+ All Categories
Home > Documents > John Patrick Publishing · 2020-06-26 · 255 Saint Paul of the Cross Parish, Pittsburgh, PA...

John Patrick Publishing · 2020-06-26 · 255 Saint Paul of the Cross Parish, Pittsburgh, PA...

Date post: 29-Jun-2020
Category:
Upload: others
View: 6 times
Download: 0 times
Share this document with a friend
12
Transcript
Page 1: John Patrick Publishing · 2020-06-26 · 255 Saint Paul of the Cross Parish, Pittsburgh, PA (third) John Patrick Publishing Company • 1-800-333-3166 • CHURCH BULLETIN ADVERTISING
Page 2: John Patrick Publishing · 2020-06-26 · 255 Saint Paul of the Cross Parish, Pittsburgh, PA (third) John Patrick Publishing Company • 1-800-333-3166 • CHURCH BULLETIN ADVERTISING
Page 3: John Patrick Publishing · 2020-06-26 · 255 Saint Paul of the Cross Parish, Pittsburgh, PA (third) John Patrick Publishing Company • 1-800-333-3166 • CHURCH BULLETIN ADVERTISING
Page 4: John Patrick Publishing · 2020-06-26 · 255 Saint Paul of the Cross Parish, Pittsburgh, PA (third) John Patrick Publishing Company • 1-800-333-3166 • CHURCH BULLETIN ADVERTISING
Page 5: John Patrick Publishing · 2020-06-26 · 255 Saint Paul of the Cross Parish, Pittsburgh, PA (third) John Patrick Publishing Company • 1-800-333-3166 • CHURCH BULLETIN ADVERTISING
Page 6: John Patrick Publishing · 2020-06-26 · 255 Saint Paul of the Cross Parish, Pittsburgh, PA (third) John Patrick Publishing Company • 1-800-333-3166 • CHURCH BULLETIN ADVERTISING
Page 7: John Patrick Publishing · 2020-06-26 · 255 Saint Paul of the Cross Parish, Pittsburgh, PA (third) John Patrick Publishing Company • 1-800-333-3166 • CHURCH BULLETIN ADVERTISING
Page 8: John Patrick Publishing · 2020-06-26 · 255 Saint Paul of the Cross Parish, Pittsburgh, PA (third) John Patrick Publishing Company • 1-800-333-3166 • CHURCH BULLETIN ADVERTISING
Page 9: John Patrick Publishing · 2020-06-26 · 255 Saint Paul of the Cross Parish, Pittsburgh, PA (third) John Patrick Publishing Company • 1-800-333-3166 • CHURCH BULLETIN ADVERTISING
Page 10: John Patrick Publishing · 2020-06-26 · 255 Saint Paul of the Cross Parish, Pittsburgh, PA (third) John Patrick Publishing Company • 1-800-333-3166 • CHURCH BULLETIN ADVERTISING

255 Saint Paul of the Cross Parish, Pittsburgh, PA (third) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

CHURCH BULLETIN ADVERTISING

This happens for thousands every day with church bulletin advertising!The constant visual presence your business needs to succeed.

DOES YOUR ADVERTISING

• Establish a relationship?

• Build a friendship?

• Earn referrals?

• Generate a testimony?

• Capture repeat business?

Community support worthy of patronizing!

1.800.333.3166 ext. 161 | www.JPPC.net

©iS

tock

.com

/Joh

nPat

rick

Publ

ishi

ng

FAMIL IAR • TRUSTED • PROVEN EFFECT IVE . . . NOW THAT’S ADVERTISING!NOW THAT’S ADVERTISING!

Jp JOHN PATRICKpublishing company, inc.

Page 11: John Patrick Publishing · 2020-06-26 · 255 Saint Paul of the Cross Parish, Pittsburgh, PA (third) John Patrick Publishing Company • 1-800-333-3166 • CHURCH BULLETIN ADVERTISING

225 Mt. Lebanon Blvd.Castle Shannon, PA

(412) 561-5150 (412) 561-5150Proudly owned and

operated by John & Kathy Santonastasso

Windows R UsWindows R UsWindows • Roofing • Siding • Repairs

Lifetime Warranty • 0% FinancingNow Offering Roofi ng and Siding Repairs! Free Inspections!

