upregulation of TGF-β in the NP patient group indicate
disturbed tissue repair and deficient eosinophil control. We also show for the first time that CRS is
characterized by a Th1 response, with T-regulatory and fibrogenic potential as indicated by
increased TGF-ß1, whereas NP have been confirmed to demonstrate a TH2 cytokine pattern,
inducing abundant eosinophils and IgE formation, but lacking an adequate regulatory T-cell activity.
Finally, CF-NP can be differentiated from CRS and NP using pro-inflammatory and neutrophil-
related markers, which are over-expressed in CF-NP. In the search for a better definition of disease
entities in the large groups of chronic rhinosinusitis patients we tried to assess quantitative values for
these cytokines and other inflammatory mediators to obtain a “inflammatory profile” of each
selected disease entity. To determine the critical markers which would predict disease diagnosis
Chapter IX _________________________________________________________________________
121
when comparing 2 out of the 3 sinus diseases, ROC curves were generated for all study parameters.
ROC analysis comparing NP with CRS demonstrated that NP can be differentiated from CRS using
the eosinophilic markers IL-5, ECP and eotaxin, and IgE, with both sensitivities and specificities
above 60%, and CRS can be differentiated from NP under the same conditions by the markers IFN-
�, TGF-�, IL1-� and TNF-�. ROC analysis comparing CF-NP and NP resulted in the selection of the
following mediators: ECP, IL-5 and IgE to predict NP and IL1-�, MPO and IL-8 to predict CF-NP
with sensitivities and specificities above 60%. The same markers, IL1-�, MPO and IL-8 also
differentiated CF-NP from CRS, while IFN-� and IgE predicted CRS in this comparative analysis .
These data support the identification of different disease groups among chronic rhinosinusitis
patients and we can attempt to add these data to the table for Clinical definition (Chapter I). The
introduction of biochemical markers (inflammatory mediators) will be necessary to finally make any
progress in disease specification. The use of functional and measurable diagnostic data is a crucial
step in launching more focused clinical studies and in delivering more objective results in
therapeutical essays and will therefore have a substantial impact on the conduction of better focused
epidemiological, clinical and immunopathological studies in chronic rhinosinusitis.
Definition proposal for identification of chronic rhinosinusitis subgroups, added to table I (Chapter
I) ( taken from EAACI Position Paper on rhinosinusitis and nasal polyps. Allergy 2005;60(5):583-
601)
Severity of the disease
The disease can be divided into MILD and MODERATE/SEVERE based on total severity visual analogue scale (VAS) score (0-10 cm):
MILD = VAS 0-4 MODERATE/SEVERE = VAS 5-10
Clinical definition of rhinosinusitis/nasal polyps
Rhinosinusitis (including nasal polyps) is defined as: • Inflammation of the nose and the paranasal sinuses characterised by two or more symptoms: - Blockage/congestion - Discharge: anterior/post nasal drip - Facial pain/pressure, - Reduction or loss of smell; • Endoscopic signs: - Polyps - Mucopurulent discharge from middle meatus - Oedema/mucosal obstruction primarily in middle meatus • CT changes: Mucosal changes within ostiomeatal complex and/or sinuses.
Duration of the disease
Acute/Intermittent < 12 weeks Complete resolution of symptoms. Chronic/Persistent >12 weeks symptoms No complete resolution of symptoms.
Diagnostic markers in nasal tissue CRS: - inflammatory mediator profile dominated by IFN-γ, TGF-β1, IL-1β, TNF-α NP: - inflammatory mediator profile dominated by Il-5, ECP, eotaxin, IgE. - innate receptor profile: significant upregulation of MMR CF-NP: - inflammatory mediator profile dominated by MPO, IL-8, Il-1β, TNF-α. - high HBD2 mRNA level - innate receptor profile: significant increase of CD14 positive cells, up regulation of TLR2 mRNA
Chapter IX _________________________________________________________________________
122
Future perspectives:
The difficult bacterial eradication in sinonasal disease and almost impossible microbial eradication
in CF sputum motivates us to try to interfere directly in the inflammatory process in CF airway
disease.
