Page 1
Iranian Trichogramma: ITS2 DNA characterizationand natural Wolbachia infection
Nafiseh Poorjavad • Seyed H. Goldansaz •
Thijs Machtelinckx • Luc Tirry •
Richard Stouthamer • Thomas van Leeuwen
Received: 8 February 2011 / Accepted: 15 July 2011 / Published online: 6 August 2011
� International Organization for Biological Control (IOBC) 2011
Abstract Egg parasitoids of the genus Tricho-
gramma (Hymenoptera: Trichogrammatidae) are
important natural enemies of many lepidopterous pests
in agricultural and forest areas. Because the use of
indigenous Trichogramma populations/species can
significantly increase the biological control efficiency,
the characterization of endemic populations and pre-
cise species identification is important. In this study,
Trichogramma wasps were collected from parasitized
eggs of several lepidopteran pests in Northern and
Central Iran. Seven Trichogramma species were
identified based on the morphology and the nucleotide
sequence, size and restriction profile (PCR-RFLP)
of the internal transcribed spacer 2 (ITS2) region of
the rDNA of T. brassicae Bezdenko, T. cacoeciae
Marchal, T. embryophagum Hartig, T. evanescens
Westwood, T. euproctidis Girault, T. pintoi Voegele
and T. tshumakovae Sorokina. This is the first report of
T. euproctidis in Iran. Additionally, natural popula-
tions were surveyed for the prevalence of Wolbachia.
Two populations of T. brassicae were found to be
infected by a single Wolbachia strain which was
identified by using a multi-locus sequencing approach.
Keywords Hymenoptera � Trichogrammatidae �Endosymbiont � Egg parasitoids � Biological control
Introduction
The species of the genus Trichogramma (Hymenop-
tera: Trichogrammatidae) have been successfully
used for the biological control of lepidopteran pests
in stored products, economical important crops and
forest areas (Kot 1964; Li 1994). An important first
step for a successful biological control programme
is identifying the correct Trichogramma species
(Hassan 1994). However, this identification is difficult
due to the large number of species (about 200 species),
their small size (less than 1 mm in length) and the
lack of clear morphological characteristics (Pinto
et al. 1989; Pinto and Stouthamer 1994). Although
the male genitalia have been used for species
identification (Nagarkatti and Nagaraja 1971), routine
application of morphological identification of field
collected wasps is hampered by the frequent inci-
dence of female biased sex ratios and complete
female field populations (Huigens and Stouthamer
Handling Editor: Stefano Colazza
N. Poorjavad � S. H. Goldansaz (&)
Department of Plant Protection, University of Tehran,
P.O. Box 4111, Karaj, Iran
e-mail: [email protected]
T. Machtelinckx � L. Tirry � T. van Leeuwen
Laboratory of Agrozoology, Department of Crop
Protection, Ghent University, Coupure Links 653,
9000 Ghent, Belgium
R. Stouthamer
Department of Entomology, University of California,
Riverside, CA 92521, USA
123
BioControl (2012) 57:361–374
DOI 10.1007/s10526-011-9397-z
Page 2
2003; Pinto 1999; Vavre et al. 2004). Therefore,
recent taxonomic studies of Trichogramma spp. have
focused on molecular techniques. Stouthamer et al.
(1999b) successfully used DNA sequences of the
internal transcribed spacer (ITS2) regions of nuclear
rDNA as a general identification tool for Tricho-
gramma species. ITS2 is a highly conserved region
within species, but varies substantially between
species (Silva et al. 1999; Stouthamer et al. 1999b).
Consequently, several molecular keys for the biolog-
ical important Trichogramma species have been
developed based on the length, nucleotide sequence
and restriction fragment length polymorphism (PCR-
RFLP) analysis of the ITS2 sequences (Chang et al.
2001; Ciociola et al. 2001; Dang et al. 2005; Jeong
et al. 2010; Kumar et al. 2009; Pinto et al. 2002;
Sappal et al. 1995; Silva et al. 1999; Stouthamer et al.
1999b; Sumer et al. 2009; Thomson et al. 2003).
In some cases, the ITS2 sequence cannot differentiate
between species (Stouthamer et al. 2000), which
makes compatibility experiments based on the
biological species concept (Mayr 1942) necessary
(Gounou et al. 2008; Pinto et al. 1991, 1992; Pinto
and Stouthamer 1994, Rosen 1986).
Besides species identification, the success of egg
parasitoids in release programmes may also depend
on their mode of reproduction (Stouthamer et al.
1999a). The most common mode of reproduction in
Trichogramma wasps is arrhenotoky, in which unfer-
tilized eggs produce haploid males, and fertilized
eggs produce diploid females. To a lesser extent,
thelytokous parthenogenesis—females arise from
unfertilised eggs (Luck et al. 1992)—is also present.
Moreover, bacteria of the genus Wolbachia can cause
thelytoky (Stouthamer et al. 1999a) by aborting the
chromosome segregation during anaphase of the first
mitotic division. This induces diploidisation leading
to the development of completely homozygous
females (Stouthamer and Kazmer 1994). Wolbachia
is an a-proteobacteria living as an obligatory endo-
symbiont in numerous arthropods and filarial nema-
todes (Taylor and Hoerauf 1999; Werren 1997) in
which they alter the reproductive characteristics.
Wolbachia can induce cytoplasmic incompatibility
(Hoffmann and Turelli 1997; O’Neill and Karr 1990),
feminization of males (Juchault et al. 1992), thely-
tokous parthenogenesis (Louis et al. 1993; Stouth-
amer et al. 1993) or male killing (Hurst et al. 2000) in
its host. They can also strongly increase fecundity
(Girin and Bouletreau 1995; Vavre et al. 1999) or
have no obvious effect at all. Although usual
transmission of Wolbachia is vertical, from the
mother to her offspring through the eggs (Stouthamer
and Kazmer 1994), occasional horizontal transfers
between individuals have also been reported (Hui-
gens et al. 2000, 2004; Jager et al. 1998; Schilthuizen
and Stouthamer 1997).
Twenty Trichogramma species are known to be
completely or partly Wolbachia-infected. The endo-
symbiont can interfere with the reproduction by
increasing the fecundity and by inducing thelytoky
(Girin and Bouletreau 1995; Pintureau et al. 2000,
2002; Vavre et al. 1999). Because Wolbachia infec-
tion can have such as large impact on the wasp’s
fitness, knowledge of the infection status of a
population may have important implications for the
use of Trichogramma in biological control pro-
grammes (Hoffmann et al. 1990; Horjus and Stouth-
amer 1995; Stouthamer and Luck 1993; Stouthamer
et al. 1994).
In Iran, eleven Trichogramma species (T. brassi-
cae Bezdenko, T. cacoeciae Marchal, T. cordubensis
Vargas and Cabello, T. dendrolimi Matsumura,
T. embryophagum Hartig, T. evanescens Westwood,
T. pintoi Voegele, T. principium Sugonjaev and
Sorokina, T. semblidis Aurivillius and T. tshumako-
vae Sorokina) have been identified using morpholog-
ical characteristics and enzymatic analysis (Ebrahimi
1996; Ebrahimi et al. 1998; Shojai et al. 1988). Since
Iranian populations of Trichogramma have not been
studied using molecular techniques, no sequence
information is available of taxonomically important
genes such as ITS2.
Several molecular keys have been developed for
identification of Trichogramma species occurring in
different regions (Kumar et al. 2009; Silva et al.
