1
JCM02270-13R3 1
Journal of Clinical Microbiology 2
Full length Paper (2883 words) 3
4
Full Title: 5
6
Virological Diagnosis of Central Nervous System Infections using 7
PCR coupled with Mass Spectometry Analysis of CSF samples 8
9
Running title: 10
Viruses Detection in CSF by PCR-MS 11
12
13
Nicolas Lévêque1, Jérôme Legoff
2, Catherine Mengelle
3, Séverine Mercier-Delarue
2, Yohan 14
N’guyen1, Fanny Renois
1, Fabien Tissier
1, François Simon
2, Jacques Izopet
3, Laurent 15
Andréoletti1 16
17 1Clinical and Molecular Virology Unit, University Hospital and EA-4684 Cardiovir SFR-CAP 18
santé, Faculty of Medicine, Reims, France; 2Microbiology laboratory, Saint-Louis University 19
Hospital and INSERM U941, Paris Diderot University, Paris, France; 3Department of 20
Virology, University Hospital and INSERM U1043, Toulouse Purpan, France. 21 22 23
None of the authors of the present manuscript have a commercial or other association that might 24 pose a conflict of interest (e.g., pharmaceutical stock ownership, consultancy). 25
26
27
28
29
30
31
32
*Corresponding author: Laurent Andréoletti, Clinical and Molecular Virology Unit, 33 University Hospital and EA-4684 CardioVir Faculty of Medicine, Reims, France, Avenue du 34 General Koenig, 51092 REIMS Cedex, France. Tel: (33) 3 26 78 39 93; Fax: (33) 3 26 78 41 35 34; E-mail: [email protected] 36
37
JCM Accepts, published online ahead of print on 6 November 2013J. Clin. Microbiol. doi:10.1128/JCM.02270-13Copyright © 2013, American Society for Microbiology. All Rights Reserved.
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
2
Abstract (266 words): 38
39
Viruses are the leading cause of central nervous system (CNS) infections ahead of bacteria, 40
parasites and fungal agents. A rapid and comprehensive virologic diagnostic testing method is 41
needed to improve the therapeutic management of hospitalized pediatric or adult patients. In 42
this study, we assessed the clinical performances of PCR amplification coupled with 43
electrospray ionization/time-of-flight mass spectrometry analysis (PCR-MS) for the diagnosis 44
of viral CNS infections. Three hundred and twenty-seven cerebrospinal fluid (CSF) samples 45
prospectively tested by routine PCR assays between 2004 and 2012 in two University 46
Hospital Centres (Toulouse and Reims, France), were retrospectively analyzed by PCR-MS 47
analysis using primers targeted to adenovirus, Human Herpesviruses (HHV1-8), 48
Polyomaviruses BK and JC, Parvovirus B19 and enterovirus (EV). PCR-MS detected single 49
or multiple virus infections in 190 (83%) of the 229 samples tested positive by routine PCR 50
analysis and in 10 (10.2%) of the 98 tested negative samples. PCR-MS results correlated well 51
with HSV1, VZV and EV detection by routine PCR assays (Kappa tests= 0.80 [0.69-0.92; 52
95%], 0.85 [0.71-0.98; 95%] and 0.84 [0.78-0.90; 95%], respectively), whereas a weak 53
correlation was observed with EBV (0.34 [0.10-0.58; 95%]). Twenty-six co-infections and 16 54
uncommon neurotropic viruses (HHV7 (n=13), Parvovirus B19 (n=2) and adenovirus (n=1)) 55
were identified by the PCR-MS analysis whereas only 4 co-infections had been prospectively 56
evidenced using routine PCR assays (P<0.01). In conclusion, our results demonstrated that 57
PCR-MS analysis is a valuable tool to identify common neurotropic viruses in CSF with, 58
however, limitations that were identified regarding EBV and EV detection, and may be of 59
major interest to better understanding the clinical impact of multiple or neglected virus 60
neurological infections. 61
62
63
64
65
66
67
68
69
Key-words: neurotropic viruses, central nervous system infections, virological diagnosis, 70
PCR, mass spectrometry. 71
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
3
Viruses are the leading cause of central nervous system (CNS) infections ahead of 72
bacteria, parasites and fungal agents (1,2). They are responsible for a wide spectrum of 73
neurological disorders ranging from the frequent and benign aseptic meningitis due to 74
enteroviruses to the rare but serious Herpes simplex encephalitis (3,4,5). Polymerase chain 75
reaction (PCR) has been recognized as the reference method for the diagnosis of viral CNS 76
infections (6,7,8,9,10). Gene amplification by PCR allows both sensitive and specific virus 77
detection in the cerebrospinal fluid (CSF). It also offers the rapid virological diagnosis 78
required to improve the therapeutic management by antiviral therapy in order to limit brain 79
necrosis in cases of Herpes simplex encephalitis or to increase cost savings in hospitalized 80
cases of enterovirus-related aseptic meningitis during the epidemic season (7,8,11,12). 81
Moreover, it has been shown that quantitation of viral nucleic acid by real-time PCR assay of 82
CSF was useful in monitoring the effectiveness of antiviral therapy as well as for establishing 83
the prognosis of the disease (13,14,15). However, the small volume of CSF available 84
combined with the wide number of DNA or RNA viruses potentially responsible for 85
meningitis or encephalitis makes it challenging to complete an exhaustive diagnostic profile. 86
