Date post: | 20-Jan-2016 |
Category: |
Documents |
Upload: | job-douglas |
View: | 212 times |
Download: | 0 times |
Joanna KleinMarch 22, 2012
Sabbatical ActivitiesScience Research Institute - Administration
and Program DevelopmentCollaboration with Department of Energy Joint
Genome InstituteInvestigator in their interpret a genome for
education programPresented at the American Society for
Microbiology Conference for Undergraduate Education
Bonus VenturesBlended Learning Course DesignWriting project with Boyd SeeversService to communityService to department and college
A collaboration between Northwestern College
and Concordia University-St. Paul
The Science Research Institute (SRI) is a
year long program partnering college
science and math majors and high
school students with an interest in
Science, Engineering, Technology and
Math (STEM) areas with the purpose of
developing their knowledge and skills in
scientific study and research.
• 5 week Summer program (July 5- August 5, 2011)
• 32 high school students, 8 College students, 3 high school teachers, 4 college faculty – split between NWC and CSP•NWC Research projects
•Dale Gentry – field biology and ecology•Joanna Klein - microbiology
•CSP Research projects•Vivian Feng (Augsburg) - chemistry •Jonathan Zderad - statistics
• Academic Year Program• Research Symposium• Presentations at Mpls. and St. Paul high
schools• Service project – Elementary School Science
Night• Science Museum trip• 3M tour• College admissions information session• Banquet
2011-2012 Program
SRI - Sabbatical ActivitiesResearch
Attended ASM/NIGMS Learning Interventions Institute: Understanding Research Techniques to Study Student Interventions
Washington D.C., January 2011Learned techniques to research best practices
in STEM student learning and persistence Research design and methodology Statistical analysis Logic Models
Goal: Use SRI as a subject to answer the question how do students who are traditionally underrepresented in the sciences advance in scientific fields?
SRI Logic Model
Situation
Objective of program is to increase high school students persistence in stem and to aid in diversifying stem.
Inputs Outputs Outcomes/Impact
Need for science and math in the community/work force. Need for education.
Need for diversity in Stem education. Political factors. Funding factors. Research
Needs.
External Factors
Professors will want to continue to work on modules. Need for the program will continue.
Need for diversity in Stem field. Need for growth of Stem field.
Assumptions
Long Term Goals:
Students choose to go to college.
Students choose a major in the Stem field.
Students pursue a career in the Stem field.
Integrate diversity in the field of science and math.
Hinder the under-representation of people of color in the field of science and math.
Help community improve to provide a more knowledgeable and skilled work force.
Staffing
Time
Money/funding
Research Base
Technology
Materials/Resources
College mentor help
High school teacher help
Number of modules completed
Knowledge gained on pre/post data
Time (hours) spent on projects
Number of presentations conducted as a result of module research
Number of Service learning projects completed
Amount of research obtained from the modules
Number of hours spent mentoring high school students.
Number of students in program cycle
Short Term Goals:
Improving knowledge from pre-post tests for each module.
Leadership development among college mentors.
Increase in Student Learning.
Increasing motivation to take science and math classes.
Increase interest in college.
Increase interest in stem careers.
Increase presentation skills among High school students.
SRI Co-DirectorsDr. Joanna Klein, NWC & Dr. Shellie Kieke, CSP
SRI - Sabbatical Activities, con’t.Program Development
Networking MN STEM network
Attended annual meeting at Boston Scientific and presented poster
Breakthrough St. Paul
Developed and supervised course for high school teacher participant – Research as Pedagogy
SRI - Sabbatical Activities, con’t.General administration
Developed SRI page for NWC websiteAttended helped coordinate academic year events
Medtronic tour Snail Lake Restoration volunteer Science fair service project Be the Match drive
Planned and carried out 2011-2012 program Recruited, hired and paid participants Taught in summer program
Incorporated new research project
Beyond the sabbaticalContinue to partner with the NWC grant
office to write to foundations for continued supportOver $400,000 in support over the past 6 years
Worked with Master of Applied Psychology student intern from UW-Stout to develop a Logic Model and evaluation plan for SRI.
