Interactions with Hosts and Pathogens-a history of close calls-
Clint MagillProfessor of Genetics
Department of Plant Pathology & MicrobiologyTexas A&M University
4N maize X 4N sorghum
• ‘Rescued’ embryos
Pathogen Variability
Louis Prom & Ramasamy Perumal
18 isolates 17 pathotypes
Anthracnose of Sorghum
Rice Blast
Complementing di-auxotrophsPyricularia oryzae
Dennis Genovesi
nic-, ura-
buf, lys-
leu-, ade-
lys-, met-
1N and 2N conidia
Parasexual origin of new pathotypes?
Anther Culture and Rice Chloroplast DNA
Chantel Scheuring
Aberrant Ct DNA in Albinos
Green
Albino
Albino
Green
Alberto Livore
Texmont Rice
Pathogenic Race Changes
Bai Chai Wu
Stable M. grisea Strain
Unstable M. grisea Strain
Phymatotrichum omnivorum
Cotton root rot
grapes
fruit trees (pear)
DNA methylation in P. omnivorum
Mol% C Mol% 5mC % C’s methylated
Mycelium 21.65 +/- 0.08 0.78 +/- 0.07 3.5
Sclerotia 20.39+/- 0.19 2.27+/- 0.08 10.1
P. omnivorum grew in 5AZA C; the sclerotia that formed had no 5mC and did not germinate
Jane Magill, Eldon Jupe
Pathogen-induced host defense -mRNA
Oscar Joost, Al Bell, Bob Stipanovic
CVVK CVVK
HMGR CoA-reductase(first step in terpenoid phytoalexin synthesis)
Chan Benedict, Jingao Liu
- gossypol
Gail Martin
Sorghum Defense Responses
Cory Cui
(PAL is the first step in flavonoid phytoalexin biosynthesis)
Head Smut; Sphacelotheca reiliana
Stealth pathogen- no response
Grain mold/Curvularia & Fusarium
Chris Little, Seriba Katilé
AFP mRNA levels in sorghum glumes 48 h post inoculation with Curvularia lunata (CL), Fusarium thapsinum (FT), water (control) or
both CL+FT.
0
5 0
1 0 0
1 5 0
2 0 0
2 5 0
RTx430+CL
RTx430+CL+FTRTx430+control
RTx430+FTSC170+CL
SC170+CL+FT SC170+Control
SC170+FTSureno+CL
Sureno+CL+FT Sureno+control
Sureno+FT TX2911+CL
TX2911+CL+FTTX2911+control
TX2911+FT
RTx430 SC170 Sureno TX2911
PR10 mRNA levels in glumes 48h p.i.
RTx430 SC170 Sureno TX2911
P. sorghi• conidia-asexual spores
• antheridum and oogonium forming in leaf tissue
Downy mildews of Andropogonea
• Peronosclerospora sorghi• P. maydis• P. sacchari• P. philippinensis (select agent)• P. zeae• Sclerophthora rayssiae (select agent)• Sclerospora graminicola
P. sorghi
Infected seed, with glume
Healthy seed, with glume
Infected seed, no glume
Healthy seed, no glume
Dot-Blot Hybridizations; probe pMLY12
Colletotrichm graminicola
Acremonium strictum
Fusarium moniliforme
Infected seed, glumes 40d
Infected seed, no glumes 40d
Chenglin Yao
ITS 1 ITS 2 & 5.8sP. sorghi pt1
P. sorghi Thai1P. sorghi Thai2
P. maydis
P. sacchari
P. sorghi pt1P. sorghi Thai1P. sorghi Thai2
P. maydis
P. sacchariM M
PCR using conserved ITS primers
Nebulize genomic DNA withHaeIII, RsaI, and DraI+ 50 ng of RNaseA
2. Ligate adaptersAP11 (5´CTCTTGCTTAGATCTGGACTA3´) &AP12 (5´pTAGTCCAGATCTAAGCAAGAGCACA3´, where p = 5´ phosphate)
3. Amplifyby PCR using AP11 primer
4. Hybridize with di & tribiotinylated oligos(TG/AC, CA/GT, GA/CT,CAA, AGG and GTT)
5. Select with streptavidin-coatedparamagnetic beads
6. Elution Of captured DNA
7. Remove residual oligos
8. Amplifyby PCR using AP11 primer
9. Cloning, Squencing,Identifying SSRs,
Primer Designing &Pathotypes genotyping
Microsatellite Capture
SSR’s for DM
Ramasamy Perumal
Cluster analysis of DM species based on 54 Simple Sequence Repeats
R gene taggingSorghum anthracnose example
Midrib infection Stem infection Seed infection
Co-segregation of AFLP marker Xtxa6227 and the Cg1 locus in F2-3 progeny derived from the cross of BTx623 and SC748-5. AFLP templates from parental inbreds BTx623 (cg1cg1) and SC748-5 (Cg1Cg1) and IS3620C (mapping parent) were run as controls to aid in the identification of polymorphic bands.
Co-segregation of dominant SSR marker SSR 1 and the cgf1 locus in F2-3 progeny derived from the cross of ATx623 and SC748-5. Genomic DNA from parental inbreds BTx623 (cg1cg1) and SC748-5 (Cg1Cg1) were run to aid in the identification of parental alleles for SSR 1. The amplified band from the SSR 1 allele was 152 bp (BTx623) or 155 bp (SC748-5)
Ramasamy Perumal
Jae Min Cho and Andy Paterson
Sorghum RGA Map
Claviceps africana: Ergot
RNAi against cotton nematodes
Root-Knot
reniform
• Two species causing large losses in Texas – Root knot = Meloidogyne incognita– Reniform = Rotylenchulus reniformis
• Plan– ID ‘matching’ sequences in genes of both species that are lethal if
knocked out in C. elegans– Prepare hairpin construct to express in cotton
• a) roots• b) constitutively (CaMV 35S promoter)
• So far– No common sequences, but individual constructs made– Transient expression in root cultures worked well– Transgenic plants look very promising
Keerti Rathore and Jim Starr
THANKS
To you for listening and to
TRRFSeveral USDA Collaborative AgreementsINTSORMILTARPThe Sorghum Checkoff ProgramGlobal Crop Diversity TrustTexas A&M Agrilife Research (formerly TAES)
For Research $$