Legionella pneumophila induced IFNβ in lung epithelial cells via IPS-1 and IRF3 which also control bacterial replication* Bastian Opitz 1,6,7 , Maya Vinzing 1,7 , Vincent van Laak 1 , Bernd Schmeck 1 , Guido Heine 2 , Stefan Gunther 3 , Robert Preissner 3 , Hortense Slevogt 1 , Philippe Dje N´Guessan 1 , Julia Eitel 1 , Torsten Goldmann 4 , Antje Flieger 5 , Norbert Suttorp 1 and Stefan Hippenstiel 1 1 Department of Internal Medicine/Infectious Diseases and Respiratory Medicine, Charité Universitätsmedizin Berlin, Augustenburger Platz 1, 13353 Berlin, Germany; 2 Department of Dermatology and Allergy, Allergy Center Charité, Charité Universitätsmedizin Berlin, Schumannstraße 20/21, 10117 Berlin, Germany; 3 Institute of Biochemistry Charité, Monbijoustrasse 2, 10117 Berlin, Germany; 4 Clinical and Experimental Pathology, Research Center Borstel, Parkallee 3, 23845 Borstel, Germany, Germany 5 Robert Koch-Institute, Research Group NG5 Pathogenesis of Legionella Infections, Nordufer 20, D-13353 Berlin, Germany 6 Address correspondence to: Bastian Opitz, Department of Internal Medicine/Infectious Diseases and Respiratory Medicine, Charité Universitätsmedizin Berlin, Augustenburger Platz 1, 13353 Berlin, Germany, Phone: +49-30-450 553383, Fax: +49-30-450 553992, e- mail: [email protected]7 Contributed equally Running title: IPS-1 and IRF3 control L. pneumophila replication 1 http://www.jbc.org/cgi/doi/10.1074/jbc.M604638200 The latest version is at JBC Papers in Press. Published on September 19, 2006 as Manuscript M604638200 Copyright 2006 by The American Society for Biochemistry and Molecular Biology, Inc. by guest on March 23, 2018 http://www.jbc.org/ Downloaded from
Transcript
Legionella pneumophila induced IFNβ in lung epithelial cells via IPS-1 and IRF3 which also control bacterial replication*
Bastian Opitz1,6,7, Maya Vinzing1,7, Vincent van Laak1, Bernd Schmeck1, Guido Heine2, Stefan Gunther3, Robert Preissner3, Hortense Slevogt1, Philippe Dje N´Guessan1, Julia Eitel1, Torsten Goldmann4, Antje Flieger5, Norbert Suttorp1 and Stefan Hippenstiel1 1Department of Internal Medicine/Infectious Diseases and Respiratory Medicine, Charité Universitätsmedizin Berlin, Augustenburger Platz 1, 13353 Berlin, Germany; 2Department of Dermatology and Allergy, Allergy Center Charité, Charité Universitätsmedizin Berlin, Schumannstraße 20/21, 10117 Berlin, Germany; 3Institute of Biochemistry Charité, Monbijoustrasse 2, 10117 Berlin, Germany; 4Clinical and Experimental Pathology, Research Center Borstel, Parkallee 3, 23845 Borstel, Germany, Germany 5Robert Koch-Institute, Research Group NG5 Pathogenesis of Legionella Infections, Nordufer 20, D-13353 Berlin, Germany 6Address correspondence to: Bastian Opitz, Department of Internal Medicine/Infectious Diseases and Respiratory Medicine, Charité Universitätsmedizin Berlin, Augustenburger Platz 1, 13353 Berlin, Germany, Phone: +49-30-450 553383, Fax: +49-30-450 553992, e-mail: [email protected] 7Contributed equally Running title: IPS-1 and IRF3 control L. pneumophila replication
1
http://www.jbc.org/cgi/doi/10.1074/jbc.M604638200The latest version is at JBC Papers in Press. Published on September 19, 2006 as Manuscript M604638200
Copyright 2006 by The American Society for Biochemistry and Molecular Biology, Inc.
Summary Legionella pneumophila, a Gram-negative facultative intracellular bacterium, causes severe pneumonia (Legionnaires´ disease). Type I IFNs were so far associated with antiviral immunity, but recent studies also indicated a role of these cytokines in immune responses against (intracellular) bacteria. Here we show that wild-type L. pneumophila and flagellin-deficient Legionella, but not L. pneumophila lacking a functional type IV secretion system Dot/Icm, or heat-inactivated Legionella induced IFNβ expression in human lung epithelial cells. We found that IFN-regulated factor (IRF)-3 and NF-κB-p65 translocated into the nucleus and bound to the IFNβ gene enhancer after L. pneumophila infection of lung epithelial cells. RNA interference demonstrated that in addition to IRF3, the caspase recruitment domain (CARD)-containing adapter molecule interferon-beta promoter stimulator 1 (IPS-1) is crucial for L. pneumophila-induced IFNβ expression, whereas other CARD-possessing molecules such as retinoic-acid-inducible protein I (RIG-I), melanoma-differentiation-associated gene 5 (MDA5), nucleotide-binding oligomerization domain protein 27 (Nod27) and apoptosis-associated speck-like protein containing a CARD (ASC) seemed not to be involved. Finally, bacterial multiplication assays in siRNA-treated cells indicated that IPS-1, IRF3 and IFNβ were essential for the control of intracellular replication of L. pneumophila in lung epithelial cells. In conclusion, we demonstrated a critical role of IPS-1, IRF3 and IFNβ in Legionella infection of lung epithelium.
