+ All Categories
Home > Documents > John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Date post: 16-Jan-2016
Category:
Upload: jerom
View: 23 times
Download: 0 times
Share this document with a friend
Description:
John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop John Fossella, PhD Sackler Institute. Tool #1: Genome Sequence Databases. The Human Genome Project. TIGR: 1 microbe per day: Sargasso Sea. Tool #2: Human Genome Variation Databases. - PowerPoint PPT Presentation
Popular Tags:
41
John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop John Fossella, PhD Sackler Institute
Transcript
Page 1: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

John Merck Fund Summer Instituteon the Biology of Developmental Disabilities

Genetics Workshop

John Fossella, PhDSackler Institute

Page 2: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

The Human Genome Project

TIGR: 1 microbe per day:Sargasso Sea

Tool #1: Genome Sequence DatabasesTool #1: Genome Sequence Databases

Page 3: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Tool #2: Human Genome Variation DatabasesTool #2: Human Genome Variation Databases

….AGTGTTCGATAGCTGTTGACATGATCGCTGTCGCTAATCTCGCTACACACACCACAGAATGACAATGATCGCTGTCGCTAATCTCTTTTCATAGACCACAGATTGACC ATGATCGCAGTCGCAGATCTCTCTTCATAGAGCACAGATCGACT ATGATCGCTGTCTCTAATCTCTTTCACATAGATCGAGATGGACA ATGATCGCTGAAGCTAATCTCTCGGCTTAGATCACAGATTGACA GTGATCGCTGTTGCTAATCTCTCTACCATAGATCACAGACTGAA GATCGCTCGATAGAAGAT…….

….AGTGTTCGATAGCTGTTGACATGATCGCTGTCGCTAATCTCGCTTCATAGATCACAGAATGACAATGATCGCTGTCGCTAATCTCTTTTCATAGACCACAGATTGACC ATGATCGCAGTCGCTAATCTCTCTTCATAGAGCACAGATCGACT ATGATCGCTGTCTCTAATCTCTTTCACATAGATCGAGATGGACA ATGATCGCTGAAGCTAATCTCTCGGCATAGATCACAGATTGACA GTGATCGCTGTTGCTAATCTCTCTACCATAGATCACAGACTGAA GATCGCTCGATAGAAGAT…….

Patient Group Control Group

Page 4: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Neuregulin –SchizophreniaRGS4 -SchizophreniaNeuroligin -Autism5HTT -Anxiety, DepressionCalcineurin -SchizophreniaDYX1C1 –Reading disorderDRD4 –ADHDFMRP -Fragile XMAOA –AggressionGPR56 -Frontal cortex structure

Tool #3: Genetic Origins of PsychopathologyTool #3: Genetic Origins of Psychopathology

Page 5: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Tool #4: Brain Gene Expression DatabasesTool #4: Brain Gene Expression Databases

Page 6: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Tool #5: Mouse Models of Tool #5: Mouse Models of Brain Development and BehaviorBrain Development and Behavior

QuickTime™ and aPhoto - JPEG decompressor

are needed to see this picture.

“The LIM-homeobox gene Lhx8 is required

for the development of

many cholinergic

neurons in the mouse

forebrain”

Zhao et al. (2003) PNAS 100 (15) pp. 9005-9010

Page 7: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

The ScientistVolume 17, June 2003

Whole-Genome SNP Genotyping

Four highly parallel approaches make the technically intractable a reality

Tool #6: High Throughput GenotypingTool #6: High Throughput Genotyping

Page 8: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop
Page 9: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.

QuickTime™ and aTIFF (LZW) decompressor

are needed to see this picture.

Ha

riri

et

al.

, (2

00

2)

Sc

ien

ce

Page 10: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

There are many issues to consider There are many issues to consider When designing a behavioral or imaging-genetics study:When designing a behavioral or imaging-genetics study:

What phenotype(s) ?What phenotype(s) ?a chance to integrate multiple levels of analysisa chance to integrate multiple levels of analysis

Population Structure & Study design ?Population Structure & Study design ?families, volunteers & patientsfamilies, volunteers & patients

What genetic markers or candidate genes ?What genetic markers or candidate genes ?biological pathwaysbiological pathways

Genotyping technologyGenotyping technologycost & conveniencecost & convenience

Statistical analysis and reporting of dataStatistical analysis and reporting of datastatistical nightmare, biology can light the waystatistical nightmare, biology can light the way

A few grant writing and IRB issuesA few grant writing and IRB issues

Page 11: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Goal of the Genetics Workshop:

Impart an understanding of:

1. The molecular nature of DNA2. Of the structure of a gene & genome3. Of variation in the genome4. Of the historical origins of variation5. How 1-5 are used in the design of studies

Page 12: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

The molecular structure of DNA

Page 13: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

How many bases ?How many genes ?How many variable sites ?

Page 14: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Goal of the Genetics Workshop:

Impart an understanding of:

1. The molecular nature of DNA2. Of the structure of a gene & genome3. Of variation in the genome4. Of the historical origins of variation5. How 1-5 are used in the design of studies

Page 15: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

What is a gene ?

