Flavobacterium johnsoniae gldN and gldO Are Partially RedundantGenes Required for Gliding Motility and Surface Localization of SprB�†
Ryan G. Rhodes, Mudiarasan Napoleon Samarasam, Abhishek Shrivastava, Jessica M. van Baaren,Soumya Pochiraju, Sreelekha Bollampalli, and Mark J. McBride*
Department of Biological Sciences, University of Wisconsin-Milwaukee, P.O. Box 413, Milwaukee, Wisconsin 53201
Received 13 November 2009/Accepted 18 December 2009
Cells of the gliding bacterium Flavobacterium johnsoniae move rapidly over surfaces. Mutations in gldN cause apartial defect in gliding. A novel bacteriophage selection strategy was used to aid construction of a strain with adeletion spanning gldN and the closely related gene gldO in an otherwise wild-type F. johnsoniae UW101 background.Bacteriophage transduction was used to move a gldN mutation into F. johnsoniae UW101 to allow phenotypiccomparison with the gldNO deletion mutant. Cells of the gldN mutant formed nonspreading colonies on agar butretained some ability to glide in wet mounts. In contrast, cells of the gldNO deletion mutant were completelynonmotile, indicating that cells require GldN, or the GldN-like protein GldO, to glide. Recent results suggest thatPorphyromonas gingivalis PorN, which is similar in sequence to GldN, has a role in protein secretion across the outermembrane. Cells of the F. johnsoniae gldNO deletion mutant were defective in localization of the motility proteinSprB to the cell surface, suggesting that GldN may be involved in secretion of components of the motility machinery.Cells of the gldNO deletion mutant were also deficient in chitin utilization and were resistant to infection bybacteriophages, phenotypes that may also be related to defects in protein secretion.
Cells of Flavobacterium johnsoniae, and of many other mem-bers of the phylum Bacteroidetes, crawl over surfaces at approx-imately 2 �m/s in a process called gliding motility. F.johnsoniae cells glide on agar, glass, polystyrene, Teflon, andmany other surfaces (16, 22). Cells suspended in liquid alsobind and propel added particles such as polystyrene latexspheres (23). The mechanism of this form of cell movement isnot well understood despite decades of research (15). Genomeanalyses suggest that F. johnsoniae gliding is genetically unre-lated to other well-studied forms of bacterial movement suchas bacterial flagellar motility, type IV pilus-mediated twitchingmotility, myxobacterial gliding motility, and mycoplasma glid-ing motility (10, 20, 21). Genes and proteins required for F.johnsoniae motility have been identified (1–3, 7–9, 17, 18).GldA, GldF, and GldG appear to form an ATP-binding cas-sette transporter that is required for gliding (1, 7). Eight otherGld proteins (GldB, GldD, GldH, GldI, GldJ, GldK, GldL,and GldM) are also required for movement (2, 3, 8, 9, 17, 18).Many of these are unique to members of the phylum Bacte-roidetes. Disruption of the genes encoding any of these 11proteins results in complete loss of motility. The mutants formnonspreading colonies, and individual cells exhibit no move-ment on agar, glass, Teflon, and other surfaces tested. The Gldproteins are associated with the cell envelope and presumablyconstitute the gliding motor, but none of them appear to beexposed on the cell surface. Mutations in sprA and sprB, whichencode cell surface proteins, result in partial motility defects.Cells form nonspreading colonies, but some of the cells exhibit
limited movement in wet mounts. SprA is required for efficientattachment to glass (22), and SprB appears to be a mobileadhesin that is propelled along the cell surface by the glidingmotor and thus transmits the force generated by the motor tothe surface over which cells crawl (10, 21). The surface local-ization of SprA and SprB and the phenotypes of sprA and sprBmutants suggest that the gliding motor is at least partiallyfunctional in these mutants but that force is inefficiently trans-mitted to the substratum. Analysis of the F. johnsoniae genomerevealed the presence of multiple paralogs of sprB, which mayexplain the residual motility of sprB mutants (20).
gldN lies downstream of gldL and gldM, and the three genesconstitute an operon (2). Cells with transposon insertions in gldNform nonspreading colonies that are indistinguishable from thoseof other gld mutants. However, unlike other gld mutants, gldNmutants exhibit some residual ability to glide in wet mounts (2).One possible explanation for this phenotype is that GldN mayhave a peripheral and nonessential role in gliding. Alternatively,GldN may perform a critical function in gliding, but in its absenceanother cellular protein may compensate for the missing GldNfunction. F. johnsoniae has a gldN paralog, gldO, that is locateddownstream of gldN but is transcribed independently (2). TheGldN and GldO proteins are 85% identical over their entirelengths, making GldO a prime candidate for a protein that mightcompensate for lack of GldN.
Recent results suggest that some of the F. johnsoniae Gldand Spr proteins, including GldN, may be components of anovel bacteroidete protein translocation apparatus referred toas the Por secretion system (PorSS) (28). This conclusionemerged from studies of gingipain protease secretion by thedistantly related nonmotile bacteroidete Porphyromonas gingi-valis. P. gingivalis is a human periodontal pathogen, and gingi-pain proteases are important virulence factors. Gingipainshave signal peptides that allow export across the cytoplasmicmembrane via the Sec machinery, but they rely on components of
* Corresponding author. Mailing address: Department of BiologicalSciences, 181 Lapham Hall, University of Wisconsin-Milwaukee, 3209N. Maryland Ave., Milwaukee, WI 53211. Phone: (414) 229-5844. Fax:(414) 229-3926. E-mail: [email protected].
† Supplemental material for this article may be found at http://jb.asm.org/.
the PorSS for secretion across the outer membrane (27–29). P.gingivalis cells with mutations in genes homologous to F.johnsoniae gldK, gldL, gldM, gldN, and sprA are defective in gin-gipain secretion across the outer membrane (28). F. johnsoniaehas a homologue to another P. gingivalis gene required for gingi-pain secretion, porT. Disruption of the F. johnsoniae porT homo-logue (referred to as sprT) results in motility defects and defectsin surface localization of SprB (28).
This study was designed to identify possible roles for GldNin motility and to determine whether GldN and GldO arepartially redundant components of the motility apparatus. Theresults demonstrate that F. johnsoniae GldN has an importantfunction in motility and that GldO can replace GldN in thisrole. They suggest that GldN is needed for efficient secretion of
the cell surface motility protein SprB, which may explain someof the motility defects of the gldN mutants.