1999; Sumer et al. 2009) or different crops (Pinto
et al. 2002). Characterization of ITS2 sequences of
Iranian Trichogramma populations is a prerequisite
for using the previously developed species identifi-
cation keys or constructing new ITS2-based keys for
the Iranian species. After extensive surveys to collect
different local populations, we identified Iranian
Trichogramma species using morphological and
molecular keys and developed an ITS2-database.
Furthermore, reproductive compatibility between
conspecific populations was studied to discover
potential cryptic species. In addition, the collected
362 N. Poorjavad et al.
123
Page 3
Trichogramma wasps were screened for the presence
of Wolbachia and when present the Wolbachia strain
was characterized by a standard multilocus sequence
typing (MLST) system (Baldo et al. 2006).
Materials and methods
Trichogramma collection
The parasitoids were obtained by collecting parasit-
ized eggs of different hosts in central and northern
parts of Iran from March 2008 to November 2009
(see Fig. 1). Natural parasitoid populations were
collected by inspecting moth eggs on fruits or foliage
in regions with no history of pesticide treatments or
Trichogramma release programmes. Hosts were identi-
fied by rearing the moth eggs from the same batch.
In forests, collections were made using trap-host
eggs of Ephestia kuehniella Zeller (Pyralidae) as
described in Pinto et al. (2002). Each parasitized card
was considered as the offspring of a single female in
our counts. Parasitized eggs were kept individually in
glass tubes until adult emergence.
Culture establishment
Single mated females emerging from collected eggs
were used to start isofemale lines on UV sterilised
eggs of E. kuehniella at 25 ± 1�C, 60–70% RH and
16:8 L:D conditions. A strip of diluted honey
(10%) was placed on the side of the vial to feed
adults. In this study, populations are defined as the
progeny from one egg batch collected of the same
species at the same location on the same day. Each
parasitoid population was reared in the laboratory
for at least six generations before crossing exper-
iments began.
Fig. 1 Map of Iran
showing the location where
the Trichogramma species
were collected. Numbers in
map refer to details of the
locations given in Table 2
Iranian Trichogramma 363
123
Page 4
Trichogramma identification
Males of each collection or F1 males emerged in the
laboratory were mounted on glass slides according to
Platner et al. (1999) and identified based on the
morphological key of Pintureau (2008). Voucher
specimens of all populations are deposited in the
Department of Applied Entomology of the University
of Tehran collection. Furthermore, several wasps
from isofemale line were kept in 96% ethanol at
-20�C for molecular identification based on ITS2
region.
DNA extraction
DNA was extracted from single ethanol preserved
wasps using the Chelex method (Walsh et al. 1991).
In summary, these wasps were first dried on tissue
paper and kept for 1 h in 1% TAE buffer (Tris–
acetate–EDTA, PH 8.0). The wasps were then ground
using a glass pestle in 60 ll of 5% Chelex-100
(Sigma Aldrich, Germany) and incubated with 4 ll
proteinase K (10 mg ml-1) for at least 2 h at 56�C.
Finally, the sample was incubated for 10 min at 95�C
to denaturate the proteinase K. Extracted samples
were stored at -20�C.
PCR and sequencing
PCR assays were carried out in 50 ll reactions
containing 2 mM MgCl2, 0.2 mM dNTP’s (Fermen-
tas), 0.2 lM of each primer (Table 1), 5 ll 109
PCR-buffer (Invitrogen), 5 ll template and 1 U Taq
DNA polymerase (Invitrogen). PCR cycling condi-
tions for the ITS2 fragment were: 3 min at 94�C, 35
cycles of 94�C for 45 s, 53�C for 45 s and 72�C for
45 s; and a final elongation step of 72�C for 3 min.
Additionally, in silico restriction digestion of the
ITS2 sequences was performed in accordance with
Sumer et al. (2009), in which the restriction enzymes
MseI, DraI and MnlI were used to distinguish
different Trichogramma species.
Wolbachia was detected using the wsp primers
(Table 1). PCR-conditions were: 3 min at 94�C,
35 cycles of 94�C for 20 s, 52�C for 30 s and 72�C
for 45 s; and a final extension step of 72�C for 3 min.
Table 1 Details of primers used for characterization of Trichogramma species and their Wolbachia
DNA region Primer Sequences (from 5’ to 3’) Product size (bp) References
ITS2 region ITS2 About 550 Stouthamer et al. (1999b)
Forward TGTGAACTGCAGGACACATG
Reverse GTCTTGCCTGCTCTGAG
wsp gene Wsp 590–632 Braig et al. (1998)
Forward TGGTCCAATAAGTGATGAAGAAAC
Reverse AAAAATTAAACGCTACTCCA
MLST loci gatB 471 Baldo et al. (2006)
Forward GAKTTAAAYCGYGCAGGBGTT
Reverse TGGYAAYTCRGGYAAAGATGA
coxA 487
Forward TTGGRGCRATYAACTTTATAG
Reverse CTAAAGACTTTKACRCCAGT
hcpA 515
Forward GAAATARCAGTTGCTGCAAA
Reverse GAAAGTYRAGCAAGYTCTG
ftsZ 524
Forward ATYATGGARCATATAAARGATAG
Reverse TCRAGYAATGGATTRGATAT
fbpA 509
Forward GCTGCTCCRCTTGGYWTGAT
ReverseA CCRCCAGARAAAAYYACTATTC
364 N. Poorjavad et al.
123
Page 5
Because the wsp-gene is prone to recombination
(Baldo et al. 2005), a Multi-Locus Sequence Typing
(MLST) was done to characterize Wolbachia. This
procedure uses five housekeeping genes to type a
Wolbachia strain, namely gatB (aspartyl/glutamyl-
tRNA amidotransferase, subunit B), coxA (cytochrome
c oxidase, subunit I), hcpA (conserved hypothetical
protein), ftsZ (cell division protein) and fbpA
(fructose-bisphosphate aldolase). Table 1 summa-
rizes the used primer pairs. These genes were
amplified using protocols described in Baldo et al.
(2006).
PCR-products were separated on a 1% agarose gel
in 0.59 TAE-buffer, visualized under UV-light and
purified using the E.Z.N.A.� Cycle Pure Kit (Omega
Bio-Tek). If necessary, the PCR products were cloned
into the pGEM-T vector (Promega) and transformed
into Escherichia coli DH5a cells. Plasmid DNA was
obtained by the E.Z.N.A. Plasmid Mini Kit I
(Omega Bio-Tek). PCR products and Plasmid DNA
were sequenced by LGC Genomics (Berlin, Germany).
Phylogenetic analysis
Homologous sequences of all five MLST genes were
retrieved for different arthropod species from the
National Centre for Biotechnology Information
(NCBI). The five genes were concatenated and
alignments were made by CLUSTALW as imple-
mented in BIOEDIT (Hall 1999). A rooted phyloge-
netic tree was constructed with Bayesian inference of
phylogeny using MRBAYES (version 3.1.2) (Huel-
senbeck and Roniquist 2001), using the Wolbachia of
Brugia malayi Brug (Onchocercidae) (Group D) as
the outgroup. Before carrying out the phylogenetic
analysis, an appropriate model of sequence evolution
was chosen using the Akaike Information Criterion in
MRMODELTEST v2.2 (Nylander 2004). The general
time reversible (GTR) ? I ? G model was used for
the concatenated MLST loci. The analysis consisted
of five million generations, with sampling every 100
generations. The first 12500 trees were considered the
‘burn-in’ and were removed.