Opitz et al.: IPS-1 and IRF3 control L. pneumophila replication Summary
Introduction The innate immunity serves as a first line defense system against invading pathogens including bacteria or viruses. It senses microbial derived molecules by so-called pattern-recognition receptors (PRRs) such as the Toll-like receptors (TLRs), the Nod-like receptors (NLRs), or the RNA helicases retinoic acid inducible gene-I (RIG-I) and melanoma differentiation-associated gene 5 (MDA5), and mediates up-regulation and production of antibacterial and antiviral mediators (1-4). IFNα and -β constitute the type I IFN family, and were originally identified as humeral factors that confer an antiviral state on cells (5). The expression of IFNα/β is essentially controlled by transcription factors of the IFN regulatory factor (IRF) family (6). After expression and secretion, IFNα/β binds to the IFNα/β receptor which via signaling to the STAT/JAK pathway induces expression of so-called IFN-stimulated genes (ISGs), many of which have antiviral activities (7). Much attention has recently been directed to the mechanism of pathogen-induced IRF activation: dsRNA and LPS when recognized by TLR3 and TLR4, respectively, stimulated a TRIF (and TRAM for TLR4)-TBK1/IKKi signaling module leading to IRF3 and IRF7 activation, TLR7-9 detect ssRNA and CpG DNA, and stimulate IRF5 and IRF7 via a MyD88-dependent pathway also involving IRAK1/4 and TRAF6 (2;8;9). Moreover,
certain viruses or dsRNA activated a TLR-independent pathway which signals via the cytosolic RNA helicases RIG-I and/or MDA5, the adapter molecule interferon-beta promoter stimulator 1 (IPS-1; also called MAVS, VISA and Cardif), thereby stimulating IRF3 and IRF7 (1;4;10-13). Besides antiviral immunity, recent work demonstrated an involvement of IFNβ in innate immune responses against the intracellular, Gram-positive bacterium Listeria monocytogenes (14-19). Whereas TBK1 and IRF3 but not the TLRs or Nod1/2 participated in Listeria-induced IFNβ induction, the upstream signaling molecules including the PRRs involved remained obscure (20-22). The Gram-negative bacterium Legionella pneumophila, the causative agent of Legionnaires' disease, has also been shown to replicate in human cells including alveolar macrophages and epithelial cells (23;24). Legionella are enclosed within a vacuole during their intracellular replication. They possess the type IVB secretion system Dot/Icm that enables them to inject proteins and nucleic acids into the host cell cytoplasm. Here we demonstrate that wild-type L. pneumophila, but not Legionella deficient in the Dot/Icm system, induced IFNβ expression through IPS-1 and IRF3. In addition, we observe a negative regulatory effect of IPS-1 and IRF3 on intracellular replication of L. pneumophila in lung epithelial cells.
Opitz et al.: IPS-1 and IRF3 control L. pneumophila replication Introduction
Experimental procedure Bacterial strains The L. pneumophila strains used in this study were wild-type serogroup 1 strains 130b (kindly provided by N. Cianciotto, Chicago, IL), JR32, JR32 mutant with a knock out in dotA, encoding a protein essential for the type IVB secretion system (kindly provided by H. Shuman, New York, NY), wild-type Corby and Corby deficient in flagellin (∆flaA; kindly provided by K. Heuner, Würzburg, Germany). L. pneumophila was grown on buffered charcoal-yeast extract (BCYE) agar for 2 days at 37°C before uses. RNA interference in A549 cells Control non-silencing siRNA (sense UUCUCCGAACGUGUCACGUtt, antisense ACGUGACACGUUCGGAGAAtt), siRNAs targeting IPS-1 (IPS-1a: sense UAGUUGAUCUCGCGGACGAtt, antisense UCGUCCGCGAGAUCAACUAtt; IPS-1b: sense CCACCUUGAUGCCUGUGAAtt, antisense UUCACAGGCAUCAAGGUGGtt), ASC (sense GAUGCGGAAGCUCUUCAGUtt, antisense ACUGAAGAGCUUCCGCAUCtt) were purchased from MWG. IRF3 siRNA (sense GGAGGAUUUCGGAAUCUUCtt, antisense GAAGAUUCCGAAAUCCUCCtg), RIG-I siRNA (sense CGAUUCCAUCACUAUCCAUtt, antisense AUGGAUAGUGAUGGAAUCGtt), MDA5 siRNA (sense GGAUUGUGCAGAAAGAAAAtt, antisense UUUUCUUUCUGCACAAUCCtt), Nod27 siRNA (sense GCAGACAGGCUAUGCUUUCtt, antisense GAAAGCAUAGCCUGUCUGCtg) and Nod5 siRNA (Nod5: sense GUUAUUCCUAAAGGAGACCtt, antisense GGUCUCCUUUAGGAAUAACtt) were from Ambion. A549 cells were transfected by using Amaxa NucleofectorTM (Amaxa) according to the manufactures protocol (Nucleofector™ Solution V, Nucleofector™ program G-16) with 2 µg siRNA per 106 cells.
