Fungal Genetics and Biology 79 (2015) 76–83

Contents lists available at ScienceDirect

Fungal Genetics and Biology

journal homepage: www.elsevier .com/ locate/yfgbi

Yeast recombination-based cloning as an efficient way of constructingvectors for Zymoseptoria tritici

http://dx.doi.org/10.1016/j.fgb.2015.03.0171087-1845/� 2015 The Authors. Published by Elsevier Inc.This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).

Abbreviations: YRBC, yeast recombination-based cloning; sdi1, succinate dehy-drogenase; hph, hygromycin phosphotransferase; nptII, neomycin phosphotrans-ferase; bar, bialaphos resistant gene; GFP, green-fluorescent protein; Zt,Zymoseptoria tritici; RB and LB, right and left border; bp, base pairs.⇑ Corresponding author. Tel.: +44 1392 722175; fax: +44 1392 723434.

E-mail address: S.Kilaru@exeter.ac.uk (S. Kilaru).

S. Kilaru ⇑, G. SteinbergSchool of Biosciences, University of Exeter, Exeter EX4 4QD, UK

a r t i c l e i n f o

Article history:Received 22 January 2015Revised 13 March 2015Accepted 21 March 2015

Keywords:Selectable markersHygromycinGeneticinCarboxin and BASTASeptoria tritici blotchMycosphaerella graminicola

a b s t r a c t

Many pathogenic fungi are genetically tractable. Analysis of their cellular organization and invasionmechanisms underpinning virulence determinants profits from exploiting such molecular tools as fluo-rescent fusion proteins or conditional mutant protein alleles. Generation of these tools requires efficientcloning methods, as vector construction is often a rate-limiting step. Here, we introduce an efficient yeastrecombination-based cloning (YRBC) method to construct vectors for the fungus Zymoseptoria tritici. Thismethod is of low cost and avoids dependency on the availability of restriction enzyme sites in the DNAsequence, as needed in more conventional restriction/ligation-based cloning procedures. Furthermore,YRBC avoids modification of the DNA of interest, indeed this potential risk limits the use of site-specificrecombination systems, such as Gateway cloning. Instead, in YRBC, multiple DNA fragments, with 30 bpoverlap sequences, are transformed into Saccharomyces cerevisiae, whereupon homologous recombina-tion generates the vector in a single step. Here, we provide a detailed experimental protocol and four vec-tors, each encoding a different dominant selectable marker cassette, that enable YRBC of constructs to beused in the wheat pathogen Z. tritici.

� 2015 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY license(http://creativecommons.org/licenses/by/4.0/).

1. Introduction

Zymoseptoria tritici is a dimorphic ascomycete fungus, whichranges amongst the most wheat pathogens in Europe (Deanet al., 2012; Gurr and Fones, 2015). Developing new strategies tocontrol this pathogen requires in-depth knowledge of its invasionstrategy and insight into crucial cellular processes required forgrowth and proliferation. Such progress is strongly dependent ondevelopment of molecular tools and techniques. Previous workprovided transformation protocols, vectors with different domi-nant selectable markers, conditional promoter analysis, GFP repor-ter system, virulence assays and high-throughput automatedimage analysis for Z. tritici (Bowler et al., 2010; Kema et al.,2000; Perez-Nadales et al., 2014; Rohel et al., 2001; Rudd et al.,2008; Skinner et al., 1998; Stewart and McDonald, 2014; Zwiersand De Waard, 2001). However, to further accelerate progress

and extend the repertoire of molecular tools, efficient cloningmethods are needed.

The majority of vectors for manipulation of Z. tritici have beengenerated using conventional cloning methods, including the useof restriction enzymes and in vitro ligation protocols (Adachiet al., 2002; Choi and Goodwin, 2011; Marshall et al., 2011;Motteram et al., 2009, 2011; Roohparvar et al., 2007; Zwiers andDe Waard, 2001; Zwiers et al., 2007). However, these procedurescarry numerous limitations. Firstly, they depend on the availabilityof unique and compatible restriction sites in the vector and theDNA fragment(s) to be cloned. Indeed, searching for the availabilityof such restriction sites or introducing new restriction sites in theDNA is time and labour-intensive (Benoit et al., 2006).Furthermore, the various manipulations could modify the primarysequence of the encoded gene product (Andersen, 2011), with thedownstream risk of affecting the function of the gene products(Kilaru et al., 2009).

Recently, Gateway recombination technology was used to gen-erate vectors for Z. tritici (Bowler et al., 2010; Mirzadi Gohari et al.,2014; Scalliet et al., 2012). The Gateway cloning method is basedon the site-specific recombination properties of the bacteriophagelambda and provides a highly efficient way to clone DNA fragmentsof interest (Hartley et al., 2000; Landy, 1989). Whilst this is a

S. Kilaru, G. Steinberg / Fungal Genetics and Biology 79 (2015) 76–83 77

powerful method for molecular cloning, the Gateway technologyintroduces 25 bp long ‘‘attachment sites’’ that results in an intro-duction of 8–11 additional amino acids. Such modification of theprimary sequence, couple with the relatively high costs of theGateway site-specific recombination kits, limit use of this cloningmethod (Engler et al., 2008).