MATERIALS AND METHODS
Bacterial strains, bacteriophages, plasmids, and growth conditions. F.johnsoniae ATCC 17061 strain UW101 was the wild-type strain used in this study(17, 20). F. johnsoniae MM101 is a direct descendant of F. johnsoniae ATCC 17061.Strain MM101 has a partial defect in chitin utilization, as previously described (17).The 39 spontaneous and chemically induced motile nonspreading mutants of F.johnsoniae UW101 were obtained from J. Pate and are designated UW102-1, -2, -3,-18, -24, -37, -43, -45, -46, -50, -51, -67, -73, -88, -91, -93, -95, -99, -103, -106, -128, -135,-136, -142, -143, -148, -149, -150, -155, -156, -158, -168, -171, -172, -176, -298, -301,-344, and -345 (4, 24, 32). F. johnsoniae strains were grown in Casitone-yeast extract(CYE) medium at 30°C, as previously described (19). To observe colony spreading,F. johnsoniae was grown on PY2 agar medium (1) at 25°C. Motility medium (MM)was used to observe movement of individual cells in wet mounts (14). The bacte-
TABLE 1. Plasmids and primers used in this study
Plasmid or primer Sequence and/or descriptiona Reference
PlasmidspCP23 E. coli-F. johnsoniae shuttle plasmid; Apr (Tcr) 1pCP29 E. coli-F. johnsoniae shuttle plasmid; Apr (Cfr Emr) 11pDH223 gldB in pCP11; Apr (Emr) 9pET30a Protein expression vector; Kmr NovagenpJVB8 1.1-kbp fragment between primers 711 and 717, encoding the C-terminal end of GldN, inserted into
EcoRI/SalI-digested pET30a; KmrThis study
pJVB9 2.3-kbp PCR product between primers 732 and 733 upstream of gldN, inserted into BamHI/SalI-cutpLYL03; Apr (Emr)
This study
pLYL03 Bacteroides-Flavobacterium suicide vector; Apr (Emr) 13pMK315 gldF in pCP29; Apr (Cfr Emr) 7pMM213 gldD in pCP23; Apr Kmr (Tcr) 8pMM265 gldJ in pCP11; Apr (Emr) 3pMM313 gldJ in pCP11; Apr (Emr) 3pNap3 3.0-kbp PCR product between primers 734 and 735 downstream of gldN, inserted into SalI/SphI-cut
pJVB9; for construction of gldNO deletion strain; Apr (Emr)This study
pSA11 gldA in pCP11; Apr (Emr) 1pSN48 sprA in pCP23; Apr Tcr (Tcr) 22pSN60 sprB in pCP29; Apr Kmr (Cfr Emr) 21pSP24 sprC in pCP23; Apr (Tcr) 26pTB79 gldN in pCP23; Apr (Tcr) 2pTB81a gldL in pCP23, expressed from the pCP23 orf1 promoter; Apr (Tcr) 2pTB94a gldM and the first 781 bp of gldN in pCP23. gldM expressed from the pCP23 orf1 promoter; Apr (Tcr) 2pTB97a gldO in pCP23; Apr Kmr (Tcr) 2pTB98 gldL, gldM, gldN, and gldO in pCP29; Apr Kmr (Cfr Emr) 2pTB99 gldK in pCP23; Apr (Tcr) 2
Primers398 5�TCTTTTAAAGCGTAATGAAAGC3�; primer in gldG399 5�CTGCAGGAAGTTCTCCCTGC3�; primer in gldG609 5�TGGGAATCATTTGAAGGTTGG3�; used for amplifying or sequencing chromosomal DNA
adjacent to IR1 of HimarEm1 or HimarEm2684 5�CAAAGGCTTGTCGTTATCAG3�; primer within gldO692 5�AAGGATTTCCTGCGATCGC3�; primer within gldM694 5�CAATGTATTTTCCTGTAGATACAGC3�; primer within gldN711 5�TTGCAAAGTCGACCACTAATAAGGGCAAAACC3�; used in construction of pJVB8b
717 5�TCTCAGAATTCGATAAGCCTTTAGCTTACG3�; used in construction of pJVB8c
732 5�GTTATGGGATCCGCTTATGGTATGGGAGCGGC3�; used in construction of pNap3d
733 5�TAGAAGGTCGACCTCCAGCGATAGAAACAATAGC3�; used in construction of pNap3b
734 5�AATGATGTCGACTCTGCGCTTCCTATTTCG3�; used in construction of pNap3b
735 5�CATATCGCATGCTTTCATACGATTTGTATCTGTAGCTGC3�; used in construction of pNap3e
939 5�ACAAGCCTCCTGCAATTCTCGAAG3�; primer downstream of gldO
a Antibiotic resistance phenotypes: ampicillin, Apr; cefoxitin, Cfr; erythromycin, Emr, kanamycin, Kmr; tetracycline, Tcr. Unless indicated otherwise, antibioticresistance phenotypes are those expressed in E. coli. Antibiotic resistance phenotypes listed in parentheses are those expressed in F. johnsoniae but not in E. coli.
b The SalI site is underlined.c The EcoRI site is underlined.d The BamHI site is underlined.e The SphI site is underlined.
riophages active against F. johnsoniae that were used in this study were �Cj1, �Cj13,�Cj23, �Cj28, �Cj29, �Cj42, �Cj48, and �Cj54 (4, 25, 32). Plasmids and primersused in this study are listed in Table 1. The plasmids used for complementation wereall derived from pCP1 and have copy numbers of approximately 10 in F. johnsoniae(1, 11, 19). Antibiotics were used at the following concentrations when needed:ampicillin, 100 �g/ml; cefoxitin, 100 �g/ml; erythromycin, 100 �g/ml; kanamycin, 35�g/ml; and tetracycline, 20 �g/ml.
Construction of a mutant lacking gldN and gldO. A 2.3-kb region of F.johnsoniae DNA which spans the upstream region of gldN (Fig. 1) was amplifiedusing primer 732 (which introduces a BamHI site), primer 733 (which introducesa SalI site), and Phusion high-fidelity DNA polymerase (New England Biolabs).The fragment was digested with BamHI and SalI and inserted into the suicidevector pLYL03 which had been digested with the same enzymes to generatepJVB9. A 3.0-kb region of F. johnsoniae DNA downstream of gldO was amplifiedusing primer 734 (which introduces a SalI site) and primer 735 (which introducesa SphI site). This fragment was digested with SalI and SphI and inserted intopJVB9 that had been digested with the same enzymes, to generate pNap3 (Fig.
1). Transfer of pNap3 by conjugation into wild-type F. johnsoniae UW101 fol-lowed by recombination resulted in strain CJ1624A, which carried wild-type anddeleted versions of the region spanning gldN and gldO. The known resistance ofgldN mutants to some bacteriophages (2) was used to select for a second recom-bination event resulting in loss of the plasmid and generation of a deletionspanning gldN and gldO. A 3-ml culture of F. johnsoniae CJ1624A was incubatedovernight at 25°C without antibiotic selection to allow for recombination and lossof the integrated plasmid. To 0.1 ml of these cells, 0.1 ml of bacteriophage �Cj1(108 PFU) was added. Cells with bacteriophage were incubated for 15 min at23°C and plated in 4 ml of CYE top agar overlaying CYE agar medium. Plateswere incubated for 2 days at 25°C, and surviving colonies were screened for lossof erythromycin resistance. The resulting strain, CJ1631A, carried a deletionwithin the region spanning gldN and gldO.
Transduction of gldN carrying a HimarEm2 insertion into F. johnsoniaeUW101. Cells of the gldN mutant F. johnsoniae CJ1304 carrying pTB79 (torestore motility and phage sensitivity) were grown overnight in MM at 25°C.Approximately 108 cells (0.2 ml of overnight growth in MM) were mixed with
FIG. 1. Map of the gldNO region and characterization of gldN and gldNO mutations. (A) Map of the gldNO region. Numbers below the maprefer to kilobase pairs of sequence. The sites of Himar insertions are indicated by triangles, and primers used for plasmid construction or forverification of strains are listed. The regions of DNA carried by the plasmid used to make the gldNO deletion (pNap3) and the regions of DNAcarried by the complementation plasmids pTB79, pTB81a, pTB94, pTB97a, pTB98, and pTB99 are indicated beneath the map. (B) Verificationof loss of gldN and gldO in the deletion mutant CJ1631A. PCR using primers 692 and 939, which flank the deletion, amplified a 3.4-kbp productfrom wild-type cells (UW101) and amplified a 1.5-kbp product from cells of the deletion mutant CJ1631A. PCR using primers 684 and 694, whichlie within the deleted region, resulted in a 1.1-kbp product from wild-type cells and no product from cells of the deletion mutant. (C) Verificationof transduction of HimarEm2 from F. johnsoniae CJ1304 (derived from F. johnsoniae MM101) into F. johnsoniae UW101. PCR using primer 692,which anneals within gldM, and primer 609, which anneals near the end of HimarEm2, amplified a 1.4-kbp product from the original gldN mutantCJ1304 and from the transductant CJ1743 but not from wild-type F. johnsoniae UW101.
VOL. 192, 2010 F. JOHNSONIAE GLIDING MOTILITY GENES gldN AND gldO 1203
approximately 105 PFU of �Cj54, incubated for 15 min at 23°C, and plated in 4ml CYE top agar overlay on CYE agar containing erythromycin. After incuba-tion overnight at 25°C, plates with confluent lysis were harvested by scraping theoverlay agar into 5 ml of a buffer consisting of 10 mM Tris and 8 mM MgSO4 (pH7.5) (TM buffer), followed by addition of 0.1 ml of chloroform and incubation for4 h at 23°C. Agar and debris were removed by centrifugation for 10 min at3,700 � g, and 0.1 ml of chloroform was added to the supernatant which con-tained the phage. Phage were stored at 4°C, and phage titers were determined byplating dilutions on lawns of wild-type cells. To avoid damaging effects of chlo-roform on recipient or host cells, phage were either diluted or incubated in opentubes at 30°C for 30 min to allow evaporation of chloroform prior to use. F.johnsoniae UW101 recipient cells for transduction were grown overnight in 10 mlMM in a 125-ml flask without shaking at 25°C. The cells (approximately 5 � 109)were sedimented by centrifugation for 10 min at 3,700 � g and resuspended in 1ml TM buffer containing 1 � 108 to 2.5 � 109 PFU (multiplicity of infection of0.02 to 0.5). Cells were incubated with phage for 15 min at 23°C, plated in 4 mlCYE top agar overlaying CYE agar containing erythromycin, and incubatedovernight at 30°C. Erythromycin-resistant transductants were streaked for isola-tion, and the resulting mutants were confirmed by PCR using primer 692 (whichbinds within gldM) and primer 609 (which binds near the end of HimarEm2). F.johnsoniae MM101 has a silent mutation within gldG, which lies 1.1 Mbp fromgldO. This can be used to distinguish strains derived from F. johnsoniae MM101from those derived from F. johnsoniae UW101. To verify that the mutation hadbeen transduced from CJ1304 (derived from F. johnsoniae MM101) into F.johnsoniae UW101, we amplified a fragment of gldG with primers 398 and 399and determined the nucleotide sequence.
