Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013

Non-Traditional Types of Gene Disorders

*NOTE that I added some additional information from the internet for better clarification, they are in italic font.

Till now we talked about several genetic disorders (the chromosomal abnormalities, single gene inheritance autosomal dominant, autosomal recessive and X-linked types of diseases)

Today we will talk about the non-traditional types of gene diseases No-traditional means that they will not follow single gene disorders and will not follow the chromosomal abnormalities, they have certain characteristics

So normally in typical genetics (mendelian inheritance) we saw in Autosomal dominant for example 1 allele is enough to make single disease and there is no difference between male and female; both are equally affected [a mutant allele of an autosomal gene is equally likely to be transmitted from a parent, of either sex, to an offspring of either sex].

So autosomal or x chromosomes they are segregated in the population almost evenly, there’s no problem

The gene it might have parental effect or maternal effect; which means that the gene is there ,, both of them are there (the maternal and the paternal) but one of them is expressed while the other one is silent In one way or the other.

During development some of these genes will be active and the others they will be silent, due to some conditions, so these when transmitted from the father or the mother they will give different types of genetic abnormalities.

These conditions we can see them as

Mosaciasm Uniparental Disomy ImprintingTrinucleotide expansionMitochondrial inheritanceFragile X Syndrome

They are not following normal genetics activation like single gene like we said

MOSAICSFrom the name, it means in a population or in an organism or in an organ there is at least two different subtypes each one of them have different type of characteristics, (maybe one has mutations and the other doesn’t have mutation, one has that gene and the other doesn’t have it).

Page 1 of 16

Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013So Mosaicism means the presence of two genetically different cell lines in a person, derived from a single zygote, these cell lines can happen either in chromosomal or single gene disorders.

((It is caused when a mutation arises early in development. The resulting individual will be a mixture of cells, some with the mutation and some without the mutation)).

we can see mosaicism in 2 conditions

1- As somatic mosaicism usually indicates the presence of a post-zygotic mutation, which can affect a certain percentage of the cells in one or more tissues/organs. (like when we talked about turner syndrome for example we said that we may have different cell lines, also we can see these types of abnormalities in down syndrome )

2- And Gonadal mosaicism, here we are talking about the gonads (the germ cell like the sperm or the ovum will have the mosaicism.

((gonadal mosaicism, is a condition in which the precursor (germline) cells to ova and spermatazoa are a mixture (mosaic) of two or more genetically different cell lines. where some gametes, i.e. either sperm or oocytes, carry a mutation, but the rest are normal. The cause is usually a mutation that occurred in an early stem cell that gave rise to all or part of the gonadal tissue)).

Slide 7 the first germ cell line is normal But here in the second line at one stage this mutation happened and at the end u will have some cells that have mutation while the others don`t (normal).This is an example of this mosaicism

Somatic mosaicism

How early in development the mutation occurs will determine what tissue(s) and what percentage of cells will have the mutation; If it was at very early stage we will have large amount of cells which are mosacic in comparison when it comes late in the development.

Whether mosaicism for a mutation involves only somatic tissues, the germline, or both depends on whether during embryogenesis the mutation occurred before or after the separation of germline cells from somatic cells. If before, both somatic and germline cell lines would be mosaic and the mutation could be transmitted to the offspring as well as being expressed somatically in mosaic form. A mutation occurring later would be found only in the germline or only in a subset of somatic tissues. 

Page 2 of 16

Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013

Examples of somatic mosaicism: down syndrome in *segmental neurofibromatosis disease; (segmental: in certain part of the tissue

or the skin) we can see that there is fibromatosis (spots on skin), Some of them could be very large some of them could be very mild like café-au-lait spo

Albright Syndrome is another example When we talk about hepatic urea we talk about the involvement of metabolism

like for example ornithine transcarbamylase enzyme which is X-linked we can see that some of the cells are deficient and other cells are normal

Germ line mosaciasm

The chance that a disorder due to a new Autosomal Dominant mutation could occur more than once in a sibship is very low (because spontaneous mutations are generally rare), and having two occur independently in the same gene in the same family is thus very unlikely

y3ni u have a normal family (the father & the mother are completely normal), but u can find their children (one or two of the children) have the same mutation, the same type of characteristics, this is a type of mosaicism in the germ cell; because the parents are normal, thus mutation has happened in the sperm or the ovum so we can see these abnormalities in the children

Like here for example the father or the mother are completely normal but two of their

children they show the same disease the same mutation This is an indication that there is a mosaicism

this is generally what we can see two sibling of the same parents they have the same mutation.