Currently planning for 2012-2013 program
Undergraduate Research in Microbial Genome Analysishttp://www.jgi.doe.gov/education/
genomeannotation.htmlStudents and instructors across the country
partner with the JGI in analysis of microbial genomes to: provide a research-based approach to teach
fundamental concepts in the life-science curriculumadvance our understanding of diverse microbes
Genomics and BioinformaticsGenome sequencing has revolutionized our
understanding of microorganisms and the role they play in important processes pathogenesisenergy production bioremediation global nutrient cyclesorigins, evolution, and diversity of life.
Currently, there are more than 3000 complete or nearly complete genome sequences of microbes available.
Phylogenetic Phylogenetic tree of tree of BacteriaBacteria
Handelsman (2004)Microbiol. Mol. Biol. Rev. 68: 669-685.
The problem: genome sequences from members of those phyla in yellowand orange are under-represented relative to those in red
Genomic Encyclopedia of Bacteria and Archaea (GEBA)goal is to sequence genomes from under-
represented phyla GEBA organisms
https://docs.google.com/View?id=dggwdv6s_2d9zhwf9f
Genome Projects
CTCTAACGCGCAAGCGCATATCCTTCTAGGTAGCGGGCAGTAGCCGCTTCAGGGAGGGACGAAGAGACCC AGCAACCCACAGAGTTGAGAAATTTGACTGGCATTCAAGCTGTCCAATCAATAGCTGCCGCTGAAGGGTG GGGCTGGATGGCGTAAGCTACAGCTGAAGGAAGAACGTGAGCACGAGGCACTGAGGTGATTGGCTGAAGG CACTTCCGTTGAGCATCTAGACGTTTCCTTGGCTCTTCTGGCGCCAAAATGTCGTTCGTGGCAGGGGTTA TTCGGCGGCTGGACGAGACAGTGGTGAACCGCATCGCGGCGGGGGAAGTTATCCAGCGGCCAGCTAATGC TATCAAAGAGATGATTGAGAACTGGTACGGAGGGAGTCGAGCCGGGCTCACTTAAGGGCTACGACTTAAC GGGCCGCGTCACTCAATGGCGCGGACACGCCTCTTTGCCCGGGCAGAGGCATGTACAGCGCATGCCCACA ACGGCGGAGGCCGCCGGGTTCCCTGACGTGCCAGTCAGGCCTTCTCCTTTTCCGCAGACCGTGTGTTTCT TTACCGCTCTCCCCCGAGACCTTTTAAGGGTTGTTTGGAGTGTAAGTGGAGGAATATACGTAGTGTTGTC TTAATGGTACCGTTAACTAAGTAAGGAAGCCACTTAATTTAAAATTATGTATGCAGAACATGCGAAGTTA AAAGATGTATAAAAGCTTAAGATGGGGAGAAAAACCTTTTTTCAGAGGGTACTGTGTTACTGTTTTCTTG CTTTTCATTCATTCCAGAAATCATCTGTTCACATCCAAAGGCACAATTCATTTTGAGTTTCTTTCAAAAC AAATCGTTTGTAGTTTTAGGACAGGCTGATGCACTTTGGGCTTGACTTCTGATTACCCTATTGTTAAATT AGTGACCCCTCTTAGTGTTTTCCTGTCCTTTATTTCGGAGGACGCACTTCGAAGATACCAGATTTTATGG GTCATCCTTGGATTTTGAAGCTTATAACTGTGACAAAAAATGTGAAGGGAAGAGATTTGAAACATGTGGA AGGAAAAGTGAGTGCAGACTATAAACTTCCAAAAAGACAAGCCCAAAATACACCTAAACGTTATGTCAGA TTATTTTGTTAAAATCAGTTGTTAGTGACGTCCGTACGTTAATAGAAAAAAGAATGCTTCAGTTTGGAGT GGTAGGTTTCTAGAGGGATTTATTGTGAAAGTATAAACTATTCAGGGCAATGGGACTGAGAGAACAGTGG GTAGAAAGGACCACTGAAGGAAAGGAAGAGAATTGGAAGGTAGATGAAAGAAGGAGCAAGAACCTGGGGA TGTTTTTTCCTTTTCACTTGTAATAGTAGTAACAGAAGCAATGGCAGACTGGCTTTTGTTTCTACTGTGT TAGAATGAATTGACAGGACAACTGGGCCTATTATTGTACTGTGCCAGAATACTGTAAAACAAAACTAAAC ATACTAGCTTGGTGGCTTGTAATTAATTACTTAAGTGGAGATTTTTATTTTTTTTTTATTTTTTTTTTAG ACGGAGTCTCACTTTGTCACCCAGGCTGGAGTGCAGTGGCGCGATCTCAGCTGACTGCAACCTCCTCCTC ACAGGTTCAAGGGAGATTCTCCTGCCTCAGCCTCCCGAGTAGCTAGGACTATAGGCATGTGCCACCACAC CTGGCTAATTTTGTATTTTTAGTAGAGATGGGATTTCTCCATGTTGGTCAGGCTGGTGTCAAAACTCTCG ATCTCAGGTGAACCGCCTGCCTCAGCCTTCCAAAGTGCTGGGATTACAGGCGTGAGCCACCGCGCCCTGC AGTTTTTTGTATTTTTAATAGAGACAGGGTTTCACCATGTTAGCCAGGATGGTCTCGATTTCCTGACCTC AGGTGATCTGCCCGCTTTGGCCTCCCAAAGTGCTGGGATTACAAGCATGAGCCACCGCGCCCGGCTCAAG