Currently, the virological diagnosis is determined through the combination of multiple PCR 87
and RT-PCR assays leading to a virological detection in only 45% to 52% of clinically 88
suspected CNS infections (16,17). A comprehensive virologic diagnostic testing method is 89
needed for rapid and broad viral detection and quantitation in CSF samples of patients 90
hospitalized for CNS infections. 91
This study retrospectively assessed the clinical performance of a new technology 92
coupling PCR amplification to electrospray ionization/time-of-flight mass spectrometry 93
analysis (PCR-MS) for the diagnosis of viral CNS infections (18,19). Three hundred and 94
twenty-seven CSF specimens taken from patients hospitalized in two french university 95
hospital centers for clinically suspected CNS infections were retrospectively analysed using 96
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
4
the PCR-MS technique. The results obtained by PCR-MS analysis were compared to those of 97
the qualitative routine PCR assays used prospectively and to those of real-time quantitative 98
PCR assays performed retrospectively. 99
100
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
5
MATERIALS AND METHODS 101
Study design. Cerebrospinal fluid samples collected by the virology laboratories of the 102
university hospitals of Toulouse and Reims were retrospectively selected because: (i) they 103
have been categorized positive or negative by routine PCR assays detecting the main 104
neurotropic viruses, and (ii) a minimum volume of 300µL remained for each of them. The 105
selected samples were nucleic acid extracted followed by PCR-MS analysis at the virology 106
laboratory of the Saint-Louis hospital (Paris). The nucleic acids extracts corresponding to 107
positive or discordant CSF sample analyses obtained between routine PCR techniques and 108
PCR-MS were sent back to the virology laboratory of Reims in order to be tested using a third 109
molecular assay allowing a viral load assessment. 110
Clinical specimens. Three hundred and twenty-seven CSF samples were obtained from 111
136 children (sex ratio M/F: 1.7; median age: 6 year-old ranging from 2 to 18) and 182 adults 112
(sex ratio M/F: 0.9; median age: 54 year-old ranging from 19 to 105) hospitalized between 113
2004 and 2012 and routinely sent to the Toulouse and Reims laboratories for clinically 114
suspected neurological virus infections. Cerebrospinal fluids were tested prospectively for 115
Human Herpesviruses (HSV1, HSV2, VZV, CMV, EBV and HHV6), enterovirus and JC 116
virus by “in-house” and commercially available PCR assays used in daily practice in the two 117
laboratories (Table 1) (20,21,22,23,24,25,26). CSF samples had been routinely divided in 118
aliquots and stored at -80°C since the date of collection. 119
Among these 327 CSF samples, 229 had been prospectively tested positive for single 120
(n=225) and multiple (n=4) viral infections with the routinely used PCR assays whereas 98 121
were negative. The distribution of the virus positive CSF samples selected for the present 122
investigation is shown in Table 2. 123
124
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
6
PCR-electrospray ionization time-of-flight mass spectrometry (PCR-MS). CSF 125
samples were retrospectively analysed with the PLEX-ID system (Abbott Molecular, IL, 126
USA) as previously reported (18,19). Briefly, RNA and DNA were extracted from 300µL of 127
the clinical specimens using the PLEX-ID total nucleic acid isolation kits on the PLEX-ID FH 128
and SP instruments and recovered in 200µL. For each clinical sample, 80µl of nucleic acids 129
were then distributed by the PLEX-ID Fluid handler into 8 reaction wells of 96-well assay 130
plates and amplified with the Viral IC II Spectrum assay (Abbott Molecular, IL, USA) 131
containing primers targeted to adenovirus, Human Herpesviruses (HHV1-8), polyomaviruses 132
BK and JC, Parvovirus B19 (PVB19) and enterovirus (EV) (Table 3). Cycling was done on 133
the PLEX-ID TC (Mastercycler ProS-Eppendorf) according to the manufacturer’s 134
instructions. After desalting and purification, amplicons were analyzed by the PLEX-ID 135
Analyzer. Methanol-based aerosols containing denatured ionized amplicons were sprayed into 136
the mass spectrometer. The molecular weight of the amplicons was determined by an 137
electrospray-ionization time-of-flight mass spectrometer and converted to base composition 138
by database analysis. The virus was then identified by bioinformatics analysis of the base 139
composition signatures produced by the virus target genes in each sample (27,28). 140
Viral load assessment was obtained by quantifying the total number of amplicons against 141
an internal calibrant that is included in every well with a known copy number. The internal 142
calibrant competes with the amplicon for the same primers and PCR reagents; it additionally 143
serves as an internal PCR control to confirm negative results (19). 144
Discrepancy methods used for analysis of discordant results between routine PCR 145
assays and PCR-MS. CSF samples, that displayed: (i) either discordant results between 146
prospective and retrospective analyses; (ii) or additional viruses detected with PCR-MS that 147