A good balance between a protective pro-inflammatory response and immune suppression is
fundamental to avoid a perpetuated chronic inflammation with eventually tissue destruction or nasal
polyp formation. Local bacterial clearance by neutrophils and macrophages is an important
cornerstone of first line innate immunity defence in the airway and precedes the onset of a adaptive
immune answer. The adaptive T cell population has an essential role in maintaining a well-regulated
physiologic state during inflammation. Therefore we want to further investigate immune cell
regulation by neutrophils, macrophages and T lymphocytes in nasal polyp tissue from patients with
and without cystic fibrosis.
A) Regulation of Neutrophilic inflammation in NP and CF-NP: role of lipoxin.
(in cooperation with Liesbeth Vandenbulcke)
Previous findings, also by other groups (1), provide sufficient arguments for dominant neutrophilic
inflammation in upper airway disease in CF. The exuberant inflammatory response dominated by
neutrophils and their potent inflammatory mediators is a possible therapeutic target in both upper
and lower airway disease of CF patients. By consequence, study of the regulation of neutrophilic
inflammation is important to explore the therapeutic potential of a counter mechanism. Serhan and
collegues were the first to describe the lipoxins as a group of endogenous arachidonic acid
metabolites (2). They are identified as important regulators of neutrophilic inflammation and provide
important counter-regulatory signals for a wide variety of pro-inflammatory mediators and
processes. The in vitro and in vivo activities of the best characterized lipoxin, LXA4, include
inhibition of neutrophil chemotaxis, adherence and transmigration, suppression of IL-8 production
by epithelia and leukocytes and upregulation of monocyte ingestion of apoptotic neutrophils. (3)
demonstrated that lipoxin concentrations in BAL (broncho-alveolar lavage) fluids are significantly
suppressed in patients with CF compared to patients with other inflammatory lung conditions. In
addition, administration of a metabolically stable lipoxin analog in a mouse model of chronic airway
inflammation and infection associated with CF has shown to reduce neutrophil accumulation in the
lung parenchyma and in the airway. This was not associated with a poorer control of the infectious
challenge but was actually associated with a decrease in pulmonary bacterial burden and attenuated
disease.
These findings strongly suggest that there is a pathophysiologically important defect in lipoxin-
mediated anti-inflammatory activity in the CF-lung and that administration of lipoxin analogues or -
Chapter IX _________________________________________________________________________
123
if possible- upregulation of the endogenous lipoxin production has therapeutic potential for
ameliorating pathogenic inflammatory responses in CF.
We therefore want to investigate the role of lipoxine metabolism and its receptors in the
physiopathology of CF-NP
Methodology:
In cystic fibrosis nasal polyps (CF-NP), in chronic rhinosinusitis in non-cystic fibrosis patients
(CRS) and in adult eosinophilic nasal polyps (AE-NP) protein expression and tissue distribution of
15 lipoxygenase, the enzyme regulating LXA4 synthesis will be determined by Western- Blot and
immunohistochemistry.
Gene expression of 15 Lipoxygenase and LXA4 receptor will be studied by real time PCR.
Local tissue Lipoxin production will be measured by ELISA.
B) Macrophages in upper airway disease of cystic fibrosis patients: role of chemokines.
Migration of macrophages into infectious foci and subsequent activation of these cells appear to be a
critical step in host defence, enabling the host to achieve and efficient removal of microbes. Under
normal conditions many of these cells circulate throughout the body. In case of infection migration,
focal accumulation and subsequent activation of these cells is mediated partly by chemokines (4)
Bacteria can stimulate the production of CXC (subfamily of chemokines, displays four highly
conserved cystein amine acid residues, with the first two separated by one non-conserved residue,
primarily target neutrophils (e.g.IL-8)) chemokines and CC (subfamily of chemokines, exhibits two
basophils (e.g. MCP)) chemokines in different cell types and the severity of inflammation is well
correlated to the magnitude of chemokine expression.
In addition to chemotactic activity, chemokines appear to increase the phagocytic capacity of
phagocytes and also influence the differentiation and apoptosis of these cells. (5)
The influence of defective CFTR function and hypertonic milieu in the lung on cytokine and
chemokine expression in airway epithelial cells is currently a key question in CF research and
chemokines are a potential target for new therapeutic approaches in airway disease.