Infection/stimulation of A549 cells Cells were infected with L. pneumophila at MOI as indicated, centrifuged for 30 min at 800 g to enhance bacterial adherences and internalization, and incubated for 6.5 h at 37°C (IFNβ mRNA expression). In the Chromatin Immunoprecipitation (ChIP) and Western blot experiments, A549 cells were starved in culture medium without FCS over night and subsequently infected with L. pneumophila (MOI 10) for the indicated time intervals. In certain experiments, LyoVec-complexed B-DNA (poly(dA-dT)-poly(dT-dA), InvivoGen) at 1 µg/ml was used as a control. RT-PCR analysis Total RNA from A549 cells was isolated with the RNeasy Mini kit (Qiagen) and reverse transcribed using AMV reverse transcriptase (Promega). The generated cDNA was amplified by semiquantitative RT-PCR using specific primers (IFNβ−sense 5’-GCTCTCCTGTTGTGCTTCTCCAC-3’; IFNβ-antisense 5’-CAATAGTCTCATTCCAGCCAGTGC-3’; IRF3-sense 5’-TACGTGAGGCATGTGCTGA-3’; IRF3-antisense 5’-AGTGGGTGGCTGTTGGAAAT-3’; IPS-1-sense 5’-ATGCCGTTTGCTGAAGAC-3’; IPS-1-antisense 5’-CTAGTGCAGACGCCGCCG-3’; RIG-I-sense 5’-TCCTTTATGAGTATGTGGGCA-3’; RIG-I-antisense 5’-TCGGGCACAGAATATCTTTG-3’; MDA5-sense 5’-TCCTGGTTGCTCACAGTGGTT-3’; MDA5-antisense 5’-GAGACAAGGCAAATCTAAGCC-3’; ASC-sense ATGCGCTGGAGAACCTGA; ASC-antisense AGGTAGGACTGGGACTCCCTTA; Nod27-sense TGGGAAGACACTCAGGCTAA; Nod27-antisense ATCATCGTCCTCACAGAGGTT; Nod5-sense GGAGTGCAGCTTTTGTGTGA; Nod5-antisense AGATGCGTCAGGCTCTTGTT; IL-8-sense 5’-CTAGGACAAGAGCCAGGAAGA-3’; IL-8-antisense 5’-AACCCTCTGCACCCAGTTTTC-3’;
Opitz et al.: IPS-1 and IRF3 control L. pneumophila replication Experimental procedure
GAPDH-sense 5’-CCACCCATGGCAAATTCCATGGCA-3’; GAPDH-antisense 5’-TCTAGACGGCAGGTCAGGTCCACC-3’). Quantitative RT-PCR Real-time PCR were carried out using SYBR-green DNA Amplification Kit (Roche) on a Lightcycler® apparatus (Roche). The primers used were IFNβ- sense 5’-AAACTCATGAGCAGTCTGCA-3’, IFNβ-antisense 5’-AGGAGATCTTCAGTTTCGGAGG-3’, Input was normalized by the average expression of the housekeeping gene S9: S9-sense 5’-ATCCGCCAGCGCCATA-3’; S9-antisense 5’-TCA ATGTGCTTCTGGGAATCC-3’. All PCR reactions were carried out in duplicates, relative IFNβ expression in control siRNA-transfected/Legionella-infected cells was set as 100%. Western blot Cytoplasmatic or nuclear extracts of A549 cells were separated by SDS-PAGE, and blotted. Membranes were exposed to antibodies specific to IRF3 (Santa Cruz), or p65 (Santa Cruz), respectively, and subsequently incubated with secondary
antibodies (IRDye 800–labeled anti-mouse, or Cy5.5-labeled anti-rabbit, respectively). Proteins were detected by using an Odyssey infrared imaging system (LI-COR Inc.). Immunhistochemistry Human lung specimens were fixed, paraffin-embedded by utilizing the HOPE-technique and subjected to immunohistochemistry. After deparaffinization the endogenous peroxidase was blocked by incubation with 3% H2O2. Unspecific binding was minimized by incubation with heat inactivated pig serum diluted 1/30 in TBS. Rabbit anti-IRF3 (Santa Cruz) was used as primary antibody, detection and visualization was performed by the LSAB2-technique with aminoethylcarbazole as a chromogenic substrate for the horseradish peroxidase. Slides were counterstained by Mayers hemalum, mounted with Kayser’s Glycerolgelatine and photomicrographed.