were not included in prospectively used PCR panel, were tested with a third molecular 148
technique. The same nucleic acid extracts as used for PCR-MS analysis were tested either 149
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
7
with end-point PCR (JC/BK consensus kit, Argene bioMerieux, Verniolle, France) or real-150
time quantitative PCR (RT-qPCR) assays for HSV1 & 2, VZV, CMV, EBV, HHV6, HHV7, 151
PVB19, ADV and EV allowing viral load assessment in virus positive CSF samples except 152
for HHV7 (HSV1 HSV2 VZV R-Gene, CMV HHV6,7,8 R-Gene, EBV R-Gene, Adenovirus 153
R-Gene, Argene bioMerieux, Verniolle, France) (29,30) (Table 1). 154
The same real-time quantitative PCR techniques were also used to determine the viral load 155
levels in positive samples by both routine PCR assays and PCR-MS in order to compare them 156
with those assessed in the samples displaying discordant results. 157
Statistical analyses. The accuracy of the PCR-MS in detecting neurotropic viruses in 158
CSF samples was determined by sensitivity and specificity considering the routine PCR 159
assays used for CSF sample prospective analysis as the reference method. The Kappa test was 160
also used for measuring the agreement between PCR-MS system and routine PCR assays. The 161
Spearman’s rank correlation was used to evaluate linear associations between viral loads 162
assessed with the PCR-MS and the RT-qPCR assays used as third analytical technique. 163
Statistical analyses were carried out with SAS software, version 8.2 (SAS Institute, Cary, NC, 164
USA). Results were considered significant for two-sided P values <0.05. 165
166
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
8
RESULTS 167
Analysis of the 327 selected CSF samples by the PCR-MS system. Among the 229 CSF 168
samples prospectively tested positive using routine PCR assays, the PCR-MS system 169
identified 218 viruses in 190 specimens (Table 2). PCR-MS assay showed concordant results 170
with routine PCR techniques for 187 viruses (81.7%) corresponding to 183 positive CSF 171
samples (79.9%). The Kappa coefficients between the PCR-MS system and routine PCR 172
assays appeared to be higher than 0.80 for HSV, VZV and EV and 0.34 for EBV (Table 4). 173
By comparison to the routine PCR assays, the PCR-MS demonstrated sensitivity above 90% 174
for HSV and VZV, 80% for EV and about 30% for EBV. Specificity ranged from 97% for 175
HSV and EBV to 99% for VZV and EV. The low number of CMV, HHV6 and JCV positive 176
samples did not allowed us to assess the accuracy of the PCR-MS in detecting these 177
neurotropic viruses in CSF samples (Table 4). Moreover, PCR-MS identified 26 co-178
infections, whereas only 4 had been detected by routine PCR techniques (P<0.01). These co-179
infections consisted of 24 double infections and two triple infections. They involved (i) EV 180
and Human Herpesviruses (n=18 (70%) mainly EV-HHV6 (n=4) and EV-HHV7 (n=7)), (ii) 181
EV and other viral species (n=4 (15%)) and (iii) different species among Human 182
Herpesviruses (n=4 (15%)) (not shown). 183
Among the 98 negative CSF samples identified by routine PCR assays, ten classical 184
neurotropic viruses were detected with PCR-MS (10/98=10.2%). Interestingly, PCR-MS 185
identified 4 HSV CNS infections that were undetected by routine PCR assays (Table 2). 186
Finally, among the 327 CSF samples tested, PCR-MS identified 16 viruses that were not 187
initially included in the panel of neurotropic viruses detected by routine PCR assays (Table 188
2). These newly detected viruses were HHV7 (n=13), PVB19 (n=2) and ADV (n=1) (Table 189
2). 190
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
9
Analysis of discrepant results between routine PCR techniques and PCR-MS 191
using a third molecular technique. Clinical samples demonstrating discrepant results 192
between routine PCR techniques and PCR-MS were analyzed with a third molecular 193
technique consisting of either end-point (JCV) or real-time quantitative PCR assays (RT-194
qPCR) allowing virus detection and quantitation except for HHV7. Overall, 73 results were 195
discordant between routine PCR techniques and PCR-MS (Table 4). 196
Forty-six viral infections prospectively diagnosed by routine PCR techniques were not 197
detected retrospectively by PCR-MS. Among these 46 routine PCR positive and PCR-MS 198
negative CSF samples, 17 (37%) were confirmed positive by a third PCR assay, whereas 29 199
(63%) remained undetectable (Table 4). Nine of the 18 EBV and 8 of the 25 EV positive CSF 200
samples that were not detected retrospectively with PCR-MS, were confirmed by RT-qPCR 201
(Table 4). They demonstrated median viral loads significantly lower than those measured in 202
positive samples by both routine PCR and PCR-MS techniques (112 copies/mL [23-384] vs. 203
2620 [93-10000] (P<0.01) for EBV; 217 copies/mL [32-5650] vs. 3695 [97-212000] (P<0.01) 204
for EV). 205
Conversely, 27 neurotropic viruses were detected by the PCR-MS alone. Nine of these 206
27 viral detections (33.3%) were confirmed by the third molecular technique used to analyze 207
discrepant samples (Table 4). 208
