Gene, 133 (1993) 267-271

0 1993 Elsevier Science Publishers B.V. All rights reserved. 0378-1119/93/$06.00

GENE 07368

Isolation and analysis of the rat genomic sequence encoding Cu/Zn superoxide dismutase

(Recombinant DNA; gene structure; promoter; transcription start point; identifier sequence)

Young Ho Kim, Hae Yong Yoo, Guhung Jung”, Ji-Young Kimb and Hyune MO Rho

Departments of Molecular Biology, and ‘Biology Education, Seoul National Uniuersity, Seoul 151-742. South Korea; and bDepartment of Genetic Engineering, Kyung Hee University, Suwon 449-701, South Korea. Tel. (82-0331) 28062435

Received by J.A. Engler: 22 March 1993; Accepted: 21 May 1993; Received at publishers: 28 June 1993

267

SUMMARY

A rat genomic DNA (SODI) encoding Cu/Zn superoxide dismutase (SODl) (superoxide; superoxide oxidoreductase, EC 1.15.1.1) was cloned and sequenced. The rat SOD1 gene consisted of five exons and four introns spanning about 6 kb. The transcription start point (tsp) was observed 93 bp upstream from the ATG codon by primer extension analysis. The 5’-flanking sequence of SOD1 contained two CCAAT box motifs, a TATA box and four CC-like boxes. In the 3’- flanking region of SODl, a polyadenylation signal, consensus sequence YGTGTTYY, and a G/T cluster were observed. A rat identifer (ID) sequence, a repetitive element of the rat genome, was located at between 569 and 484 bp upstream from the tsp.

INTRODUCTION

The Cu/Zn superoxide dismutase (SODl; EC 1.15.1.1) is a key enzyme in the metabolism of oxygen free radicals. It catalyzes the dismutation of superoxide radicals (0;) to oxygen and hydrogen peroxide (H,O,) according to the reaction: 0; + 0; + 2H+ -0, + H,Oz. Production and/or removal of superoxides have been observed to play significant roles in a variety of critical homeostatic mechanisms both at the cellular and the organismic level. The superoxide level is precisely controlled in a cell. The damage to various macromolecules caused by superox-

Correspondence to: Dr. H.M. Rho, Department of Molecular Biology,

Seoul National University, Seoul 151-742, South Korea. Tel. (82-2)

880-6688; Fax (82-2) 872-1993; e-mail: HYUNERHO@KRSN-

UCCl.BITNET

Abbreviations: bp, base pair(s); CAT, Cm acetyltransferase;

cDNA, DNA complementary to RNA; Cm, chloramphenicol; ID, rat

identifier sequence; kb, kilobase or 1000 bp; nt, nucleotide(s);

SODl, Cu/Zn superoxide dismutase; SODl, gene encoding SODl;

SV40, simian virus 40; tsp, transcription start point(s); Y, C or T

( pyrimidine).

ides has led to the ‘free radical’ theory of aging (Warner et al., 1987). Several physiological functions are associ- ated with the free radical generation (Aitken and Clarkson, 1987; Ezekowitz et al., 1987; Tamura et al., 1988). Because of its function as a free radical scavenger, SOD1 has been hypothesized to play a role in all of these systems. Until now, only a few reports of transcription regulation of the SOD1 gene were published. In yeast, the copper-dependent transcription factor, ACEl, activates expression of the yeast Cu/Zn SOD gene (Carri et al., 1991; Gralla et al., 1991). Lutropin, CL?+ ion, and re- active oxygen seemed to induce a SOD level in the rat (Laloraya et al., 1988; Nicotera et al., 1989; Percival and Harris, 1991).