Negative controls were included by omission of the primary antibody. Chromatin Immunoprecipitation (ChIP) A549 cells were infected with L. pneumophila as indicated and then subjected to ChIP assay as previously described using anti-IRF3 (Santa Cruz), anti-p65 (Santa Cruz), or anti-RNA polymerase II (Santa Cruz) antibodies (25). The IFNβ enhancer region was amplified by PCR using HotstarTaq polymerase (Qiagen)
and specific primers as followed: sense 5’-GAATCCACGGATACAGAACCT-3’; antisense 5’-TTGACAACACGAACAGTGTCG-3’. PCR amplifications of the total input DNA in each sample is shown as a control. Bacterial replication assay A549 cells were transfected with siRNA targeting IRF3 or IPS-1 or control siRNA. After 56 h, cells were pretreated with 1000 IU/ml rIFNβ (InvivoGen) as indicated. After further 16 h, cells were infected with L. pneumophila (MOI 0.1), centrifuged for 30 min at 800 g, and incubated for further 1.5 h at 37°C. Cells were then washed twice with PBS, and culture medium containing 50 µg/ml gentamycin was added to the cells for 1 h to kill remaining extracellular Legionella. Subsequently, cells were washed, and culture medium with rIFNβ as indicated, was added (this time point represents the 0 h). Cells were incubated, and washed at the indicated time intervals with PBS, lysed with 0.1% saponine for 5 min, and lysates were plated on BCYE agar to count Legionella CFU. Statistics Inhibitory effects of siRNAs used were statistically evaluated employing the Student's t test. p values of < 0.05 are indicated by one asterisk.
Opitz et al.: IPS-1 and IRF3 control L. pneumophila replication Experimental procedure
Results L. pneumophila induced IFNβ expression in lung epithelial cells. In order to characterize the effects of L. pneumophila on lung epithelial cells, we incubated A549 cells with the bacteria at different MOI. L. pneumophila infection with strain 130b and JR32 both dose-dependently increased IFNβ mRNA expression (Fig. 1A and B), while L. pneumophila JR32 deficient in its type IVB secretion system, or heat-inactivated L. pneumophila did not (Fig. 1B and C), suggesting that substrate translocation via the type IVB secretion system and/or intracellular replication were necessary for the IFNβ response. Moreover, Legionella flagellin seemed not being involved, since L. pneumophila strain Corby and a respective flagellin mutant were both capable to induce IFNβ induction (1 D). IRF3 is required for L. pneumophila-stimulated IFNβ expression. IFNβ responses upon Legionella infection led us to assess a possible link between Legionella infection and IRF3 activation. IRF3 is expressed in human lung tissue (Fig. 2A) and in A549 cells. L. pneumophila infection of A549 cells induced nuclear translocation of IRF3 as demonstrated by immunoblotting of nuclear extracts with a specific IRF3 antibody (Fig. 2B). Moreover, the NF-κB subunit p65/RelA also translocated into the nucleus of Legionella-infected cells. In order to further address the effects of L. pneumophila on the transcription factors examined, we performed a ChIP assay by using IFNβ enhancer-specific primers. A549 cells were infected with L. pneumophila, and immunoprecipitations with IRF3, p65 and RNA polymerase II antibodies were carried out. As shown in Fig. 2C, Legionella infection led to a temporary binding of IRF3 and p65 to the IFNβ enhancer. After 60 min, recruitment of RNA polymerase II to the IFNβ enhancer indicated gene transcription. Taken together, these results demonstrated that Legionella
infection stimulated transcriptional activity of IRF3 and p65. Next, we performed RNAi experiments to analyze the importance of IRF3 for IFNβ expression. A549 cells were transfected either with unspecific non-silencing control siRNA or with specific siRNA targeting IRF3, respectively. After 72 h, cells were infected with L. pneumophila and quantitative Q-PCR as well as semi-quantitative RT-PCR were carried out. As shown in Fig. 3, Legionella infection induced IFNβ expression in cells that were transfected with the control siRNA. IRF3 siRNA strongly inhibited IFNβ up-regulation caused by L. pneumophila. The expression of IRF3 was assessed in parallel in order to monitor the RNAi effects. Data indicate that the siRNA used was capable of silencing its specific target mRNA. As a second control, we checked mRNA expression of IL-8, a predominantly NF-κB-regulated gene (26): as expected, the Legionella-induced IL-8 mRNA up-regulation was hardly affected by any siRNA used. Overall, our data showed that IRF3 is important for IFNβ induction by L. pneumophila. IPS-1 is required for L. pneumophila-stimulated IFNβ expression. IPS-1/MAVS/VISA/Cardif has been demonstrated to be crucial for RIG-I and MDA5-mediated IRF3 activation and subsequent IFNβ induction by dsRNA as well as certain viruses, and very recently also for IFNβ responses induced by cytosolic B-form DNA via a so far unidentified receptor (10-13;27). Knowing in addition that in the TLR family different TLRs share adapter molecules and thereby activate similar signaling cascades (2;8), overall, we hypothesized that IPS-1 mediates IFNβ responses by Legionella. We therefore tested involvement of IPS-1 by using two IPS-1 siRNAs which had already been used in two of the initial reports identifying IPS-1/MAVS (10;12). Data obtained in A549 cells demonstrated that both siRNAs targeting IPS-1, abrogated the up-regulation of IFNβ caused by L. pneumophila infection or by synthetic B-DNA (Fig. 4 and data not shown).