An alternative cloning approach makes use of the ability ofSaccharomyces cerevisiae to recombine DNA fragments in vivo byhomologous recombination (Ma et al., 1987; Raymond et al.,1999). Here, DNA fragments, with overlapping sequences, aretransformed into S. cerevisiae for in vivo recombination (Ma et al.,1987). Such overhangs can be as short as 30 bp (Kilaru et al.,2006; Oldenburg et al., 1997; Schuster et al., 2011a) and are addedusing commercially synthesized primers. This method circumventsboth the need for restriction enzymes and expensive commercialkits. Most importantly, yeast recombination-based cloning(YRBC) avoids changes in the primary DNA sequence. Instead, thismethod allows precise cloning of multiple overlapping DNA frag-ments in a single step, thereby rapidly generating complex vectors(Andersen, 2011; Shanks et al., 2006). This powerful cloningmethod, YRBC has been used to construct viral and bacterial vec-tors (Shanks et al., 2006; Youssef et al., 2011), and indeed, toassemble the entire genome of the prokaryote Mycoplasma genital-ium d from 25 overlapping DNA fragments (Gibson et al., 2008). Infungi, YRBC has been used in Coprinopsis cinerea (Kilaru et al.,2006), and subsequently, to investigate the corn pathogenUstilago maydis (Schuster et al., 2011a) and the rice blast fungusMagnaporthe oryzae (Dagdas et al., 2012; Lu et al., 2014).

Here, we introduce the detailed protocol to construct vectorsusing YRBC. We also provide four vectors, carrying different dom-inant selectable marker cassettes, suitable for yeast recombina-tion-based construction of vectors for use in Z. tritici.

2. Materials and methods

2.1. Fungal growth conditions and genomic DNA isolation

Z. tritici was grown in YG broth (yeast extract, 10 g/l; glucose,30 g/l) for 3 days at 18 �C with 200 rpm. Three ml of cells were har-vested by centrifugation at 13,000 rpm for 2 min and followed byaddition of 400 ll of lysis buffer (2% Triton X, 1% SDS, 100 mMNaCl, 10 mM Tris HCl pH-8.0, 1 mM EDTA), 500 ll phenol:chloroform (1:1) and a small scoop of acid washed glass beads(425–600 lm; Sigma–Aldrich, Gillingham, UK). The tubes weremixed for 10 min by using IKA Vibrax shaker (IKA, Staufen,Germany) and centrifuged for 10 min at 13,000 rpm. The super-natant was transferred to a fresh Eppendorf tube containing 1 mlof 100% ethanol. The tubes were centrifuged for 10 min at13,000 rpm and the DNA was washed with 500 ll of 70% ethanol.The residual ethanol was removed by incubating the tubes at55 �C for 5 min and DNA was suspended in 50 ll water/RNaseA

Table 1Primers used in this study.

Primer name Direction Sequen

SK-41 Sense GTGGASK-Sep-11 Antisense ATTCAGSK-Sep-12 Sense AGCTTGSK-Sep-137 Antisense CCCGASK-Sep-282 Sense GCTTGSK-Sep-283 Antisense GCTTG

a Italics indicate part of the primer that is complementary with anothcerevisiae.

solution. For PCR applications, the genomic DNA was diluted withwater by 200 times.

2.2. Construction of vectors pCGEN-YR, pCHYG-YR and pCBAR-YRusing conventional ligation method

The vectors pCGEN-YR, pCHYG-YR and pCBAR-YR were con-structed using conventional restriction digestion and ligation clon-ing method. The yeast recombination cassette consists of URA3 and2l ori from plasmid pNEB-hyg-yeast (Schuster et al., 2012) wascloned into the vectors pCGEN (Motteram et al., 2011), pCHYG(Motteram et al., 2009) and pCAMB-BAR (Kramer et al., 2009)resulting in vectors pCGEN-YR, pCHYG-YR and pCBAR-YR respec-tively. For construction of vector pCGEN-YR, a 8257 bp of vectorpCGEN (SacII and PsiI fragment) was ligated with 2820 bp fragmentof vector pNEB-hyg-yeast (SacII and SspI fragment). For construc-tion of vector pCHYG-YR, a 8117 bp of vector pCHYG (SacII andPsiI fragment) was ligated with 2820 bp of fragment of vectorpNEB-hyg-yeast (SacII and SspI fragment). For construction ofvector pCBAR-YR, a 7616 bp of vector pCAMB-BAR (BclI and PsiIfragment) was ligated with 2847 bp of fragment of vectorpNEB-hyg-yeast (BclI and DraI fragment). Primers SK-41 and SK-Sep-137 (Table 1) were used to identify the positive clones andthe expected band sizes are 2728 bp, 2588 bp and 2090 bp for vec-tors pCGEN-YR, pCHYG-YR and pCBAR-YR respectively.

2.3. Construction of vector pCCBX-YR using yeast recombination-basedcloning

Plasmid pCCBX-YR was constructed using in vivo recombinationin the yeast S. cerevisiae DS94 (MATa, ura3-52, trp1-1, leu2-3,his3-111, and lys2-801 (Tang et al., 1996) following published pro-cedures (Raymond et al., 1999). For the recombination events, thefragments were amplified with 30 bp homologous sequences tothe upstream and downstream of the fragments to be cloned.The detailed steps involved in the construction of this vector aredescribed below.