- if we have another generation we might mix it with autosomal recessive because here we find jump (skip) in one of the generations

another example u can this see that this male is married with two different females , the mosacism from the father because both children have the disease, so the mothers are normal -from the father they get it-.

Page 3 of 16

No previous

family history of

this disorder

Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013*segmental Neurofibromatosis in which skin manifestations are not uniform and occur in a patchy distribution

other examples of Gonadal mosaciam Osteogenesis imperfecta, OI and sometimes known as brittle bone disease Duchenne muscular dystrophy, Achondroplasia, Hemophilia A.

Clinical examples , we can see -Individual with two different eye colors (one eye is green and the other is blue for example.

-An Individual Eye with Two Colors (zy “shamat” in their eyes)

-Identical twins have different hair color.

*So this mosaciasim is not autosomal recessive or autosomal dominant or any type of traditional inheritance

Uniparental disomyIt means that both genes or both chromosomes or both characteristics are inherited from one parent either from the mother or from the father.

Generally The incidence of UPD is estimated to be as high as 2.8 to 16.5 per 10,000 conceptions, So the problem here is very very low

Isodisomy : If the parent passed on two copies of the same chromosome as results from non-disjunction in meiosis II, (a single chromosome from one parent is duplicated).

heterodisomy ,, If the parent provides one copy of each homolog as results from non-disjunction in meiosis I, (a pair of non-identical chromosomes are inherited from one parent).

Page 4 of 16

Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013

In the previous picture

A This is a normal type of division in meiosis 1, but in meiosis 2 here we have a non disjunction (two chromosomes stayed together) when these get fertilized- if this is ovum- with a sperm (normal one) u will get a trisomy here, Now the extra chromosome which come from the sperm, it might get lost due to smthn -.- , And u will end up with two chromosomes coming from one parent and this is what we call uniparental iso-disomy (two chromosomes from one parent), iso-disomy because both of them are identical (as a duplicated chromosome).

B If we look here the disjunction happened at meiosis 1 (homologous chromosomes), so we will get trisomy after fertilization, again also one of the chromosomes will get lost but the two that are left are not identical (not from the same chromosome, but from homologous ones), so we call them heterodisomy.

-Example of this, Father-to-son transmission of hemophilia, affected boy inherited both X & Y from father. (non disjunction happens at meiosis one)

Other examples of these (Uniparental disomies):

-Prader willi syndrome and cystic fibrosis (CF)

-Expression of X-linked in homozygous form in a female offspring of a carrier mother and a normal father

*Note that both of them (isodisomy & heterodisomy) are uniparental disomy (two chromosomes from one parent).

slide 18 examples of uniparental diseases

like Hydrops fetalis (abnormal hemoglobin –during pregnancy- especially alpha thalassemia)

Page 5 of 16

Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013

ImprintingAll the mammalian traits, the phenotype depends on which parent passed along the alleles for those traits; y3ni x chromosome contains certain characteristics, and this depends on the mother because the x chromosome in the male is inherited from the mother, so here all the phenotypic which are controlled by the x chromosome they have maternal characteristics, these types of characteristics which depend on one parent we call it imprinting.

For most genes, we inherit two working copies -- one from mom and one from dad. But with imprinted genes, we inherit only one working copy. Depending on the gene, either the copy from mom or the copy from dad is

epigenetically silenced. Silencing usually happens through the addition of methyl groups during egg or sperm formation.

So what is the imprinting

Chromosomes are “marked” with their parental origin, Chromosome 1 is inherited from the father and chromosome 2 from the mother for example.

The imprinting differs in sperm and egg depending on the genes which is found on x-chromosomes

Imprinting turns off specific genes; if we have two alleles 1 will be silent in one way or the other by Methylation

Imprinting does not change the nucleotide sequence; the gene is the same, there’s no mutation here we are talking only about the expression of that gene -whether expressed or not-.

So some genetic disorders, the expression of the disease phenotype depends on the mutant allele which is inherited from the father or the mother this is what we call genomic imprinting.

But this does not change anything in the sequence of the gene, this silencing is reversible which means during the development of the embryo there will be imprinting but when fertilization happens that imprinting will be released, -like in the inactivation of the chromosome exactly the same-.