Reproductive compatibility studies
Populations of T. embryophagum, T. evanescens and
T. brassicae collected from various hosts and places
were subjected to intra-species crossing experiments
in order to test whether they are reproductively
isolated. We followed the general procedures out-
lined by Pinto et al. (1991 and 2003). First, single
parasitized eggs were isolated in glass vials to ensure
emerged females were virgin. Two wasps emerging
from one egg (female and male) were not used to
prevent sib-mating, which is common in this genus
(Stouthamer et al. 2000). For each population, ten
virgin females were individually isolated to deter-
mine whether the females used in crosses were
arrhenotokous or thelytokous. Individuals used in all
crosses were \24 h old. A cross between two
arrhenotokous cultures (A and B) was performed
using 20 replicates of each heterogamic (between
population, A$ 9 B#; B$ 9 A#) and ten replicates
of each homogamic (within population, A$ 9 A#;
B$ 9 B#) combination as controls. The crosses were
conducted at 25 ± 1�C, 60–70% RH and 16:8 L:D on
E. kuehniella eggs (about 100 UV-sterilized eggs).
Adult parasitoids were fed with a 10% honey
solution. Three days after the first offspring emerged,
adult wasps were killed by placing them in the freezer
after which the number and sex of the offspring was
recorded. Only the offspring emerging the first
three days was used to avoid offspring of mothers
who ran out of sperm. In each cross the mean sex
ratio (MSR) was calculated as the female progeny
percentage. Two relative compatibility (RC) values
of a heterogamic cross (A 9 B) are expressed as
MSR (A$ 9 B#)/MSR (A$ 9 A#) and MSR
(B$ 9 A#)/MSR (B$ 9 B#). Furthermore, a mean
value was also determined. Relative compatibility
values \0.75 were used as evidence of partial
incompatibility, as suggested by Pinto et al. (1991).
Correlations between levels of compatibility and
geographic distance separating the origin of popula-
tions were calculated by the Spearman rank correla-
tion (SAS institute 1996).
Results
Trichogramma identification and distribution
A total of 302 parasitized eggs were collected from
different hosts and regions (Table 2). Using the
morphological key of Pintureau (2008) and ITS-2
sequences, seven Trichogramma species were found:
T. brassicae (fourteen populations), T. evanescens
Iranian Trichogramma 365
123
Page 6
(ten populations), T. euproctidis Girault (two
populations), T. embryophagum (four populations),
T. cacoeciae (one population), T. pintoi (two popu-
lations) and T. tshumakovae (one population).
The ITS2 sequences that we obtained from each
species were (96–100% Max Ident score in BLAST)
similar to those present in GenBank. Populations of
T. evanescens can be separated into two groups
Table 2 Geographic origin, host and the number of collected Trichogramma wasps
Name of species Geographic origin (latitude, longitude) Numberb nc Host
T. brassicae (203)a Sangtop (36.55212N, 52.330627E) 1 50 Ostrinia nubilalis on Xanthium sp.
Kasgarmahal (36.533916N, 51.933746E) 2 13 Chilo suppressalis on Oryza sativa
Lekode (36.521777N, 52.277069E) 3 6 O. nubilalis on Xanthium sp.
Rasht (37.259572N, 49.536324E) 4 3 C. suppressalis on O. sativa
Sote (36.64611N, 52.540741E) 5 9 C. suppressalis on weed
Tonekabon (36.815881N, 50.873566E) 6 6 C. suppressalis on O. sativa
Varaz deh (36.452218N, 52.2000165E) 7 4 C. suppressalis on O. sativa
Hosein abad (36.51957N, 52.26059E) 8 39 C. suppressalis on O. sativa
Sharam kala (36.536123N, 52.441177E) 9 51 C. suppressalis on O. sativa
Taleb amoli (36.619386N, 52.265396E) 10 7 C. suppressalis on O. sativa
Gand yab (36.539433N, 52.036228E) 11 4 O. nubilalis on Xanthium sp.
Posht nesha (37.374523N, 49.888916E) 12 2 C. suppressalis on weed
Velisde (36.458983N, 52.271404E) 13 6 C. suppressalis on O. sativa
Chaboksar (36.95291N, 50.541573E) 14 3 C. suppressalis on O. sativa
T. cacoeciae (6)a Qum (34.657569N, 50.911589E) 15 6 Ectomyelois ceratoniaeon Punica granatum
T. evanescens (46)a Aktij mahale (36.559015N, 52.667942E) 16 12 O. nubilalis on X. sp.
dasht-naz sari (36.662636N, 53.262749E) 17 10 O. nubilalis on Zea mays
Gorgan (36.82234N, 54.425583E) 18 3 C. suppressalis on O. sativa
Salma, Gorgan (36.913666N, 54.574585E) 19 3 C. suppressalis on O. sativa
Semnan (35.57943N, 53.387547E) 20 3 E. ceratoniae on P. Granatum
Keteshest (37.213925N, 49.850464E) 21 2 C. suppressalis on O. sativa
Bishe kala (36.660432N, 52.376289E) 22 9 O. nubilalis on X. sp.
Qum (34.670488N, 50.887642E) 23 1 E. ceratoniae on P. granatum
Nokade (36.249672N, 53.369865E) 24 2 O. nubilalis on X. sp.
Shiraz (29.773914N, 52.715149E) 25 1 E. ceratoniae on P. granatum
T. embryophagum (25)a Saryazd (31.35636N, 54.29777E) 26 6 E. ceratoniae on P. granatum
Ashkezar (31.56531N, 54.10496E) 27 6 E. ceratoniae on P. granatum
Varamin (35.357696N, 51.992798E) 28 8 E. ceratoniae on P. granatum
Neyriz (29.11293N, 54.16 297E) 29 5 E. ceratoniae on P. granatum
T. euproctidis (13)a Nahalestan (35.483005N, 50.58534E) 30 7 P. brassicae & P. xylostellaon Brassica oleracea
Golestanak (35.774372N, 50.904465E) 31 6 P. brassicae & P. xylostellaon B. oleracea
T. pintoi (3)a Ghochhesar (35.546195N, 51.441422E) 32 2 P. brassicae on B. oleracea
Charbagh (36.032442N, 50.565948E) 33 2 P. brassicae on B. oleracea
T. tshumakovae (5)a Kheyrod (36.584658N, 51.556091E) 34 5 Egg trap in forest
a Total number of collected eggs parasitized by Trichogramma spp.b Number in map (Fig. 1)c Number of collected wasps
366 N. Poorjavad et al.
123
Page 7
based on the ITS2 alignment (Fig. 2). The ITS2
sequence of T. tshumakovae was not available in
GenBank and could not be identified using existing
molecular keys. Forty ITS2 sequences identified in
this study were deposited on GenBank (accession
numbers JF920421–JF920460). The deposited sequences
are complete ITS2 sequences plus flanking
sequences of 5.8S and 28S. These sequences showed
low intraspecific variability in length (3–18 bases)
while displaying significant interspecies differences.
Reproductive compatibility studies
Relative compatibility values for crosses between
different populations of T. evanescens, T. brassicae
and T. embryophagum are presented in Table 3.
Although populations of T. evanescens were separated
into two groups based on ITS2 region sequences,
crosses between all populations were at least partially
compatible as indicated by their RC values (RC C
0.45). In T. brassicae and T. embryophagum, the RC
values of heterogamic crosses ranged between
0.54–0.81 and 0.34–1.22, respectively. Also, homoga-
mic crosses produced more female progeny than
heterogamic crosses within species in all crossing
experiments except in a few crosses in T. embryopha-
gum. In addition, levels of compatibility in T. brass-
icae were significantly correlated with geographic
distance (n = 3, r = -1.00, P = 0.0001).