2.4. Primer designing and PCR amplification of DNA fragments

Primer design is vital step in constructing the vectors usingYRBC. The 30 bp overlapping sequences to the next DNA fragmentneeds to be incorporated in the 50 end of the 20–25 bp primersequence, which makes the total primer length to 50–55 bp.Likewise, primers SK-Sep-11, SK-Sep-12, SK-Sep-282 and SK-Sep-283 (Table 1) were synthesized and then the desired DNA frag-ments were amplified either from Z. tritici IPO323 (Goodwin et al.,2011; Kema and van Silfhout, 1997) genomic DNA using Phusionhigh-fidelity DNA polymerase (Thermo Scientific, Leicestershire,UK). PCR was performed by using 1 ll of template DNA with finalconcentration of 200 lM each dNTPS, 0.5 lM of each oligos, 1x HFbuffer, 0.02 U/ll of Phusion DNA polymerase in a total volume of

ce (50 to 30)a

TGATGTGGTCTCTACAGGAATGGTGAGGCATCGGTACAAGCTCATGCTGTTGTTGAGTGCGTCCTACCGATGCCTCACCATTCTGAATTGCTCAAGGACCTGCCCCAAG

TCTAGTAACATAGATGACAACGACATTCCGAAACCCCCAATTTCGCTACCGAGCGGCGAGCAGACATGCCTGCAGGTCGACTCTAGAGGATCCCTTCCGTCGATTTCGAGACAGC

er DNA fragment, to be ligated by homologous recombination in S.

78 S. Kilaru, G. Steinberg / Fungal Genetics and Biology 79 (2015) 76–83

50 ll. Cycling parameters were 94 �C for 2 min, then 35 cycles of94 �C for 10 s, 60 �C for 20 s and 72 �C for 2 min (30 s for 1 kb ofDNA), followed by a single 10 min extension at 72 �C. The DNAbands of interest were excised and purified from the gel asdescribed below. In parallel, the plasmid to be cloned was digestedwith suitable restriction enzymes and the DNA fragment of interestexcised from the agarose gel.

2.5. Purification of DNA fragments

DNA fragments of interest were purified using silica glass sus-pension as described previously (Boyle and Lew, 1995). In brief,the gel slice was melted at 55 �C for 5 min with 3 volumes of6 M sodium iodide, followed by further incubation for 5 min at55 �C with 20 ll silica glass suspension (100 mg/ml stock solution,Sigma–Aldrich, Gillingham, UK). Then, the reaction mixture wascentrifuged at 13,000 rpm for 30 s and the supernatant was dis-carded. The pellet was washed with DNA wash buffer (50 mMNaCl, 10 mM Tris HCl pH-7.5, 2.5 mM EDTA and 50% ethanol (v/v)) for 3 times. Finally, the DNA was eluted from the glass beadsby addition of 10 ll water and incubation at 55 �C for 10 min.

2.6. Preparation of yeast competent cells and transformation

Transformation of DNA fragments into S. cerevisiae DS94 wasperformed as described previously (Gietz and Schiestl, 2007;Raymond et al., 1999). In brief, the S. cerevisiae DS94 cells weregrown in 3 ml YPD media (yeast extract, 10 g/l; peptone, 20 g/l;glucose, 20 g/l; agar, 20 g/l) at 28 �C for overnight with 200 rpm.Then, the overnight culture was transferred to 50 ml YPD andgrown for 5 h at 28 �C with 200 rpm. The cells were harvested bycentrifugation at 2200 rpm for 5 min and cells were washed with5 ml sterile water. The cells were suspended in 300 ll water andkept at room temperature for further use.

4 ll of each purified DNA fragments of 9,766 bp fragment ofpCGEN-YR obtained as BamHI and ZraI, 1929 bp PCR productobtained with primers SK-Sep-282 and SK-Sep-11 (Table 1) and303 bp PCR product obtained with primers SK-Sep-12 and SK-Sep-283 (Table 1) were added to a fresh Eppendorf tube followedby 50 ll salmon sperm DNA (2 lg/ll stock; Sigma–Aldrich,Gillingham, UK), 50 ll S. cerevisiae cells, 32 ll 1 M lithium acetateand 240 ll 50% PEG 4000. The components were mixed by gentlyinverting the tubes for few times and incubated at 28 �C for30 min. Heat shock was performed at 45 �C for 15 min and tubeswere centrifuged at 2000 rpm for 2 min. The supernatant wasgently removed and the pellet was suspended in 150 ll water.Finally, the cell suspension was plated on to yeast syntheticdrop-out media which lacks uracil (yeast nitrogen base withoutamino acids and ammonium sulphate, 1.7 g/l; ammonium sul-phate, 5 g/l; casein hydrolysate, 5 g/l; tryptophan, 20 mg/l; agar,20 g/l) and incubated at 28 �C for 2 days.

2.7. Colony PCR on yeast colonies and plasmid DNA isolation fromyeast cells

Colony PCR was performed on yeast cells by using DreamTaqDNA polymerase (Thermo Scientific, Leicestershire, UK) in 20 lltotal volume. Cycling parameters were 94 �C for 5 min, then 35cycles of 94 �C for 2 min, 60 �C for 30 s and 72 �C for 1 min(1 min for 1 kb of DNA), followed by a single 10-min extension at72 �C. Primers SK-Sep-282 and SK-Sep-283 (Table 1) were usedto identify the positive clones and the expected band sizes are of2296 bp. Plasmid DNA was isolated from the positive yeast colo-nies as described previously with slight modification (Hoffmanand Winston, 1987). In brief, the recombinant S. cerevisiae cellswere grown in 15 ml yeast synthetic drop-out media at 28 �C for