Mechanism of Imprinting must occur before fertilization; which means imprinting will happen either in the sperm

or in the ovum before fertilization Must be able to confer transcriptional silencing, which means there is no transcription so

the methylation happens on the messenger RNA at that time and there will be no translation.

Page 6 of 16

Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013 Must be stably transmitted through mitosis in somatic cells, it’s stable through all life Must be reversible on passage through the opposite parental germ-line; which means

after fertilization this could be reactivated and this happens because of the methylation of that gene.

methylation which the binding of CH3 group to one of the nucleotides.

Slide 25(after fertilization) demethylation In the sperm happens much earlier while the maternal demethylation happens later.

And during the development of the zygote, the methylation will be completley released.-So methylation happens before fertilization and after fertilization the methylation will be completely released-.

Imprinted genes Approximately 100-200 thought to exist. Involved in many aspects of development including

- Fetal and placental growth

- Cell proliferation

- Brain development

- Adult behaviour

So imprinting can be seen in the genes that are controlling those developmental processes, if u silent the gene that is coming from the father mainly u will get the expression of the gene coming from the mother and vice versa.

IMPRINTED: Just after fertilization, a global demethylation event occurs in the zygote, first in the paternal pronucleus, followed by the maternal pronucleus. Imprinting established during gametogenesis must resist this demethylation process during the development , which means it will be stable all life as we said. Remethylation of the diploid genome occurs post-implantation and sets secondary imprints that are maintained for the life of the individual.

Examples of genes and inhireted diseases that involve imprinted genes:(Slide 28)

Page 7 of 16

Aseel Al-Momani Genetics Sheet #8 Date 15/4/20131- Wt1 gene we find maternal allele is expressed in wilms syndrome for example 2- INS gene paternal is expressed ,, Insulin Resistance 3- Igf2 paternal ,, insulin like growth factor4- Igf2 Receptor Maternal ,, receptor for insulin like growth factor5- H-19 , maternal 6- SNRPN, Paternal

So the genes expressed either paternal or maternal

One example is Prader-Willi syndrome

(deletion on chromosome 15 “q” arm )The deletion is the same in males and females, but the expression is different depending on who you received the normal version from.

In short, imprinting of the same region on chromosome 15 has been implicated for both Angelman (AS) and Prader-Willi (PWS) syndromes. However, it is the loss of the maternal contribution that is linked to Angelman syndrome and the loss of the paternal contribution that is linked to PWS. In each case, the presence of a second good copy of the gene(s) on the methylated, tightly packed copy of chromosome 15 is of no use in correcting the defect.

if that normal chromosome (which contain the gene) comes from the mother and the sperm has the defected gene here Prader Willi type of syndrome

The genes on the paternal copy have been deleted, and the genes on the maternal copy are turned off (inactive)PWS

If normal sperm fertilize defected chromosome in the ovum we will get angle man syndrome.

The genes on the maternal copy have been deleted, and the genes on the paternal copy are turned off (inactive) AS

Example Igf2 -insulin like growth factor 2-

Fetal growth-promoting hormone

Most fetal tissues they need this

Paternal copy expressed / transcribed (imprinted)

Maternal copy suppressed / inactivated (methylated ,, can’t produce Igf2)

Page 8 of 16

Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013 So paternal activation (produce the Igf2)

Gene must be marked when transmitted: imprinted from the father.

Note ,, *the imprinted gene is the paternal ,, the one that is in function.

Slide 32

If the maternal copy is mutated here u will get a normal sized mouse while if the paternal is mutated u will get a dwarf type of mouse because paternal copy is the active one (and the maternal is inactive)

Trinucleotide Repeat

- It’s a type of dynamic disease not fixed like in imprinting or mosaciam. Here it’s variable with age and time.

-So it’s mutation that changes upon transmission; means the number is increased from one generation to the other.

Trinucleotide Repeat Disorders Are the Best Example

Three Nucleotides Which Are Present in Increased Number

e.g. CAGCAGCAGCAGCAGCAGCAGCAGCAG (repeated CAG)

** these nucleotides could be in the coding region and could be in other areas.

**The number here is important -how many repeats they have at that sequence-

**So these repeats could be

Normal or it could be Disease Causing When Expanded Beyond a Certain Threshold, we might have

what we call pre-mutation it’s a mild disease or after that threshold we have just have a disease.