Bacterial Luciferase
Process of annotationDone automatically using computer softwareManual annotation is best
35% of computer generated annotations are wrong or are missing information.
Limitation of computer algorithmsDraw backs: Labor intensive and time
consuming
Manual Annotation
• IMG-ACT is a toolkit of online gene and genome analysis programs.
• Using IMG-ACT, students annotate genomes• provide human expertise necessary for
accurate, up-to-date, reliable annotation• Students contribute to the scientific community
and learn biological concepts through participating in original research
JGI Genome Annotation Workshop
Walnut Creek, CA, Jan. 2011
Genomic Encyclopedia of Bacteria and Archeae https://docs.google.com/View?
id=dggwdv6s_2d9zhwf9f Northwestern College has adopted the
genome of Cellulophaga lytica to study
Marine bacteriumIsolated from beach
mud near Limon, Costa Rica in 1969
Member of the Cytophaga-Flavobacterium-Bacteroides (CFB) groupPoorly characterized
branch of the tree of life
Has the ability to degrade cellulose Biofuel research http://www.infoplease.com/atlas/centralamerica.html
Cellulophaga lytica
http://travel.yahoo.com/p-travelguide-482616-limon_vacations-i
Cellulophaga lyticaGram negative FilamentousExhibits gliding motilityYellow pigmentation
H:\JGI IMG_ACT\C. lytica\Photos\C. lytica 63X video in water fast\C. lytica 63X video in water fast_t01.MOV
Beyond the SabbaticalIncorporated IMG-ACT into teaching and
researchSRI, Summer 2011Genetics, Fall 2011Microbiology, Spring 2012Principles of Biology 2, Spring 2012 Research Students: Stephen Erickson and Andy
JaegerNetworking
St. Thomas, St. John’s/St. Ben’s, Gustavus, U of MN, UN-Lincoln, St. Cloud, JGI
ASM Conference for Undergraduate Educators Johns Hopkins University, June 2011
Is it E. coli O157:H7? Using Bioinformatics to Develop and Test Hypothesesmanuscript submitted to Journal of
Microbiology and Biology EducationLeading an Elementary School Science Club:
A Service Learning Project for Microbiology Students
New Blended Learning Course Development
Writing ProjectGENETICS AND THE BIBLE: THE CURIOUS
CASE OF THE LEFT-HANDED BENJAMITESBoyd Seevers, Ph.D.; Joanna Klein, Ph.D.
Service to CommunityVolunteer with science program at Island
Lake ElementaryMember of organizing committeeOrganized help sessions for students working
on science fair projectsOrganized DNA activity for familiesInterviewed students
Recruited NWC college student volunteers for all of the above activities
Service to the Department and CollegeDepartment
Tri-Beta advisorContinued to advise, attend dept. meetings and
eventsTaught a session of Senior Seminar and
Microbiology Lab Assessment Committee
ePortfolio sub-committeeAdvising sub-committee
AcknowledgementsThank you to Northwestern College for
providing the opportunity and support. Funding received from Faculty Development
Grant and SRI grants