overnight and harvested by centrifugation at 3000 rpm for 5 min.Then 200 ll yeast-lysis buffer (2% Triton X-100, 1% SDS, 100 mMNaCl, 10 mM Tris pH-8.0 and10 mM EDTA), 200 ll phenol:chloro-form: isoamylalcohol (25:24:1 v/v) and 0.3 g acid washed glassbeads (425–600 lm diameter, Sigma–Aldrich, Gillingham, UK)were added and the tubes were vortexed for 5 min using IKAVibrax shaker (IKA, Staufen, Germany). 200 ll TE buffer (10 mMTris HCl; 1 mM EDTA, pH-8.0) was added and centrifuged for5 min at 13,000 rpm. The upper aqueous layer was carefully trans-ferred to a fresh Eppendorf tube and 50 ll 3 M sodium acetate pH-5.5 and 1 ml ethanol was added. The tubes were kept at �20 �C for15 min and centrifuged at 13,000 rpm for 20 min. The cell pelletwas suspended in 400 ll TE and RNaseA (Sigma–Aldrich,Gillingham, UK) and incubated at 37 �C for 15 min. DNA was pre-cipitated by addition of 10 ll 4 M ammonium acetate and 1 ml100% ethanol. The tubes were centrifuged for 5 min at13,000 rpm and DNA was washed with 70% ethanol. The residualethanol was removed by incubating the tubes at 37 �C for 10 minand the DNA was suspended in 20 ll water.

2.8. E. coli transformation and confirmation by restriction analysis

10 ll of DNA isolated from the S. cerevisiae was transformedinto E. coli DH5a by using ‘‘homemade’’ competent cells. In orderto prepare the competent cells, a single E. coli colony was grownin 20 ml DYT media for overnight at 37 �C with 200 rpm. 100 llovernight culture was added to 100 ml fresh DYT with 10 mMMgCl2 and incubated at 18 �C with 100 rpm until the optical den-sity reaches to 0.25 (for 48 h). Then, the cells were chilled in icewater for 10 min and centrifuged at 4 �C for 10 min at 5000 rpm.The supernatant was discarded and the pellet was suspended in60 ml ice cold TB (transformation buffer; 250 mM KCl, 15 mMCaCl2, 10 mM PIPES, 55 mM MnCl2). The cell suspension was cen-trifuged at 4 �C for 10 min at 5000 rpm and the cell pellet was sus-pended in 16 ml TB. Finally 1.2 ml DMSO was added and 50 llaliquots were frozen in liquid nitrogen and the competent cellswere stored at �80 �C. Finally, the plasmid DNA was isolated fromthe E. coli colonies and further confirmed by restriction analysis.

3. Technical details and discussion

3.1. Steps involved in the construction of vectors using yeastrecombination-based cloning

Here, we provide a detailed ‘‘step-by-step’’ description of YRBCand compare the procedure to the more conventional restriction/ligation-based method (Fig. 1). Both methods require digestion ofthe vector with suitable restriction enzymes. Conventional restric-tion/ligation-based methods rely on the availability of suitablerestriction enzymes, which should generate the compatible endsin both the vector and DNA fragment(s) of interest. By contrast,YRBC requires linearization of the vector, but the enzyme can bechosen freely and independently of the DNA fragment to be cloned(henceforth named ‘‘insert’’). However, for both methods, thedigested vector needs to be purified.

The next step is to design the primers, which may require use ofboth methods (Fig. 1), depending on the availability of suitablerestriction sites in both the vector and the insert. With conven-tional cloning, such sites are often not present and need to beintroduced by polymerase chain reaction (PCR), or existing restric-tion sites need to be removed by site-directed mutagenesis (Benoitet al., 2006; van den Ent and Lowe, 2006). This results in modifica-tions of the nucleotide sequence. By contrast, YRBC relies on 30 bphomologous sequences, which are added by extended primers toeither end of the insert(s). These 30 bp overlapping sequences

Fig. 1. Flow chart depicting experimental cloning steps. YRBC involves fewer stepsthan standard in vitro ligation methods, but requires about the same time input toobtain the final plasmid.

S. Kilaru, G. Steinberg / Fungal Genetics and Biology 79 (2015) 76–83 79

navigate the recombination event and, therefore, assembleprecisely the overlapping DNA fragments, without altering the pri-mary sequence (Oldenburg et al., 1997).

Further steps involve amplification by PCR and the purificationof inserts (Fig. 1). In the conventional ligation method, the pre-pared inserts and the linearized vector are ligated in vitro, usingDNA ligase. In the YRBC method, the linearized vector and theDNA fragments are transformed into S. cerevisiae (Fig. 1), whichassembles the vector by in vivo recombination. S. cerevisiae utilizesits own recombination machinery for this process, circumventingthe need for DNA ligase or other commercial cloning kits(Oldenburg et al., 1997). Pre-selection of positive yeast clones isachieved by direct PCR amplification of yeast colonies, followedby purification of plasmid DNA and transformation E. coli forin vivo amplification. This protocol increases the amount and qual-ity of the DNA (Singh and Weil, 2002).

Finally, both methods require identification of positive E. colitransformants and purification of the plasmid for further use.