An important example of chemokine up regulation in CF-NP has been shown in our lab: IL-8 is
significantly up regulated compared to CRS and NP with an impact on neutrophilic influx and MPO
expression.
Because of the observation of different macrophage subpopulations in different sinonasal conditions,
more precisely significant increased amount of CD14+ monocyte derived macrophages in CF-NP
Chapter IX _________________________________________________________________________
124
compared to NP and CRS, we want to assess which chemokines influence macrophage influx and
activation in CF-NP.
Furthermore, reciprocally macrophages are themselves a source of chemokines by which they
sustain immune cell influx. Finally the expression of chemokine receptors (CCR and CXCR) on
macrophages is of importance to evaluate their reactivity to environmentally released chemokines.
In a future project we want to evaluate chemokine metabolisms at 3 levels:
o Compare tissue expression of chemokines in CF-NP (on mRNA and protein level), CRS and
NP. We will measure monocyte chemoattractant protein-1 (MCP-1), macrophage
inflammatory protein-1 (MIP-1) and Platelet factor 4 (PF4).
MCP 1: member of the CC subfamily, targets monocytes and enhances macrophage
phagocytic and bactericidal activities. (6)
PF4 : a CXC chemokine secreted by activated platelets , promotes prolonged monocyte
survival and induces differentiation of monocytes into macrophages (4)
MIP-1 : member of the CC chemokine family, also termed CCL3 (=MIP-1α), CCL4 (=MIP-
1β), CCL5. These molecules expressed by monocytes macrophages and lymphocytes induce
chemotaxis, degranulation, phacocytosis and release of inflammatory mediators. They are
crucial for T cell chemotaxis and Th differentiation (CCL3 and its receptor promotes Th1
skewing) (7)
Compare CCR and CXCR expression on CD14+ monocytes from normal peripheral blood,
peripheral blood in CF patients and in tissue of CRS, NP and CF-NP by using flow
cytometry and immunohistochemistry. (8)
o In vitro evaluation by using a macrophage model (already operational) in which we
determine the influence of chemokines (selected after the results from part 1) on
macrophage metabolisme (cytokine release, receptor expression, phagocytotic capacity) and
also the influence of bacterial triggering on chemokine release and chemokine receptor
expression on macrophages.
(in cooperation with Drieke Van Damme)
C) T cell typing in cystic fibrosis nasal polyps.
(in cooperation with Thibaut Van Zele)
The influence of T cell derived cytokines on macrophage endocytotic activity, macrophage
maturation and receptor expression has been shown before (9,10)
The reciprocal interaction between antigen presenting cells (macrophages) and antigen-specific cells
(T cells) is an important example of innate adaptive interaction. The differentiation of naive CD4(+)
Chapter IX _________________________________________________________________________
125
T cells into subsets of T helper cells is a pivotal process with major implications for host defense and
the pathogenesis of immune-mediated diseases.
Two T cell types (Th1 and Th2) are responsible for specific patterns of cytokine production and are
both derived from naïve CD(4)+T cells (Th0).
We now know that Th1 differentiation is regulated by transcription factors such as T-bet, Stat1, and
Stat4, as well as cytokines such as IL-12, IL-23, IL-27, type I IFNs, and IFN-γ. In contrast, Th2 cells
differentiation is regulated by transcription factors Stat6, GATA-3, and the cytokine IL-4 produce.
Th1 cells produce IFN-γ and enhance cellular immune responses, while Th2 cells produce mainly
IL-4, IL-5 and IL-13 and are known to mediate allergic inflammation and the humoral response.
To maintain a well regulated functional steady state, Th1 and Th2 mediated inflammation has to
remain in balance. Recently CD4+ CD25+ regulatory T cells (Treg) have been identified as
important mediators in this balance. (11) These lymphocytes induce tolerance and suppress or
terminate both Th1 and Th2 immune responses via transforming growth factor β (TGFβ) and IL-10
production, the latter playing an important role in limiting inflammation and preventing an
overwhelming immune response. Recently several authors suggest a deficient production of IL-10 in
CF lung ( as result of CFTR defect or lower production by activated T cells in CF ) (12). It has been
shown in mice that in the absence of IL-10, a prolonged and excessive proinflammatory cytokine
production and neutrophil infiltration in the airway persists even when bacteria had been eradicated. (14) It was recently demonstrated that the transcription factor Foxp3 was essential for the
differentiation of regulatory T-cells. Mutations of Foxp3 in human beings result in a condition called
by autoimmune endocrinopathy, type I diabetes, inflammatory bowel disease, and severe atopy.