Below That Threshold They Are Stable Both in Mitosis and Meiosis

-This increase happen during the mitosis of that cell when they have certain number of that gene-

“Repeat disorders“ * for example x-fragile, Friedreich Ataxia, Huntington disease, and Myotonic dystrophy. All these diseases depend on the number of tri-repeats

Page 9 of 16

Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013

Intergenerational instability

- Repeat changes in size from parent to offspring, there is instability in the integration of DNA during replication.

- Sex of transmitting parent important is important female or male- Some more unstable from father, others from mother, In away also there is maternal or

paternal effect

*Repeats disorders : are a set of genetic disorders caused by trinucleotide repeat expansion, a kind of mutation where trinucleotide repeats in certain genes exceed the normal, stable threshold, which differs per gene.

Anticipation (symptoms become more severe in each successive generation).

Pre-mutation ; means Repeat size which is unstable but does not result in a phenotypebut that can expand into a full mutation when transmitted to offspring (Full mutations are associated with clinical symptoms of the disorder.)the number of these repeates -if we found that there’s pre mutation in the mother for example- we can expect their children to have full known type of mutation. That is why if the mother has a pre-mutation prenatal diagnosis should be done.

Genotype/Phenotype correlation

Again here depends on the severity of the disease. The more the repeated are increased in number the more the severity of that disease we can see in the patient.

-These repeats could be in the coding region

Diseases with a CAG expansion within the coding region, produce an enlarged polyglutamine tract Huntigngton, Spinocerebellar ataxia type 1)…

-In the non coding area could be

1 .Untranslated 5’ (Fragile X,syndrome, Spinocerebellar Ataxia type 2..)

2 .Untranslated 3’ (myotonic dystrophy)

3 .Intron (Friedreich ataxia, )

Slide 39 Here are examples of triple repeat disorders

Page 10 of 16

Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013 Fragile x ,, CGG repeats from 6-50 they are normal, & around 50-200 we call it pre-mutation and 200-2000 there is a mutation that leads to disease. Freidreich ataxia (Intron) Huntington disease (coding Seq.) Jacobsen syndrome (11 copies normal , 100-1000 diseased.

the number of the copies here is important to get the disease like we said.

((each disease its known where it cause the abnormalities, whether in the coding region or the 5’ or 3’ area or other areas.))

MITOCHONDRIAL GENETICS

The mitochondrion is Important orgenelle which is responsible of the generation of energy in the body, This organelle produces energy by oxidising organic acids and fats with oxygen by the process of oxidative phosphorylation and generates oxygen radicals (reactive oxygen species ROS )as a toxic by-product. –that’s why some people take anti-oxidants-

It contain circular double stranded DNA No crossing over or DNA repair Unlike Nuclear DNA. Many copies of the mitochondrial we can find in the same cell Around 37 genes Maternal inheritance (inherited from the mother not from the father).

Most of the genes are important in oxidative phosphorylation reactions.

If u compare the Mitochondrial DNA with the Nuclear DNA u can see that

1.5% maximum is the conserved area (the coding area -where they are responsible for the protein synthesis) while the mitochondria almost 93-95% are the coding area (producing proteins or enzymes).

highly conserved areas around 3% in Nuclear genome and 5% in mt-DNA. We don’t have transposon or heterochromatin or other non-conserved areas in mt-DNA.

Like we said 37 genes 2 genes are responsible ribosomal RNA, 22 Transfer RNA, 13 polypeptide coding for Oxidative phosphorylation.

90 nuclear genes coding peptide transported to mt to participate in Oxidative phosphorylation

No introns, some nucleotide participates in more than one gene

Page 11 of 16

Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013

Most cells contains at least 1000 mitochondrial DNA in each cell distributed among hundreds of individual mt

Mature oocyte has more than 100,000 copies of mtDNA. So in the ovum there is large amounts of mitochondria.

Mitochondrial DNA (mtDNA) contains 37 genes (13 encode polypeptides, 2 rRNA, and 22 tRNAs).

Mitochondrial Inheritance

completely inherited from the mother.

Important in oxidative phosphorylation.

The diseases generated due to mutation in these genes, generally we see it in multiple organs and Mainly these organs need high energy, for example we can see it in neurological diseases, we can see there is diabetes, we can see this in phosphorylation area where we need high

energy like in muscles .