The SOD1 gene, being biologically important, is an attractive system for the study of gene expression that may lead to a better understanding of the relationship between oxidative stress and SOD1 gene expression. For an analysis of the inducible mechanism of SOD1 gene transcription, the genomic structure, especially 5’- flanking region, has to be analyzed. The genomic se- quences of human and mouse SOD1 have been cloned

268

(Levanon et al., 1985; Benedetto et al., 1991), but that of rat SOD1 has not yet been characterized. We report here the isolation of the rat SOD1 gene, the determination of genomic DNA sequence, the organization of exon:intron and the assignment of tsp.

EXPERIMENTAL AND DISCUSSION

(a) Structure of rat SOD1 gene The rat genomic library was screened using human

SOD1 cDNA as a probe, with 84% homology to rat SOD1 cDNA (Lee et al., 1990). Among 2 x lo6 clones, three showed a positive signal to both 5’ and 3’ end- specific probes of cDNA. The restriction map of the entire region of the cloned DNA containing the rat SOD1 gene is shown in Fig. 1. Nucleotide sequences were determined for all exons with partial flanking intronic sequences as well as with 1.7 kb of the 5’-flanking and 0.36 kb of the 3’-flanking regions of the gene (Fig. 2). The rat SOD1 gene consisted of five exons and four introns spanning about 6 kb. The exon:intron organizations were deduced by comparing the sequence of the rat SOD1 cDNA (Ho and Crapo, 1987). The nt sequences of exon:intron junc- tions were in agreement with the consensus 5’-GT.. .AG- 3’ except for the first exon:intron boundary which showed a variant of the donor sequence, the dinucleotide 5’-GC. This feature is also characteristic of the human and the mouse SOD1 genes. The genomic organization of the rat SOD1 gene is quite similar to that of the human and the mouse SOD1 genes (Levanon et al., 1985; Benedetto et al., 1991).

(b) Structural features of the 5’- and 3’4anking regions

The 5’-flanking region (about 300 nt) of the rat SOD1 gene showed the homology of 66.4%, 81.9% to that of the human and the mouse SOD1 gene, respectively (Fig. 3). Primer extension analysis demonstrated a tsp at 93 bp upstream from the ATG start codon (data not shown). In the promoter region of the gene, the consensus TATA box sequence was found at -28 bp from the tsp.

The region immediately upstream from the TATA box showed high G + C content. While the human SOD1 gene has CCAAT boxes at nt positions - 73 and - 132, the rat promoter region did not contain such sequences at a corresponding position. However, a CCAT sequence was found at nt -375, and a CAAT sequence was located at nt - 317 (Fig. 2). Sequence motifs CCGCGG and CCGCCG, which are homologous to the consensus se- quence for the Spl-binding site, were found at nt - 18, - 116, - 241 and + 70. Farther upstream from the TATA box, putative AP2, CREB, and HSF-binding sites were shown by sequence homology analysis using FASTA pro- gram with TFD, an EMBL database of transcription factor (data not shown). This result suggests that external signal (i.e., heat shock, hormone etc.) may exert some control over the level of SOD1 gene expression. One poly- adenylation signal (ATTAAA) was found at 65 bp down- stream from the stop codon (Fig. 2). Consensus sequence YGTGTTYY (McLauchlan et al., 1985) and G/T cluster located downstream the ATTAAA signal may be required for efficient 3’ terminus formation of mRNA.

(c) Identification of the ID sequence

Initially, rat ID-homologous sequence was found at between nt - 569 and -484 when the 5’-flanking se-

I I

AK14 I I

hK22 I I

EXOOI II IIIN V

Fig. 1. Restriction map of a 16.5-kb fragment containing the rat SOD1 gene. Three overlapping phage clones (hK5, 1K14 and hK22) are shown. A

rat genomic library was purchased from Clontech laboratories (Palo Alto, CA). The library was screened using human SOD1 cDNA as a probe,

which has 84% homology to rat SOD1 cDNA (Lee et al., 1990). The probe was “P labeled by the random primer labeling method (Sambrook et al.,

1989). Hybridization positive clones were purified and characterized by restriction mapping for the location of exon sequences. To facilitate a structural

analysis, fragments of the cloned genomic DNA were subcloned into pUC plasmid. Blackened boxes, exons; arrows, direction of sequencing.