T reg are have been well studied in several chronic inflammatory conditions, but their role in the
sustained chronic inflammation in CF-NP is currently unknown.
In this project we want to examine the Th1 and Th2 balance and especially the role and impact of T
reg cells in CF-NP inflammation from 3 different viewpoints:
1) characterisation of lymphocyte subgroups by immunohistochemistry and flowcytometry
using several specific lymphocyte markers like CD4, CD8, CD3, CD25, CD45RA,
CD45RO. The presence of CD4+ CD25+ cells will be evaluated by immmunofluorescene.
2) Secondly the cytokine production pattern in tissue homogenates and serum from CF-NP
patients (IL-4, IL-5, IL-10, IL-12, IL-13) will be measured and compared to levels found in
AE-NP and CRS.
3) On mRNA level the balance between Th1, Th2 and T-reg will be studied using several
transciption factors: FoxP3 as a specific marker for CD4+ CD25+ lymphocytes, IL12
receptor beta2, STAT4 and Tbet as markers for Th1. STAT6 and GATA transcription
factors will be used as markers for Th2.
Chapter IX _________________________________________________________________________
126
E) Large prospective cohort study supported by Ga²len (Global Allergy and Astma European
Network ) (directed by Prof C .Bachert)
The exploration of parameters of disturbed immune responses and regulation in chronic
rhinosinusitis in a large prospective cohort study will deliver a significant contribution to basic
research. Such a cohort study has been launched recently. One of the goals of this study is to
assemble a inflammatory profile for every subgroup of chronic rhinosinusitis patients with an
attempt to eventually describe a risk profile for patient with chronic rhinosinusitis likely to develop
nasal polyps.
References (1) Sobol SE, Christodoulopoulos P, Manoukian JJ, et al. Cytokine profile of chronic sinusitis in patients with
cystic fibrosis. Arch Otolaryng Head Neck Surg 2002; 128: 1295-8. (2) Serhan C, Hamberg M, Samuelsson B. Lipoxins: novel series of biologically active compounds formed
from arachidonic acid in human leukocytes. Proc Natl Acad Sci USA 1984; 81: 5335-9. (3) Karp CL, Flick LM, Park KW, Softic S, Greer TM, Keledjian R, et al. Defective lipoxin-mediated anti-
inflammatory activity in cystic fibrosis airway. Nature Immunology 2002; 5: 388-92. (4) Matsukawa A, Hogaboam CM, Lukacs NW, Kunkel SL. Chemokines and innate immunity. Review in immunogenetics, 2000: 2: 339-358. (5) Scheuerer B, Ernst M, Dürrbaum-Landmann I, Fleischer J, Grage-Griebenow E, Brandt E, et al. The CXC-
chemokine platelet factor 4 promotes monocyte survival and induces monocyte differentiation into macrophages. Blood 2000; vol 95 n.4 Feb, p.1158-1166.
(6) Schwiebert LM, Estell K, Propst SM. Chemokine expression of CF in epithelia: implications for the role
of CFTR in RANTES expression. Am J Cell -Physiol 276:C700, 1999. (7) Maurer M, von Stebut E. .Macrophage inflammatory protein -1. Int J Bioch Cell Biol. 2004 Oct; 36(10),
1882-1886. (8) Katschke KJ, Koch AE. Differential expression of chemokine receptors on pheropheral blood, synovial
fluid, and synovial tissue monocytes /macrophages in rheumatoid arthritis. Arthritis Rheum. 2001; 44(5): 1022-32.
(9) Montaner L, da Silva RP, Sun J, Sutterwala S, Hollinshead M, Vaux D, Gordon S. Type 1 and type 2
cytokine regulation of macrophage endocytosis: differential activation by IL-4/IL-13 as opposed to IFN-γ or IL-10. The journal of immunology 1999; 162: 4606-4613
(10) Maritinez-Pomares S, Reid DM, Brown GD, Taylor PR, Stillion RJ, Linehan SA, et al. Analysis of
mannose receptor regulation by IL-4, IL-10, and proteolytic processing using novel monoclonal antibodies. J Leukoc Biol 2003 May; 73:604-613.