3.2. Comparison of conventional and yeast-based cloning: an example

The advantages of YRBC over restriction/ligation-based cloningcan be best illustrated using a pictorial representation of the con-struction of two GFP-fusion constructs (Fig. 2). This cloning proce-dure introduces 4 different inserts (the promoter for alpha-tubulin,Ptub2; a gene for green-fluorescent protein, egfp; an open readingframe for protein 1, ORF1; the alpha-tubulin terminator, Ttub2),cloned into a linearized vector (Fig. 2, multiple cloning sites areindicated by ‘‘MCS’’), digested, in our example, with DraI and PstI.Following conventional cloning methods, unique restriction sitesneed to be added to all fragments (see Fig. 2 for example enzymes).Most often, DNA fragments of interest do not carry ideal restrictionenzyme sites and thus demand end modification. This often intro-duces small insertions that modify the primary sequence of thefinal construct (Fig. 2). Furthermore, repeated use of fragments isoften hindered by the fact that new inserts contain enzymes thatwere used before (Fig. 2, we used BamHI and EcoRI, which weintroduced into protein 2, ORF2). The consequence of this situationis that the fragments prepared cannot be used. In our case, 2 of theprevious inserts had to be re-engineered (Fig. 2, Ptub2, GFP). Thus,placing the two open reading frames under the a-tubulin promoterand fusing them to GFP required the generation of 8 fragments andthe introduction of 10 short sequence stretches.

When cloning the same constructs using YRBC, the vector canbe linearized with any single suitable restriction enzyme(Oldenburg et al., 1997). The presence of the 30 bp overlappingsequences, attached by PCR, guarantee directed recombination ofall 4 fragments in a single step in vivo (Fig. 2). Neither additionalsequences are added, nor is the insert DNA altered in any way.This minimizes potential cloning artifacts. In addition, most frag-ments can be used in both constructs (Fig. 2), which reduces thenumber of newly-generated inserts to 6. This advantage is evenmore obvious when more open reading frames are cloned in a sim-ilar way. In addition, YRBC is a very cost effective method. In thispaper we used ‘‘home-made’’ reagents. For instance, we havereplaced the expensive gel purification kit with silica glass suspen-sion, as described previously, with slight modifications (Boyle andLew, 1995; see materials and methods for details). The yeast plas-mid isolation and plasmid miniprep systems were also replacedwith home-made solutions, as described elsewhere (Birnboimand Doly, 1979; Gietz and Schiestl, 2007; Hoffman and Winston,1987; see materials and methods for details). Furthermore, we pre-pared transformation-competent E. coli and S. cerevisiae ourselvesand transformations were carried out as described previously withslight modifications (Hoffman and Winston, 1987; Tu et al., 2005;see materials and methods for details). In summary, YRBC is a low-cost and efficient way of generating complex constructs, with min-imum risk of unwanted sequence modifications. In this way, it issuperior to more conventional restriction enzyme-based cloningmethods.

3.3. Vectors for yeast recombination-based cloning of constructs foruse in Z. tritici

Agrobacterium tumefaciens-based transformation is well-established for Z. tritici (Zwiers and De Waard, 2001). The binaryvector pCAMBIA03800 is widely used for this method and itallows replication in E. coli and A. tumefaciens due to the presenceof their corresponding origin of replications (CAMBIA, Canberra,Australia). To make this vector suitable for YRBC, we introduced‘‘yeast survival elements’’, – the 2-micron origin of replication(2l ori) and an auxotrophic selectable marker – URA3 (Joska

Fig. 2. Example cloning strategy showing generation of two GFP-fusion constructs by in vitro ligation and YRBC. Due to internal restriction sites, in vitro ligation requiresintroduction of unique restriction sites at the 30 and 50 end of each the 8 fragments. Alternatively, unique internal sites can be used (not shown). Both approaches alter theprimary sequence (see both final constructs, indicated by asterisks in cloning by in vitro ligation). Only a few DNA fragments can be used for cloning both genes (here thecloning vector, fragment 1, and the tub2 terminator, fragment 5). The yeast recombination method does not involve restriction site generation. Instead, complementarysequence ends of 30 bps are generated that enable homologous recombination in S. cerevisiae. The primary sequence is not altered (see final constructs, two asterisks; cloningby yeast recombination), and several fragments can be used for cloning both genes (fragments 1, 2, 4 and 5). Vector = cloning plasmid backbone; MCS = multiple cloning site;Ptub2 = promoter of the Z. tritici alpha tubulin gene tub2 ; Ttub2 = terminator of the Z. tritici alpha tubulin gene tub2; GFP = green fluorescent protein; ORF1, 2 = open readingframes of interest.

80 S. Kilaru, G. Steinberg / Fungal Genetics and Biology 79 (2015) 76–83

et al., 2014; Kuijpers et al., 2013). Introducing a �3.0 kb frag-ment, consisting of 2l ori and URA3, into plasmids for use inU. maydis and M. oryzae had previously made these vectors suit-able for YRBC (Dagdas et al., 2012; Schuster et al., 2011a). Wefollowed a similar strategy here and modified the previously pub-lished vectors pCGEN, pCHYG, pCAMB-BAR (Kramer et al., 2009;Motteram et al., 2009, 2011; Perez-Nadales et al., 2014), whichcarry different dominant selectable markers genes that conferresistance against hygromycin, geneticin and Basta, respectively.The resulting Z. tritici vectors pCGEN-YR, pCHYG-YR, pCBAR-YRand pCCBX-YR, are suitable for YRBC and subsequent transforma-tion into Z. tritici (Fig. 3).

