Parish Celebrationsns
Saturday 4:00 p.m. Athens
Sunday 8:45 a.m. Catskill 10:45 a.m. Athens
Holy Days As announced
Recitation Of The Rosary Monday 9:30 a.m., Athens
Arrangements should be made six weeks in advance
Arrangements should be made six months in advance
Communal Penance During Advent and Lent
Individual Penance Saturday 3:00-3:30 p.m.
And by appointment with our Sacramental Minister
Available after Mass and on request by calling the parish office.
Parish Life Coordinator Janine O’Leary
Parochial Vicar Fr. Michael P. Melanson
Pastoral Associate For
Evangelization and Ministry Michaela Anderson
Director Of Music Athens
Vincent B. Brennan, Jr.
Catskill Marie A. Bitter
Parish Trustees
Athens Anne L. Pirrone
Thomas R. Riescher
Catskill Ashley R. McCarthy Charles G. McEntee
Finance Council
Chairperson Athens
Barbara A. Moran
Catskill Dennis R. O’Grady William D. Rinaldi
Pastoral Council
Chairperson Athens
Joan A. Draiss
Catskill Teresa A. Gustas
Th
e
Ch
ur
ch
O
f
Th
e
Ro
ma
n
Ca
th
ol
ic
D
io
ce
se
O
f
Al
ba
ny
24 North W
ashington Street Athens, N
ew Y
ork 12015 66 William
Street Catskill, N
ew Y
ork 12414 Phone 518 943-3150 F
ax 518 943-5257 E
mail cspacny@
aol.com
Faith F
ormation E
mail stpatrickff@
aol.com
Web site w
ww
.stpatrickathenscatskill.org
Our mission is to be a welcoming Catholic Our mission is to be a welcoming Catholic community, sharing God’s immeasurable love.
24142414
Saint Kateri Tekakwitha July 14
458~1
Ordinary Time Year A
Fifteenth Sunday 12 July 2020
What heroic deeds cause us to remember Kateri Tekakwitha, who died at the age of 24, only seven years after she was baptized? Kateri was born in upstate New York in 1656. Her mother, a Christian Algonquin, and her father, a Mohawk warrior, died of
smallpox when Kateri was four. Kateri sur-vived the epidemic but was left disfigured and partially blind. She grew up in the care of her uncle. When Kateri was eleven, a group of Jesuit missionaries (called “Blackrobes” by the native peoples) visited Kateri’s village. Their stories touched her deeply. At the age of 17, she took the courageous step of being bap-tized. Her decision to be baptized angered her relatives. They knew of so-called Christians who had burned villages and brought deadly diseases to the Native American peoples. Kate-ri also chose not to marry, which was unthink-able for a young girl in her culture. The opposition of her relatives to her choices led Kateri to flee to a Christian settle-ment near Montreal. There she taught young children and cared for the sick and aged. She quickly became known for her remarkable acts of penance and prayer. But soon her health began to fail. She died in 1680 at the age of 24. Because she followed the traditional Christian virtues of prayer, fasting and works of mercy to such an extraordinary degree, it was not long before word of her life spread far and wide. Kateri was beatified, a preliminary step for sainthood, in 1980 and Canonized in 2012. She is the first Native American and the first American lay person to receive this hon-or. We honor the “Lily of the Mohawks” each year on July 14. Copyright © 1997 Archdiocese of Chicago: Liturgy Training Publications, 1800 North Hermitage Avenue, Chicago IL 60622-1101; 1-800-933-1800. Text by Kathy Luty. Art by Chuck Ludeke.
RR e a d i n g s F o r TT h e W e e k O f J u l y 1 2
Sunday: Is 55:10-11/Rom 8:18-23/Mt 13:1-23 Monday: Is 1:10-17/Mt 10:34 — 11:1 Tuesday: Is 7:1-9/Mt 11:20-24 Wednesday: Is 10:5-7, 13b-16/Mt 11:25-27 Thursday: Is 26:7-9, 12, 16-19/Mt 11:28-30 Friday: Is 38:1-6, 21-22, 7-8/Mt 12:1-8 Saturday: Mi 2:1-5/Mt 12:14-21 Sunday: Wis 12:13, 16-19/Rom 8:26-27/Mt 13:24-43
We encourage you to reflect on the readings for our Sunday Eucharistic Liturgy before you come to church.