Microscopic observations of cell attachment and movement. Wild-type andmutant cells of F. johnsoniae were examined for attachment to glass using aPetroff-Hausser counting chamber, as previously described (22). Cells weregrown overnight in MM at 25°C without shaking. Equal numbers of cells ofdifferent strains were introduced into the chambers, and the number of cells thatattached to the glass slide after a 2-min incubation was determined. Cells werealso examined for movement over glass and Teflon by phase-contrast microscopyat 25°C. Cells in MM were spotted onto a glass microscope slide and werecovered with a glass coverslip or with an oxygen-permeable Teflon membrane(Yellow Springs Instrument Co., Yellow Springs, OH), incubated for 1 min, andobserved for motility using an Olympus BH-2 phase-contrast microscope with aheated stage set at 25°C. Images were recorded using a Photometrics Cool-SNAPcf
2 camera and were analyzed using MetaMorph software (MolecularDevices, Downingtown, PA).
Measurements of chitin digestion. Chitin utilization on plates was observed aspreviously described (17) except that cells were cultured in MM overnight at25°C prior to spotting 2 �l on the MYA-chitin medium. For chitinase activityassays, 3-ml cultures of F. johnsoniae cells were grown in MM at 25°C overnightwith gentle mixing by rotation. Cells were pelleted by centrifugation at 21,000 �g for 10 min, and culture supernatants were filtered through a 0.22-�m polyvi-nylidene difluoride (PVDF) filter (Fisher Scientific). For whole-cell samples,cells were suspended in the original volume of a buffer consisting of 137 mMNaCl, 2.7 mM KCl, 10 mM Na2PO4, and 2 mM KH2PO4 (pH 7.4) (phosphate-buffered saline [PBS]). For cell lysates, cells were washed in PBS and suspendedin the original volume of bacterial protein extraction reagent (BPER) (ThermoFisher Scientific, Waltham, MA). Chitinase activity was determined by a modi-fication of the procedure described by Thompson et al. (31) using the syntheticsubstrates 4-methylumbelliferyl �-D-N-acetyl-glucosaminide (4-MU-GlcNAc),4-methylumbelliferyl �-D-N,N�-diacetyl-chitobioside [4-MU-(GlcNAc)2], and4-methylumbelliferyl �-D-N,N�,N�-triacetylchitotrioside [4-MU-(GlcNAc)3], whichwere each obtained from Sigma-Aldrich (St. Louis, MO). Specifically, 15 �l ofsample (supernatant, whole cells, or lysed cells) was added to 75 �l of Tris-buffered saline (50 mM Tris, 150 mM NaCl, pH 7.5) in a black half-well micro-titer plate (Greiner Bio-one, Frickenhausen, Germany). Reactions were startedby adding 10 �l of 1.0 mM fluorescent substrate, and plates were incubated at37°C for 4 h. Enzyme activity was detected using a BioTek Synergy HT micro-plate reader (BioTek Instruments, Inc., Winooski, VT) at an excitation wave-length of 360 nm and an emission wavelength of 460 nm. Standard curves usingauthentic 4-methylumbelliferone were used to determine pmol of substrate hy-drolyzed. Enzyme assays were performed in duplicate and averages calculated.Means and standard errors were determined from three independent experi-ments. Chitinase activities in whole cells, cell extracts, and cell-free supernatantsare indicated as pmol 4-methylumbelliferone released per �g of total protein inthe original cell suspension. Protein concentrations were determined by thebicinchoninic acid (BCA) assay (Thermo Fisher Scientific).
Measurements of bacteriophage sensitivity. Sensitivity to F. johnsoniae bacte-riophages was determined essentially as previously described by spotting 3 �l of
phage lysates (109 PFU/ml) onto lawns of cells in CYE overlay agar (9), exceptthat host cells were from overnight cultures in MM at 25°C. The plates wereincubated for 24 h at 25°C to observe lysis.
Expression of recombinant GldN and antibody production. A 1,110-bp frag-ment encoding the C-terminal 283 amino acids of GldN was amplified usingPhusion DNA polymerase (New England Biolabs, Ipswich, MA), primer 711(which introduces a SalI site), and primer 717 (which introduces an EcoRIsite). The product was digested with EcoRI and SalI and inserted intopET30a (Novagen, Madison, WI) which had been digested with the sameenzymes, to generate pJVB8. pJVB8 was introduced into Escherichia coliRosetta2(DE3) (Novagen), which produces seven rare tRNAs required forefficient expression of some F. johnsoniae proteins in E. coli (21, 22). Expres-sion was induced by addition of 1.0 mM IPTG (isopropyl-�-D-thiogalactopy-ranoside) and incubation for 3 h at 37°C. Cells were collected by centrifuga-tion and disrupted using a French pressure cell, and recombinant GldN waspurified by Ni affinity chromatography. Polyclonal antibodies against recom-binant GldN were produced and affinity purified using the recombinant pro-tein by Proteintech Group, Inc. (Chicago, IL).
Detection and localization of GldN, GldO, and SprB. Western blots wereperformed to detect GldN and GldO in extracts of wild-type and mutant cells ofF. johnsoniae. Overnight cultures were grown in MM at 25°C without shaking.Cells were pelleted by centrifugation at 4,400 � g for 10 min and suspended ina buffer consisting of 20 mM sodium phosphate and 10 mM EDTA, pH 7.5.Proteins were separated by SDS-PAGE essentially as described previously (12)and transferred to nitrocellulose membranes using a Trans Blot cell (Bio-Rad,Hercules, CA). Approximately 6 �g protein was loaded per lane. GldN andGldO were detected using antiserum against recombinant GldN, goat anti-rabbitsecondary antibody linked to horseradish peroxidase (Bio-Rad), and a Super-Signal West Pico detection kit (Thermo Fisher Scientific) with a Foto/AnalystLuminaryFx Workstation (Fotodyne, Hartland, WI). F. johnsoniae cells grown inMM at 25°C without shaking were fractionated into soluble, inner membrane(Sarkosyl-soluble), and outer membrane (Sarkosyl-insoluble) fractions as de-scribed previously (9) except that EDTA-free protease inhibitor cocktail(Thermo Fisher Scientific) was added to cells in 20 mM sodium phosphate–10mM EDTA (pH 7.5) before lysis in a French pressure cell. Proteins were sepa-rated by SDS-PAGE, and Western blotting was performed as described above.To detect SprB, cells were lysed using a French pressure cell as described above.Proteins (25 �g) were separated on 3 to 8% Criterion XT Tris-acetate acryl-amide gels (Bio-Rad) before transfer to nitrocellulose and detection as describedabove except that antisera against SprB were used (21).
Detection of surface-localized SprB. Movement of surface localized SprB wasdetected as previously described (21). Cells were grown overnight at 25°C in MMwithout shaking. Purified anti-SprB (1 �l of a 1:10 dilution of a 300-mg/literstock), 0.5-�m-diameter protein G-coated polystyrene spheres (1 �l of a 0.1%stock preparation; Spherotech Inc., Libertyville, IL), and bovine serum albumin(BSA) (1 �l of a 1% solution) were added to 7 �l of cells (approximately 5 � 108
cells per ml) in MM. The cells were spotted on a glass slide, covered with a glasscoverslip, and examined using an Olympus BH2 phase-contrast microscope witha heated stage at 25°C. Images were recorded with a Photometrics CoolSNAPcf
2
camera and analyzed using MetaMorph software. Samples were examined 1 minafter spotting, and images were captured for 30 s.