Opitz et al.: IPS-1 and IRF3 control L. pneumophila replication Results
We thus concluded, that IPS-1 is critically involved in the IFNβ responses to Legionella infection. RIG-I, MDA5, ASC, Nod27 and Nod5 siRNAs did not inhibit the L. pneumophila-stimulated IFNβ expression. Since the CARD domain containing IPS-1 is known to interact with homologues domains within its upstream receptor molecules RIG-I and MDA5 (10-13), we hypothesized that the putative PRR or an intermediate which mediates the IFNβ responses by Legionella lies upstream of IPS-1 and also contains a CARD (28). An own search in Pfam database (29) with IPS-1-CARD together with published data (28) identified in addition to RIG-I and MDA5 several proteins, of which some were tested by RNAi for its involvement in IFNβ responses to Legionella. Data demonstrated indicate that siRNAs targeting RIG-I, MDA5, ASC, Nod27 (which might have a atypical CARD, (28)) or Nod5 (which might not have a CARD, (28)) inhibited their specific mRNA but not the IFNβ induction activated by L. pneumophila infection or by synthetic B-DNA (Fig. 5 and data not shown). In case of Nod27 siRNA, we even observed an enhancement of the Legionella-induced IFNβ up-regulation. Overall, the data argue against RIG-I, MDA5, ASC, Nod27 and Nod5 mediating IFNβ induction activated by L. pneumophila. IPS-1, IRF3 and IFNβ negatively regulate intracellular replication of L. pneumophila in lung epithelial cells. Finally, we wanted to know if the IPS-1-IRF-IFNβ cascade activated by L. pneumophila has a regulatory impact on the intracellular replication of the bacteria. Therefore, A549 cells were either transfected with non-silencing control siRNA, or with specific siRNAs targeting IPS-1 or IRF3, respectively. In addition, some cells were pretreated with rIFNβ 56 h after transfection. 72 h after transfection (16 h after rIFNβ treatment), cells were infected with L. pneumophila, and numbers of intracellular bacteria were counted at different time points, as described in the
materials and methods section. As shown in Fig. 6, L. pneumophila replicated within the lung epithelial cells examined (0 h: 1533 +/- 88, 48 h: 146667+/- 37564). Moreover, overall numbers of Legionella increased in cells in which expression of IPS-1 or IRF3 was inhibited by siRNA (6A and B). In case of IPS-1 silencing, similar results were obtained by using the two different siRNA sequences (data not shown). In contrast, treatment with rIFNβ diminished numbers of intracellular bacteria, and rescued the IPS-1 and IRF3 deficiencies. Taken together, intracellular replication of L. pneumophila in lung epithelial cells was enhanced by IPS-1 and IRF3 silencing, and inhibited by rIFNβ treatment.
Opitz et al.: IPS-1 and IRF3 control L. pneumophila replication Results
Discussion Classically, type I IFNs had been particularly associated with antiviral immune responses, but an increasing body of work demonstrated that type I IFNs played also important roles in the host defense against bacterial infections (30). We expand on this by demonstrating (I) that L. pneumophila induced IFNβ expression in lung epithelial cells, a process dependent on its type IVB secretion system but not on flagellin, (II) that IPS-1 and IRF3 are crucial for the IFNβ response to L. pneumophila, and (III), that IPS-1 and IRF3 were important for the control of intracellular replication of L. pneumophila in lung epithelial cells. Our results showing enhanced multiplication of Legionella in IPS-1 or IRF3 siRNAi-transfected cells which was restored by IFNβ treatment did not formally prove but strongly suggest that endogenously produced IFNβ controlled Legionella replication. Our finding demonstrating that the CARD-containing IPS-1 mediated the IFNβ responses against Legionella led us to hypothesize that the upstream located putative PRR or signaling mediator involved also possess a CARD. We started to examine several CARD-containing molecules for their contribution in the IFNβ induction by Legionella: Because Nod1 and Nod2 do not mediate IFNβ induction (data not shown and (20-22)), and Nod3 is not expressed in A549 cells (data not shown and (31)), first we focused on Nod27 and Nod5 which might have a CARD or atypical CARD (28), as well as on CARD-containing RIG-I, MDA5 and ASC. Our results argue against these molecules mediating the Legionella-induced IFNβ responses. Due to its CARD and LRR, IPAF/CARD12/CLAN (potentially together with NAIP/Birc1) would also have been an promising candidate, but recent reports demonstrating that IPAF together with NAIP5/Birc1e mediate host cell responses against Legionella flagellin in mice (32-34), and our finding that Legionella flagellin was not required for IFNβ induction suggest that IPAF is not involved in the type I IFN response. On the other hand, both the IFNβ