R e c i t a t i o n O f T h e R o s a r y
TBD
S a c r a m e n t O f R e c o n c i l i a t i o n Individual Penance
Saturday 3:00 to 3:30 p.m. (Athens)
M a s s I n t e n t i o n s
At our Eucharistic Liturgy on July 18/19, we re-member in a special way:
Saturday 4:00 p.m. Joseph Capobianco, III The Family
Sunday 8:45 a.m. Cosmo Casaregola Ursula Casaregola
Frank Stabile, Jr. Mary Niblock
Sunday 10:45 a.m. Aldo Fiorini The Family
R e m e m b e r I n Y o u r P r a y e r s
Gene Antonelli ~ Jimmy Apa ~ Marcy Bartley ~ Ruth Bennett ~ Joanne Blasewitz ~ Betty Burger ~ Kathleen Burger ~ Joseph Caro ~ Sr. Theresa Clarizio ~ Nick DeBow ~ Jean DeCicco ~ Sarah Deering ~ Anthony Delucy ~ Mary Dickson ~ Mary Doebler ~ Joan Draiss ~ J. B. Ellis ~ Pat-rick Enright ~ Frances Esposita ~ Jerry Fargo ~ Louise Finley ~ Ron Gabriele ~ Anna Geter ~ Sheila Gilfeather ~ Bishop Capistrano Heim ~ Jan Doebler Hempstead ~ Colleen Holloway ~ Lisa Jakob ~ Elizabeth Jarvis ~ Roger Johnston ~ Paul Kelly ~ Rosie Lennon ~ Amy Lynch ~ Joan Lynch ~ Avery Lyons ~ Carmella Maffucci ~ An-drea Mango ~ Karen Mansfield ~ Dennis and Nancy Maiorino ~ Scott Mattice ~ Irene Maxwell ~ Peter McGrath ~ William McLean ~ Carol McNeany ~ Peter Monteleone ~ Ian Morgan ~ Guiseppe Multari ~ Cameron Nickles ~ Clement Oropallo ~ Rosalie Parrillo ~ Joan Pepia ~ Frank Porto, III ~ Landon Portu ~ Kathy Pritker ~ Michael Regan ~ Julia Rightmyer ~ Fr. Rick Shaw ~ Cindy Borfitz Smith ~ Marge Stabile ~ Kelly Steenburgh ~ Mary Tennermann ~ Tim Watkins ~ John Williams ~ Kyle Zindell
458~2
Thank you! Thank you!
Words cannot express our gratitude for your extreme gen-erosity during this difficult time.
Thank you to all who share their Time, Talent, and Treas-ure to carry out the mission of Christ through the work of our Parish Family Of Saint Patrick.
Fifteenth Sunday In Ordinary Time July 12 8:45 a.m. Eucharistic Liturgy Church / Catskill 10:45 a.m. Eucharistic Liturgy Church / Athens ………………………………………………………………………………………………………………………………………………………………….
Saturday July 18 4:00 p.m. Eucharistic Liturgy Church / Athens ………………………………………………………………………………………………………………………………………………………………………
Sixteenth Sunday In Ordinary Time July 19
8:45 a.m. Eucharistic Liturgy Church / Catskill 10:45 a.m. Eucharistic Liturgy Church / Athens
Beginning in August Fr. Mike will be offering Daily Mass two days a week. The schedule will be: Monday at 8:30 a.m. in Athens Wednesday at 8:30 a.m. in Catskill
All are welcome.
In this weeks Gospel, Jesus gives us yet another parable, the one known as “The parable of the sower”. Without asking them directly, he tells them three stories about sowing seeds on different types of soil in a manner that as a listener, they would wonder which one they are. Through our baptism, we know that we are the ones that were planted on rich soil, “one who hears the word and understands it, who indeed bears fruit and yields a hundred or sixty or thirty fold.”
Through the Holy Spirit, we have been chosen to be the bearers of good news to the world, that our Lord and savior, Jesus Christ loves us beyond our imagination. This is quite a large responsibility. But again, we have been chosen to do this and so we have been given all that is needed to do the job. All we need to do is not be afraid and just do it.
So, this week, find someone to be kind to. Do something small for someone in a big way. Help someone who can’t help themselves, and sow new seed along this new path for others to find.
Enjoy the journey .
Fr Mike
Someone you know may be in an abusive relationship. The National Domestic Violence Hotline offers assess-ment and resources, and also includes a live chat op-tion.
You can also call 800-799-SAFE(7233) or TTY 800-787-3224.
458~3
T h e K n i g h t s o f C o l u m b u s w i l l b e h o s t i n g a F r e s e ’ s
C h i c k e n B a r b e c u e
Thursday, August 20, 2020 (Parking Lot, Catskill)
Take out only: from 3:00 to 6:00 p.m. Cost: $13.00
For reservations contact Pete Gustas at 943-5138. So-cial Distancing will be in effect.
Apostles Peter and Paul
4:00 p.m.. 8:45 a.m. 10:45 a.m.