Comparison of viral load assessment between PCR-MS and real-time 209
quantitative PCR assays. Correlation analysis of viral load levels obtained by PCR-MS and 210
RT-qPCR assays was performed for HSV, VZV, EBV and EV positive CSF samples. 211
Quantitative values between RT-qPCR and PCR-MS were compared and showed poor 212
correlation with r2 ranging from 0.003 (P=0.77) for HSV to 0.415 for EBV (P=0.08) (data not 213
shown). 214
215
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
10
DISCUSSION 216
The aim of this work was to assess the performance characteristics of a new test based 217
on a multiplex PCR amplification coupled with electrospray ionization/time-of-flight mass 218
spectrometry analysis (PCR-MS) for the diagnosis of viral CNS infections in comparison with 219
routine PCR assays used as reference methods. Among the 229 virus positive CSF samples, 220
PCR-MS results were well correlated with routine PCR techniques for HSV, VZV and EV 221
detection demonstrating Kappa coefficients greater than or equal to 0.8. The agreement was, 222
however, weaker for EBV detection (Kappa coefficient=0.34) since only 8 of the 26 EBV 223
positive CSF specimens selected were retrospectively detected by PCR-MS. This suggests a 224
sensitivity defect of the Viral Spectrum IC II kit regarding this virus (Table 4). 225
Among the 229 positive CSF samples tested, PCR-MS system failed to detect 46 226
viruses identified by routine PCR techniques (Table 4). Three hypotheses can be claimed to 227
explain these discrepancies: (i) nucleic acid degradation occurred either during the storage of 228
the samples from the date of collection or at the time of samples thawing; this hypothesis 229
could be particularly true for samples with low viral load (101 (44%) of the 229 positive CSF 230
samples selected for this study have displayed a viral load <500 copies/mL by RT-qPCR) and 231
RNA viruses such as EV not detected retrospectively in 25 of the 154 positive samples; (ii) 232
the PCR-MS technology has a lower sensitivity in comparison to routine PCR assays: the 233
quantitation of EBV and EV viral load levels revealed that they were significantly higher in 234
the concordant CSF samples positive by both techniques than in discordant CSF samples not 235
detected retrospectively by the PCR-MS; (iii) a higher concentration of nucleic acids in 236
extracts used for prospective analysis by routine classical techniques than in those used for 237
retrospective PCR-MS analysis: the ratio between the CSF volume subjected to extraction and 238
the elution volume of nucleic acids ranged from 2 (Toulouse ) to 4 (Reims) for routine PCR 239
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
11
analyses whereas it was of only 1.5 for PCR-MS analysis leading to signal loss particularly 240
for CSF samples with low viral loads. 241
Two main strengths of the PCR-MS technology have been highlighted in the present 242
investigation on CSF samples. First, this new technology significantly improved the detection 243
of multiple viral infections by comparison to routine PCR assays (26 vs. 4, P<0.01). These co-244
infections mainly involved EV and Human Herpes viruses. The clinical relevance of viral co-245
infections of the CNS remains undefined, especially for those infections including HHV-7 246
and/or HHV-6 (10,31). These viruses could be considered as an innocent bystander of the 247
immune response in the cerebrospinal fluid, passively carried in inflammatory cells to the 248
central nervous system. In contrast, simultaneous infection of the brain by several viruses 249
could also result in an increase of the inflammatory response, edema or cerebral necrosis. 250
Secondly, PCR-MS technology identified a significant number of viruses not included in the 251
panel of classical neurotropic viruses detected by routine PCR techniques. Human Herpes 252
Virus type 7 (n=13) is currently considered as an orphan virus with uncertain neuropathogenic 253
properties even if it is frequently detected in CSF samples, particularly of children (33,34). 254
The literature on the PVB19 (n=2) is much more extensive. Many neurological manifestations 255
have been described in patients infected with PVB19 such as encephalitis, aseptic meningitis, 256
vasculitis and peripheral neuropathy involving mostly children, and, in one third of the cases, 257
immunocompromised patients (35). Adenoviruses (n=1) are opportunistic viruses responsible 258
for severe disseminated infections in immunocompromised patients, particularly in bone 259
marrow transplant recipients (36). Their involvement in immunocompetent patients is limited 260
to rare cases of aseptic meningitis (37). Overall, the use of this innovative technology 261
combining PCR and mass spectrometry could drastically increase the panel of pathogens 262
detected by comparison with routine PCR assays. In a recent study, this new technology 263
allowed the detection and semi-quantitation in cardiac tissues of 84 different common or 264
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
12
uncommon viruses, including confirmed neurological pathogens such as dengue virus, West 265