269

gectctcceggetegtcetegegcegegccceggggtctecet~gteectgtetcccegtgtegcceetcegttcctcctgtttctctggcctegegtteg~ttcggtettttgccet 120

cctceguttaratcctgcctcctgegtgtegceg~cetgcegttttetgcetg~ctcttgggegeccecegegetttc~tttt~gegec~ttttcttttttegttg~e~ 2110

eceectttaacggtccccegctccgg~ee~eeee~eeeg~egeeeceecttt~~egegec~ttctgtttttegtteeg~ttctctctcttectgeteccctttcttggctc 360 c~ggectccccetetetctttct~ecetttctgeg~ctc~gt~tetetggtgetgtctccccacctttttttgtegtttgteccttttgctcettcceteCc~ctt~e~t 460 etcttccttgeegcectetgtctcecccegtgcetggegtttcec~etgecttcetceggcetcttgttctccegcgceggctgtctgegeececttcee~ggce~geggetecgee 600 tgttectetgaagtarcecgectggggetggtgggcegecgecteetcgtetectgetetgggtectgegecggegggtectgegecggeggetctc~tg~tttegtcccetctct 120 aeegtteeeegeeegccaggtececgcctcteeccccegceectgggeggcegeggtC~eggcegggegegccCtgtgegtttgeggtCgctggtCtgceteetgegttCtgtg6tegC 640 ceaggtetececggtgtgetttttt~~ggeggtgtgtc~ccggcegegcecetgtctgtcecgeg~gtgt~gtegtc~etccccegtecc~gt~c~cettegtg~g 960 eataegteecgtgatetgtgccceggeettegeeecctgcegege~~~~tt~~~4ttt~ota~t~~t~4a~~att[4~~~q4~4~~o44t~t4~4tt4444~4t44 1010

g~ucccccccccceeeeeeeegeeecctgcegegee~~eeeeeecctgcegegectcegeggtgtgtctggegetgeeeetgggccttececetettececcgegcetcc 1200 ~cttggctcecccceectttcecec~ceectgcggcgcgetgce~gtcegtcg~ccgcetttctegecg~cggcttcegeccttctegggcgcgcecgceggcccttcgcc~ 1320 ggttctcggttcccgccgcgectcggcgectcecegttgeegecetagcgecttcccegctctgtctcgttctggeecttctcegtccgceegctcctgeegctggcgctcccctcegct 1440 ccgcceccceecgtgcaccgcggccegggeecttceggeegggteggcegegecctcggctegcgettggttccctgcceeggtgggegtggcceggceceggc~egctccgcg 1560

IletAlelletLys 4 Ikgctgggccctcg~ttgceccttcgtttcctgcggcggcttctgtcgtctc~ttgctttttgctctccceggttccgeggccgccgcgcgtctcccggggeegc ATGGCGATGMG 1616 AleVelC~sVelLeeL~sC1yAspGlyProVelGlnGl~VelIleEisPheGluGlnL~s 24 GCCGTGTCCGTGCTGMCGGCGACGGTCCGGTGCAG~CGTCATTCACTTCGAGCA6MG gceeggcccggggcgctggagccegegccegcggtgecggcggececctegtgcggge 1196 cgcegccecgcccccgccgcggcctgegcccgtteeetgctgegtceccgcggccttgegge~ggcggcgcggect~ggeggcggggcgccgcggggeccttcggcgggtctctcgeg 1916 ccccgagtgcgggcgccgegegegcegtttgcetcgctetcctetggect~~e~~~~~eeggetcccceceggcegteggececeettettttctggctect~eteeettetgggeect 2026 getMacetcac~g~tgtggegtaesgbtttctgggcegcceetgttctge~egtc~gcctgececegtgcegtegccetccettccctagttctgecettgegctgcccccttttg 2146 ttcctctgggtgcttttceagtgctgttgegtcceggtgtctgcececgtgcetctggeeeceegtgttegggccgetgggtegggegggegeggcctegegcteegcegctctegegtc 2266 eccctggeggaaatgggtctecttggetttggeceteggtttgettttgttttgttttttgcettgtgcctttttcetgtgettc~egtettecec~cttgetgtcttetttttgta 2366