Wild-type and mutant cells were also examined by immunofluorescence micros-copy to identify cell surface-localized SprB. Cells were grown overnight in MM at25°C. Twenty microliters of cells was diluted in 130 �l of MM and fixed with 1%formaldehyde for 15 min. Cells were collected on 0.4-�m Isopore membrane filters(Millipore, Billerica, MA) by filtration. Cells were washed three times with 200 �l ofPBS and were blocked with 0.1% BSA in PBS for 30 min. After removal of theblocking solution by filtration, cells were exposed to 200 �l of a 1:200 dilution ofpurified anti-SprB (21) in PBS with 0.1% BSA for 90 min. Cells were washed fivetimes with 200 �l of PBS and exposed to 200 �l of F(ab�) fragment of goat anti-rabbit IgG conjugated to Alexa-488 (0.4 �g/ml; Invitrogen, Carlsbad, CA) in PBSplus 0.1% BSA. Cells were incubated for 60 min in the dark, the liquid was removed,and cells were washed five times with PBS. During the final PBS wash, 1 �l ofInSpeck 0.3% relative intensity fluorescence beads (Invitrogen-Molecular Probes,Eugene, OR) was added as a control. The final wash was removed by filtration, thefilters were mounted on glass slides with 6 �l of VectaShield with DAPI (4�,6�-diamidino-2-phenylindole) (Vector Laboratories Inc., Burlingame, CA), coverslipswere applied, and samples were observed using a Nikon Eclipse 50i microscope.Images were captured with a Photometrics CoolSNAPES camera with exposuretimes of 700 to 1200 ms (DAPI) and 500 ms (Alexa-488).
Construction of a gldNO deletion mutant and of an isogenicgldN mutant. Fragments upstream of gldN and downstream ofgldO were cloned into the bacteroidete suicide vector pLYL03to generate pNap3 (Fig. 1). Introduction of pNap3 into F.johnsoniae UW101 and selection for erythromycin resistanceresulted in integration of the vector into the genome by a singlerecombination event. Methods to select for loss of vector DNAby a second recombination event have not been reported for F.johnsoniae. To facilitate isolation of the gldNO deletion, wedeveloped a selection strategy that relies on the known resis-tance of F. johnsoniae motility mutants to bacteriophage infec-tion. gldN mutants are resistant to infection by �Cj1, �Cj13,�Cj23, and �Cj29 (2). Exposure of F. johnsoniae UW101 car-rying pNap3 integrated into its genome to �Cj1 resulted in theisolation of phage-resistant, erythromycin-sensitive colonies.These were analyzed by PCR using primer pairs 692/939 and694/684 (Fig. 1B) and by sequencing the amplified products.Each of seven phage-resistant erythromycin-sensitive coloniestested carried identical deletions within the region spanninggldN and gldO, and one of these (F. johnsoniae CJ1631A) wasselected for further study. This approach to deletion construc-tion is not suitable for all genes, but it is a general method forconstructing unmarked deletions within F. johnsoniae motilitygenes since in all cases examined, disruption of motility genesresults in resistance to one or more bacteriophages (1–3, 7–9,17, 18, 21, 22).
Strains with HimarEm insertions in gldN have previouslybeen isolated (2). The original HimarEm2 gldN mutant,CJ1304, was constructed in F. johnsoniae MM101, which is
derived from F. johnsoniae ATCC 17061 UW101 but has anunidentified mutation resulting in a partial deficiency in chitinutilization (17). In order to facilitate comparisons between theeffects of this gldN HimarEm2 mutation (in the chitin utiliza-tion-deficient background) and the gldNO deletion (in thechitin utilization-proficient background), a method was devel-oped to transduce the gldN HimarEm2 mutation from F.johnsoniae CJ1304 into F. johnsoniae UW101 using �Cj54.Bacteriophage �Cj54 was grown on F. johnsoniae CJ1304 car-rying pTB79, and the lysate was used to transduce the trans-poson, conferring erythromycin resistance, and adjacent chro-mosomal DNA into F. johnsoniae UW101, resulting in the gldNmutant F. johnsoniae CJ1743. The presence of the transposonin gldN was confirmed by PCR (Fig. 1C). To demonstrate thatthe mutation had been introduced into F. johnsoniae UW101,we took advantage of the fact that F. johnsoniae MM101 has asilent C-T mutation at position 114 (numbered from the firstnucleotide of the start codon of gldG). This mutation is located1.1 Mbp from gldN and gldO, making cotransduction unlikely.Amplification and sequencing of gldG verified that the trans-poson had been transduced into F. johnsoniae UW101. �Cj54was used for transduction in this study, but we also demon-strated that �Cj1, �Cj13, �Cj23, �Cj28, �Cj29, �Cj42, and�Cj48 can also be used to transduce markers between strainsof F. johnsoniae (data not shown). Phage transduction is auseful addition to the genetic tools available for F. johnsoniaeand should facilitate strain construction.
Either GldN or GldO is sufficient to allow formation ofspreading colonies. Motility phenotypes of wild-type F.johnsoniae UW101 and of isogenic strains carrying either a
FIG. 2. Photomicrographs of F. johnsoniae colonies. Colonies were incubated at 25°C on PY2 agar medium for 48 h, and photomicrographswere taken with a Photometrics CoolSNAPcf
2 camera mounted on an Olympus IMT-2 phase-contrast microscope. (A) Wild-type (WT) F.johnsoniae UW101 with control vector pCP23. (B) Wild-type F. johnsoniae UW101 with pTB79, which carries gldN. (C) Wild-type F. johnsoniaeUW101 with pTB97a, which carries gldO. (D) Wild-type F. johnsoniae UW101 with pTB98, which carries gldL, gldM, gldN, and gldO. (E) gldNmutant CJ1743 with pCP23. (F) gldN mutant CJ1743 with pTB79. (G) gldN mutant CJ1743 with pTB97a. (H) gldN mutant CJ1743 with pTB98.(I) gldNO deletion mutant CJ1631A with pCP23. (J) gldNO deletion mutant CJ1631A with pTB79. (K) gldNO deletion mutant CJ1631A withpTB97a. (L) gldNO deletion mutant CJ1631A with pTB98. Bars indicate 0.5 mm.
VOL. 192, 2010 F. JOHNSONIAE GLIDING MOTILITY GENES gldN AND gldO 1205
transposon insertion in gldN (CJ1743) or a deletion spanninggldN and gldO (CJ1631A) were examined. Wild-type cellsformed spreading colonies, whereas cells of the gldN mutantCJ1743 formed nonspreading colonies (Fig. 2A and E). Intro-duction of pTB79, which expresses gldN, into CJ1743 resultedin complementation and formation of spreading colonies (Fig.2F). Colony spreading was partially restored to CJ1743 byintroduction of pTB97a, which carries gldO, suggesting thatincreased levels of GldO can partially compensate for thedefect in gldN (Fig. 2G). The gldNO deletion mutant CJ1631Aformed nonspreading colonies (Fig. 2I) that were indistin-guishable from those of CJ1743. The ability to form spreadingcolonies was restored by introduction of pTB79 (which carriesgldN) and was partially restored by introduction of pTB97a(which carries gldO) (Fig. 2J and K). Introduction of pTB98(which carries gldL, gldM, gldN, and gldO) into wild-type cellsor into cells of the gldN or gldNO mutants resulted in theformation of small colonies that exhibited some spreading (Fig.2D, H, and L). The presence of pTB98 resulted in a decreasedgrowth rate, presumably because of deleterious effects of mod-erate overexpression of gldL, gldM, gldN, and gldO together. Asimilar effect was previously reported for cells expressing plas-mid-borne gldK and gldL together (2).
Disruption of gldN and gldO eliminates motility and resultsin decreased attachment to surfaces. Wild-type and mutantcells were examined for attachment to glass coverslips in aPetroff-Hauser counting chamber. Wild-type cells readily at-tached to glass, whereas few cells of the gldN or gldNO mutantstrains attached (Table 2). Complementation of the mutantswith pTB79, which carries gldN, or pTB97a, which carries gldO,restored attachment to glass to near-wild-type levels.
Wild-type cells moved rapidly over glass surfaces in wet mounts(see Movie S1 in the supplemental material). Cells of the gldNmutant CJ1743 were severely deficient in motility, but a few cellsexhibited some ability to glide (see Movie S2 in the supplementalmaterial). In contrast, cells of CJ1631A carrying a deletion span-ning gldN and gldO were completely nonmotile (see Movie S3 inthe supplemental material). Even the rare cells that attached to
the glass failed to exhibit any movements. Introduction of pTB79,which spans gldN, and pTB97a, which spans gldO, into the mu-tants resulted in restoration of motility (see Movies S4 and S5 inthe supplemental material), indicating that the presence of eitherGldN or GldO supports gliding. Essentially identical results wereobtained in separate experiments using Teflon membranes in-stead of glass coverslips, indicating that the attachment and mo-tility defects of gldN and gldNO mutants were not specific to glasssurfaces (data not shown).