Furthermore, we generated the vector pCCBX-YR, which con-tains a mutated allele of the succinate dehydrogenase gene thatconfers resistance against carboxin (Bowler et al., 2010; Scallietet al., 2012; see Kilaru et al., 2015). Herein, we provide moredetailed description of each vector. Technical details of theirgeneration can be found in the Materials and Methods.

pCGEN-YR. The plasmid pCGEN contains the nptII gene (795 bp)encoding neomycin phosphotransferase, conferring resistanceagainst Geneticin (Jimenez and Davies, 1980), under the controlof Cochliobolus heterostrophus gpdI promoter (368 bp) andNeurospora crassa b-tubulin terminator (261 bp) sequences(Motteram et al., 2011; Fig. 3). In order to amend the pCGEN for

YRBC, a 2820 bp fragment, covering the URA3 marker and 2l orifrom plasmid pNEB-hyg-yeast (digested with SacII and SspI)(Schuster et al., 2012) was ligated in vitro with 8257 bp fragmentof vector pCGEN (digested with SacII and PsiI) resulting inpCGEN-YR. pCGEN vector was built on the Agrobacterium binaryvector pCAMBIA0380 (CAMBIA, Canberra, Australia). This vectorallows A. tumefaciens-based transformation into Z. tritici, which isbased on the 25 bp imperfect directional repeat sequences of theT-DNA borders (right and left border, RB and LB; Fig. 3). The vectoralso carries a kanamycin resistance gene and origins of replicationfor amplification in E. coli and A. tumefaciens.

pCHYG-YR. The plasmid pCHYG contains hph gene (1026 bp),encoding hygromycin phosphotransferase, conferring resistanceagainst hygromycin (Waldron et al., 1985), under the control ofAspergillus nidulans trpC promoter (361 bp) and A. tumefaciens nosterminator (253 bp) sequences (Motteram et al., 2009; Fig. 3). Inorder to amend the pCHYG for YRBC, a 2820 bp fragment coveringthe URA3 marker and 2l ori from plasmid pNEB-hyg-yeast(digested with SacII and SspI) (Schuster et al., 2012) was ligatedin vitro with 8117 bp fragment of plasmid pCHYG (digested withSacII and PsiI) resulting in pCHYG-YR. As this vector was derivedfrom the binary vector pCAMBIA0380 (CAMBIA, Canberra,Australia), it is suitable for A. tumefaciens-based transformationinto Z. tritici.

Fig. 3. Organization of four cloning vectors for yeast recombination-based cloning in Z. tritici. Note that fragments are not drawn to scale. The multiple cloning site isindicated by ‘‘MCS’’. Vectors need to be linearized by restriction enzyme-based digestion. See main text for further details on fragment sizes and methodology.

S. Kilaru, G. Steinberg / Fungal Genetics and Biology 79 (2015) 76–83 81

pCBAR-YR. The plasmid pCAMB-BAR contains the bar gene(552 bp) encoding phosphinothricin acetlytransferase, conferringresistance against Bialaphos and BASTA (Block et al., 1987), underthe control of A. nidulans trpC promoter (383 bp) and A. tumefaciensnos terminator (253 bp) sequences (Kramer et al., 2009; Fig. 3). Inorder to amend the pCAMB-BAR for YRBC, a 2847 bp fragment, cov-ering the URA3 marker and 2l ori from plasmid pCGEN-YR(digested with BclI and DraI) was ligated with 7616 bp fragmentof plasmid pCAMB-BAR (digested with BclI and PsiI) resulting inpCBAR-YR. Like the other vectors, pCAMB-BAR is suitable for A.tumefaciens-based transformation into Z. tritici.

pCCBX-YR. The vector pCCBX-YR contains sdi1R gene (1008 bp)encoding mutant allele of the succinate dehydrogenase, whichconfers resistance to the fungicide carboxin, under the control ofZ. tritici sdi1 promoter (1027 bp) and the sdi1 terminator (197 bp)sequences (Fig. 3). This vector was constructed by using homolo-gous recombination in yeast (for details see Methods section).The 9766 bp fragment of pCGEN-YR (digested with BamHI andZraI), 1027 bp of sdi1 promoter, 1008 bp of H267L mutated alleleof sdi1 gene and 197 bp of sdi1 terminator were recombined inyeast S. cerevisiae to obtain the plasmid pCCBX-YR. 1027 bp sdi1promoter and 902 bp 50 end of the sdi1 gene was amplified by usingprimers SK-Sep-282 and SK-Sep11 (Table 1); 106 bp 30 end of thegene and 197 bp sdi1 terminator was amplified by using SK-Sep-12 and SK-Sep-283 primers (Table 1). The point mutation(H267L) was introduced with in the 30 bp of regions needed forhomologous recombination of both SK-Sep-11 and SK-Sep-12 pri-mers (Table 1). Apart from the sdi1 promoter and sdi1 terminator,a point mutation (H267L) was introduced in the sdi1 gene and thesame was also recombined in a single cloning step, demonstratingthe powerfulness of the YRBC approach. This vector was also built

on the binary vector pCAMBIA0380 (CAMBIA, Canberra, Australia)thus enabling A. tumefaciens-based transformation into Z. tritici.

4. Conclusion

In this study we introduce YRBC as a powerful method of con-structing complex vectors for use in Z. tritici. This method offersseveral advantages over conventional restriction enzyme-basedcloning: (1) It allows efficient cloning, as many DNA fragmentscan be used in various combinations (see Fig. 2 for illustration),which also enables the rapid exchange of genes, promoters anddominant selectable marker cassettes; the method (2) is indepen-dent of restriction sites, making cloning of large or many fragmentseasier; (3) allows precise cloning without alteration of the codingsequence; (4) YRBC comes with relatively low associated costs.YRBC was successfully used in studying U. maydis (Bielska et al.,2014; Higuchi et al., 2014; Schuster et al., 2011b, 2012; Steinberget al., 2012). Adapting this powerful cloning method in Z. tritici willrapidly inflate the number of useful constructs, required to betterunderstand cell biology and plant invasion strategies in this impor-tant wheat pathogen.