AlaSerG1~GlaProValVelValSerGl~lnIleTbrGlyLeuThrGluCl~l~isGlyPhe~isVel~isGlnTyrGlyAspAsnT~rGln 56 tttttteaete~GCAAGCGGTGMCCAGTTGTCGTGTCA~ACAGATTACA~ATTMCTGM~CGAGCAT~TTCCATG~CATCMTATGGGGACMTACACMG~eggtccte 2506 ggctggctage~eee~ee~ctgcegetetcetgggctgtggt~tgegeccctgtctc~etctce~eceeeceeecetgecegtctegtgeaeeagcgggt~cttgeeaettgcee 2616 ggccetategtccegcctetttgteccegggtgctgcttcctgtttgtetcectccegceceteccegctccetgtttgctgt~ttgg~gttgteegeettccgetgtcettgcetece 2136

GlyCysThrThrAleGlyProEisPbehsnProHisSerLysLys~isGlyGlyProAl~spGl~Gl~rg 60 geggtttecttceteetctgectgctggtttctggteet~GCTGTACCACTGCA~ACCTCATT~MTCCTCACTCTMG~CAT~GGTCCA~CGAT6MGAGAG~gegcegc 2656 ettctctcetgcetggtggtggageggggtctgtggeeeacecctgeegecegeectgegtggtctcectgccttttcttttgtetgtttccettceccceectcccecetcccceegts 2916 ctggaategtttetettgggtgeeggegctgec~etgtggectctteegtgettt~ttttgtegcett~ttgeegetgeect~teceegtgcc~eggeecceeteceg~eets 3196 tcatggeteacagtectatcacgtcactagc~eggteeetcettgtetaetetcetteetgcegetteeteeeeectegttg~ettccgtttgtatgtgaecctteggeegtccttce 3316 tattaageggctegctctttgeetgegctggegc~eccttcgt~tceggegctgcetecttcgteecctcg~gtgccttcttctegegcegegtge~ee~~~~~ettegecette 3436

HisVelGlyAspLeuGlyAsnVelAleAieGlyLysAspGlyVelA~~snVelSerIleGl~spArgValIleSerLeuSerGlyGl~isSer 112 getccctetgettgggeeet~ GCATGTTGGAGACCTGGGCMTGTGGCTGCTGG~GGACGATTCC 3555 IleIleGlyArgThrlietVe~ 119 ATCATTCGCCCTACTATGCTG~eagtttccetetegtagtegetgtaggetttcttcteecetegttetgtecctttccetgecttcgtggtggtggtteeectegttcctaeeegetc 3615 acateeattggtaegatgttc~eeteggeeee~tattettttettggetgteetegt6eegeetteetttgcctegtcegtteegeacgctcgttctgctcgeegtgctggtegeeeg 3195 ctggttecetttgatcegectggetctg~ttgeggeteceetegtctttegttt~ecegctggettttcttgccetgettgcccccttecegtt~tcetttce~~~~e~e~ctte 3905 gtegtctgecttttagctgetggce~eeettegcttettgetttecteetegetttgeecettttcteetetecatggtcctttgeegtettgctgggeegeegtgcteettacttect 4025