Prevalence and characterization of the associated
Wolbachia strain
A PCR assay was carried out to detect Wolbachia in
seven species of Trichogramma. In total, 268 indi-
vidual collected wasps from 34 populations were
tested, but infection was only detected in two
populations of T. brassicae. The Wolbachia found
in these populations was identical as determined by
the sequences of the wsp gene and the genes used in
the MLST. Moreover, all 40 tested individuals of
these two populations were infected and reproduced
via thelytokous parthenogenesis in the laboratory.
Since these two populations were infected with the
same Wolbachia strain, we used only one of them in
the phylogenetic analysis based on MLST loci. This
Wolbachia strain was classified in supergroup B
(Fig. 3) and was phylogenetically closely related to
the Wolbachia strain of T. deion. The sequences for
the MLST loci have been deposited in GenBank
under the accession numbers JF920461–JF920472.
Discussion
Seven Trichogramma species were identified in this
field survey. To our knowledge, this is the first report
of T. euproctidis in Iran. The observed natural
parasitism rates by Trichogramma were low (2–5%)
in our collection areas. Trichogramma brassicae was
T_eva1 1 TTATAAAAACGAACCCGACTGCTCTCTCGCAAGAGAGAGCGTTGATCTGGGCGCTCGTCT T_eva2 1 ............................................................
T_eva1 61 CTATCTCTATGCGC--GCGCGCGCGCGCTCTTTCTTCTATTTTCGTAGAGAGAGAG---- T_eva2 61 ..............--T.......................--..............AGAG
T_eva1 115 TGCGCGAGAGCGTGCGTGTAGCAGTGTGACACGTCGCCTCAAACGAAACGCAAGAAAAAA T_eva2 117 ..........T......--................C........................
T_eva1 175 GATGAATTCGTTCGTCTAGCTGGCGCGCGCGCTTACCGCTTGGAGAGTACGTCAGTACTT T_eva2 175 .................G..........................................
T_eva1 235 CCGATCGTTCTGCGTCGAGTCCCGGAGCTTTCTCGACTCGTCGAGCAGCGGACCGACGTC T_eva2 235 ..........................T..............................A..
T_eva1 295 TAGCACACGATCAGGCTCGTCCATGCATCGGTCATTGAACGCGCGCGCGCGCTCGTGCTC T_eva2 295 ............................................................
T_eva1 355 TCTTTTGTTTTAACGAACGAAAGTAGGGGTGTAACGACGGCTAGCTCGAAGCTTTTTGCG T_eva2 355 ...........................----...................T.........
T_eva1 415 CTGAACGAGTCTTTTTTCTCGA T_eva2 411 ........T.............
Fig. 2 Aligned sequences
of ITS2 of T. evanescenspopulations. Group 1
(T_eva1) including Nokade,
Dasht-naz, Semnan, Qum
and Keteshest populations;
group 2 (T_eva2) including
Shiraz, Salma-gorgan,
Bishe-kala and Aktij-
mahale populations. Dots
indicate identical
nucleotides and dashes
indicate insertions/
deletions. Numbers indicate
the position in the aligned
sequence
Iranian Trichogramma 367
123
Page 8
Table 3 Relative compatibility (RC) values for crosses between different T. evanescens, T. brassicae and T. embryophagumpopulations
Name of species Heterogamic
cross
Proportion of
females(a) ± SE
Homogamic
cross
Proportion of
females(b) ± SE
Relative
compatibility(a/b)
Mean
RC
T. evanescens Gor$ 9 Ket# 31 ± 5 Gor 9 Gor 70 ± 10 0.44 0.45
Ket 9 Ket 67 ± 8 0.46
Ket$ 9 Gor# 48 ± 9 Gor 9 Gor 70 ± 10 0.68 0.70
Ket 9 Ket 67 ± 8 0.72
Das$ 9 Gor# 43 ± 7 Das 9 Das 76 ± 7 0.56 0.58
Gor 9 Gor 70 ± 10 0.61
Gor$ 9 Das# 49 ± 8 Das 9 Das 76 ± 7 0.64 0.67
Gor 9 Gor 70 ± 10 0.70
T. brassicae Sot$ 9 Ras# 47 ± 9 Sot 9 Sot 78 ± 12 0.60 0.62
Ras 9 Ras 73 ± 7 0.64
Ras$ 9 Sot# 44 ± 9 Sot 9 Sot 78 ± 12 0.56 0.58
Ras 9 Ras 73 ± 7 0.60
Sot$ 9 Ton# 46 ± 9 Sot 9 Sot 78 ± 12 0.59 0.70
Ton 9 Ton 57 ± 11 0.81
Ton$ 9 Sot# 42 ± 8 Sot 9 Sot 78 ± 12 0.54 0.64
Ton 9 Ton 57 ± 11 0.74
Pos$ 9 Ton# 42 ± 8 Pos 9 Pos 64 ± 6 0.66 0.70
Ton 9 Ton 57 ± 11 0.74
Ton$ 9 Pos# 42 ± 8 Pos 9 Pos 64 ± 6 0.66 0.70
Ton 9 Ton 57 ± 11 0.74
T. embryophagum Ash$ 9 Sar# 70 ± 12 Ash 9 Ash 71 ± 13 0.98 0.99
Sar 9 Sar 70 ± 7 1
Sar$ 9 Ash# 60 ± 11 Ash 9 Ash 71 ± 13 0.84 0.85
Sar 9 Sar 70 ± 7 0.86
Ash$ 9 Var# 87 ± 15 Ash 9 Ash 71 ± 13 1.22 1.13
Var 9 Var 83 ± 7 1.05
Var$ 9 Ash# 73 ± 9 Ash 9 Ash 71 ± 13 1.03 0.95
Var 9 Var 83 ± 7 0.88
Ash$ 9 Ney# 42 ± 8 Ash 9 Ash 71 ± 13 0.59 0.65
Ney 9 Ney 58 ± 11 0.72
Ney$ 9 Ash# 46 ± 9 Ash 9 Ash 71 ± 13 0.65 0.72
Ney 9 Ney 58 ± 11 0.79
Ney$ 9 Var# 28 ± 4 Ney 9 Ney 58 ± 11 0.48 0.41
Var 9 Var 83 ± 7 0.34
Var$ 9 Ney# 29 ± 4 Ney 9 Ney 58 ± 11 0.5 0.42
Var 9 Var 83 ± 7 0.35
Ney$ 9 Sar# 61 ± 6 Ney 9 Ney 58 ± 11 1.05 0.96
Sar 9 Sar 70 ± 7 0.87
Sar$ 9 Ney# 66 ± 7 Ney 9 Ney 58 ± 11 1.14 1.04
Sar 9 Sar 70 ± 7 0.94
Sar$ 9 Var# 40 ± 6 Sar 9 Sar 70 ± 7 0.57 0.52
Var 9 Var 83 ± 7 0.48
Var$ 9 Sar# 33 ± 5 Sar 9 Sar 70 ± 7 0.47 0.43
Var 9 Var 83 ± 7 0.40
Gor Gorgan (group 2 of T. evanescens), North Iran, Ket Keteshest (group 1 of T. evanescencs), North Iran, Das Dasht-Naz (group 1 of T. evanescens),
North Iran, Sot Sote, North Iran, Ras Rasht, North Iran, Ton Tonekabon, North Iran, Pos Posht Nesha, North Iran, Ash Ashkezar, Central Iran, SarSaryazd, Central Iran, Var Varamin, Central Iran, Ney Neyriz, Central Iran