The Central Dogma

Page 16: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Goal of the Genetics Workshop:

Impart an understanding of:

1. The molecular nature of DNA2. Of the structure of a gene & genome3. Of variation in the genome4. Of the historical origins of variation5. How 1-5 are used in the design of studies

Page 17: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Single Nucleotide Polymorphisms (SNPs) …AGTTCGATTGCTCGATAGCACGAT……AGTTCAATTGCTTGATAGCACGAT……AGTTCGATTGCTTGATAGCTCGAT…

Repeats…AGTTCAATTGCTTGATAGCGCGAT…

…AGTTCAATTGCTTGCTTGCTTGATAGCGCGAT…

Deletions…AGTTCAATTGATAGCGCGAT…

3 million polymorphic sites

Page 18: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Protein Structure PolymorphismsPolymorphisms in the DRD4 gene

Page 19: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

DRD4

DA facilitatesNMDA and Ca++ influx

(permits weight change)

DA

Glu

CB1, BDNF

mGlu

D2short

MAOA

MAOA

COMT

Page 20: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

DA Receptor

G-protein Beta-arrestin

Page 21: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Protein StructureProtein StructureValine / Methionine Polymorphisms in the COMT gene

Page 22: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Gene Regulation Polymorphisms

5HTT “long” allele lower 5HT

5HTT “short” allelehigher 5HT

Why are carriers of the 5HTT “short” allele more susceptible to affective disorders ?

Page 23: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Goal of the Genetics Workshop:

Impart an understanding of:

1. The molecular nature of DNA2. Of the structure of a gene & genome3. Of variation in the genome4. Of the historical origins of variation5. How 1-5 are used in the design of studies

Page 24: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Single Nucleotide Polymorphisms (SNPs) …AGTTCGATTGCTCGATAGCACGAT……AGTTCAATTGCTTGATAGCACGAT……AGTTCGATTGCTTGATAGCTCGAT…

Repeats…AGTTCAATTGCTTGATAGCGCGAT…

…AGTTCAATTGCTTGCTTGCTTGATAGCGCGAT…

Deletions…AGTTCAATTGATAGCGCGAT…

3 million polymorphic sites

Page 25: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

DNA ReplicationDNA Replication

“Mistakes”

Page 26: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop
Page 27: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

HumanGTGATGAC

BonoboGTGCTGAC

ChimpanzeeGTGCTGAC

GorillaGTGCTGAT

OrangutanATGCTGAT

A to G change

T to C change

C to Achange

The collection of “mistakes” is an history book of evolution

Page 28: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

“Mitochondrial Eve”& Y-chromosomal Adam

Page 29: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop
Page 30: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop
Page 31: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Goal of the Genetics Workshop:

Impart an understanding of:

1. The molecular nature of DNA2. Of the structure of a gene & genome3. Of variation in the genome4. Of the historical origins of variation5. How 1-5 are used in the design of studies

Page 32: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

….AGTGTTCGATAGCTGTTGACATGATCGCTGTCGCTAATCTCGCTACACACACCACAGAATGACAATGATCGCTGTCGCTAATCTCTTTTCATAGACCACAGATTGACC ATGATCGCAGTCGCAGATCTCTCTTCATAGAGCACAGATCGACT ATGATCGCTGTCTCTAATCTCTTTCACATAGATCGAGATGGACA ATGATCGCTGAAGCTAATCTCT

CGGCTTAGATCACAGATTGACA GTGATCGCTGTTGCTAATCTCTCTACCATAGATCACAGACTGAA GATCGCTCGATAGAAGAT…….

….AGTGTTCGATAGCTGTTGACATGATCGCTGTCGCTAATCTCGCTTCATAGATCACAGAATGACAATGATCGCTGTCGCTAATCTCTTTTCATAGACCACAGATTGACC ATGATCGCAGTCGCTAATCTCTCTTCATAGAGCACAGATCGACT ATGATCGCTGTCTCTAATCTCTTTCACATAGATCGAGATGGACA ATGATCGCTGAAGCTAATCTCTCGGCATAGATCACAGATTGACA GTGATCGCTGTTGCTAATCTCTCTACCATAGATCACAGACTGAA GATCGCTCGATAGAAGAT…….

Efficient Executive Attention Group Poor Executive Attention Group

How do we know that the yellow T influences variation in executive attention ?

Page 33: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

“T”

Pedigree, family-based design

Page 34: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Efficient Executive Attention Group Poor Executive Attention Group

60% “T”

5% “T”

Case-control design: Qualitative trait

Page 35: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Efficient Executive Attention Group Poor Executive Attention Group

60% “T”

5% “T”

Case-control design: Qualitative trait

Page 36: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

Efficient Chopstick Dexterity Group Poor Chopstick Dexterity Group

60% “T”

5% “T”

Case-control design: Qualitative trait

Page 37: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

All

ele

1A

llel

e “T

Attentional Efficiency

Asian

Non-asian

Case-control design: Quantitative trait

Page 38: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

All

ele

1A

llel

e “T

Dexterity with chopsticks

Asian

Non-asian

Case-control design: Quantitative trait

Page 39: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

(rare) between group vs. (abundant) within group variation

Page 40: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

There are many issues to consider There are many issues to consider When designing a behavioral or imaging-genetics study:When designing a behavioral or imaging-genetics study:

What phenotype(s) ?What phenotype(s) ?a chance to integrate multiple levels of analysisa chance to integrate multiple levels of analysis

Population Structure & Study design ?Population Structure & Study design ?twins, families, volunteers & patientstwins, families, volunteers & patients

What genetic markers or candidate genes ?What genetic markers or candidate genes ?biological pathwaysbiological pathways

Genotyping technologyGenotyping technologycost & conveniencecost & convenience

Statistical analysis and reporting of dataStatistical analysis and reporting of datastatistical nightmare, biology can light the waystatistical nightmare, biology can light the way

A few grant writing and IRB issuesA few grant writing and IRB issues

Page 41: John Merck Fund Summer Institute on the Biology of Developmental Disabilities Genetics Workshop

http://www.roche.com/home/science/sci_gengen/sci_gengen_cdrom/sci_gengen_cdrom_online.htm

Roche Genetics Education Online Course

https://www5.nationalgeographic.com/genographic/atlas.html

National Genographic’s Genographic Project


Recommended