Nile virus and Japanese or St. Louis encephalitis viruses (19). The addition to the Viral 266
Spectrum IC II kit panel of emerging viruses in neurological infectious diseases such as Nipah 267
virus, Hendrah, or parechoviruses as well as the combined detection of bacteria, fungi and 268
parasites would make this new technology more attractive and could facilitate its 269
implementation in clinical microbiology laboratories (38,39). 270
The quantitative aspect of the PCR-MS technology is, however, more questionable. 271
Quantitative values between RT-qPCR and PCR-MS were compared and showed poor 272
correlation with r2 less than or equal to 0.415 for all targets. The ability of the PCR-MS 273
technology to generate quantitative data in the CSF did not seem to be reliable through the 274
results obtained in the present work. 275
The qualitative approach proposed by the PCR-MS therefore implicates this new 276
technology as a rapid screening broad-spectrum method. In fact, results concerning all the 13 277
viral species detected by the Viral IC II Spectrum assay can be given to the clinician within 6 278
to 8 hours after the arrival of the sample in the laboratory. A single technician can carry out 279
this new technology using only one CSF aliquot of 300ȝL. In this way, PCR-MS technology 280
could find its place in clinical virology laboratories as a first line test to perform a rapid and 281
broad virological diagnosis in ICU patients with severe disease or in immunocompromised 282
patients at risk for developing a severe infection potentially induced by a wide range of viral 283
species (40). Moreover, PCR-MS technology could be the second line test used for 284
neurological infections in immunocompetent patients when conventional molecular 285
techniques detecting the most common pathogens such as HSV, VZV, EBV and EV were 286
negative. Following the qualitative analysis by PCR-MS allowing a rapid implementation of 287
appropriate medical care, a RT-qPCR would be performed in order to assess the viral load in 288
the CSF for prognosis and quantitative monitoring of the disease under proper potential 289
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
13
antiviral therapy (13,14,15). However, the sensitivity defect of the PCR-MS regarding EBV 290
and EV detection identified in our study could be a limitation of its use in its present form as a 291
first line test in clinical practice since sensitivity, at least equivalent to the current molecular 292
methods, is mandatory. Moreover, the cost of the PLEX-ID platform could also limit its 293
implementation in many clinical microbiology laboratories either as a widely used first-line 294
technique but also as a second-line test whose cost would then add to the molecular 295
techniques used routinely. 296
In conclusion, our results demonstrated that PCR-MS analysis is a valuable tool to 297
identify the main common neurotropic viruses responsible for meningitis and encephalitis in 298
hospitalized pediatric and adult patients. However, we observed lower sensitivity for the 299
detection of EBV and EV by the PCR-MS method. The results of this study suggest that 300
multiplex molecular platforms, such as PCR-MS, may allow for a greater understanding of 301
the pathophysiology of CNS viral infections by allowing for a better assessment of the clinical 302
implications of viral co-infections of the CNS and an increased understanding of the potential 303
pathogenicity of neglected neurotropic viruses. 304
305
306
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
14
Acknowledgments: We thank Abbott Ibis Biosciences for supporting our study with reagents 307
and instrumentation. Special thanks to Dr Marcus Picard-Maureau (Abbott GmbH & Co. KG, 308
Europe, Wiesbaden, Germany) who supervised the molecular analyses and interpreted the 309
mass spectra obtained from the PCR-MS system at Saint-Louis University Hospital. 310
311
Transparency Declaration: The data obtained for the CSF samples were independently 312
analysed and interpreted in the Reims clinical and molecular virology unit that possesses all 313
the final data bank. None of the authors of the present manuscript have a commercial or other 314
association that might pose a conflict of interest (e.g., pharmaceutical stock ownership, 315
consultancy). The corresponding author had full access to all the data of the study and had the 316
responsibility for the decision to submit this work for publication with the agreement of all 317
the co-authors. 318
319
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
15
REFERENCES 320
1. Glaser CA, Honarmand S, Anderson LJ, Schnurr DP, Forghani B, Cossen CK, 321
Schuster FL, Christie LJ, Tureen JH. 2009. Beyond viruses: clinical profiles and 322
etiologies associated with encephalitis. Clin. Infect. Dis. 43:1565-1577. 323
2. Somand D, Meurer W. 2009. Central nervous system infections. Emerg. Med. Clin. 324
North Am. 27:89-100. 325
3. Big C, Reineck LA, Aronoff DM. 2009. Viral infections of the central nervous 326
system: a case-based review. Clin. Med. Res. 7:142-146. 327
4. Brunel D, Lévêque N, Jacques J, Renois F, Motte J, Andréoletti L. 2008. Clinical 328