Identification and localization of GldN and GldO. Anti-serum to GldN were used to detect GldN and GldO in cellextracts. GldN, which migrated with an apparent molecular massof approximately 36 kDa, was detected in extracts of wild-typecells (Fig. 3, lane 1) but was absent from extracts of the gldN
FIG. 3. Immunodetection of GldN and GldO. Whole-cell extractswere examined for GldN and GldO by Western blot analysis. Lane 1,wild-type F. johnsoniae with control vector pCP23. Lane 2, gldN mu-tant CJ1743 with pCP23. Lane 3, gldN mutant CJ1743 with pTB79,which carries gldN. Lane 4, gldN mutant CJ1743 with pTB97a, whichcarries gldO. Lane 5, gldNO deletion mutant CJ1631A with pCP23.Lane 6, gldNO deletion mutant CJ1631A with pTB79, which carriesgldN. Lane 7, gldNO deletion mutant CJ1631A with pTB97a, whichcarries gldO. Lane 8, gldNO deletion mutant CJ1631A with pTB98,which carries gldL, gldM, gldN, and gldO.
FIG. 4. Localization of GldN and GldO. (A) Fractionation ofGldN between soluble and particulate fractions. Cells of wild-type F.johnsoniae UW101 were disrupted and separated into soluble andmembrane fractions. Equal amounts of each fraction based on thestarting material were separated by SDS-PAGE, and GldN was de-tected by Western blot analysis. NaCl was added to some extracts todetermine whether the increased ionic strength would alter the local-ization of GldN. Lanes 1, 4, and 7, whole cells. Lanes 2, 5, and 8,soluble fraction. Lanes 3, 6, and 9, particulate fraction. Lanes 1, 2, and3, no salt added. Lanes 4, 5, and 6, 100 mM NaCl. Lanes 7, 8, and 9,500 mM NaCl. (B) Fractionation of GldN and GldO. Wild-type andmutant cells were disrupted and separated into soluble and membranefractions. Membranes were fractionated further by differential solubi-lization in Sarkosyl, and proteins were detected by Western blot anal-ysis. Equal amounts of each fraction based on the starting materialwere loaded in each lane. Lanes 1 to 4, wild-type F. johnsoniae withcontrol vector pCP23. Lanes 5 to 8, gldN mutant CJ1743 with pCP23.Lanes 9 to 12, gldNO deletion mutant CJ1631A with pTB97a, whichcarries gldO. Lanes 1, 5, and 9, whole-cell extracts. Lanes 2, 6, 10,soluble (cytoplasmic and periplasmic) fractions. Lanes 3, 7, and 11,Sarkosyl-soluble (cytoplasmic membrane) fractions. Lanes 4, 8, and 12,Sarkosyl insoluble (outer membrane) fractions.
TABLE 2. Effect of mutations in gldN and gldO on attachment ofcells to glass coverslips
Strain Description
Avg (SD) no. ofcells attached to0.03-mm2 region
of glass coverslipa
UW101 with controlplasmid pCP23
Wild type 171.6 (34.1)
CJ1743 with pCP23 gldN mutant 13.8 (6.6)CJ1743 with pTB79 gldN mutant complemented
with gldN121.5 (30.5)
CJ1743 with pTB97a gldN mutant complementedwith gldO
133.3 (31.5)
CJ1631A with pCP23 gldNO deletion mutant 0.4 (0.7)CJ1631A with pTB79 gldNO deletion mutant
complemented with gldN140.4 (62.4)
CJ1631A withpTB97a
gldNO deletion mutantcomplemented with gldO
96.6 (20.6)
a Approximately 2 � 106 cells in 2.5 �l of MM were introduced into a Petroff-Hausser counting chamber and incubated for 2 min at 25oC. Samples wereobserved using an Olympus BH-2 phase-contrast microscope, and cells attachedto a 0.03-mm2 region of the cover glass were counted. Numbers in parenthesesare standard deviations calculated from 12 measurements.
mutant CJ1743 and of the gldNO deletion mutant CJ1631A (Fig.3, lanes 2 and 5). Introduction of gldN on pTB79 restored pro-duction of GldN. Antiserum raised against GldN also recognizedGldO. GldO, which migrated with an apparent molecular mass ofapproximately 38 kDa, was not usually apparent in extracts ofwild-type cells but was detected in cells of the gldN mutantCJ1743 (Fig. 3 lane 2) or in cells expressing GldO from pTB97aor pTB98 (Fig. 3 lanes 4, 7, and 8).
GldN and GldO were found in both the soluble and partic-ulate fractions of cell extracts (Fig. 4). Addition of 100 and 500mM NaCl had no effect on this distribution, suggesting thatlocalization to the particulate fraction was not the result ofelectrostatic interactions (Fig. 4A and data not shown). GldNand GldO both have predicted cleavable signal peptides, butthey do not have obvious features of membrane proteins suchas additional predicted hydrophobic alpha-helical segments asexpected for cytoplasmic membrane proteins or extensive beta-sheet structure as expected for outer membrane proteins. Pro-grams used to predict protein localization did not allowprediction of localization with confidence. The subcellular lo-calization predictor Cello v.2.5 (34, 35) predicted that bothproteins were likely to localize to either the periplasm or outermembrane, and PSORTb (6) gave no prediction for eitherGldN or GldO. Sarkosyl has been demonstrated to solubilizecytoplasmic membrane proteins but not outer membrane pro-
teins of F. johnsoniae (9). Exposure to Sarkosyl resulted insolubilization of most of the GldN and GldO that were presentin the particulate (membrane) fraction (Fig. 4B), suggestingthat the proteins were associated with the cytoplasmic mem-brane. However, it is possible that exposure to Sarkosyl dis-rupted a protein complex containing GldN and GldO or thatthese proteins were loosely associated with the outer mem-brane and were solubilized by the detergent.
SprB is improperly localized in cells of the gldN and gldNOmutants. Comparative genome analysis revealed that the dis-tantly related nonmotile bacteroidete P. gingivalis has homo-logues to some of the F. johnsoniae motility genes, includinggldN (2, 20). P. gingivalis is a common cause of gum disease,and secretion of gingipain proteases is important for patho-genesis. Recent results suggest that the P. gingivalis “motility”proteins, such as the GldN homologue PorN, are required forsecretion of gingipain protease virulence factors rather thanfor cell movement (28). F. johnsoniae GldN may also be in-volved in protein secretion, and an inability to secrete cellsurface motility proteins could account for some of the motilitydefects of gldN mutants. Antibodies were used to examine thelocalization of SprB in wild-type cells, in cells with a transpo-son insertion in gldN, and in cells carrying a deletion spanninggldN and gldO. Each of these strains produced SprB protein(Fig. 5). Protein G-coated polystyrene spheres carrying anti-bodies against SprB were used to detect the presence of sur-face-exposed SprB on live cells. As previously reported (21),antibody-coated spheres attached specifically to wild-type cellsexpressing SprB and were rapidly propelled along the surfacesof the cells (Table 3; see Movie S6 in the supplemental mate-rial). Also as previously reported (21), such spheres failed toattach to sprB mutant cells, and Protein-G coated sphereswithout antibodies failed to bind to wild-type cells (Table 3; seeMovie S7 in the supplemental material). Antibody-coatedspheres failed to bind to cells of the gldNO deletion mutantCJ1631A (Table 3; see Movie S8 in the supplemental mate-rial), indicating that SprB was not exposed on the surface ofthese cells. Complementation of the gldNO mutant withpTB79, which carries gldN, or with pTB97a, which carries gldO,restored surface localization of SprB (Table 3; see Movie S9 inthe supplemental material). Cells of the gldN mutant CJ1743appeared to have some surface-localized SprB, since some cellsbound to the antibody-coated spheres. Surprisingly, although
FIG. 5. Western blot analysis of SprB in cells of wild-type andmutant F. johnsoniae strains. Cells were disrupted using a Frenchpressure cell, and samples were boiled in SDS-PAGE loading buffer.Proteins (25 �g per lane) were separated by electrophoresis, and SprBwas detected using anti-SprB antibody. Lane 1, molecular weightmarkers. Lane 2, wild-type F. johnsoniae carrying control plasmidpCP23. Lane 3, sprB mutant FJ156 carrying pCP23. Lane 4, gldNmutant CJ1743 carrying pCP23. Lane 5, gldNO deletion mutantCJ1631A carrying pCP23.
