+ All Categories
Home > Documents > Investigation 9 A “whodunit” Biotechnology: Restriction Enzyme Analysis of DNA Big Idea 3...

Investigation 9 A “whodunit” Biotechnology: Restriction Enzyme Analysis of DNA Big Idea 3...

Date post: 02-Jan-2016
Category:
Upload: godfrey-matthews
View: 225 times
Download: 3 times
Share this document with a friend
26
Investigation 9 Investigation 9 A “whodunit” A “whodunit” Biotechnology: Restriction Biotechnology: Restriction Enzyme Analysis of DNA Enzyme Analysis of DNA Big Idea 3 Big Idea 3 Connections to Big Idea 1 Connections to Big Idea 1
Transcript

Investigation 9Investigation 9A “whodunit”A “whodunit”

Biotechnology: Restriction Enzyme Biotechnology: Restriction Enzyme Analysis of DNAAnalysis of DNA

Big Idea 3Big Idea 3Connections to Big Idea 1Connections to Big Idea 1

Investigation 9 LO’sInvestigation 9 LO’s

LO 3.5 The student can justify the claim LO 3.5 The student can justify the claim that humans can manipulate heritable that humans can manipulate heritable information by identifying at least two information by identifying at least two commonly used technologies.commonly used technologies.

LO3.13 The student is able to pose LO3.13 The student is able to pose questions about ethical, social, or medical questions about ethical, social, or medical issues surrounding human genetic issues surrounding human genetic disordersdisorders

Safety Note:Safety Note:

Power supply on last and off first!Power supply on last and off first! Don’t handle gels with bare hands.Don’t handle gels with bare hands.

manmonthly.com.au

Informational videosInformational videos

Preparing and pouring a gel.Preparing and pouring a gel. http://bcove.me/mweu5eru Loading a gelLoading a gel http://bcove.me/z1gm7u7j

Concentration MattersConcentration Matters

Gels are made with buffer!

Heat, cool to 60Heat, cool to 60°, and pour smoothly.°, and pour smoothly.

Keep reagents coldKeep reagents cold

Avoid errors when you pipette.Avoid errors when you pipette.

Practice with 10 Practice with 10 drops of glycerol or drops of glycerol or corn syrup with 50 corn syrup with 50 drops of water and drops of water and one drop of blue one drop of blue food coloring.food coloring.

Load, add water to empty wells Load, add water to empty wells then fill right below top of gelthen fill right below top of gel

No budget? Make your own.No budget? Make your own.

Pause when DNA has begun Pause when DNA has begun moving through gel, add buffer.moving through gel, add buffer.

Staining…troublesome area.Staining…troublesome area.Destaining may take large volumes of waterDestaining may take large volumes of water

Restriction EnzymesRestriction Enzymes

DNA ProfilingDNA Profiling

FoodsFoods PaternityPaternity Inherited Inherited

diseasedisease Historical Historical

questionsquestions

Question to ponder: Who owns your DNA?

Restriction EnzymesRestriction Enzymes

Restriction enzymes cut DNA at very Restriction enzymes cut DNA at very specific locations. They are very specific locations. They are very predictable, each enzyme always cutting predictable, each enzyme always cutting the same way. This characteristic is used the same way. This characteristic is used in genetic engineering.in genetic engineering.

Restriction Enzyme Cut from EcoRI

Restriction EnzymesRestriction EnzymesCut at palindromesCut at palindromes

EcoRIEcoRI GAATTCGAATTCCTTAAGCTTAAG

HindIIIHindIII AAGCTTAAGCTTTTCGAATTCGAA

PstIPstI CTGCAGCTGCAGGACGTCGACGTC

These are molecular tools!

It is really useful when they leave “sticky ends.”

Try the exercise on page S113.

http://asymptotia.com/wp-images/2008/08/e_coli.jpg

Recombinant DNARecombinant DNA

Is to “recombine.”Is to “recombine.” Yep, a new piece of DNA from knitting Yep, a new piece of DNA from knitting

pieces together.pieces together. Restriction Enzymes cutRestriction Enzymes cut Ligase “glues”Ligase “glues”

Restriction MappingRestriction Mapping

Makes a DNA fingerprint.Makes a DNA fingerprint. The fragments, cut by restriction enzymes The fragments, cut by restriction enzymes

are RFLP’s or restriction fragment length are RFLP’s or restriction fragment length polymorphisms.polymorphisms.

RFLP’s separate by size.

About LambdaAbout Lambda

Lambda DNA is from a bacteriophageLambda DNA is from a bacteriophage A bacteriophage is a virus which A bacteriophage is a virus which

infects bacteria.infects bacteria. The DNA piece is 48,502 base pairs The DNA piece is 48,502 base pairs

long.long. Within this strand are locations which Within this strand are locations which

can be cut by restriction enzymes.can be cut by restriction enzymes. These are specific locations.These are specific locations.

Uncu

tPst

IEco

RI

Hin

dIII

1 2 3 4

Hind III sample size is known and will serve as the DNA Standard.

Band #

Base pair size

HindIII

1. 23,130

2. 9,416

3. 6,557

4. 4,361

5. 2,322

6. 2,027

Distance mm

Siz

e,

base

pair

s

Use semi-log paper. The size in base pairs is graphed logarithmically.

Can you figure out Can you figure out “whodunit?”“whodunit?”

Use the provided samples and Use the provided samples and give it a shot.give it a shot.

Motive, means, opportunity, DNA Motive, means, opportunity, DNA evidence.evidence.

Thinking About Your ResultsThinking About Your Results

Choose one ethical problem from page Choose one ethical problem from page S123.S123.

Research and write about it.Research and write about it.


Recommended