Vel~isGlaLysGlnAspAspLeuGlyLysGlyGlyAsnG~~GluSerThrLysThrGlyAsnAleGlySerArgLenAle 146 tgatcecegaeacctaaetgttctteettcttttcee~GTCCACGAGAAACMGATGACTTGGGC~GGT~~TGMG~GTACAMGACTGGMAT~T~MGCCGCTT~T 4145 CysGlyValIleGlyIleAlaGlnStop 154 TGTCGTGTGATTGGGATTGCCCAATMecettccctetgtggtctgegtctcegectcetctgctgtcctgcteeectgteg~ecce~ccett~ctgteetctteecegt~ttcc 4265 _____ aatgtgtgtgcetccctttgcttectgcteeggcetccgtgegtgegeggtgctecg4teggtttggeggte ceettcctgaetgtgteceectcttei3eecteeete~ 4385 gttgttttctgtgcccegeccctcectgggtggttteegctgeeetttctctttc~gcctctctctctctctgtgtgtgtgtctgtgtgtgtgtgtgtgtgtgtgtgtgt~gtgegeg 4505 a~ctgegecttatttegegct 4531

Fig. 2. Organization and nt sequence of the rat SOD1 gene. Exon:intron boundaries were determined by comparing the nt sequence of the genomic

DNA with that of the cDNA (Ho and Crapo, 1987); nt sequences corresponding to exons are in capital letters, and intron and flanking sequences

are in lower-case letters. CCAAT motifs and GC boxes are underlined. TATA motif is boxed. Polyadenylation signal is indicated by dashed underline,

and poly(A)-addition site is indicated by an arrowhead. Asterisk marks nt of introns which were not sequenced. Putative ID sequence is in bold

letters. Exonintron junctions are doubly underlined. The tsp is indicated by a bent arrow. The G/T clusters mentioned in section b are italicized at

the 3’-flanking region. The YGTGTTYY motifs are indicated by wavy underlines. Various restriction fragments were subcloned into M13mp18 and

19, and sequenced by the dideoxy chain termination method (Sanger et al., 1977) using Sequenase kit (US. Biochemicals, Cleveland, OH, USA).

Accession numbers for RnsodlOl to RnsodlO4 are 221917 to 221920, respectively, and the accession number of RnsodlO5 is 221924.

quence (up to 1.7 kb) of rat SOD1 gene had been aligned the ID sequence may play a role in the expression of

using a combination of the FASTA program with the PolII genes in postnatal cortical neurons, perhaps medi-

EMBL sequence database. The rat ID sequence, a short ated by PolIII transcription (McKinnon et al., 1986). A interspersed repetitive DNA element present in lo5 copies comparison of ID sequence of rat SOD1 gene with other

in the rat genome, is predominantly located in introns of ID sequences in the S-flanking or 3’-flanking region of

a specific class of neuronal genes. It was suggested that rat genes is shown (Fig. 4). In the present study of the

270

TCACAGTPAGAAGACMTACC--GACTTTC-CCA~TCAC-C -169 - . . ..I... . ..I... IO. ..I.. * .I...#.. .I..... ,.I. ..1.* ***"'* : ::: . .*...*. '* ".I' ::::: 6. ..o* CCACCGCAGG-CCC~C-CCCT-AGCTTCTCGC-TTC-CC~C~GACTC~GACTCACAGTT-GMGACA-TA~--GAC~-C-CCA~CTGT-CTCG--TT~~MC--TTCTC -171 ..I.. I,, .*,** .I. : '*'*' .* 0. : : : : :: : ::: :: : :: :::: :: : :: : : : : :: ::: . ..*.*I : :;: : .I...., GTACCCTGTTTACATCAT~TGCCATTTTC~GTA~~MC-C~G-~CACG--CCGTGAAAAGA----A~~GT~-CTC---CACAGTT-TC~TTCT~A-CGTWCCC -167 --