TABLE 3. Effect of mutations in gldN and gldO on binding of protein G-coated polystyrene spheres carrying antibodies against SprB
UW101 with control plasmid pCP23 Wild type None 0.3 (0.6)UW101 with pCP23 Wild type Anti-SprB 51.7 (4.0)FJ156 sprB mutant Anti-SprB 1.0 (1.0)CJ1743 with pCP23 gldN mutant Anti-SprB 21.0 (2.6)CJ1743 with pTB79 gldN mutant complemented with gldN Anti-SprB 45.7 (6.1)CJ1743 with pTB97a gldN mutant complemented with gldO Anti-SprB 46.7 (5.9)CJ1631A with pCP23 gldNO deletion mutant Anti-SprB 0.0 (0.0)CJ1631A with pTB79 gldNO deletion mutant complemented with gldN Anti-SprB 48.0 (4.6)CJ1631A with pTB97a gldNO deletion mutant complemented with gldO Anti-SprB 58.0 (2.6)
a Purified anti-SprB and 0.5-�m-diameter protein G-coated polystyrene spheres were added to cells as described in Materials and Methods. Samples were spottedon a glass slide, covered with a glass coverslip, incubated for 1 min at 25°C, and examined using a phase-contrast microscope. Images were recorded for 30 s, and 100randomly selected cells were examined for the presence of attached spheres during this period. Numbers in parentheses are standard deviations calculated from threemeasurements.
VOL. 192, 2010 F. JOHNSONIAE GLIDING MOTILITY GENES gldN AND gldO 1207
these cells bound some spheres, very few (fewer than 1% ofthose with spheres attached) were observed to move them. Incontrast, examination of 100 wild-type cells with antibody-coated spheres attached revealed that 90 of these cells rapidlypropelled the spheres during a 30-s observation. Cells of thegldN mutant CJ1743 that had been complemented with pTB79
or pTB97a behaved similarly to wild-type cells and rapidlypropelled attached spheres. The inability of gldN mutant cellsto propel spheres that were attached to surface-localized SprBmay indicate that GldN is directly involved in cell movement,in addition to its role in surface localization of SprB.
Analysis of surface exposure of SprB by immunofluores-cence microscopy of fixed cells confirmed that gldN and gldNOmutant cells are defective in surface localization of SprB (Fig.6). Cells of F. johnsoniae with mutations in another gene re-quired for efficient motility, sprT, also fail to efficiently assem-ble SprB on the cell surface, suggesting a defect in proteinsecretion (28). The decreased levels of SprB, and perhaps ofother motility proteins, on the cell surface may explain some ofthe motility defects exhibited by cells of the gldN and gldNOdeletion mutants.
Cells of the gldNO mutant fail to digest chitin. F. johnsoniaerapidly digests chitin (17, 30). Genome analysis identifiedfive potential chitinases predicted to cut the long chitinpolymers and four potential �-N-acetyl-glucosaminidasespredicted to release N-acetyl-glucosamine or chitobiosefrom the oligomers. Wild-type cells of F. johnsoniae rapidlydigested colloidal chitin, cells of the gldN mutant CJ1743digested chitin more slowly, and cells of the gldNO mutantCJ1631A were completely deficient in digestion of colloidalchitin (Fig. 7). In each case, complementation of the mu-tants with plasmids carrying gldN or gldO restored the abilityto digest chitin. In order to determine the reason for thedefect in colloidal chitin utilization of the gldN and gldNOmutants we examined chitinase activities in intact cells, cellextracts, and cell-free supernatants using the syntheticsubstrates 4-MU-GlcNAc, 4-MU-(GlcNAc)2, and 4-MU-(GlcNAc)3. Release of methylumbelliferone from 4-MU-GlcNAc is typically the result of �-N-acetyl-glucosamini-dases, release of methylumbelliferone from 4-MU-(GlcNAc)3 istypically the result of chitinases, and release of methylumbel-liferone from 4-MU-(GlcNAc)2 may be the result of eitheractivity. Intact cells and cell extracts released 4-meth-ylumbelliferone from each of the substrates, and there were
FIG. 6. Detection of surface-localized SprB protein by immunofluo-rescence microscopy. Cells of wild-type and mutant F. johnsoniae wereexposed to DAPI and to anti-SprB antibodies followed by secondaryantibodies conjugated to Alexa-488. The fluorescent spheres are InSpeckrelative intensity control fluorescence beads. WT, wild-type F. johnsoniaeUW101. sprB refers to the HimarEm2 sprB mutant FJ156. gldN refers tothe HimarEm2 gldN mutant CJ1743. gldNO refers to the gldNO deletionmutant CJ1631A. pCP23 is a control vector, pTB79 carries gldN, andpTB97a carries gldO. The bar indicates 10 �m.
FIG. 7. Mutations in gldN and gldO result in defects in chitin uti-lization. Approximately 106 cells of F. johnsoniae were spotted onMYA-chitin medium and incubated at 25°C for 4 days. (A) Wild-typeF. johnsoniae UW101 with control vector pCP23. (B) gldN mutantCJ1743 with pCP23. (C) gldN mutant CJ1743 with pTB79, which car-ries gldN. (D) gldN mutant CJ1743 with pTB97a, which carries gldO.(E) gldNO deletion mutant CJ1631A with pCP23. (F) gldNO deletionmutant CJ1631A with pTB79. (G) gldNO deletion mutant CJ1631Awith pTB97a.
no significant differences between the activities associatedwith wild-type and mutant cells (Fig. 8). Cell-free superna-tants from wild-type cells failed to digest 4-MU-GlcNAc buthad substantial activities against 4-MU-(GlcNAc)2 and4-MU-(GlcNAc)3. This suggests that the F. johnsoniae �-N-acetyl-glucosaminidases are primarily cell bound, as pre-dicted from bioinformatics analyses (20), but that cells se-crete one or more chitinases. Cell-free supernatants fromcells of the gldN mutant contained much lower levels ofchitinase activities, and supernatants of cells of the gldNOdeletion mutant contained no detectable chitinase activity(Fig. 8). Complementation with plasmids carrying gldN orgldO restored the soluble extracellular chitinase activities towild-type levels. These results suggest that one or morechitinases may be secreted via the proposed PorSS.
Bacteriophage resistance of gldNO mutants. Sensitivity to F.johnsoniae bacteriophages was determined as previously de-scribed (9) by spotting 5 �l of phage lysates (109 PFU/ml) ontolawns of cells in CYE overlay agar. The plates were incubatedfor 24 h at 25°C to observe lysis (Fig. 9). Wild-type F.johnsoniae showed complete lysis by all of the bacteriophages.The gldN mutant exhibited resistance to most of the bacterio-
phages but was partially susceptible to �Cj28 and �Cj54 (Fig.9B). In contrast, the gldNO mutant, F. johnsoniae CJ1631A,was resistant to infection by each of the phages (Fig. 9E).Introduction of the plasmids pTB79, which spans gldN, andpTB97a, which spans gldO, into the gldN mutant or the gldNOdeletion mutant resulted in restoration of sensitivity to each ofthe bacteriophages.