A l t a r S e r v e r s
C o m m e n t a t o r P. Gustas J. Sencabaugh J. Hale
M i n i s t e r s O f C o m m u n i o n
T. Gustas C. Murphy / J. O’’Leary Need Volunteers J. O’Leary
Need Volunteers
L e c t o r s
J. Capobianco S. Van Dyke T. Pieruzzi
M i n i s t e r s o f H o s p i t a l i t y M. Archambault B. DeLuca
R. Allen / K. Heck P. Wallace D. Zelasko
J. Pulice A. Ramm G. Walker
We are excited to announce that we have part-nered with Vanco Payments to offer GivePlus eGiv-ing tools to our parishioners.
We encourage you to consider our electronic giv-ing program. We accept donations made from your bank account and credit card or debit cards. It takes just a few minutes to set up a recurring giv-ing plan. The links are below: Athens: WebPay Link:https://tinyurl.com/yaqc7ypc GivePlus Text Phone Number: (833) 612-6907 Catskill: WebPay Link:https://tinyurl.com/y7s4om44 GivePlus Text Phone Number: (833) 612-6907
458~4
F e r t i l e G r o u n d F o r G o d ’ s Wo r dd Isaiah 55:10 –11 Psalm 65:10, 11, 12 –13, 14 Romans 8:18 – 23 Matthew 13:1– 23
S C RR I P T U R E R E F L E C T I O NN
Most people love stories. We often see the point of something more clearly if we hear it connected to a story. Our imaginations play with stories, inspiring new implications for our lives. Jesus’ listeners were no different than us. Je-sus constantly told parables to teach his message. Chapter 13 of Matthew’s account of the Gospel, which we will hear over the next few weeks, offers many stories exploring the kingdom of heaven.
In today’s Gospel, we hear about the magnitude of responding faithfully to God’s word. Jesus invites his listeners to be fully attentive with open ears, eyes, and hearts. When we approach Jesus’ message with this depth of openness, our hearts can be converted and we can be touched and healed by Jesus. There are obstacles to overcome, but rich soil waits. The images in Isaiah and the psalm add to our understanding of the fruitfulness of God’s word. God pro- mises that the word will be watered by the rain and snow so that it does not return empty, but overflowing with a rich and abundant harvest.
But the seed sown on rich soil is the one who hears the word and understands it, who indeed bears fruit and yields a hundred
or sixty or thirtyfold. Matthew 13:23
S H A R I N G F A I T HH
✦ Read Isaiah’s prophecy in Matthew 13:14 –15. How does God call you to reflect on your own openness and God’s promise of healing? ✦ Our Church calls us to be good stewards of the earth. What does stewardship mean to you? How do you live that out? ✦ On what kind of ground has your seed fallen? L I V I N G T H E L I T U R G YY
✦ Perhaps you have a garden or can find a way to participate in a community garden. Many of these gardens also share their harvest with those in need of food or who have no resources for homegrown products. How are we called to cultivate and share the fruits of the earth? ✦ Reread the scripture passages of this Sunday and list the multiple references to soil, seed, growth, and plants. What do these images say to you about your developing relationship with God? Discuss your thoughts in a group or with a friend. ✦ Jesus walked on the earth and was a part of human life. He told stories using things of the earth. In their pastoral letter “Renewing the Earth,” the U.S. bishops spoke about the fragility of the earth and our need to restore it. How might Jesus urge us to act? What is one thing you or your family might do to help the earth’s environment?
The Word to Go © 2010 Archdiocese of Chicago: Liturgy Training Publications. English scripture texts from the New American Bible with revised New Testament and Psalms © 1991, 1986, 1970 Confraternity of Christian Doctrine, Inc. Permission to publish granted by the Very Reverend John F. Canary, Vicar General, Archdiocese of Chicago, on March 25, 2010.
458 St. Patrick, Athens, NY (back) John Patrick Publishing Company 1-800-333-3166 • www.jppc.net
Bob Schmidt & SonsGeneral Contracting
All TypesRoofi ng & Siding
Flat Roof Specialist70 Schoharie Tpk., Athens
945-2689e-mail: [email protected]
518-756-2010Prompt Professional Installation
Hot Water • Cooking • Heatingwww.nolanpropane.com
CatskillDental CareJoseph M. Pilatich III D.D.S.
132 Jeff erson Heights Catskill, NY
518-943-0920www.catskilldentalcare.com
New West Properties
Bill Rinaldi - Sales [email protected] ce 518-943-2620 Cell 518-441-5077
74 Maple Ave. (Route 9W) Catskill, NY 12414
www.c21newwest.com
90 Catskill Commons, Catskill943-4446
Center for Nursing & Rehabilitation
Barbara Schobel, MSDir. of Admissions & Marketingwww.PinesCatskill.com154 Jefferson Heights, Catskill, NY 12414
T. 518.943.5151 x4034 F. 518.943.5208 C. 518.795.5967E. @nathealthcare.com
731-2644 42 Lafayette Ave.Coxsackie, N.Y.