368 N. Poorjavad et al.
123
Page 9
the dominant species in this survey with fourteen
different populations, collected from Asiatic rice
borer, Chilo suppressalis Walker (Crambidae), eggs
infesting rice fields in Northern Iran. Although maize
farms and citrus orchards were surveyed, this species
only was found in rice fields. According to Pintureau
(2008), this species has been collected from eggs of
several farm and orchard crop pests such as Scrobi-
palpa ocellatella Boyd (Gelechiidae), Helicoverpa
armigera Hubner, Mamestra brassicae L. (Noctui-
dae), Cydia pomonella L. and Lobesia botrana Denis
and Schiffermuller (Tortricidae). The second most
common species, T. evanescens, was collected from
Ostrinia nubilalis Hubner eggs (Crambidae) and
C. suppressalis in maize and rice fields in Northern
Iran, respectively. It was also collected from eggs of
the carob moth, Ectomyelois ceratoniae Zeller
(Pyralidae), in pomegranate orchards of central Iran.
This species has been extensively used in inundative
release programmes against the European corn borer,
O. nubilalis (Hafez et al. 1999) and the grape moth
L. botrana (Barnay et al. 2001) in Germany and
France, respectively. It has also been reported from
pomegranate orchards in Tunisia (Ksentini et al.
2010). We also collected T. embryophagum and
T. cacoeciae from E. ceratoniae eggs in pomegranate
orchards. These Trichogramma species are known to
mainly occur in orchards and forests (e.g., Pintureau
1997; Breedveld and Tanigoshi 2007).
Trichogramma pintoi and T. euproctidis were
collected in cabbage farms in central Iran on Pieris
brassicae L. (Pieridae) and Plutella xylostella L.
(Plutellidae) eggs. Trichogramma pintoi has been
reported from Euproctis chrysorrhoea L. (Lymantrii-
dae), Agrotis segetum Denis and Schiffermuller,
H. armigera, M. brassicae, Plusia sp. Ochsenheimer
(Noctuidae), O. nubilalis, C. pomonella, L. botrana
(Tortricidae), Prays oleae Bernard (Yponomeutidae),
P. brassicae (Pieridae), Cassida nebulosa L. (Chryso-
melidae) and Acantholyda posticalis Matsumura
(Pamphiliidae) eggs (Ebrahimi et al. 1998; Fursov
1995; Nagarkatti and Nagaraja 1971, 1977; Pinto
1999; Pintureau and Babault 1988). Also, T. eu-
proctidis has been reported as an egg parasitoid on
Euproctis chrysorrhoea, H. armigera, Sesamia non-
agrioides Lefebvre (Noctuidae), Chilo agamemnon
Bleszynski (Pyralidae), Agrius convolvuli L. (Sphin-
gidae), Epichoristodes acerbella Walker (Tortrici-
dae) and P. brassicae (Hansen 2000; Neto and
Pintureau 1995; Pintureau et al. 2003; Rohi and
Pintureau 2003). Trichogramma tshumakovae was
collected in Northern Iranian forests by using egg trap
cards (Table 2). This species have been reported from
Iran (Ebrahimi et al. 1998) and Kirgistan (Sorokina
1984) on M. brassicae and C. suppressalis, respec-
tively. There is no information about ITS2 sequences
and biology of this species in literature.
Based on the DNA sequences of the species found in
Iran, the key for the Mediterranean Trichogramma
species (Sumer et al. 2009) would correctly identify all
the species we discovered in Iran with the exception of
T. tshumakovae. Using this key, the T. tsumakovae
individuals would be misidentified as T. evanescens.
However, based on the single ITS2 sequence of
T. tsumakovae, we would be able to distinguish it
from T. evanescens in that the largest band following
digestion with Mnl1 would be *460 bp, while for
T. evanescens it is only *300 bp. Furthermore, EcoRI
would cut both species in two fragments. Two clearly
different bands with sizes of 236 and 307 bp would be
visible for T. tshumakovae, but for T. evanescens the
two bands are very similar (270, 282 bp) by which only
a single band would be visible on the gel. However,
more collections of T. tshumakovae are needed to
confirm this.
The relationship between the species T. embryo-
phagum and T. cacoeciae is still ambiguous: ITS2
sequences of previously found populations of both
species do not differ, and although the males are
distinguishable (Pintureau 2008), determination is
difficult due to the rarity of T. cacoeciae males
(Stouthamer et al. 1990). If isofemale lines of these
species are available the distinction can be made
quite easily. Trichogramma cacoeciae reproduces by
thelytoky where males are not produced following
antibiotic treatments, while T. embryophagum repro-
duces either by arrhenotoky or, if thelytokous, males
can be obtained by antibiotic treatment (Stouthamer
et al. 1990). Similarly, a thelytokous and an arrhe-
notokous form are known in Lysiphlebus fabarum
Marshall (Braconidae). Recently, Sandrock and
Vorburger (2011) showed that the thelytoky in this
species is not microbe induced, rather thelytoky is
caused by a single recessive allele. The rare males
from the thelytokous form can pass the allele on by
mating with arrhenotokous females. It would be
interesting to determine if this is also the case in these
two species.
Iranian Trichogramma 369
123
Page 10
The role of cross mating data in taxonomic
classification depends on the potential (in)compati-
bilities between populations (Pinto et al. 1991, 1992;
Stouthamer et al. 2000). Reproductive incompatibil-
ity in Trichogramma species has been reported to be
correlated with differences in morphology and ITS2
sequence (Stouthamer et al. 2000). In this study, all
intra-species crosses were at least partially compat-
ible, observing RC levels ranging from 0.41 to 1.13.
Different selection pressures and/or adaptation to
local environments may result in populations with
various levels of reproductive compatibility, biolog-
ical traits and genetic variability (Diehl and Bush
1984; Hopper et al. 1993). Because there were slight
0.1
Brugia malayi
Cimex lectularius
Armadillidium vulgare
Lissorhoptrus oryzophilus
Nilaparvata muiri
Nasonia vitripennis
Gryllus firmus
dryinid wasps
Polistes fuscatus
Ephestia kuehniella
Culex quinquefasciatus0.95
0.51
Calyptratae sp.
Azanus mirza
Nacaduba angusta
1.00
0.99
Encarsia formosa
Trichogramma deion
Trichogramma brassicae1.00
0.87
1.00
0.87
Chloropidae sp.
Pityogenes chalcographus0.98
0.87
Acraea encedon
Tribolium confusum
Drosophila simulans0.61
Laodelphax striatellus
Sogatella furcifera
Laodelphax striatellus
1.00
0.88
0.74
0.87
0.95
1.00
Aedes albopictus
Nasonia giraulti
Drosophila melanogaster
Muscidifurax uniraptor1.00
0.97 1.00
1.00
D
F
B
A
Fig. 3 Bayesian likelihood inference phylogeny based on the
concatenated data set for the five MLST loci (29 strains,
2079 bp). Names correspond to the host species and the
isolated strain is in bold letters. The uppercase letters represent
the different supergroups of Wolbachia. Posterior probabilities
supporting nodes ([0.50) are shown
370 N. Poorjavad et al.
123
Page 11
differences in ITS2 sequences between different
populations of T. evanescens (group 1: Nokade,
Dasht-naz, Semnan, Qum and Keteshest populations;
group 2 including Shiraz, Salma-gorgan, Bishe-kala
and Aktij-mahale populations), the crossing experi-
ments were very useful in showing that they can
interbreed and consequently are the same species.