Many spontaneous or chemically induced motile non-spreading mutants have mutations in gldN or in other gldgenes. Pate and colleagues isolated numerous spontaneous andchemically induced nonspreading mutants, and 85 of these areavailable for analysis (4, 32). Forty-six of these mutants arecompletely nonmotile and have mutations in known gld genes,as previously reported (1–3, 7–9, 17, 18). Individual cells of theremaining 39 nonspreading mutants retain some ability to glidein wet mounts and were referred to as “motile nonspreading”mutants (4). The motility phenotypes of these mutants aresimilar to those of cells with transposon insertions in sprA,sprB, or gldN (2, 21, 22). Plasmids carrying each of the knowngld and spr genes were introduced into these mutants. Five ofthe mutants were complemented by pSN48, which spans sprA;four were complemented by pSN60, which spans sprB; one wascomplemented by pSP24, which carries sprC; and eight werecomplemented by pTB79, which carries gldN (Table 4). Fur-
FIG. 8. Chitinase and �-N-acetyl-glucosaminidase activities. Chiti-nase and �-N-acetyl-glucosaminidase activities of intact cells, celllysates, and culture supernatants of F. johnsoniae strains were deter-mined using the synthetic substrates 4-MU-GlcNAc, 4-MU-(GlcNAc)2,and 4-MU-(GlcNAc)3. Equal amounts of each sample, based on theprotein content of the cell suspension, were incubated with 10 nmol ofsynthetic substrate for 4 h at 37°C, and the amount of 4-MU releasedwas determined by measuring fluorescence emission at 460 nm follow-ing excitation at 360 nm. Yellow, wild-type F. johnsoniae UW101carrying control vector pCP23. Red, gldN mutant CJ1743 with pCP23.Dark blue, gldN mutant CJ1743 with pTB79, which carries gldN. Or-ange, gldN mutant CJ1743 with pTB97a, which carries gldO. Green,gldNO deletion mutant CJ1631A with pCP23. Pink, gldNO deletionmutant CJ1631A with pTB79. Light blue, gldNO deletion mutantCJ1631A with pTB97a. Error bars indicate standard errors.
FIG. 9. Mutations in gldN and gldO result in resistance to bacte-riophages. Bacteriophages (5 �l of lysates containing approximately109 phage/ml) were spotted onto lawns of cells in CYE overlay agar.The plates were incubated at 25°C for 24 h to observe lysis. Bacterio-phages were spotted in the following order from left to right, asindicated also by the numbers in panel A: top row, �Cj1, �Cj13, and�Cj23; middle row, �Cj28, �Cj29, and �Cj42; bottom row, �Cj48 and�Cj54. (A) Wild-type F. johnsoniae UW101 with control vector pCP23.(B) gldN mutant CJ1743 with pCP23. (C) gldN mutant CJ1743 withpTB79, which carries gldN. (D) gldN mutant CJ1743 with pTB97a,which carries gldO. (E) gldNO deletion mutant CJ1631A with pCP23.(F) gldNO deletion mutant CJ1631A with pTB79. (G) gldNO deletionmutant CJ1631A with pTB97a.
VOL. 192, 2010 F. JOHNSONIAE GLIDING MOTILITY GENES gldN AND gldO 1209
ther complementation analysis suggested that 18 of the re-maining 21 spontaneous and chemically induced motile non-spreading mutants had mutations in known gld genes (gldA,gldB, gldD, gldF, gldJ, gldK, gldL, and gldM) (Table 4). Disrup-tion of any of these gld genes results in complete loss of mo-tility, so the point mutations likely result in production ofpartially functional Gld proteins and thus cause less drasticeffects on motility. These gld mutants with partial function maybe useful in elucidating the roles of the individual Gld proteinsin motility and in protein secretion. Most of the gld and sprgenes were originally identified by transposon mutagenesis.The fact that 82 of 85 independently isolated spontaneous andchemically induced nonspreading mutants were complemented
with plasmids carrying the 15 known spr and gld genes suggeststhat few motility genes may remain to be identified.
DISCUSSION
The results described above demonstrate that GldN, or theGldN-like protein GldO, is essential for F. johnsoniae glidingmotility. GldN and GldO appear to be partially redundantcomponents of the motility machinery. Other gliding bacte-roidetes for which complete genome sequences are available,such as Flavobacterium psychrophilum (5), and Cytophagahutchinsonii (33), have single copies of gldN, so the presence ofsemiredundant GldN-like proteins may be a somewhat unusualfeature of F. johnsoniae. We do not know why F. johnsoniae hastwo GldN-like proteins. GldN and GldO may be producedunder different conditions and may allow optimal movementover different surfaces. GldN and GldO may function in pro-tein secretion as part of the F. johnsoniae PorSS. They arerequired for efficient surface localization of the SprB adhesin,which is thought to be one of the outermost components of themotility machinery. However, mislocalization of SprB cannotexplain all of the attachment and motility defects of the gldNOdeletion mutant. Unlike cells of the gldNO mutant, cells of sprBmutants retain significant ability to attach to and glide on glass(21). F. johnsoniae has several paralogs of sprB (20) that mayencode alternative adhesins for attachment to and movementover different surfaces. GldN and GldO may be required forsecretion of these proteins in addition to secretion of SprB,which might account for the complete loss of gliding motilityexhibited by the gldNO deletion mutant. It is possible thatGldN and GldO provide optimal secretion of different cellsurface adhesins required for optimal movement over differentsurfaces. This could provide an explanation for the presence ofthe seemingly redundant gldN and gldO genes in F. johnsoniae.
It has been known for decades that motility mutants of F.johnsoniae are often deficient in utilization of chitin and dis-play resistance to bacteriophages, but the underlying reasonsfor these pleiotropic effects were not understood (4). The iden-tification of cell surface motility proteins such as SprB (21) andof an apparent protein secretion system associated with glidingmotility (28) suggest explanations for these phenotypes. Cellswith mutations in sprB are resistant to some bacteriophages(21), suggesting the possibility that the mobile cell surfaceadhesin SprB serves as a receptor for these phages. SincegldNO mutants fail to efficiently assemble SprB on the cellsurface, such cells would be expected to be resistant to anybacteriophages that require SprB for attachment or entry intothe cell. However, gldNO mutants are resistant to all bacterio-phages tested, whereas sprB mutants are resistant to only asubset of bacteriophages (21). Many sprB-like genes arepresent in the F. johnsoniae genome (20). These may encodesemiredundant cell surface components of the motility machin-ery that may be secreted by the PorSS and serve as receptorsfor some of the bacteriophages that infect cells lacking SprB.The inability of gldNO mutants to secrete any of these recep-tors to the cell surface could explain the complete resistance toall bacteriophages. Other motility mutations that directly orindirectly disrupt the PorSS would also likely result in phageresistance. Our results also suggest an explanation for thechitin utilization defect of motility mutants such as those de-
TABLE 4. Complementation of spontaneous and chemicallyinduced motile nonspreading mutants by plasmids
a The motile nonspreading mutants were previously described (4, 24, 32). Theyform nonspreading colonies, but cells retain some ability to glide in wet mounts.
b These strains were described as completely nonmotile in the original publi-cations (4, 24, 32), but more recent observations indicate that a few cells exhibitsome motility in wet mounts.
c Partial complementation.d The strain was not complemented by plasmids carrying gldA, gldB, gldD, gldF,
ficient in gldN and gldO. The presence of extracellular chitinasesecreted by wild-type cells and the absence of secreted chiti-nase in the gldNO mutant suggest that the PorSS is involved inchitinase secretion as well as being involved in assembly of themotility apparatus. Further analyses may identify additionalfunctions of this secretion system.
The available evidence supports a model of F. johnsoniaemotility in which some of the Gld proteins constitute the “mo-tor” embedded in the cell envelope that propels SprB andrelated SprB-like adhesins along the cell surface, resulting incell movement (10, 21). GldN appears to be involved in assem-bly of the motility apparatus, since it is needed for localizationof SprB to the cell surface. Based on the work presented hereand on studies conducted with P. gingivalis (28), the F.johnsoniae protein secretion machinery involved in assembly ofSprB on the cell surface is likely to involve GldK, GldL, GldM,GldN, SprA, SprE, SprT, and perhaps several other proteins. Ifthese proteins are dedicated to protein secretion, then theremaining motility proteins (GldA, GldB, GldD, GldF, GldG,GldH, GldI, and GldJ) might be more directly involved in cellmovement. However, the separation between motility and se-cretion functions may not be complete. The apparent failure ofgldN mutant cells to propel the small amount of SprB that doesmake it to the surface suggests the possibility that GldN may haveother roles in motility besides localization of SprB and relatedproteins to the cell surface. Further studies are needed to deter-mine the range of functions performed by GldN and to determinewhich of the motility proteins are involved in assembly of themotility apparatus, which are involved in function of the appara-tus, and which, if any, are involved in both processes.
ACKNOWLEDGMENT
This research was supported by grant MCB-0641366 from the Na-tional Science Foundation.
REFERENCES
1. Agarwal, S., D. W. Hunnicutt, and M. J. McBride. 1997. Cloning and char-acterization of the Flavobacterium johnsoniae (Cytophaga johnsonae) glidingmotility gene, gldA. Proc. Natl. Acad. Sci. U. S. A. 94:12139–12144.