AG-T-CG---CA -----AG-CTCCACGA-G--CTCGACCTITCCTCGGCCCC~C~---CAG---CGT~C-C-CGC~C--A~A~CC---ACGM~CG~C~A~CGCG -76 :: : :: :: :: :::: : : :: : ::: :::: :: ::::: : :: ::::: ; :::;;:: ..**. ,. : . . . ..I. II. I., I. :: .I.., .I * . ..I.. 0.. (0 II AC-TCCG---CA -----AG-CTCCTG-A-A-CTGGCGCTCCCCTCAGCTCCGCCACC--CAA---CGTGCA-C-CGCGGCC--AG~AAC~C---AGGAAGGGTAG~AGAGACCTCG -76 _- * , I. (,(( : "'"': *.*.o .I.. . . I... * *. II. ,,*, :: : ::: : :: :::: *o**** ::: * ..I. I. :: : ::: ::: @.I .I, : :: *a* .I. GGCTGCCCGCCCGGGGCAGTCTCCCGCGCACGC-GCC----CCCTT~-CCGCCCCAGTCATTCCCG-~CACTC~GACCCGA~---CTGCCGCA~--~~TGAG--C~G -81 --

CCGTCCGTCGGC-TT-CTCGTCTTGCTCTCTCTGGTCCCTCC~AGGAGGCCGCCGC~GTC~CCGGGGAAGC-ATG rSOD tlO6 o.*o*. 0.0 9 ***I,*** . 9.. .**, ,,* *I..*I*,,,I** II.*,*,,,, I., 8 I.. .I. * *a ,* . .*.4,..* . 0. .*a, es. .I*.*.***.,** . . . . . . ..I. *,, CTGTC-GTCTCC-TTGCTT-T-TT~TCTCCCACGT---TCCG-A~---CCGCC~GCGTCTCCC~GAA~-ATG rSOD t96

: :: ::: :::: : ::: :: :: ::: .I..,. :: * ’ “.’ :: :::: ::: G-G---GTTTCCGTTGCAG-T---CCTC -----GGA---ACC--AGGA--CCTC-G-GCGTGGCCTAGCGA-GTTATG MOD t63

Fig. 3. Comparison of the S-flanking sequences (up to about 300 bp from tsp) of mouse (m), rat (r) and human (h) SOD2 genes. The homology

between rat and mouse was 81.9%, 66.4% between rat and human sequence, and 59.9% between human and mouse sequence. Matching nt are

marked by colons. The typical regulatory sequences are underlined (see Fig. 2 legend). Numbers on the right margin show the position of nt relative to the tsp.

rat SOD1 gene, the ID sequence was observed at the S- flanking region, which was also the case in HNFI, CYP17 and y-r>-crystallin genes (Tomei et al., unpublished data; Den Dunnen et al., 1990; Zhang et al., 1992). Our prelimi- nary study showed that addition of the ID sequence to the upstream of SV40 early promoter increased the repor- ter CAT activity (data not shown). This result suggested that the ID sequence may exert some role in rat SOD1 transcription. However, the exact role of the ID sequence in rat SOD1 gene has to be further studied.

(d) Conclusions

The rat liver SOD1 gene was cloned and analyzed. (1) There were five exons and four introns in the rat SOD1

gene. (2) The tsp was determined by primer extension analysis. (3) The rat SOD1 gene had two motifs of CCAAT boxes, a TATA box and four variant GC boxes in the promoter region. (4) Farther upstream from TATA, seve- ral putative factor-binding sites were observed. (5) Rat identifier sequence was observed at the 5’-flanking se- quence of rat SOD1 gene. (6) Isolation of the S-flanking

Rasodid Rn55rep Rnraspba Rncypllg Rnlfhnpr Rntl4 Rncryg

t : $ I 1:

-569~GGGGTTGGG~ATTTAGCTC~GTGGTAGAC~GCTTGCCTAGGTbCbCECCCTGGGTTCGAT~CCCCAGCTCCGAAAAAAAGAA( -484) 4187) ----------------------------GCA---------C--------------A------G- *_____________________( 4273)