response and the NAIP5-IPAF-caspase-1 cascade (32-34) restrict replication of Legionella in host cells or mice, respectively, potentially suggesting an interaction of these mechanisms. Thus, while we were so far unable to identify the exact sensing molecule upstream of IPS-1, further studies regarding identification of this putative PRR and a potential involvement of IPAF (and NAIP/Birc1) and other CARD-containing molecules in the Legionella-induced IFNβ responses are needed. Type I IFNs have been demonstrated to be both, favorable and detrimental to the host defense during bacterial infections and may dependent on the pathogen involved. In line with our results, multiplication of L. pneumophila in mouse macrophages was inhibited by treatment with IFNα/β, and enhanced by anti-IFNα/β antibodies, thus also suggesting a role of endogenous type I IFNs in controlling replication of Legionella in host cells (35). In a different infection model with L. monocytogenes, however, murine macrophages defective in type I IFN receptor signaling were more resistant to infections than wild-type macrophages, and mice defective in type I IFN receptor were less susceptible to Listeria infections than wild-type mice in vivo (14;15;17;19). The underlining mechanisms are poorly understood, but the differences observed may be related to the different pathogens (L. pneumophila vs. L. monocytogenes). After completion of this work, several studies pertinent to results presented were published: Akira´s group demonstrated an IPS-1-dependent, but TLR- and RIG-I-independent induction of type I IFNs by B-DNA in human cells (27). In addition, Stetson and Medzhitov showed a stimulation of IFNβ response by L. pneumophila but not by Legionella lacking dotA, which was independent of Nod1/2 and the TLRs (36). The study suggested that by means of its type IVB secretion system, L. pneumophila translocated DNA into the host cell cytosol, which in turn activated IFNβ expression. Thus, while these studies and our results suggest that L. pneumophila-derived
Opitz et al.: IPS-1 and IRF3 control L. pneumophila replication Discussion
DNA activates an IPS-1- and IRF3-dependent IFNβ response, more recent data failed to support this hypothesis by demonstrating that IPS-1/MAVS-KO mice cells showed an only moderately reduced or even equal IFN response to cytosolic B-DNA, DNA virus or L. monocytogenes compared to wild-type cells (37;38). In addition, IPS-1 siRNA did not block type I IFN induction by L. monocytogenes in mice macrophages (39). Thus, this discrepancy might reflect differences between humans and mice. Moreover, in addition to B-DNA further PAMPs of Legionella or Listeria might contribute to the observed responses, and different pathogens (L. pneumophila vs. L. monocytogenes) might be sensed by distinct sensing mechanisms. Overall, further work is warranted to further elucidate (I) the sensing mechanism which recognizes Legionella or potentially its DNA and activates IRFs, and (II) which mechanism enables IPS-1-IRF-IFNβ to control L. pneumophila replication in host cells.
Opitz et al.: IPS-1 and IRF3 control L. pneumophila replication Discussion
*Footnotes We are grateful to J. Hellwig, and S. Schapke for excellent technical assistance, and C. Dang for help with Q-PCR. This work was supported in part by grants given by the Bundesministerium für Bildung und Forschung to S. H. (BMBF Competence Network CAPNETZ C15), B. S. (CAPNETZ C15) and N. S. (CAPNETZ C4). Parts of this work will be included in the M.D. thesis of M. V. Abbreviation used are: ASC, apoptosis-associated speck-like protein containing a CARD; CARD, caspase recruitment domain; IFN, interferon; IPS, IFNβ promoter stimulator 1; IRF, IFN-regulated factor; MDA5, melanoma-differentiation-associated gene 5; NF-κB, nuclear factor-κB; Nod, nucleotide-binding oligomerization domain protein; RIG-I, retinoic-acid-inducible protein I; TLR, Toll-like receptor
Opitz et al.: IPS-1 and IRF3 control L. pneumophila replication Footnotes
1. Andrejeva, J., Childs, K. S., Young, D. F., Carlos, T. S., Stock, N., Goodbourn, S., and
Randall, R. E. (2004) Proc Natl Acad Sci U S A 101, 17264-17269 2. Kawai, T. and Akira, S. (2005) Curr.Opin.Immunol 17, 338-344 3. Philpott, D. J. and Girardin, S. E. (2004) Mol Immunol 41, 1099-1108 4. Yoneyama, M., Kikuchi, M., Natsukawa, T., Shinobu, N., Imaizumi, T., Miyagishi, M., Taira,