(11) Bellinghausen I, Klosterman B, Knop J and Saloga J. Human CD4+CD25+ T cells derived from the
majority of atopic donors are able to suppress Th2 cytokine production. J Allergy Clin Immunol 2003;111: 862-868
Voornamen: Sofie, Estella, Martha Geboortedatum: 26 maart 1966 Geboorteplaats: Dendermonde Nationaliteit: Belg Burgelijke Stand: Gehuwd, 2 kinderen Adres: A. Servaesdreef 1, 9830 St. Martens-Latem Telefoon:09/282.26.76
Universitaire Opleiding
� Kandidaat in de Genees-, Heel- en Verloskunde, RUG, Faculteit van de Geneeskunde:onderscheiding , 1987
� Doctor in de Genees-, Heel- en Verloskunde RUG, Faculteit van de Geneeskunde: grote onderscheiding, 1991
Professionele Ervaring
� Voltijds specialist NKO, AZ St. Elisabeth, Zottegem: januari 1997- november 2000 � Specialist NKO, Revalidatiecentrum De Kim Geraardsbergen: februari 1998 – september
2000 � Stafmedewerker dienst Neus- keel- en oorheelkunde, Universitair Ziekenhuis Gent. � Assisterend Academisch Personeel , Universiteit Gent sinds januari 2001.
Wetenschappelijk werk
� “Ultrastructureel onderzoek en immunohistochemie van M-cellen in NALT bij de mens”.
van 1994 tot 1996 in samenwerking met Prof. Dr. C. Cuvelier, dienst Anatomopathologie, UZ Gent.
� “Innate immunity in upper airway: chronic rhinosinusitis, nasal polyps in non-cystic
fibrosis and cystic fibrosis patients”. Gestart in 2001 in voorbereiding van doctoraatsthesis.
Publicaties
� “Resultaten van ablatie van de atrioventiculaire geleidingsweefsels.” Jordaens, Palmer A, Germonpré P, Claeys S, Clement DL Tijdschrift voor Geneeskunde 1989Jul-Aug; Vol. 45, nr. 14-15.
� “Immunohistochemical Analyses of the Lymphoepithelium in Human
Chapter X _________________________________________________________________________
130
Nasopharyngeal Associated Lymphoid Tissue (NALT).” Claeys S, Cuvelier C, Van Cauwenberge P Acta Otolaryngologica (Stockholm), 1996; Suppl. 523: 38-39
� “Ultrastructural Investigation of M-cells and Lymphoepithelial Contacts in Nasopharyngeal Associated Lymphoid Tissue (NALT).” Claeys S, Cuvelier C, Quatacker J, Van Cauwenberge P Acta Otolaryngologica (Stockholm), 1996; Suppl. 523: 40-42
� “Outcome of laryngeal and velopharyngeal biofeedback treatment in children and young adults: a pilot study.” Van Lierde K, Claeys S, De Bodt M, Van Cauwenberge P Journal of voice 2004;18(1): 97-106.
� “Human β-defensins and toll-like receptors in the upper airway.” Claeys S, Debelder T, Holtappels G, Gevaert P, Verhasselt B, van Cauwenberge P, Bachert C. Allergy 2003; 58: 748-753.
� “Macrophage mannose receptor in chronic sinus disease”. Claeys S, De Belder T, Holtappels G, Gevaert P, Verhasselt B, Van Cauwenberge P, Bachert C. Allergy 2004; Jun;59(6):606-12
� Cystic fibrosis nasal polyps and adult eosinophilic nasal polyps: differentiation by innate markers and cytokine profile Claeys S, Van Hoecke H, Holtappels G, Gevaert P, De Belder T, Verhasselt B, Van Cauwenberge P, Bachert C. Clin Exp Allergy, in press.
• “Vocal quality characteristics in children with cleft palate: a multiparameter approach”. Van Lierde K, Claeys S, De Bodt M, van Cauwenberge P. Journal of Voice 2004;18(3):354-362.