Medical & Relaxation Massage
Richards Funeral Home
of the Mid-Hudson Valley, Inc.
Athens 945-1065Athens 945-1065Cairo 622-9503Cairo 622-9503
Richard E. Vigilo • Paul R. Seney, Jr. • VIncent J. PerniciaroRichard E. Vigilo • Paul R. Seney, Jr. • VIncent J. Perniciaro
W.C. Brady’s Sons, Inc.Established 1840
Coxsackie 731-8000Coxsackie 731-8000
NYS Licensed Funeral Directors
Full auto service for your family518-943-6018 • [email protected]
Ralph Vignera
5877 Cauterskill Rd.Leeds, NY 12451
www.rclacy.com 518.943.4300
Sales, Service & Parts
Our Family Serving Your FamilyJohn Luvera - General Sales Manager
Hometown People ~ Hometown ServiceCall for a Free QuoteCall for a Free Quote 518-943-3980518-943-3980All Personal & Commercial Lines of InsuranceAll Personal & Commercial Lines of Insurance
Over 100 Years of customer service!Over 100 Years of customer service!332 Main Street ~ Catskill, NY 12414332 Main Street ~ Catskill, NY 12414
www.catskillinsurance.comwww.catskillinsurance.com
Dr. Mario CatalanoDr. Howard LeiferDr. Thomas Bruno
Dr. Stacey RussellDr. Madina Khabiyeva
Dr. Jay Vuong
11 Boulevard Ave., Catskill, NY 12414 518-943-9090
Millspaugh CameratoFuneral Home
Professional, Aff ordable and Compassionate ServiceParishioner • Robert J. Gaus • Licensed Manager
139 Jeff erson Heights, Catskill 518-943-3240www.MillspaughCamerato.com
PAUL’SPizza & Italian Restaurant
Rt. 9, Coxsackie518-731-8600
www.paulspizzaandpasta.com
Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if
we can help Save you money with your monthly payments on your commercial property.
Multi-Family, Retail, Offi ce Building, Apartment and Condos. Can close in as little as 45 days!
Four season customer service is our top priority.
www.duqfunding.com1650 Market Street - Suite 3600
Philadelphia, PA 19103
Mallory’s Army Foundation
United Together In The Fight Against Bullying...
Don’t Just Teach Kindness...
B E K I N D N E S S !www.MallorysArmy.com
(973) [email protected]
It’s easy to join our mailing list! Just send your email address by text message:
Text MALLORYSARMY to 22828 to get started.
Message and data rates may apply.
What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering their vehicle
to make sure it is the car they are supposed to enter.
In Remembrance of Samantha Josephson#WHATSMYNAME
Internet, AT&T Cell Phones & More
The Musso Family
See what colorcan do for you!
John Patrick Publishing
800-333-3166
to advertise in color, please call us at
Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M
To all those essential workers keeping us safe,
yourservice is
invaluable & appreciated.
afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg
y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis
cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfornfornfornfornfornfornfornformatimammmmmmammmmmm o
echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n
acturing - Chemical &&&&&&&&&&&l &l & l & l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens
dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans
ortation &&&&& & && & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker
CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia
ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforcforcforcforcforceement, Public Safety - O
To all those nforcement, Public Sanforcement, Public Sa
essentiallture - Energylture - EnergyWater aste TraWater aste Tra
workerscs - Public Wors - Public WorCommunicatioCommunicatio
keeping echnology Wochnology Woovernment Wovernment W
us safe,acturing Caterials Finanaterials Finan
yournicationnicationWorkerWorke
service isovernment Workovernment Workacturing Chemacturing Chem
invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar
ment, Public Safety - OSafety - Othan
k yo
u
g gyWatateatttatatatattaaaaaa rwaswaswawaswaswawwwaswaswwwwwasswasawaw ste -tetttttttttteee Transportation & Log
cccscccccc - PPPPPPPPPPPPPPubliubliubliubliublililublibbliububuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrkrkkkkkrr & - & -& -&& -&& -&&&& -&& -&&&&& -&&&& -&& InfrInfInfrnfrInfInfrnfrIInffI ffInI fnfI fInfnfInnnfn astructuCCoCoCoCoCoCoCCoCCoCCCoooCCCCCCCC mmunmmunmmmmmmunmmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicatcaticaticatcatcatcatcattcatcatcatcattcatcatcatcatccacatcccacc ionsionsionsonsionononsonsiooionssonsonsonsiononoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornforforfnfnfornfornfornfornforfofornfornforrrfornnfforrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmatim
echhhhhhhhhnolonononoonnoloonolonnoln lonolonoooloonnnn onolonoln oonoo ggy Wgggg orkers - Community
Advertise Your Business Here
800-333-3166 ext. 161www.jppc.net