and virological features of an aseptic meningitis outbreak in North-Eastern France, 329
2005. J. Clin. Virol. 42:225-228. 330
5. Steiner I. 2011. Herpes simplex virus encephalitis: new infection or reactivation? 331
Curr. Opin. Neurol. 24:268-274. 332
6. DeBiasi RL, Kleinschmidt-DeMasters BK, Weinberg A, Tyler KL. 2002. Use of 333
PCR for the diagnosis of herpesvirus infections of the central nervous system. J. Clin. 334
Virol. 25:S5-11. 335
7. Ramers C, Billman G, Hartin M, Ho S, Sawyer MH. 2000. Impact of a diagnostic 336
cerebrospinal fluid enterovirus polymerase chain reaction test on patient management. 337
JAMA 283:2680-2685. 338
8. Stellrecht KA, Harding I, Woron AM, Lepow ML, Venezia RA. 2002. The impact 339
of an enteroviral RT-PCR assay on the diagnosis of aseptic meningitis and patient 340
management. J. Clin. Virol. 25:S19-26. 341
9. Tunkel AR, Glasser CA, Bloch KC, Sejvar JJ, Marra CM, Roos KL, Hartman 342
BJ, Kaplan SL, Scheld WM, Whitley RJ, and the Infectious Diseases Society of 343
America. 2008. The management of encephalitis: clinical practice guidelines by the 344
Infectious Diseases Society of America. Clin. Infect. Dis. 47:303-327. 345
10. Leveque N, Van Haecke A, Renois F, Boutolleau D, Talmud D, Andreoletti L. 346
2011. Rapid virological diagnosis of central nervous system infections by use of a 347
multiplex reverse transcription-PCR DNA microarray. J. Clin. Microbiol. 49:3874-348
3879. 349
11. King RL, Lorch SA, Cohen DM, Hodinka RL, Cohn KA, Shah SS. 2007. Routine 350
cerebrospinal fluid enterovirus polymerase chain reaction testing reduces 351
hospitalization and antibiotic use for infants 90 days of age or younger. Pediatrics. 352
120:489-496. 353
12. Nigrovic LE, Chiang VW. 2000. Cost analysis of enteroviral polymerase chain 354
reaction in infants with fever and cerebrospinal fluid pleocytosis. Arch. Pediatr. 355
Adolesc. Med. 154:817-821. 356
13. Dalwai A, Ahmad S, Pacsa A, Al-Nakib W. 2009. Echovirus type 9 is an important 357
cause of viral encephalitis among infants and young children in Kuwait. J. Clin. Virol. 358
44:48-51. 359
14. Persson A, Bergström T, Lindh M, Namvar L, Studahl M. 2009. Varicella-zoster 360
virus CNS disease-viral load, clinical manifestations and sequels. J. Clin. Virol. 361
46:249-253. 362
15. Weinberg A, Li S, Palmer M, Tyler KL. 2002. Quantitative CSF PCR in Epstein-363
Barr virus infections of the central nervous system. Ann. Neurol. 52:543-548. 364
16. Boriskin YS, Rice PS, Stabler RA, Hinds J, Al-Ghusein H, Vass K, Butcher PD. 365
2004. DNA microarrays for virus detection in cases of central nervous system 366
infection. J. Clin. Microbiol. 42:5811-5818. 367
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
16
17. Oostenbrink R, Moons KG, Theunissen CC, Derksen-Lubsen G, Grobbee DE, 368
Moll HA. 2001. Signs of meningeal irritation at the emergency department: how often 369
bacterial meningitis? Pediatr. Emerg. Care. 17:161-164. 370
18. Mengelle C, Mansuy JM, Da Silva I, Guerin JL, Izopet J. 2013. Evaluation of a 371
polymerase chain reaction-electrospray ionization time-of-flight mass spectrometry 372
for the detection and subtyping of influenza viruses in respiratory specimens. J. Clin. 373
Virol. 57:222-226. 374
19. Nguyen Y, Renois F, Leveque N, Giusti D, Picard-Maureau M, Bruneval P, 375
Fornes P, Andreoletti L. 2013. Virus detection and semiquantitation in explanted 376
heart tissues of idiopathic dilated cardiomyopathy adult patients by use of PCR 377
coupled with mass spectrometry analysis. J. Clin. Microbiol. 51:2288-2294. 378
20. Espy MJ, Uhl JR, Mitchell S, Thorvilson JN, Svien KA, Wold AD, Smith TF. 379
2000. Diagnosis of Herpes Simplex Virus infections in the clinical laboratory by Light 380
Cycler PCR. J. Clin. Microbiol. 38:795-799. 381
21. Espy MJ, Teo R, Ross TK, Svien KA, Wold AD, Uhl JR, Smith TF. 2000. 382
Diagnosis of Varicella-Zoster Virus infections in the clinical laboratory by Light 383
Cycler PCR. J. Clin. Microbiol. 38:3187-3189. 384
22. Gault E, Michel Y, Dehée A, Belabani C, Nicolas JC, Garbarg-Chenon A. 2001. 385
Quantification of Human Cytomegalovirus DNA by real-time PCR. J. Clin. Microbiol. 386
39:772-775. 387
23. Brengel-Pesce K, Morand P, Schmuck A, Bourgeat MJ, Buisson, M, Barguès G, 388
Bouzid M, Seigneurin JM. 2002. Routine use of real-time quantitative PCR for 389
laboratory diagnosis of Epstein–Barr virus infections. J. Med. Virol. 66:360-369. 390
24. Gautheret-Dejean A, Manichanh C, Thien-Ah-Koon F, Fillet A-M, Mangeney N, 391
Vidaud M, Dhedin N, Vernant JP, Agut H. 2002. Development of real-time 392
polymerase chain reaction assay for the diagnosis of human herpesvirus-6 infection 393
and application to bone marrow transplant patients. J. Virol. Meth. 100:27-35. 394
25. Verstrepen WA, Bruynseels P, Mertens AH. 2002. Evaluation of a rapid real-time 395
RT-PCR assay for detection of enterovirus RNA in cerebrospinal fluid specimens. J. 396
Clin. Virol. 25:S39-43. 397
26. Mengelle C, Kamar N, Mansuy JM, Sandres-Sauné K, Legrand-Abravanel F, 398
Miédougé M, Rostaing L, Izopet J. 2011. JC virus DNA in the peripheral blood of 399
renal transplant patients: a 1-year prospective follow-up in France. J. Med. Virol. 400
83:132-136. 401