• “Impact van sinuschirurgie op stem en de resonantie”. Van Lierde K, Claeys S, Vervaeke A, Bachert C. Tijdschrift voor Logopedie Audiologie 2004;(34)-4, 131-141.
Abstracts / orale presentaties
� Immunohistochemical analysis of epithelium associated lymphoid cells in human
Nasopharyngeal Associated Lymphoid Tissue (NALT). Symposiumboek “Third International Symposium on Tonsils” (Sapporo, Japan), 21-22 juni 1995
� Utrastructural Investigation of M-cells and Lymphoepithelial contacts in human
Nasapharyngeal Associated Lymphoid Tissue (NALT). Symposiumboek “Third International Symposium on Tonsils” (Sapporo, Japan), 21-22 juni 1995
� M cells and antigen presentation in adenoids and tonsils: S. Claeys, P. Van Cauwenberge.
ESPO: Oxford 2002 September 11-14: abstractbook (p61:03.03)
� Innate Immunity markers in upper airway disease: S. Claeys, T. De Belder, G. Holtappels, P. Gevaert, C. Bachert, B. Verhasselt, P. Van Cauwenberge. EAACI Davos meeting febryary 2003: abstractbook
� Quantitative analysis of human beta-defensins, Toll-like receptors and Mannose receptor
in upper airway.De Belder T, Claeys S, Holtappels G, Gevaert P, Verhasselt B, Bachert C, Van Cauwenberge P: EAACI Paris: june 2003: abstractbook.
� Expression of innate markers and cytokine profile in upper airway disease. S. Claeys, H.
Van Hoecke, T. De Belder, G. Holtappels, P. Gevaert, P. Van Cauwenberge, C. Bachert. EAACI- section ENT meeting Ghent: November 16th 2003
Chapter X _________________________________________________________________________
131
� Innate Markers in upper airway disease.Claeys S., Van Hoecke H, Holtappels G., van Cauwenberge P., Bachert C. Serin :5 th International symposium on experimental rhinology and immunology of the nose- Ghent: 19 november2003.
� Expression of innate markers and cytokine profile in nasal polyps from children with
cystic fibrosis. S. Claeys, H. Van Hoecke, T. De Belder, G. Holtappels, P. Gevaert, P. Van Cauwenberge, C. Bachert . Abstract spring meeting of the Royal Society for Ear, Nose , Throat, Head and Neck Surgery. Febr 7, 2004: oral presentation.
Posters
� Quantitative analysis of human beta-defensins, Toll-like receptors and Mannose receptor in upper airway. Claeys S, De Belder T, Holtappels G, Gevaert P, Verhasselt B, Bachert C, Van Cauwenberge P. EAACI Paris 2003
� Expression of innate markers and cytokine profile in upper airway disease
S.Claeys, H.Van Hoecke, T.De Belder, G.Holtappels, P.Gevaert, P.Van Cauwenberge, C.Bachert. Wetenschapsdag vakgroep inwendige geneeskunde in samenwerking met de faculteit geneeskunde en gezondheidswetenschappen. 22 januari 2004
� Nasal polyps in patients with versus without cystic fibrosis: a differentiation by
• Nasal Polyps in Patients With and Without Cystic Fibrosis: Differentiation by Inflammatory Mediators and Macrophage Phenotype Heterogeneity. S. Claeys, H van Hoecke, G. Holtappels,T. Van Zele, P. Van Cauwenberge, C. Bachert. EAACI, Davos, feb 3-6, 2005
Beursen :
- Onderzoeksfinanciering gesteund door de Belgische Vereniging voor Strijd tegen
- Onderzoeksfinanciering gesteund door het Fonds Alphonse en Jean Forton, beheerd door de Koning Boudewijnstichting (2002-2004).
Prijzen: Glaxo Wellcome Award voor fundamentele research in ORL, februair 2004, voordracht met titel: Nasal Polyps in Cystic Fibrosis: innate markers and cytokine profile. Lidmaatschappen. Koninklijke Belgische Vereniging voor Otorhinolaryngologie, Hoofd-en Hals chirurgie (1991-2005) European Academy of Allergy and clinical immunology (2002-2004) Belgian Association for the Study of Sleep (2004-2005)