During the division of the cell u remember that the segregation of chromosome is evenly distributed -in one daughter cell there is 23 chromosome and the other has 23 also). However the cytoplasm of the cell during division is not evenly distributed (one cell will have more cytoplasm than the other one). The same thing in mitochondria when the cell divides the mitochondria also will not be evenly distributed in the daughter cells (one cell may take 100 for example and the other one may take 50) so the number of mitochondria is different between the daughter cells. ((Absence of the tightly controlled segregation)).

The mitochondria, are distributed randomly between the two daughter cells. This process is known as replicative segregation.

Heteroplasmy: Variable expression of mt diseases, due to the un-equal distribution of the mitochondria so we will have hetero-characteristics. So the number of mitochondria that have mutation is different from the number of the normal ones so also we can say that we have heteroplasmy, If all the mitochondria have the same mutation then we call this homoplasmy

Page 12 of 16

Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013example

greennormal mitochondria Brownmutanat

When the cell divides we might get some cells which might have 80% mutation, other cell might have 60% others 40%, others are completely normal.

-So that is why the severity of the disease varies ,, for example we might find it in the central nervous system very severe while in the heart muscle much less or diabetes much less .

-The same thing we might find in one person the disease is severe while in others is mild depends on the number of the mutated mitochondria in that cell so this is heteroplasmy.

What are the enzymes that are controlled by the mitochondria

They are mostly important in the phosphyrlation and energy production in the human body

a. Pyruvate dehydrogenase .

b. Electron transport and OP enzymes .

c. Citric acid cycle enzymes .

d. Fatty acid oxidation enzymes.

Examples of mitochondrial diseases (slides 52+53)

MELAS (Mitochondrial Encephalomyopathy with Lactic Acidosis and Stroke-like episodes).

MERRF (Myoclonic Epilepsy with Ragged Red Fibres)

Leber Hereditary Optic Neuropathy (LHON)

So we have 8 mild different diseases all of them if u can see they affect multiple organs (for

example ,, in LHON affecet the optical nerve ,, MELAS mitochondrial encephalopathy , Lactic acidosis with stroke-like signs)

Slide 54

Page 13 of 16

Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013Mitochondrial Inheritance

If u look to the pedigree, it’s very typical u can find it (the disease) in each generation -which u may mix with autosomal dominance or x-linked dominance-.

But the main characteristic that the inheritance come from the mother never from the father, if the father is affectedall the children are normal.

If the mother is affected all the children are affected.

Note that Here (arrows) although the parents don’t have mutation the childrens are affected. here we are talking about Incomplete penetrance and Variable expression, the disease is there but the number of mitochondria affected is less than what is normal. So the clinical picture is very mild or is not seen, but it’s seen in her children.

FRAGILE S SYNDROMEThe characteristics of the patient

long face prominent ears and Macroorchidism Cognitive difficulties, Moderate to sever Mental Retardation Dependent and Attention and behavioral problems (they can’t live alone, always they

need somebody to take care of them). Connective tissue abnormalities. Anticipation. Hyperactivity, Autism (in 30-40% of the patient). In Females poor eye contact and shyness &Social anxiety.

Page 14 of 16

Complications

Incomplete penetrance Variable expression

Incomplete penetrance

Variable expressions

Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013

The problem here is when we have fragile x Which is responsible of producing certain protein and that protein is very important in the development of the brain, so if we have mutation the end result the gene that is mutated will not be able to produce functional protein which is mainly for brain development.

The consequences of expansion

methylation of the c (CCG) due to mispaired Cytosine number and thus increase template for methylation. (abnormal methylation).

And there is a lack of transcription of that gene where a disease will be seen and the protein loss and that loss will cause the disease

Pedigree

The females can be affected but the chance for males to be affected is almost double.

In the female carrier most likely

16-50% prevalence of Autism/ASD in Fragile X Syndrome 15% of women with FMR1 premutation 13% FMR1 premutation in familial POI - )primary ovarian insufficiency(

And Finally,

Page 15 of 16

Aseel Al-Momani Genetics Sheet #8 Date 15/4/2013

Sry for any mistakes & for the long sheet ;p , that’s what the doctor mentioned ;)

Dear Exams, Be Great, Slow Down, & Most Importantly, Be Easy to Us.

GOOD LUCK All ;D Aseel AL-Momani

Page 16 of 16