K., Akira, S., and Fujita, T. (2004) Nat Immunol 5, 730-737 5. Katze, M. G., He, Y., and Gale, M., Jr. (2002) Nat Rev Immunol 2, 675-687 6. Barnes, B., Lubyova, B., and Pitha, P. M. (2002) J Interferon Cytokine Res 22, 59-71 7. Levy, D. E. and Darnell, J. E., Jr. (2002) Nat.Rev.Mol Cell Biol 3, 651-662 8. Beutler, B. (2005) Immunogenetics 57, 385-392 9. Honda, K., Yanai, H., Takaoka, A., and Taniguchi, T. (2005) Int.Immunol 17, 1367-1378 10. Kawai, T., Takahashi, K., Sato, S., Coban, C., Kumar, H., Kato, H., Ishii, K. J., Takeuchi, O.,
and Akira, S. (2005) Nat Immunol 6, 981-988 11. Meylan, E., Curran, J., Hofmann, K., Moradpour, D., Binder, M., Bartenschlager, R., and
Tschopp, J. (2005) Nature 437, 1167-1172 12. Seth, R. B., Sun, L., Ea, C. K., and Chen, Z. J. (2005) Cell 122, 669-682 13. Xu, L. G., Wang, Y. Y., Han, K. J., Li, L. Y., Zhai, Z., and Shu, H. B. (2005) Mol Cell 19,
727-740 14. Auerbuch, V., Brockstedt, D. G., Meyer-Morse, N., O'Riordan, M., and Portnoy, D. A. (2004)
J Exp.Med 200, 527-533 15. Carrero, J. A., Calderon, B., and Unanue, E. R. (2004) J Exp.Med 200, 535-540 16. McCaffrey, R. L., Fawcett, P., O'Riordan, M., Lee, K. D., Havell, E. A., Brown, P. O., and
Portnoy, D. A. (2004) Proc Natl Acad Sci U S A 101, 11386-11391 17. O'Connell, R. M., Saha, S. K., Vaidya, S. A., Bruhn, K. W., Miranda, G. A., Zarnegar, B.,
Perry, A. K., Nguyen, B. O., Lane, T. F., Taniguchi, T., Miller, J. F., and Cheng, G. (2004) J Exp.Med 200, 437-445
18. O'Riordan, M., Yi, C. H., Gonzales, R., Lee, K. D., and Portnoy, D. A. (2002) Proc Natl Acad Sci U S A 99, 13861-13866
19. Stockinger, S., Materna, T., Stoiber, D., Bayr, L., Steinborn, R., Kolbe, T., Unger, H., Chakraborty, T., Levy, D. E., Muller, M., and Decker, T. (2002) J Immunol 169, 6522-6529
20. O'Connell, R. M., Vaidya, S. A., Perry, A. K., Saha, S. K., Dempsey, P. W., and Cheng, G. (2005) J Immunol 174, 1602-1607
21. Opitz, B., Puschel, A., Beermann, W., Hocke, A. C., Forster, S., Schmeck, B., van, L., V, Chakraborty, T., Suttorp, N., and Hippenstiel, S. (2006) J Immunol 176, 484-490
22. Stockinger, S., Reutterer, B., Schaljo, B., Schellack, C., Brunner, S., Materna, T., Yamamoto, M., Akira, S., Taniguchi, T., Murray, P. J., Muller, M., and Decker, T. (2004) J Immunol 173, 7416-7425
23. Neild, A. L. and Roy, C. R. (2004) Cell Microbiol 6, 1011-1018 24. Swanson, M. S. and Hammer, B. K. (2000) Annu.Rev Microbiol 54, 567-613 25. Schmeck, B., Zahlten, J., Moog, K., van, L., V, Huber, S., Hocke, A. C., Opitz, B., Hoffmann,
E., Kracht, M., Zerrahn, J., Hammerschmidt, S., Rosseau, S., Suttorp, N., and Hippenstiel, S. (2004) J Biol Chem 279, 53241-53247
26. Mukaida, N., Mahe, Y., and Matsushima, K. (1990) J Biol Chem. 265, 21128-21133 27. Ishii, K. J., Coban, C., Kato, H., Takahashi, K., Torii, Y., Takeshita, F., Ludwig, H., Sutter,
G., Suzuki, K., Hemmi, H., Sato, S., Yamamoto, M., Uematsu, S., Kawai, T., Takeuchi, O., and Akira, S. (2006) Nat.Immunol 7, 40-48
28. Martinon, F. and Tschopp, J. (2005) Trends Immunol 26, 447-454
Opitz et al.: IPS-1 and IRF3 control L. pneumophila replication References
29. Finn, R. D., Mistry, J., Schuster-Bockler, B., Griffiths-Jones, S., Hollich, V., Lassmann, T., Moxon, S., Marshall, M., Khanna, A., Durbin, R., Eddy, S. R., Sonnhammer, E. L., and Bateman, A. (2006) Nucleic Acids Res. 34, D247-D251
30. Decker, T., Muller, M., and Stockinger, S. (2005) Nat Rev Immunol 5, 675-687 31. Conti, B. J., Davis, B. K., Zhang, J., O'connor, W., Jr., Williams, K. L., and Ting, J. P. (2005)
J Biol Chem 280, 18375-18385 32. Molofsky, A. B., Byrne, B. G., Whitfield, N. N., Madigan, C. A., Fuse, E. T., Tateda, K., and
Swanson, M. S. (2006) J Exp.Med 203, 1093-1104 33. Ren, T., Zamboni, D. S., Roy, C. R., Dietrich, W. F., and Vance, R. E. (2006) PLoS.Pathog. 2,
e18 34. Zamboni, D. S., Kobayashi, K. S., Kohlsdorf, T., Ogura, Y., Long, E. M., Vance, R. E.,
Kuida, K., Mariathasan, S., Dixit, V. M., Flavell, R. A., Dietrich, W. F., and Roy, C. R. (2006) Nat.Immunol 7, 318-325
35. Schiavoni, G., Mauri, C., Carlei, D., Belardelli, F., Pastoris, M. C., and Proietti, E. (2004) J Immunol 173, 1266-1275
36. Stetson, D. B. and Medzhitov, R. (2006) Immunity 24, 93-103 37. Kumar, H., Kawai, T., Kato, H., Sato, S., Takahashi, K., Coban, C., Yamamoto, M., Uematsu,
S., Ishii, K. J., Takeuchi, O., and Akira, S. (2006) J Exp.Med 38. Sun, Q., Sun, L., Liu, H. H., Chen, X., Seth, R. B., Forman, J., and Chen, Z. J. (2006)
Immunity 24, 633-642 39. Soulat, D., Bauch, A., Stockinger, S., Superti-Furga, G., and Decker, T. (2006) FEBS Lett.