11861 ------_--_--------_--__---_-GC--------------------------------G- ,---____---_---____A__[ 1272)

2022j ___--__-________-___________GT __---_---_---.--__--__-_-_____T-G-,---------------______( 2106) 6211----C -----------------------GC-.--A---------------------------G- ,___________________C_( 736)

~7l5l)___--___________T-__--__---.GC__------_--------------------_--G-,----___--__--________(l7D67)

306271 -----__________--_______----TCA_-_-_--_-C--__--------~--------G-,--T-------TGG-----A--(3D543)

Fig. 4. Comparison of ID sequences in the 5’-flanking or 3’-flanking region of rat genes. The sequences are from rat SOD2 gene (Rnsodid; this study),

rat 5.5-kb DNA fragment containing repetitive sequences (Rn55rep; Herget et al., 1986), exon 1 region of rat proto-Ha-ras gene (Rnraspha; Chakraborty

et al., 1991), 5’ upstream region of rat CYPZ7 gene (Rncypl7g; Zhang et al., 1992), nt sequence for rat LFBl/HNFl promoter (Rnlfhnpr; Tomei

et al., unpublished data), 3’-flanking region of rat TM4 gene (Rntm4; Lees-Miller et al., 1990) and 5’-flanking region of rat y-D-crystallin gene (Rncryg;

Den Dunnen et al., 1990). Numbers of rat SOD1 ID sequence show position of nt relative to the tsp. Deletions are marked by dots (.) and mismatches

are shown. Numbers indicate the first and last nt in each line. Rnlfhnpr, Rntm4 and Rncryg sequences are reverse-oriented for comparison.

271

region of the rat SOD1 gene may allow investigation of the relationship between external signals (including oxi- dative stress) and rat SOD1 gene expression.

ACKNOWLEDGEMENTS

This work was supported by a research grant from KOSEF through the Research Center for Cell Differentiation (93-4-l).

REFERENCES

Aitken, R.J. and Clarkson, J.S.: Cellular basis of defective sperm func-

tion and its association with the genesis of reactive oxygen species

by human spermatozoa. Reprod. Fert. 81 (1987) 459-469.

Benedetto, M.T., Anzai, Y. and Gordon, J.W.: Isolation and analysis

of the mouse genomic sequence encoding Cu’+-Zn’+ superoxide

dismutase. Gene 99 (1991) 191-195.

Carri, M.T., Galiazzo, F., Ciriolo, M.R. and Rotilio, G.: Evidence for

co-regulation of Cu,Zn superoxide dismutase and metallothionein

gene expression in yeast through transcriptional control by copper

via ACE1 factor. FEBS Lett. 278 (1991) 263-266.

Chakraborty, A.K., Cichutex, K. and Duesberg, P.H.: Transforming

function of proto-ras genes depends on heterologous promoters and

is enhanced by specific point mutation. Proc. Natl. Acad. Sci. USA

88 (1991) 2217-2221.

Den Dunnen, J.T., Van Neck, J.W., Cremers, F.P.M., Lubsen, N.H. and

Schoenmakers, J.G.G.: Nucleotide sequence of the rat gamma-

crystallin gene region and comparison with an orthologous human

region. Gene 87 (1990) 225-232.

Ezekowitz, R.A.B., Orkin, S.H. and Newburger, P.E.: Recombinant in-

terferon gamma augments phagocyte superoxide production and

x-chronic granulomatous disease gene expression in x-linked variant

chronic granulomatous disease. J. Clin. Invest. 80 (1987) 100991016.

Gralla, E.B., Thiele, D.J., Silar, P. and Valentine, J.S.: ACEl, a copper-

dependent transcription factor, activates expression of the yeast

copper, zinc superoxide dismutase gene. Proc. Natl. Acad. Sci. USA

88(1991)8558-8562.