Acknowledgments

We thank Dr. J. Rudd (Rothamsted Research, Harpenden, UK) forthe plasmids pCGEN and pCHYG and Dr. A. J. Foster (Institute forBiotechnology and Drug Research, Kaiserslautern, Germany) forthe plasmid pCAMB-BAR. The authors are grateful for fundingfor this work from the Biotechnology & Biological SciencesResearch Council (BB/I025956/1). We thank Prof. S.J. Gurr forimproving the manuscript.

82 S. Kilaru, G. Steinberg / Fungal Genetics and Biology 79 (2015) 76–83

References

Adachi, K., Nelson, G.H., Peoples, K.A., Frank, S.A., Montenegro-Chamorro, M.V.,DeZwaan, T.M., Ramamurthy, L., Shuster, J.R., Hamer, L., Tanzer, M.M., 2002.Efficient gene identification and targeted gene disruption in the wheat blotchfungus Mycosphaerella graminicola using TAGKO. Curr. Genet. 42, 123–127.

Andersen, E.C., 2011. PCR-directed in vivo plasmid construction using homologousrecombination in baker’s yeast. Methods Mol. Biol. 772, 409–421.

Benoit, R.M., Wilhelm, R.N., Scherer-Becker, D., Ostermeier, C., 2006. An improvedmethod for fast, robust, and seamless integration of DNA fragments intomultiple plasmids. Protein Expr. Purif. 45, 66–71.

Bielska, E., Schuster, M., Roger, Y., Berepiki, A., Soanes, D.M., Talbot, N.J., Steinberg,G., 2014. Hook is an adapter that coordinates kinesin-3 and dynein cargoattachment on early endosomes. J. Cell Biol. 204, 989–1007.

Birnboim, H.C., Doly, J., 1979. A rapid alkaline extraction procedure for screeningrecombinant plasmid DNA. Nucleic Acids Res. 7, 1513–1523.

Block, M.D., Botterman, J., Vandewiele, M., Dockx, J., Thoen, C., Gossele, V., Movva,N.R., Thompson, C., Montagu, M.V., Leemans, J., 1987. Engineering herbicideresistance in plants by expression of a detoxifying enzyme. EMBO J. 6, 2513–2518.

Bowler, J., Scott, E., Tailor, R., Scalliet, G., Ray, J., Csukai, M., 2010. New capabilitiesfor Mycosphaerella graminicola research. Mol. Plant Pathol. 11, 691–704.

Boyle, J.S., Lew, A.M., 1995. An inexpensive alternative to glassmilk for DNApurification. Trends Genet. 11, 8.

Choi, Y.E., Goodwin, S.B., 2011. MVE1, encoding the velvet gene product homolog inMycosphaerella graminicola, is associated with aerial mycelium formation,melanin biosynthesis, hyphal swelling, and light signaling. Appl. Environ.Microbiol. 77, 942–953.

Dagdas, Y.F., Yoshino, K., Dagdas, G., Ryder, L.S., Bielska, E., Steinberg, G., Talbot, N.J.,2012. Septin-mediated plant cell invasion by the rice blast fungus, Magnaportheoryzae. Science 336, 1590–1595.

Dean, R., Van Kan, J.A., Pretorius, Z.A., Hammond-Kosack, K.E., Di Pietro, A., Spanu,P.D., Rudd, J.J., Dickman, M., Kahmann, R., Ellis, J., Foster, G.D., 2012. The Top 10fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 13, 414–430.

Engler, C., Kandzia, R., Marillonnet, S., 2008. A one pot, one step, precision cloningmethod with high throughput capability. PLoS ONE 3, e3647.

Gurr, S.J., Fones, H., 2015. The impact of Septoria tritici Blotch disease on wheat: anEU perspective. Fungal. Genet. Biol. 79, 3–7.

Gibson, D.G., Benders, G.A., Axelrod, K.C., Zaveri, J., Algire, M.A., Moodie, M.,Montague, M.G., Venter, J.C., Smith, H.O., Hutchison 3rd, C.A., 2008. One-stepassembly in yeast of 25 overlapping DNA fragments to form a completesynthetic Mycoplasma genitalium genome. Proc. Natl. Acad. Sci. USA 105, 20404–20409.

Gietz, R.D., Schiestl, R.H., 2007. Quick and easy yeast transformation using the LiAc/SS carrier DNA/PEG method. Nat. Protoc. 2, 35–37.

Goodwin, S.B., M’Barek, S.B., Dhillon, B., Wittenberg, A.H., Crane, C.F., Hane, J.K.,et al., 2011. Finished genome of the fungal wheat pathogen Mycosphaerellagraminicola reveals dispensome structure, chromosome plasticity, and stealthpathogenesis. PLoS Genet. 7, e1002070.

Hartley, J.L., Temple, G.F., Brasch, M.A., 2000. DNA cloning using in vitro site-specificrecombination. Genome Res. 10, 1788–1795.

Higuchi, Y., Ashwin, P., Roger, Y., Steinberg, G., 2014. Early endosome motilityspatially organizes polysome distribution. J. Cell Biol. 204, 343–357.