2. Braun, T. F., M. K. Khubbar, D. A. Saffarini, and M. J. McBride. 2005.Flavobacterium johnsoniae gliding motility genes identified by mariner mu-tagenesis. J. Bacteriol. 187:6943–6952.
3. Braun, T. F., and M. J. McBride. 2005. Flavobacterium johnsoniae GldJ is alipoprotein that is required for gliding motility. J. Bacteriol. 187:2628–2637.
4. Chang, L. Y. E., J. L. Pate, and R. J. Betzig. 1984. Isolation and character-ization of nonspreading mutants of the gliding bacterium Cytophaga johnso-nae. J. Bacteriol. 159:26–35.
5. Duchaud, E., M. Boussaha, V. Loux, J. F. Bernardet, C. Michel, B. Ker-ouault, S. Mondot, P. Nicolas, R. Bossy, C. Caron, P. Bessieres, J. F. Gibrat,S. Claverol, F. Dumetz, M. L. Henaff, and A. Benmansour. 2007. Completegenome sequence of the fish pathogen Flavobacterium psychrophilum. Nat.Biotechnol. 25:763–769.
6. Gardy, J. L., M. R. Laird, F. Chen, S. Rey, C. J. Walsh, M. Ester, and F. S. L.Brinkman. 2005. PSORTb v. 2.0: expanded prediction of bacterial proteinsubcellular localization and insights gained from comparative proteomeanalysis. Bioinformatics 21:617–623.
7. Hunnicutt, D. W., M. J. Kempf, and M. J. McBride. 2002. Mutations inFlavobacterium johnsoniae gldF and gldG disrupt gliding motility and inter-fere with membrane localization of GldA. J. Bacteriol. 184:2370–2378.
8. Hunnicutt, D. W., and M. J. McBride. 2001. Cloning and characterization ofthe Flavobacterium johnsoniae gliding motility genes gldD and gldE. J. Bac-teriol. 183:4167–4175.
9. Hunnicutt, D. W., and M. J. McBride. 2000. Cloning and characterization ofthe Flavobacterium johnsoniae gliding motility genes, gldB and gldC. J. Bac-teriol. 182:911–918.
10. Jarrell, K. F., and M. J. McBride. 2008. The surprisingly diverse ways thatprokaryotes move. Nat. Rev. Microbiol. 6:466–476.
11. Kempf, M. J., and M. J. McBride. 2000. Transposon insertions in the Fla-vobacterium johnsoniae ftsX gene disrupt gliding motility and cell division. J.Bacteriol. 182:1671–1679.
12. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature 227:680–685.
13. Li, L.-Y., N. B. Shoemaker, and A. A. Salyers. 1995. Location and charac-terization of the transfer region of a Bacteroides conjugative transposon andregulation of the transfer genes. J. Bacteriol. 177:4992–4999.
14. Liu, J., M. J. McBride, and S. Subramaniam. 2007. Cell-surface filaments ofthe gliding bacterium Flavobacterium johnsoniae revealed by cryo-electrontomography. J. Bacteriol. 189:7503–7506.
15. McBride, M. J. 2001. Bacterial gliding motility: multiple mechanisms for cellmovement over surfaces. Annu. Rev. Microbiol. 55:49–75.
16. McBride, M. J. 2004. Cytophaga-flavobacterium gliding motility. J. Mol.Microbiol. Biotechnol. 7:63–71.
17. McBride, M. J., and T. F. Braun. 2004. GldI is a lipoprotein that is requiredfor Flavobacterium johnsoniae gliding motility and chitin utilization. J. Bac-teriol. 186:2295–2302.
18. McBride, M. J., T. F. Braun, and J. L. Brust. 2003. Flavobacteriumjohnsoniae GldH is a lipoprotein that is required for gliding motility andchitin utilization. J. Bacteriol. 185:6648–6657.
19. McBride, M. J., and M. J. Kempf. 1996. Development of techniques for thegenetic manipulation of the gliding bacterium Cytophaga johnsonae. J. Bac-teriol. 178:583–590.
20. McBride, M. J., G. Xie, E. C. Martens, A. Lapidus, B. Henrissat, R. G. Rhodes,E. Goltsman, W. Wang, J. Xu, D. W. Hunnicutt, A. M. Staroscik, T. R. Hoover,Y. Q. Cheng, and J. L. Stein. 2009. Novel features of the polysaccharide-digesting gliding bacterium Flavobacterium johnsoniae as revealed by genomesequence analysis. Appl. Environ. Microbiol. 75:6864–6875.
21. Nelson, S. S., S. Bollampalli, and M. J. McBride. 2008. SprB is a cell surfacecomponent of the Flavobacterium johnsoniae gliding motility machinery. J.Bacteriol. 190:2851–2857.
22. Nelson, S. S., P. P. Glocka, S. Agarwal, D. P. Grimm, and M. J. McBride.2007. Flavobacterium johnsoniae SprA is a cell-surface protein involved ingliding motility. J. Bacteriol. 189:7145–7150.
23. Pate, J. L., and L.-Y. E. Chang. 1979. Evidence that gliding motility inprokaryotic cells is driven by rotary assemblies in the cell envelopes. Curr.Microbiol. 2:59–64.
24. Pate, J. L., and D. M. De Jong. 1990. Use of nonmotile mutants to identifya set of membrane proteins related to gliding motility in Cytophaga johnso-nae. J. Bacteriol. 172:3117–3124.
25. Pate, J. L., S. J. Petzold, and L.-Y. E. Chang. 1979. Phages for the glidingbacterium Cytophaga johnsonae that infect only motile cells. Curr. Microbiol.2:257–262.
26. Pochiraju, S. 2009. Role of cell surface and cytoplasmic membrane proteinsin Flavobacterium johnsoniae gliding motility. M.S. thesis. University of Wis-consin-Milwaukee, Milwaukee, WI.
27. Saiki, K., and K. Konishi. 2007. Identification of a Porphyromonas gingivalisnovel protein Sov required for the secretion of gingipains. Microbiol. Im-munol. 51:483–491.
28. Sato, K., M. Naito, H. Yukitake, H. Hirakawa, M. Shoji, M. J. McBride,R. G. Rhodes, and K. Nakayama. 2010. A protein secretion system linked tobacteroidete gliding motility and pathogenesis. Proc. Natl. Acad. Sci. U. S. A.107:276–281.
29. Sato, K., E. Sakai, P. D. Veith, M. Shoji, Y. Kikuchi, H. Yukitake, N. Ohara,M. Naito, K. Okamoto, E. C. Reynolds, and K. Nakayama. 2005. Identifica-tion of a new membrane-associated protein that influences transport/matu-ration of gingipains and adhesins of Porphyromonas gingivalis J. Biol. Chem.280:8668–8677.
30. Stanier, R. Y. 1947. Studies on non-fruiting myxobacteria. I. Cytophagajohnsonae, N. Sp., A chitin-decomposing myxobacterium. J. Bacteriol. 53:297–315.
31. Thompson, S. E., M. Smith, M. C. Wilkinson, and K. Peek. 2001. Identifi-cation and characterization of a chitinase antigen from Pseudomonas aerugi-nosa strain 385. Appl. Environ. Microbiol. 67:4001–4008.
32. Wolkin, R. H., and J. L. Pate. 1985. Selection for nonadherent or nonhy-drophobic mutants co-selects for nonspreading mutants of Cytophaga johnso-nae and other gliding bacteria. J. Gen. Microbiol. 131:737–750.
33. Xie, G., D. C. Bruce, J. F. Challacombe, O. Chertkov, J. C. Detter, P. Gilna,C. S. Han, S. Lucas, M. Misra, G. L. Myers, P. Richardson, R. Tapia, N.Thayer, L. S. Thompson, T. S. Brettin, B. Henrissat, D. B. Wilson, and M. J.McBride. 2007. Genome sequence of the cellulolytic gliding bacterium Cy-tophaga hutchinsonii. Appl. Environ. Microbiol. 73:3536–3546.
34. Yu, C. S., Y. C. Chen, C. H. Lu, and J. K. Hwang. 2006. Prediction of proteinsubcellular localization. Proteins 64:643–651.
35. Yu, C. S., C. J. Lin, and J. K. Hwang. 2004. Predicting subcellular localiza-tion of proteins for Gram-negative bacteria by support vector machinesbased on n-peptide compositions. Protein Sci. 13:1402–1406.
VOL. 192, 2010 F. JOHNSONIAE GLIDING MOTILITY GENES gldN AND gldO 1211