27. Ecker DJ, Sampath R, Massire C, Blyn LB, Hall TA, Eshoo MW, Hofstadler SA. 402
2008. Ibis T5000: a universal biosensor approach for microbiology. Nat. Rev. 403
Microbiol. 6:553-558. 404
28. Ecker JA, Massire C, Hall TA, Ranken R, Pennella T-TD, Agasino Ivy C, Blyn 405
LB, Hofstadler SA, Endy TP, Scott PT, Lindler L, Hamilton T, Gaddy C, Snow 406
K, Pe M, Fishbain J, Craft D, Deye G, Riddell S, Milstrey E, Petruccelli B, Brisse 407
S, Harpin V, Schink A, Ecker DJ, Sampath R, Eshoo MW. 2006. Identification of 408
Acinetobacter species and genotyping of Acinetobacter baumannii by multilocus PCR 409
and mass spectrometry. J. Clin. Microbiol. .44:2921-2932. 410
29. Lévêque N, Renois F, Talmud D, Nguyen Y, Lesaffre F, Boulagnon C, Bruneval 411
P, Fornes P, Andréoletti L. 2012. Quantitative genomic and antigenomic enterovirus 412
RNA detection in explanted heart tissue samples from patients with end-stage 413
idiopathic dilated cardiomyopathy. J. Clin. Microbiol. 50:3378-3380. 414
30. Candotti D, Etiz N, Parsyan A, Allain J-P. 2004. Identification and characterization 415
of persistent human erythrovirus infection in blood donor samples. J. Virol. 78:12169-416
12178. 417
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
17
31. Yoshikawa T, Ihira M, Suzuki K, Suga S, Matsubara T, Furukawa S, Asano Y. 418
2000. Invasion by human herpesvirus 6 and human herpesvirus 7 of the central 419
nervous system in patients with neurological signs and symptoms. Arch. Dis. Child. 420
83:170-171. 421
32. Spencer JV, Lockridge KM, Barry PA, Lin G, Tsang M, Penfold ME, Schall TJ. 422
2002. Potent immunosuppressive activities of cytomegalovirus-encoded interleukin-423
10. J. Virol. 76:1285-1292. 424
33. Tanaka K, Kondo T, Torigoe S, Okada S, Mukai T, Yamanishi K. 1994. Human 425
herpesvirus 7: another causal agent for roseola (exanthem subitum). J. Pediatr. 125:1. 426
34. Van den Berg, J. S., J. H. van Zeijl, J. J. Rotteveel, W. J. Melchers, F. J. 427
Gabreëls, and J. M. Galama. 1999. Neuroinvasion by human herpesvirus type 7 in a 428
case of exanthem subitum with severe neurologic manifestations. Neurology. 52:1077. 429
35. Douvoyiannis M, Litman N, Goldman DL. 2009. Neurologic manifestations 430
associated with parvovirus B19 infection. Clin. Infect. Dis. 48:1713-1723. 431
36. Yilmaz M, Chemaly RF, Han XY, Thall PF, Fox PS, Tarrand JJ, De Lima MJ, 432
Hosing CM, Popat UR, Shpall E, Champlin RE, Qazilbash MH. 2013. Adenoviral 433
infections in adult allogeneic hematopoietic SCT recipients: a single center 434
experience. Bone Marrow Transplant. doi: 10.1038/bmt.2013.33. 435
37. de Ory F, Avellon A, Echevarria JE, Sanchez-Seco MP, Trallero G, Cabrerizo M, 436
Casas I, Pozo F, Fedele G, Vicente D, Pena MJ, Moreno A, Niubo J, Rabella N, 437
Rubio G, Pérez-Ruiz M, Rodríguez-Iglesias M, Gimeno C, Eiros JM, Melón S, 438
Blasco M, López-Miragaya I, Varela E, Martinez-Sapiña A, Rodríguez G, 439
Marcos MÁ, Gegúndez MI, Cilla G, Gabilondo I, Navarro JM, Torres J, Aznar 440
C, Castellanos A, Guisasola ME, Negredo AI, Tenorio A, Vázquez-Morón S. 441
2013. Viral infections of the central nervous system in Spain: a prospective study. J. 442
Med. Virol. 85:554-562. 443
38. Wilson MR. 2013. Emerging viral infections. Curr. Opin. Neurol. 26:301-306. 444
39. Zhong H, Lin Y, Su L, Cao L, Xu M, Xu J. 2013. Prevalence of human 445
parechoviruses in central nervous system infections in children: a retrospective study 446
in Shanghai, China. J. Med. Virol. 85:320-326. 447
40. Meyding-Lamadé U, Strank C. 2012. Herpesvirus infections of the central nervous 448
system in immunocompromised patients. Ther. Adv. Neurol. Disord. 5:279-296. 449
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Table 1. Extraction methods and PCR tests used by the Toulouse and Reims virology laboratories for prospective CSF analysis, and by Reims
virology laboratory for retrospective analysis of discordant results between routine PCR tests and PCR-MS.
Prospective analysis Retrospective analysis of discordant results
Toulouse University Hospital Reims University Hospital Reims University Hospital
Extraction method
MagNA Pure LC Total Nucleic kit
MagNA Pure LC instrument (Roche)
Until 2009:
QIAamp Viral RNA Mini Kit
QIAamp DNA Mini Kit (Qiagen)
Since 2009:
NucliSens EasyMAG instrument (bioMerieux)
PLEX-ID total nucleic acid isolation kit (Abbott)
Input sample volume 200µl
Output elution volume 100µl
Input sample volume 300µl
Output elution volume 75µl
Input sample volume 300µl
Output elution volume 200µl
PCR assay
HSV-1 & 2 In-house (20)
Herpes Consensus Generic
(Argene-bioMerieux)
HSV1 HSV2 VZV R-Gene (Argene-bioMerieux)
VZV In-house (21)
CMV In-house (22) CMV HHV6,7,8 R-Gene (Argene-bioMerieux)
EBV In-house (23) EBV R-Gene (Argene-bioMerieux)
HHV6 In-house (24) CMV HHV6,7,8 R-Gene (Argene-bioMerieux)
Enterovirus In-house (25) Enterovirus
Consensus (Argene-bioMerieux)
Enterovirus R-gene (Argene-bioMerieux)
In-house (29)
JCV In-house (26) JC/BK Consensus (Argene-bioMerieux) JC/BK Consensus (Argene-bioMerieux)
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Table 2. Detection of neurotropic viruses in 327 CSF samples using routine PCR assays and PCR-MS.