1116 Castle Shannon Blvd. Castle Shannon, PA 15324412-892-9960 • www.windowsruspgh.com

Full Service Pharmacy with Old Fashioned Style

Immunizations CompoundingFree Delivery

250 Mt. Lebanon Blvd. 412.561.2347

Nancy Russell McKenna REALTOR®

#1 Real Estate Company in PA, OH, WV and NY

www.howardhanna.com412-561-7400, Ext. 292412-561-7400, Ext. 292

[email protected]

701 Washington Rd., Pittsburgh, PA 15228

B U I L D Y O U R B U I L D Y O U R C O M M U N I T YC O M M U N I T Y- Shop Local -

P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering

their vehicle to make sure it is the car they are supposed to enter.

In Remembrance of Samantha Josephson

#WHATSMYNAME

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 [email protected]

It’s easy to join our mailing list! Just send your email address by text message:

Text MALLORYSARMY to 22828 to get started.

Message and data rates may apply.

Wedding Wedding Invitations & Invitations & Holiday CardsHoliday CardsLog onto Log onto www.jppc.netwww.jppc.netconveniently from conveniently from your home or offi ce.your home or offi ce.Online CatalogOnline CatalogOnline OrderingOnline OrderingOnline ProofingOnline ProofingAll Major Credit All Major Credit Cards AcceptedCards Accepted

FREE UPS FREE UPS GROUND GROUND SHIPPINGSHIPPING!

255 Saint Paul of the Cross Parish, Pittsburgh, PA (inside) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Compliments of EASTERN MIRROR & GLASS INC.

James Rockacy, ParishionerJames Rockacy, Parishioner

Serving the South Hills by the golden rule since 1972Heather Stipanovich - Agent & Parishioner

412-833-5351 • www.billfl innagency.com2754 South Park Rd., Bethel Park, PA 15102

Short-Term Skilled Nursing Rehabilitation

Independent LivingPersonal CareMemory Care

(412) 650-3100www.paramountseniorliving.com100 Knoedler Rd., Pittsburgh

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg

y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis

cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm o

echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n

acturing - Chemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens

dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans

ortation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker

CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia

ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforcforcforcforcforceement, Public Safety - O

To all those nforcement, Public Sanforcement, Public Sa

essentiallture - Energylture - EnergyWaterwaste TraWater aste Tra

workerscs - Public Wors - Public WorCommunicatioCommunicatio

keepingechnology Wochnology Woovernment Wovernment W

us safe,acturing Caterials Finanaterials Finan

yournicationnicationWorkerWorke

service isovernment Workovernment Workacturing Chemacturing Chem

invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar

ment, Public Safety - OSafety - Othan

k yo

u

g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tettttttttttteee Transportation & Log

cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCoCCoCCoCCCoooCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicatcaticaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim

echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community

Page 12: John Patrick Publishing · 2020-06-26 · 255 Saint Paul of the Cross Parish, Pittsburgh, PA (third) John Patrick Publishing Company • 1-800-333-3166 • CHURCH BULLETIN ADVERTISING

255 Saint Paul of the Cross Parish, Pittsburgh, PA (back) John Patrick Publishing Company • 1-800-333-3166 • www.jppc.net

Tom KaercherAutomotive

699 Castle Shannon Blvd.412-563-2827

ASE Certifi ed Technicians

Independent Living

Skilled Nursing

Personal Care Memory Support

(412) [email protected]

Now Hiring

LINDENWOOD BEER DISTRIBUTINGFamily Owned & Operated For Over 50 YearsBeer • Pop • Ice Snacks • Cigarettes

PA Lottery • Instant Games

830 Sleepy Hollow Rd. • Castle Shannon (Next to #1 Cochran Collision Center)

Hrs: Sun 11-5 Mon-Sat 10-9 • 412-561-1534

JORDAN J. CRAMER, OWNER

(724) [email protected]

M.K.M.Tax &

AccountingPersonal

Small Business

www.mkmtax.com • 412.343.6247300 Mt. Lebanon Blvd #230

“The Appliance Experts”40 Years of Servicing Our Neighbors

APPLIANCESERVICE CENTER INC.