Herget, T., Reich, M., Stuber, K. and Starzinski-Powitz, A.: Regulated

expression of repetitive sequences including the identifier sequence

during myotube formation in culture. EMBO J. 5 (1986) 659-664.

Ho, Y-S. and Crapo, J.D.: cDNA and deduced amino acid sequence of

rat copper-zinc-containing superoxide dismutase. Nucleic Acids Res.

15 (1987) 6747.

Laloraya, M., Pradeep Kumar, G. and Laloraya, M.M.: Changes in the

levels of superoxide anion radical and superoxide dismutase during

the estrous cycle of Rattus noruegicus and induction of superoxide

dismutase in rat ovary by lutropin. Biochem. Biophys. Res.

Commun. 157 (1988) 146-153.

Lee, W.G., Kim, Y.H., Yang, J. and Rho, H.M.: Molecular cloning and

high-level expression of human cytoplasmic superoxide dismutase

gene in E. coli. Kor. J. Microbial. 28 (1990) 91-97.

Lees-Miller, J.P., Yan, A. and Helfman, D.M.: Structure and complete

nucleotide sequence of the gene encoding rat fibroblast tropomyosin

4. J. Mol. Biol. 213 (1990) 3999405.

Levanon, D., Lieman-Hurwitz, J., Dafni, N., Wigderson, M.,

Sherman, L., Bernstein, Y., Laver-Rudich, Z., Danciger, E., Stein, 0.

and Groner, Y.: Architecture and anatomy of the chromosomal

locus in human chromosome 21 encoding the Cu/Zn superoxide

dismutase. EMBO J. 4 (1985) 77-84.

McKinnon, R.D., Shinnick, T.M. and Sutcliffe, J.G.: The neuronal iden-

tifier element is a cis-acting positive regulator of gene expression.

Proc. Natl. Acad. Sci. USA 83 (1986) 3751-3755.

McLauchlan, J., Gaffney, D., Whitton, J.L. and Clements, J.B.: The

consensus sequence YGTGTTYY located downstream from the

AATAAA signal is required for efficient formation of mRNA 3’ ter-

mini. Nucleic Acids Res. 13 (1985) 1347-1368.

Nicotera, T.M., Notaro, J., Notaro, S., Schumer, J. and Sandberg, A.A.:

Elevated superoxide dismutase in Bloom’s syndrome: a genetic con-

dition of oxidative stress. Cancer Res. 49 (1989) 5239-5243.

Percival, S.S. and Harris, E.D.: Regulation of Cu,Zn superoxide dismu-

tase with copper: caeruloplasmin maintains levels of functional

enzyme activity during differentiation of KS62 cells. Biochem. J. 274

(1991) 153-158.

Sambrook, J., Fritsch, E.F. and Maniatis, T.: Molecular Cloning. A

Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press,

Cold Spring Harbor, NY, 1989, pp. 10.14-10.15.

Sanger, F., Nicklen, S. and Coulson, A.R.: DNA sequencing with chain-

terminating inhibitors. Proc. Nat]. Acad. Sci. USA 74 (1977)

546335467.

Tamura, Y., Chi, L., Driscoll Jr., E.M., Hoff, P.T., Freeman, B.A.,

Gallagher, K.P. and Lucchesi, B.R.: Superoxide dismutase conju-

gated to polyethylene glycol provides sustained protection against

myocardial ischemia/reperfusion injury in canine heart. Circ. Res.

63 (1988)9444959.

Warner, H.R., Butler, R.N., Sprott, R.L. and Schneider, E.L. (Eds.):

Modern Biological Theories of Aging. Raven, New York, 1987.

Zhang, P., Nason, T.F., Han, X.G. and Hall, P.F.: Gene for 17-alpha-

hydroxylase/C (17-20) lyase P-450: complete nucleotide sequence

of the porcine gene and 5’ upstream sequence of the rat gene.

Biochim. Biophys. Acta 1131 (1992) 3455348.