Slight differences in ITS2 sequences have been found
within other Trichogramma species as well (Stouth-
amer et al. 1999).
All field collected populations had a female-biased
progeny when reared in the laboratory. However, two
Wolbachia-infected T. brassicae populations and one
uninfected T. cacoeciae population reproduced by
thelytokous parthenogenesis. Thelytoky in T. cacoe-
ciae has a genetic cause and is not associated with
microbial infection (Pintureau et al. 1999; Vavre
et al. 2004). Thelytoky in Iranian T. brassicae was
earlier reported by Farrokhi et al. (2010) to be
associated with Wolbachia infection. Similarly, we
found that all tested individuals on these two
populations were infected with Wolbachia, which is
commonly found in thelytokous Trichogramma
(Huigens and Stouthamer 2003; Pintureau et al. 2002).
The involvement of Wolbachia in causing thelytoky
in this T. brassicae is very likely although antibiotic
experiments to confirm this remain to be performed.
The phylogeny of Wolbachia has already been
studied extensively using a number of different gene
sequences (e.g., Braig et al. 1998; Pintureau et al.
2002; Rousset et al. 1992; Schilthuizen and Stouth-
amer 1997; van Meer et al. 1999). Although the wsp-
gene seemed satisfactory at associating the Wolbachia
effect with their phylogenetic position (Pintureau et al.
2002), the extensive recombination and strong diver-
sifying selection of the wsp gene make it an unreliable
tool for the characterization of Wolbachia (Baldo et al.
2002, 2005; Jiggins et al. 2002; Werren and Bartos
2001). Therefore, an MLST procedure has been
developed (Baldo et al. 2006), which uses five genes
to type a specific Wolbachia strain.
The phylogenetic tree based on the concatenated
MLST loci showed that the Wolbachia strain of
T. brassicae belonged to supergroup B and was
phylogenetically closely related to the Wolbachia of
T. deion, which is also known to induce thelytoky in its
host (Pintureau et al. 2002, Vavre et al. 1999). Within
the Wolbachia phylogeny, strains found in Trichogram-
ma form a monophyletic group (Stouthamer et al. 1999).
In conclusion, we found that Iranian and Mediter-
ranean Trichogramma populations have very similar
ITS2 sequences and the molecular key developed for
the Mediterranean region can be successfully used
for identification of Iranian species, except for
T. tshumakovae. The intra-species crosses confirmed
the morphological and molecular identification of the
species. Although two slightly different ITS2 variants
were detected in T. evanescens, crosses between these
two variants were still compatible and the relative
compatibility indices found within crosses involving
the different variants of T. evanescens were within
the range found in the other two species.
Wolbachia bacteria have infected some popula-
tions of T. brassicae collected from Northern Iran and
belong to group B. As Wolbachia-infected thelytok-
ous strain exists for T. brassicae—the most wide-
spread and dominant species in Northern Iran in our
study—it offers a considerable potential for biolog-
ical control of Lepidopteran pests in this region. The
use of thelytokous T. brassicae populations may be a
powerful biological control agent after complemen-
tary studies confirm its biological control potential
compared to conspecific arrhenotokous populations
in the laboratory and the field.
Acknowledgments We are grateful to Dr. Bernard Pintureau
in (INRA/INSA) France for morphological identifying
Trichogramma samples. Thijs Machtelinckx is supported by
grant number SB-73469 from the Institute for the Promotion of
Innovation through Science and Technology in Flanders (IWT-
Vlaanderen). Thomas Van Leeuwen is a post-doctoral fellow
of the Research Foundation Flanders (FWO).
References
Baldo L, Bartos JD, Werren JH, Bazzocchi C, Casiraghi M,
Panelli S (2002) Different rates of nucleotide substitutions
in Wolbachia endosymbionts of arthropods and nema-
todes: arms race or host shifts? Parasitologia 44:179–187
Baldo L, Lo N, Werren JH (2005) Mosaic nature of wsp(Wolbachia surface protein). J Bacteriol 187:5406–5418
Baldo L, Dunning Hotopp JC, Jolley KA, Bordenstein SR,
Biber SA, Choudhury RR, Hayashi C, Maiden MCJ,
Tettelin H, Werren JH (2006) Multilocus sequence typing
system for the endosymbiont Wolbachia pipientis. Appl
Environ Microb 72(11):7098–7110
Barnay O, Hommay G, Gertz C, Kienlen JC, Schubert G,
Marro JD, Pizzol J, Chavigny P (2001) Survey of natural
populations of Trichogramma (Hym., Trichogrammati-
dae) in the vineyards of Alsace (France). J Appl Entomol
125:469–477
Iranian Trichogramma 371
123
Page 12
Braig HR, Zhou W, Dobson S, O’Neill SL (1998) Cloning and
characterization of a gene encoding the major surface
protein of the bacterial endosymbiont Wolbachia. J Bac-
teriol 180:2373–2378
Breedveld KGH, Tanigoshi LK (2007) Seasonal phenology of
Enarmonia formosana (Lepidoptera: Tortricidae) and egg
parasitism by Trichogramma cacoeciae (Hymenoptera:
Trichogrammatidae) in Washington State, USA. J Pest Sci
80:15–19
Chang SC, Hu NT, Hsin CY, Sun CN (2001) Characterization
of differences between two Trichogramma wasps by
molecular markers. Biol Control 21:75–78
Ciociola AI, Zucchi RA, Stouthamer R (2001) Molecular key to
seven Brazilian species of Trichogramma (Hymenoptera:
Trichogrammatidae) using sequences of the ITS2 region
and restriction analysis. Neotrop Entomol 30(2):259–262
Dang XL, Wen SY, He XF, Pang XF (2005) M-PCR:
a powerful method for rapid molecular identification of
Trichogramma wasps. J Insect Sci 12:77–85
Diehl SR, Bush GL (1984) An evolutionary and applied per-
spective of insect biotypes. Ann Rev Entomol 29:471–483
Ebrahimi E (1996) The species of Trichogramma Westwood in
Iran. (Abstract 20-102). In: Proceeding XX international
congress of entomology, Firenze, Italy, p 639
Ebrahimi D, Pintureau B, Shojai M (1998) Morphological
and enzymatic study of the genus Trichogramma (Hym.
Trichogrammatidae) in Iran. J Appl Entomol Phytopha-
thol 66:122–141
Farrokhi S, Ashouri A, Shirazi J, Allahyari H, Huigens ME
(2010) A comparative study on the functional response of
Wolbachia-infected and uninfected forms of the parasitoid
wasp Trichogramma brassicae. J Insect Sci 10:167
Fursov V (1995) The taxonomic control of Trichogrammaproduction in Ukraine. In: Wajnberg E (ed) Trichogram-ma and other egg parasitoids. Les Colloques de l’INRA,
vol 73, pp 19–21
Girin C, Bouletreau M (1995) Microorganism-associated
variation in host infection efficiency in parasitoid wasp
Trichogramma bourarachae (Hymenoptera: Trichogram-
matidae). Experientia 52:398–401
Gounou S, Chabi-Olaye A, Poehling HM, Schulthess F (2008)
Reproductive compatibility of several East and West
African Cotesia sesamiae (Hymenoptra: Braconidae)
populations and their crosses and backcrosses using
Sesamia calamistis (Lepidoptera: Noctuidae) as the host.