412-381-4104APPLIANCESERVICE-CENTER.COM

Robert J. Winters, Esq.Attorney At Law

Wills & Trusts • Estate Planning • Business LawWill Make House Calls

412-281-0587 • [email protected]

Selling or Buying?

CALL ME!

Kathy McKenna 412.343.9000 • [email protected] located in Castle Shannon

A-BossOPTICIANS

Serving Pittsburgh Since 1971~We Repair~

www.abossopticians.com634 Braddock Ave.412-271-4424

938 Brookline Blvd. 412-561-0811

5071 W. Library Ave.412-854-5838

Retirement LivingCall today to set up a Call today to set up a

personal tour: personal tour: 412-294-1351

1300 Bower Hill Rd., 1300 Bower Hill Rd., PittsburghPittsburgh

412-278-1300www.Concordia-SouthHills.org

1350 Locust Street, Ste. 406Pittsburgh, PA 15219412.232.8104412.232.8104

David V. Glorioso, M.D.

David L. Limauro, M.D.

Mark A. Cedar, D.O.

Nicholas A. Bellicini, D.O.

2589 Boyce Plaza Rd.Upper St. Clair, PA 15241

412.838.0400412.838.0400Lisa A. Oliva, D.O.

Xuong Lu, M.D.

Robert Pagano, D.O.

Theresa Schuerle, D.O.

Jungmin Leo Lee, M.D.

Colon Cancer Screenings AvailableColon Cancer Screenings Available • www.pghgastro.com • www.pghgastro.com

Pawlak Plumbing, Inc.Pawlak Plumbing, Inc.412-341-2815 412-341-2815

www.pawlakplumbing.comwww.pawlakplumbing.com1st Place Winner 2018 Pittsburgh South Fan Favorite

Angie’s List Super Service Award

Doug Hyrb, REALTOR®

25 Years Experience in 25 Years Experience in Construction & Real EstateConstruction & Real Estate

doughyrb.howardhanna.comdoughyrb.howardhanna.com� � [email protected]@howardhanna.com

Real Estate Services

C: 412.780.3021C: 412.780.3021O: 412.833.3600O: 412.833.3600

McGERVEY ELECTRICResidential • Commercial • 220 Service

New Home Construction • Bucket Truck Service Full Housepower

412-854-4436 • www.mcgerveyelectric.com

Excellence is a GOOD choice

GOOD ORTHODONTICSRobert F. Good II, D.M.D., M.D.S • Ronald S. Good, D.M.D., M.S.

“We shall never know all the good that a simple smile can do.” Mother Teresa

WASHINGTON724-225-1114

PLEASANT HILLS412-655-4660

MOUNT LEBANON412-344-4663

Bring paradise to your home(412) 531-2364

HEATING & AIRCONDITIONING

[email protected]

412.221.2248

2875 West Liberty Ave • 412-531-9700

3447 Babcock Blvd • 412-369-0200

The Appliances You Like at the Best Prices!

Residential Electric Services

Service Upgrades

Circuit Breaker Panels

Outdoor Lighting

LED Lighting

FREE ESTIMATES(412) 854-5800

www.peterselectric.com

Contractor: HIC: PA 19905

Over 50 years in business

Laughlin Cremation & Funeral TributesMount Lebanon (412) 531-5100 Castle Shannon

Kurt J. Warmbein Jr. - Peter A. SantoreMichael J. Englert - Sarah McAlee

Shannon Long Barrett

ST. PAUL SELLERS-FREE HOME WARRANTY

#1 REAL ESTATE COMPANY GLOBALLY

PARISHIONER & REALTOR FOR OVER 15 YEARS!

CALL OR TEXT TODAY @

412-901-4073


Recommended