+ All Categories
Home > Documents > Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape...

Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape...

Date post: 21-Dec-2015
Category:
Upload: douglas-quinn
View: 220 times
Download: 0 times
Share this document with a friend
Popular Tags:
74
Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many slides courtesy of Rafael Irizarry)
Transcript
Page 1: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2)

Héctor Corrada BravoCMSC858P Spring 2012

(many slides courtesy of Rafael Irizarry)

Page 2: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

How do we measure DNA methylation?

Page 3: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Microarray Data

Page 4: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

One question…

• Where do we measure?

• At least 7 arrays are needed to measure entire genome

• CpG are depleated

• Remaining CpGs cluster

Page 5: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

CpG Islands

Page 6: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

But variation seen outside

Page 7: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

McRBC

No Methylation

Cuts at AmCG or GmCG Input

Page 8: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

McRBC

Methylation

Page 9: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

McRBC after GEL

Methylation

Page 10: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

McRBC after GEL

Methylation

Page 11: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Now unmethylated

No Methylation

Page 12: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

McRBC after Gel

No Methylation

Page 13: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.
Page 14: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.
Page 15: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.
Page 16: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Gene Expression Normalization does not work well here

Page 17: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

We use control probes

Page 18: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

There are also waves

Page 19: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Smoothing

Page 20: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

McRBC on tiling two channel array

We smooth

Page 21: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Proportion of neighboring CpG also methylated/not methylated

Page 22: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

True signal (simulated)

Page 23: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Observed data

Page 24: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Observed data and true signal

Page 25: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

What is methylated (above 50%)?

Page 26: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Naïve approach

Page 27: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Many false positives (FP)

Page 28: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Smooth

Page 29: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

No FP, but one false negative

Page 30: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Smooth less? No FN, lots of FP

Page 31: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

We prefer this!

Page 32: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

CHARMDMR for three tissues (five replicates)

Irizarry et al, Nature Genetics 2009

Page 33: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Some findings

[Irizarry et al., 2009, Nat. Genetics]

Page 34: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Tissue easily distinguished

Page 35: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Cancer DMR

Page 36: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Many Regions like thisNote: hypo and hyper methylation

Page 37: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Both hyper and hypo methylated

Page 38: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Cancer and Tissue DMRs coincide

Page 39: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

DMR enriched in Shores

Page 40: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Still affects expression

T-DMRs

Page 41: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Still affects expression

C-DMRs

Page 42: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

USING SEQUENCING (BS-SEQ)

Page 43: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

TTCGATTACGA

AAGCTAATGCT

CH3

CH3

TTCGATTACGA

AAGCTAATGCT

CH3

CH3

Liver Brain

Page 44: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

TTCGATTACGA

AAGCTAATGCT

CH3

CH3

TTCGATTACGA

AAGCTAATGCT

CH3

CH3

TTCGATTACGA

AAGCTAATGCT

CH3

CH3

TTCGATTACGA

AAGCTAATGCT

CH3

TTCGATTACGA

AAGCTAATGCT

CH3

CH3TTCGATTACGA

AAGCTAATGCT

CH3

CH3

TTCGATTACGA

AAGCTAATGCT

CH3

CH3

85% Methylationchr3:44,031,616-44,031,626

Page 45: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Bisulfite Treatment

Page 46: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Bisulfite Treatment

GGGGAGCAGCATGGAGGAGCCTTCGGCTGACT

GGGGAGCAGTATGGAGGAGTTTTCGGTTGATT

Page 47: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

BS-seq

GTCGTAGTATTTGTCT GTCGTAGTATTTGTNN TGTCGTAGTATCTGTC TATGTCGTAGTATTTG TATATCGTAGTATTTT TATATCGTAGTATTTG NATATCGTAGTATNTG TTTTATATCGCAGTAT ATATTTTATGTCGTA ATATTTTATCTCGTA ATATTTTATGTCGTA GA-TATTTTATGTCGTGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTAC

GTTCAATATT

Coverage: 13Methylation Evidence: 13Methylation Percentage: 100%

Page 48: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

BS-seq

GTCGTAGTATTTGTCT GTCGTAGTATTTGTNN TGTCGTAGTATCTGTC TATGTCGTAGTATTTG TATATTGTAGTATTTT TATATCGTAGTATTTG NATATTGTAGTATNTG TTTTATATTGCAGTAT ATATTTTATGTCGTA ATATTTTATCTTGTA ATATTTTATGTCGTA GA-TATTTTATGTCGTGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTAC

GTTCAATATT

Coverage: 13Methylation Evidence: 9Methylation Percentage: 69%

Page 49: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

BS-seq

GTCGTAGTATTTGTCT GTCGTAGTATTTGTNN TGTTGTAGTATCTGTC TATGTTGTAGTATTTG TATATTGTAGTATTTT TATATTGTAGTATTTG NATATTGTAGTATNTG TTTTATATTGCAGTAT ATATTTTATGTCGTA ATATTTTATCTTGTA ATATTTTATGTTGTA GA-TATTTTATGTCGTGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTAC

GTTCAATATT

Coverage: 13Methylation Evidence: 4Methylation Percentage: 31%

Page 50: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

BS-seq

• Alignment is much trickier:– Naïve strategy: do nothing, hope not many CpG in a

single read– Smarter strategy: “bisulfite convert” reference: turn all

Cs to Ts• Also needs to be done on reverse complement reference and

reads

– Smartest strategy: be unbiased and try all combinations of methylated/un-methylated CpGs in each read

• Computationally expensive (see Hansen et al, 2011, for a strategy)

Page 51: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

BS-seq

• There are similarities to SNP calling (we’ll see this in a couple of weeks)

• EXCEPT: we want to measure percentages– Use a binomial model to estimate p, percentage of

methylation– Allow for sequencing errors, coverage differences,

etc.

Page 52: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Measuring DNA Methylation

• Estimating percentages• Use “local-likelihood”

method– Based on loess

(Plot courtesy of Kasper Hansen)

Page 53: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

BS-seq

Lister et al. 2009, Nature

Page 54: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Gene Expression Regulation: DNA methylation in promoter regions

Lister et al. 2009, Nature

Page 55: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

DNA methylation patterns within genomic regions

Lister et al. 2009

Page 56: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Putting it together

Page 57: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.
Page 58: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

What were we after?

• The epigenetic progenitor origin of human cancer• [Feinberg, et al., Nature Reviews Genetics, 2006]• Stochastic epigenetic variation as driving force of

disease• [Feinberg & Irizarry, PNAS, 2009]• Phenotypic variation, perhaps epigenetically mediated,

increases disease susceptibility• Increased epigenetic and gene expression variability of

specific genes/regions is a defining characteristic of cancer

Page 59: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

What did we do?

• Custom Illumina methylation microarray• Confirmed increased epigenetic variability in

specific regions across five cancer types

Page 60: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

What did we do?

• Custom Illumina methylation microarray• Confirmed increased epigenetic variability in

specific regions across five cancer types

Page 61: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

What did we do?• Custom Illumina methylation microarray

• Confirmed increased epigenetic variability in specific regions across five cancer

types

• Confirmed same sites are involved in tissue differentiation

Page 62: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

What did we do?• Custom Illumina methylation microarray

• Whole genome sequencing of bisulfite treated DNA– Found large blocks of hypo-methylation (sometimes Mbps long) in

colon cancer

Page 63: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

What did we do?• Custom Illumina methylation microarray

• Whole genome sequencing of bisulfite treated DNA– Found large blocks of hypo-methylation (sometimes Mbps long) in

colon cancer– These regions coincide with hyper-variable regions across cancer types

Page 64: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

What did we do?• Custom Illumina methylation microarray• Whole genome sequencing of bisulfite treated DNA• Gene Expression Analysis

Page 65: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Gene Expression Data

Page 66: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Gene Expression Data

When using multiple microarray experiments, proper normalization is key[McCall, et al., Biostatistics 2010]

Page 67: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Normalization is key

• fRMA: a single-chip normalization procedure• GNUSE: a single-chip quality metric• Barcode: a single-chip common-scale

measurement

Page 68: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

What did we do?• Custom Illumina methylation microarray• Whole genome sequencing of bisulfite treated DNA• Gene Expression Analysis

– Genes with hyper-variable gene expression in colon cancer are enriched in hypo-methylation blocks

[Corrada Bravo, et al., under review]

Page 69: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

What are we doing next?• Custom Illumina methylation microarray• Whole genome sequencing of bisulfite treated DNA• Gene Expression Analysis

– Genes with hyper-variable gene expression in colon cancer are enriched in hypo-methylation blocks

Page 70: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Bigger gene expression study

• 7,741 HGU133plus2 samples• 598 normal tissue samples, 4,886 tumor

samples• 176 different tissue types• 175 different GEO studies

Page 71: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

Bigger gene expression study

[Corrada Bravo, et al., under review]

Page 72: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

What are we doing next?• Custom Illumina methylation microarray• Whole genome sequencing of bisulfite treated DNA• Gene Expression Analysis

– Genes with hyper-variable gene expression in colon cancer are enriched in hypo-methylation blocks

– Tissue-specific genes have hyper-variable gene expression across cancer types

[Corrada Bravo, et al., under review]

Page 73: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

[Corrada Bravo, et al., under review]

Page 74: Introduction to epigenetics: chromatin modifications, DNA methylation and the CpG Island landscape (part 2) Héctor Corrada Bravo CMSC858P Spring 2012 (many.

[Corrada Bravo, et al., under review]


Recommended