Biocontrol Sci Techn 18(3):255–266
Hafez MB, Schmitt A, Hassan SA (1999) The side effects of
plant extracts and metabolites of Reynoutria sachalinensis(F. Schmidt) Nakai and conventional fungicides on the
beneficial organism Trichogramma cacoeciae Marchal
(Hym., Trichogrammatidae). J Appl Entomol 123:363–368
Hall TA (1999) BioEdit: A user-friendly biological sequence
alignment and analysis program for Windows 95/98/NT.
Nucleic Acids Symp Ser 41:95–98
Hansen LS (2000) Development time and activity threshold of
Trichogramma turkestanica on Ephestia kuehniella in
relation to temperature. Entomol Exp Appl 96:185–188
Hassan SA (1994) Strategies to select Trichogramma species
for use in biological control. In: Wajnberg E, Hassan SA
(eds) Biological control with egg parasitoids. CAB
International, Wallingford, pp 55–71
Hoffmann AA, Turelli M (1997) Cytoplasmic incompatibility
in insects. In: O’Neill SL, Hoffmann AA, Werren JH (eds)
Influential passengers: inherited microorganisms and
arthropod reproduction. Oxford University Press, Oxford,
pp 42–80
Hoffmann AA, Turelli M, Harshman LG (1990) Factors
affecting the distribution of cytoplasmic incompatibility
in Drosophila simulans. Genetics 126:933–948
Hopper KR, Roush RT, Powell W (1993) Management of
genetics of biological control introductions. Ann Rev
Entomol 38:27–51
Horjus M, Stouthamer R (1995) Does infection with thelytoky
causing Wolbachia in pre-adult and adult life stages
influence the adult fecundity of Trichogramma deion and
Muscidifurax uniraptor? Proc Exp Appl Entomol 6:35–40
Huelsenbeck JP, Roniquist F (2001) MRBAYES: Bayesian
inference of phylogenetic trees. Bioinformatics 17:754–755
Huigens ME, Stouthamer R (2003) Parthenogenesis associated
with Wolbachia. In: Bourtzis K, Miller TA (eds) Insect
symbiosis. CRC Press, Boca Raton, pp 247–266
Huigens ME, Luck RF, Klaassen RHG, Maas MFPM, Tim-
mermans MJTN, Stouthamer R (2000) Infectious parthe-
nogenesis. Nature 405:178–179
Huigens ME, Almedia RP, Boons PAH, Luck RF, Stouthamer
R (2004) Natural intraspecific and interspecific horizontal
transfer of parthenogenesis-inducing Wolbachia in
Trichogramma wasps. Proc R Soc Lond 271:509–515
Hurst GDD, Johnson AP, Schulenburg JH, Fuyama Y (2000)
Male killing Wolbachia in Drosophila: a temperature-
sensitive trait with a threshold bacterial density. Genetics
156:699–709
Jager CR, Pintureau B, Heddi A (1998) Comparison between
phylogenetic trees of some Trichogramma species and their
Wolbachia endosymbionts. Russ Entomol J 7:163–168
Jeong G, Kim H, Chio Y, Kim W, Park K, Bae S, Kim J, Choi J
(2010) Molecular identification of two Trichogrammaspecies (Hymenoptera: Trichogrammatidae) in Korea.
J Asia Pac Entomol 13:41–44
Jiggins FM, Hurst GD, Yang Z (2002) Host-symbiont conflicts:
positive selection on an outer membrane protein of parasitic
but mutualistic Rickettsiaceae. Mol Biol Evol 19:1341–1349
Juchault P, Rigaud GT, Mocquard JP (1992) Evolution of sex
determining mechanisms in a wild population of Armadil-lidium vulgare (Crustacea, Isopoda): competition between
two feminizing parasite sex factors. Heredity 69:382–390
Kot J (1964) Experiments in the biology and ecology of species
of the genus Trichogramma Westw. and their use in plant
protection. Ekol Pol Ser A 12:243–303
Ksentini I, Monje JC, Jardak T, Zeghal N (2010) Naturally
occurring egg parasitoids of the genus Trichogramma(Hymenoptera: Trichogrammatidae) in a pomegranate
orchard in Tunisia. J Entomol Sci 13:99–106
Kumar GA, Jalali SK, Venkatesan T, Stouthamer R, Niranjana
P, Lalitha Y (2009) Internal transcribed spacer-2 restric-
tion fragment length polymorphism (ITS-2-RFLP) tool to
differentiate some exotic and indigenous Trichogramma-
tid egg parasitoids in India. Biol Control 49:207–213
Li YL (1994) Worldwide use of Trichogramma for biological
control on different crops: a survey. In: Wajnberg E,
Hassan SA (eds) Biological control with egg parasitoids.
CAB international, Wallingford, pp 37–53
372 N. Poorjavad et al.
123
Page 13
Louis C, Pintureau B, Chapelle L (1993) Recherches sur
l’origine de l’unisexualite : la thermotherapie elimine a la
fois rickettsies et parthenogenese thelytoque chez un
Trichogramme (Hym., Trichogrammatidae). Comptes
Rendus de l’Academie des Sciences de Paris Serie III
316:27–33
Luck RF, Stouthamer R, Nunney L (1992) Sex determination
and sex ratio patterns in parasitic hymenoptera. In:
Wrench DL, Ebbert MA (eds) Evolution and diversity of
sex ratio in haplodiploid insect and mites. Chapman and
Hall, New York, pp 442–476
Mayr E (1942) Systematics and the origin of species, from the
viewpoint of a zoologist. Harvard University Press,
Cambridge
Nagarkatti S, Nagaraja H (1971) Redescription of some known
species of Trichogramma, showing the importance of male
genitalia as a diagnostic character. Bull Entomol Res
61:13–31
Nagarkatti S, Nagaraja H (1977) Biosystematics of Tricho-gramma and Trichogrammatoidea species. Ann Rev
Entomol 22:157–176
Neto L, Pintureau B (1995) Taxonomic study of a population
of Trichogramma turkestanica discovered in southern
Portugal (Hymenoptera: Trichogrammatidae). Ann Soc
Entomol Fr 31:21–30
Nylander JAA (2004) Bayesian phylogenetics and the evolu-
tion of gall wasps. Comprehensive Summaries of Uppsala
Dissertations from the Faculty of Science and Technol-
ogy, ISSN 1104-232X, p 937
O’Neill SL, Karr T (1990) Bidirectional incompatibility
between conspecific populations of Drosophila simulans.