580, 2341-2346
Opitz et al.: IPS-1 and IRF3 control L. pneumophila replication References
Figure Legends Figure 1. L. pneumophila induced IFNβ expression in A549 cells. (A) A549 cells were infected with wild-type L. pneumophila strain 130b (L. p.), or (B) wild-type L. pneumophila strains JR32 (L. p. JR) or JR32 Legionella which were deficient in their type IVB secretion system (L. p. JR ∆dotA). (C) A549 cells were infected with wild-type L. pneumophila strain 130b (L. p.) at an MOI of 10, or stimulated with an equal amount of heat-inactivated Legionella (hiL. p.). (D) A549 cells were infected with wild-type L. pneumophila strain Corby (L. p. Corby) or flagellin-lacking Legionella (L. p. Corby ∆flaA). IFNβ and GAPDH expressions were analyzed by RT-PCR. Results shown are representative of 3 independent experiments. Figure 2. L. pneumophila induced IRF3 and p65 nuclear translocation and IFNβ enhancer binding. (A) Detection of IRF3 in human lung tissues by immunohistochemistry. IRF3 is expressed in human lung airway epithelia (I, 400x), within alveolar epithelial cells (II, 800x), and within alveolar macrophages (III, 400x). Arrows indicate alveolar epithelial cells and arrowheads alveolar macrophages. (B) A549 cells were infected with L. pneumophila (130b). After indicated time intervals, nuclear cell extracts were probed by Western blot using the indicated antibodies. Shown is one representative experiment out of three. (C) A549 cells were infected with L. pneumophila for the indicated time intervals. ChIP assay was performed by using antibodies as indicated and subsequent amplification of the IFNβ enhancer. IFNβ enhancer was also amplified from the DNA-protein complex before the precipitation (Input). Data are representative for three independent experiments. Figure 3. Role of IRF3 in L. pneumophila-induced IFNβ expression. A549 cells were transfected with control siRNA (contr.) or siRNAs targeting IRF3. After 3 days, cells were infected with L. pneumophila (130b, MOI 10; L. p.) for 7 h and quantitative and semi-quantitative RT-PCRs as indicated were performed. Gels shown are representative of three independent experiments. Data obtained by Q-PCR represents means ± SD of two independent experiments performed in duplicates. Figure 4. Role of IPS-1 in L. pneumophila-induced IFNβ expression. A549 cells were transfected with control siRNA (contr.) or two different siRNAs targeting IPS-1 (IPS-1a, IPS-1b). After 3 days, cells were infected with L. pneumophila (130b, MOI 10; L. p.), and quantitative and semi-quantitative RT-PCRs were performed. Gels shown are representative of three independent experiments. Data obtained by Q-PCR represents means ± SD of two independent experiments performed in duplicates with quantification of IFNβ mRNA normalized to S9 mRNA. Figure 5. RIG-I, MDA5, ASC, Nod27 and Nod5 siRNA did not inhibited the IFNβ responses against Legionella. A549 cells were transfected with control siRNA (contr.) or siRNAs targeting RIG-I, MDA5, ASC, Nod27 or Nod5. After 3 days, cells were infected with L. pneumophila (130b, MOI 10; L. p.), and RT-PCRs as indicated were performed. Gels shown are representative of at least two independent experiments. Figure 6. IPS-1 and IRF3 control replication of L. pneumophila in lung epithelial cells. A549 cells were transfected with control siRNA or siRNAs targeting IPS-1 (A), or IRF3 (B). In addition, cells were treated with rIFNβ were indicated. 72 h after transfection, cells were infected with L. pneumophila (130b, MOI 0.1) for 2 h, extracellular bacteria were removed by washing and killed by gentamycin, and multiplication of Legionella was assessed by CFU counting. Data represents means of three independent experiments.
Opitz et al.: IPS-1 and IRF3 control L. pneumophila replication Figure Legends
Torsten Goldmann, Antje Flieger, Norbert Suttorp and Stefan HippenstielGunther, Robert Preissner, Hortense Slevogt, Philippe Dje N´Guessan, Julia Eitel,
Bastian Opitz, Maya Vinzing, Vincent van Laak, Bernd Schmeck, Guido Heine, Stefanwhich also control bacterial replication
in lung epithelial cells via IPS-1 and IRF3βLegionella pneumophila induced IFN
published online September 19, 2006J. Biol. Chem.
10.1074/jbc.M604638200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