Positive CSF samples (n=229)
Negative CSF samples (n=98)
Routine PCR assays
PCR-MS Routine PCR assays PCR-MS
Total number of virus detected (%)
233 (100)
218 (93.6)
0
12 (12.2)
Number of positive CSF (%)
229 (100)
190 (83)
0
12 (12.2)
Monoinfections (%)
225/229 (98.3)
164/190 (86.3)
0
12/12 (100)
Coinfections (%)
4/229 (1.7)
26/190 (13.7)
0
0
Classical neurotropic viruses
HSV 25 27 0 4
VZV 16 19 0 0
CMV 1 1 0 0
EBV 26 11 0 5
HHV6 6 11 0 0
JCV 5 6 0 0
Enterovirus 154 129 0 1
Viruses not included in routine diagnosis
HHV7 ND 11 ND 2
ADV ND 1 ND 0
PVB19
ND 2 ND 0
Total 233 218 0 12
ND: not done.
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Table 3. Primers included in the Viral IC II Spectrum assay for virus detection in CSF samples using the PCR-MS.
Virus Targeted Gene Target forward primer sequence reverse primer sequence
Adenovirus Penton TCGTTCCTGCCCTCACAGATCACG TAGGTCCGGCGACTGGCGTCAGT
Adenovirus Hexon TTGCAAGATGGCCACCCCATCGAT TGTGGCGCGGGCGAACTGCA
BK/JC Polyomavirus VP1 TGATGGCCCCAACCAAAAGAAAAG TAGTTTTGGCACTTGCACGGG
BK/JC Polyomavirus VP2 TGCCTTTACTTCTAGGGCTGTACGG TAGTTTTGGCACTTGCACGGG
Enterovirus 5UTR TTCCTCCGGCCCCTGAATG TGAAACACGGGCACCGAAAGTAGT
Enterovirus 5UTR TGGCTGCGTTGGCGGCC TAGCCGCATTCAGGGGCCGGA
Erythrovirus (Parvovirus B19) NS1 TGGGCCGCCAAGTACTGGAAAAAC TGTTTTCATTATTCCAGTTAACCATGCCATA
Erythrovirus (Parvovirus B19) VP1 TTACACAAGCCTGGGCAAGTTAGC TCCTGAATCCTTGCAGCACTGTC
Gamma Herpesviridae DNA POL TAAGCAGCAGCTGGCCATCAA TGCCACCCCCGTGAAGCCGTA
Gamma Herpesviridae DNA POL TCGTCCCCATCGACATGTAC TACTGTGTCCAGCTTGTAGTCTGA
Gamma Herpesviridae DNA POL TGACTTTGCCAGCCTGTACCC TCAGGGTGGAGTAGCACAGGTT
HHV1-3 DNA POL TCTGGAGTTTGACAGCGAATTCGAG TGTTGTAACCGGTGGCGAACTCGGG
HHV6-7 DNA POL TCCGCGCGGTATAATGCATGATGG TAGAACATACGCGGTTCCGAGTCACAAA
HHV5 (CMV) DNA POL TCGCGCCCAGGTAGGC TGGCCCCGGCCTCGTAGTG
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from
Table 4. Comparison of neurotropic viruses’ detection with routine PCR and PCR-MS assays in the 327 CSF samples collected by the Reims
and Toulouse virology laboratories between 2004 and 2012.
Routine PCR assays
HSV VZV CMV EBV HHV6 JCV ENTEROVIRUS
Positive Negative Positive Negative Positive Negative Positive Negative Positive Negative Positive Negative Positive Negative
PC
R-M
S v
iru
s Positive 23 8δδ
15 4** 1 0 8 8££
6 5§ 5 1
§§ 129 1
&&
Negative 2δ
294 1* 307 0 326 18£ 293 0 316 0 321 25
& 172
Kappa test
[CI 95%] 0.80 [0.69-0.92] 0.85 [0.71-0.98] NC 0.34 [0.10-0.58] NC NC 0.84 [0.78-0.90]
Sensitivity
(%) 92 94 NC 31 NC NC 84
Specificity
(%) 97 99 NC 97 NC NC 99
CI 95%: Confidence interval 95%; NC: Not Calculated. δ
None of these 2 samples was shown to be positive for HSV DNA by a third PCR method.
δδ One of these 8 samples was shown to be positive for HSV DNA by a third PCR method.
* This sample was shown to be negative for VZV DNA by a third PCR method.
** One of these 4 samples was shown to be positive for VZV DNA by a third PCR method. £
Nine of these 18 samples were shown to be positive for EBV DNA by a third PCR method. ££
Two of these 8 samples were shown to be positive for EBV DNA by a third PCR method. §
Four of these 5 samples were shown to be positive for HHV6 DNA by a third PCR method. §§
This sample was shown to be negative for JCV DNA by a third PCR method. &
Eight of these 25 samples were shown to be positive for EV RNA by a third PCR method. &&
This sample was shown to be positive for EV RNA by a third PCR method.
on Novem
ber 7, 2020 by guesthttp://jcm
.asm.org/
Dow
nloaded from