Nature 348:178–180
Pinto JD (1999) The systematic of the North American species
of Trichogramma. Memoirs Entomol Soc Wash no 22
(1998), p 287
Pinto JD, Stouthamer R (1994) Systematics of the Tricho-
grammatidae with emphasis on Trichogramma. In: Wa-
jnberg E, Hassan SA (eds) Biological control with egg
parasitoids. CAB International, Wallingford, pp 1–36
Pinto JD, Velten RK, Platner GR, Oatman ER (1989) Pheno-
typic plasticity and characters in Trichogramma. Ann
Entomol Soc Am 85:413–422
Pinto JD, Stouthamer R, Platner GR, Oatman ER (1991)
Variation in reproductive compatibility in Trichogrammaand its taxonomic significance (Hymenoptera: Tricho-
grammatidae). Ann Entomol Soc Am 84:37–46
Pinto JD, Kazmer DJ, Planter GR, Sassaman CA (1992) Tax-
onomy of the Trichogramma minutum complex (Hyme-
noptra: Trichogrammatidae): allozymic variation and its
relationship to reproductive and geographic data. Ann
Entomol Soc Am 85:413–422
Pinto JD, Koopmanschap AB, Platner GR, Stouthamer R (2002)
The North American Trichogramma (Hymenoptera: Tricho-
grammatidae) parasitizing certain Tortricidae (Lepidoptera)
on apple and pear, with ITS2 DNA characterizations and
description of a new species. Biol Control 23:134–142
Pinto JD, Platner GR, Stouthamer R (2003) The systematic of
the Trichogramma minutum species complex (Hymenop-
tera: Trichogrammatidae), a group of important North
American biological control agents: the evidence from
reproductive compatibility and allozymes. Biol Control
27:167–180
Pintureau B (1997) Systematic and genetical problems revised
in two closely related species of Trichogramma, T. em-bryophagum and T. cacoeciae (Hym., Trichogrammati-
dae). Miscellania Zoologica 20:11–18
Pintureau B (2008) Les especes europeennes de Tricho-
grammes. InLibroVeritas, Cergy-Pontoise
Pintureau B, Babault M (1988) Systematique des especes af-
ricaines des genres Trichogramma Westwood et Tricho-grammatoidea Girault (Hym. Trichogrammatidae). Les
Colloques de l’INRA 43:97–120
Pintureau B, Chapelle L, Delobel B (1999) Effects of repeated
thermic and antibiotic treatments on a Trichogramma(Hym., Trichogrammatidae) symbiont. J Appl Entomol
123:473–483
Pintureau B, Chaudier S, Flassabliere CH, Grenier S (2000)
Addition of wsp sequences to the Wolbachia phylogeny
tree and stability of the classification. J Mol Evol
51:374–377
Pintureau B, Grenier S, Heddi A, Charles H (2002) Biodiver-
sity of Wolbachia and of their effects in Trichogramma(Hymenoptera: Trichogrammatidae). Ann Soc Entomol Fr
38(4):333–338
Pintureau B, Bourarach K, Rohi L (2003) Preliminary inven-
tory of Hymenopteran egg parasitoids from Morocco.
Actes Inst Agron Vet Hassan II 23:163–183
Platner JD, Velten RK, Planoutene M, Pinto JD (1999) Slide-
mounting techniques for Trichogramma (Trichogram-
matidae) and other minute parasitic Hymenoptera. Ento-
mol News 110:56–64
Rohi L, Pintureau B (2003) Reassessment of Trichogrammaeuproctidis (Girault, 1911) (Hymenoptera: Trichogram-
matidae). Russ Entomol 12:373–379
Rosen D (1986) The role of taxonomy in effective biological
control programs. Agric Ecosyst Environ 15:121–129
Rousset F, Bouchon D, Pintureau B, Juchault P, Solignac M
(1992) Wolbachia endosymbionts responsible for various
alterations of sexuality in arthropods. Proc R Soc Lond B
250:91–98
Sandrock C, Vorburger C (2011) Single locus recessive
inheritance of asexual reproduction in a parasitoid wasp.
Curr Biol 21:433–437
Sappal NP, Jeng RS, Hubbes M, Liu F (1995) Restriction
fragment length polymorphisms in polymerase chain
reaction amplified ribosomal DNAs of three Tricho-gramma species. Genome 38:419–425
SAS Institute (1996) SAS for Windows, version 6.12. SAS
Institute, Cary, NC
Schilthuizen M, Stouthamer R (1997) Horizontal transmission
of parthenogenesis inducing microbes in Trichogrammawasps. Proc R Soc Lond B 264:361–366
Shojai M, Tirgari S, Nasrollahi A (1988) Primary report on the
occurrence of Trichogramma. In: Trichogramma and
other egg parasites. Les Colloques de I’INRA, vol 43,
p 121
Silva IMMS, Honda J, van Kan F, Hu J, Neto L, Pintureau B,
Stouthamer R (1999) Molecular differentiation of five
Trichogramma species occurring in Portugal. Biol Control
16:177–184
Iranian Trichogramma 373
123
Page 14
Sorokina AP (1984) New species of the genus TrichogrammaWestw. (Hymenoptera, Trichogrammatidae) from the
USSR. Entomologicheskoe Obozrenie 63(1):154–156
Stouthamer R, Kazmer DJ (1994) Cytogenetics of microbe-
associated parthenogenesis and its consequences for gene
flow in Trichogramma wasps. Heredity 73:317–327
Stouthamer R, Luck RF (1993) Influence of microbe-associated
parthenogenesis on the fecundity of Trichogramma deionand T. pretiosum. Entomol Exp Appl 67:183–192
Stouthamer R, Pinto JD, Platner GR, Luck RF (1990) Taxo-
nomic status of thelytokous forms of Trichogramma. Ann
Entomol Soc Am 83:475–481
Stouthamer R, Breeuwer JAJ, Luck RF, Werren JH (1993)
Molecular identification of microorganisms associated
with parthenogenesis. Nature 361:66–68
Stouthamer R, Luko S, Mak F (1994) Influence of partheno-
genesis Wolbachia on host fitness. Norw J Agric Sci
16:117–122
Stouthamer R, Breeuwer JAJ, Hurst GDD (1999a) Wolbachiapipientis: microbial manipulator of arthropod reproduc-
tion. Ann Rev Microbial 53:71–102
Stouthamer R, Hu J, van Kan FJPM, Platner GR, Pinto JD
(1999b) The utility of internally transcribed spacer 2 DNA
sequences of the nuclear ribosomal gene for distinguish-
ing sibling species of Trichogramma. BioControl 43:
421–440
Stouthamer R, Gai Y, Koopmanschap AB, Platner GR, Pinto
JD (2000) ITS-2 sequences do not differ for the closely
related species Trichogramma minutum and T. platneri.Entomol Exp Appl 95:105–111
Sumer F, Tuncbilek AS, Oztemiz S, Pintureau B, Rugman-
Jones P, Stouthamer R (2009) A molecular key to the
common species of Trichogramma of the Mediterranean
region. BioControl 54:617–624
Taylor MJ, Hoerauf A (1999) Wolbachia bacteria of filarial
nematodes. Parasitol Today 15:437–442
Thomson L, Rundle BJ, Carew ME, Hoffmann AA (2003)
Identification and characterization of Trichogramma spe-
cies from south-eastern using the internal transcribed
spacer 2 (ITS2) region of the ribosomal gene complex.
Entomol Exp Appl 106:235–240
Van Meer MMM, Witteveldt J, Stouthamer R (1999) Phylog-
eny of arthropod endosymbiont Wolbachia based on wspgene. Insect Mol Biol 8(3):399–403
Vavre F, Girin C, Bouletreau M (1999) Phylogenetic status of
fecundity-enhancing Wolbachia that does not induce
thelytoky in Trichogramma. Insect Mol Biol 8:67–72
Vavre F, De Jong JH, Stouthamer R (2004) Cytogenetic
mechanism and genetic consequences of thelytoky in the
wasp Trichogramma cacoeciae. Heredity 93:592–596
Walsh PS, Metzgar DA, Higuchi R (1991) Chelex-100 as a
medium for simple extraction of DNA for PCR-based
typing from forensic material. BioTechniques 10:506–513
Werren JH (1997) Biology of Wolbachia. Ann Rev Entomol
42:587–609
Werren JH, Bartos JD (2001) Recombination in Wolbachia.
Curr Biol 11:431–435
374 N. Poorjavad et al.
123