Hoffman, C.S., Winston, F., 1987. A ten-minute DNA preparation from yeastefficiently releases autonomous plasmids for transformation of Escherichia coli.Gene 57, 267–272.

Jimenez, A., Davies, J., 1980. Expression of a transposable antibiotic resistanceelement in Saccharomyces. Nature 287, 869–871.

Joska, T.M., Mashruwala, A., Boyd, J.M., Belden, W.J., 2014. A universal cloningmethod based on yeast homologous recombination that is simple, efficient, andversatile. J. Microbiol. Methods 100, 46–51.

Kema, G.H., Verstappen, E.C., Waalwijk, C., 2000. Avirulence in the wheat Septoriatritici leaf blotch fungus Mycosphaerella graminicola is controlled by a singlelocus. Mol. Plant Microbe Interact. 13, 1375–1379.

Kema, G.H.J., van Silfhout, C.H., 1997. Genetic variation for virulence and resistancein the wheat-Mycosphaerella graminicola pathosystem. III. Comparative seedlingand adult plant experiments. Phytopathology 87, 266–272.

Kilaru, S., Schuster, M., Latz, M., Das Gupta, S., Steinberg, N., Fones, H., Gurr S.,Talbot, N.J., Steinberg, G., 2015. A gene locus for targeted ectopic geneintegration in Zymoseptoria tritici. Fungal. Genet. Biol. 79, 118–124.

Kilaru, S., Collins, C.M., Hartley, A.J., Burns, C., Foster, G.D., Bailey, A.M., 2009.Investigating dominant selection markers for Coprinopsis cinerea: a carboxinresistance system and re-evaluation of hygromycin and phleomycin resistancevectors. Curr. Genet. 55, 543–550.

Kilaru, S., Hoegger, P.J., Majcherczyk, A., Burns, C., Shishido, K., Bailey, A., Foster,G.D., Kues, U., 2006. Expression of laccase gene lcc1 in Coprinopsis cinerea undercontrol of various basidiomycetous promoters. Appl. Microbiol. Biotechnol. 71,200–210.

Kramer, B., Thines, E., Foster, A.J., 2009. MAP kinase signalling pathway componentsand targets conserved between the distantly related plant pathogenic fungiMycosphaerella graminicola and Magnaporthe grisea. Fungal Genet. Biol. 46, 667–681.

Kuijpers, N.G., Solis-Escalante, D., Bosman, L., van den Broek, M., Pronk, J.T., Daran,J.M., Daran-Lapujade, P., 2013. A versatile, efficient strategy for assembly of

multi-fragment expression vectors in Saccharomyces cerevisiae using 60 bpsynthetic recombination sequences. Microb. Cell Fact. 12, 47–59.

Landy, A., 1989. Dynamic, structural, and regulatory aspects of lambda site-specificrecombination. Annu. Rev. Biochem. 58, 913–949.

Lu, J., Cao, H., Zhang, L., Huang, P., Lin, F., 2014. Systematic analysis of Zn2Cys6transcription factors required for development and pathogenicity by high-throughput gene knockout in the rice blast fungus. PLoS Pathog. 10, e1004432.

Ma, H., Kunes, S., Schatz, P.J., Botstein, D., 1987. Plasmid construction byhomologous recombination in yeast. Gene 58, 201–216.

Marshall, R., Kombrink, A., Motteram, J., Loza-Reyes, E., Lucas, J., Hammond-Kosack,K.E., Thomma, B.P., Rudd, J.J., 2011. Analysis of two in planta expressed LysMeffector homologs from the fungus Mycosphaerella graminicola reveals novelfunctional properties and varying contributions to virulence on wheat. PlantPhysiol. 156, 756–769.

Mirzadi Gohari, A., Mehrabi, R., Robert, O., Ince, I.A., Boeren, S., Schuster, M.,Steinberg, G., de Wit, P.J., Kema, G.H., 2014. Molecular characterization andfunctional analyses of ZtWor1, a transcriptional regulator of the fungal wheatpathogen Zymoseptoria tritici. Mol. Plant Pathol. 15, 394–405.

Motteram, J., Kufner, I., Deller, S., Brunner, F., Hammond-Kosack, K.E., Nurnberger,T., Rudd, J.J., 2009. Molecular characterization and functional analysis of MgNLP,the sole NPP1 domain-containing protein, from the fungal wheat leaf pathogenMycosphaerella graminicola. Mol. Plant Microbe Interact. 22, 790–799.

Motteram, J., Lovegrove, A., Pirie, E., Marsh, J., Devonshire, J., van de Meene, A.,Hammond-Kosack, K., Rudd, J.J., 2011. Aberrant protein N-glycosylation impactsupon infection-related growth transitions of the haploid plant-pathogenicfungus Mycosphaerella graminicola. Mol. Microbiol. 81, 415–433.

Oldenburg, K.R., Vo, K.T., Michaelis, S., Paddon, C., 1997. Recombination-mediatedPCR-directed plasmid construction in vivo in yeast. Nucleic Acids Res. 25, 451–452.

Perez-Nadales, E., Nogueira, M.F., Baldin, C., Castanheira, S., El Ghalid, M., Grund, E.,Lengeler, K., Marchegiani, E., Mehrotra, P.V., Moretti, M., Naik, V., Oses-Ruiz, M.,Oskarsson, T., Schafer, K., Wasserstrom, L., Brakhage, A.A., Gow, N.A., Kahmann,R., Lebrun, M.H., Perez-Martin, J., Di Pietro, A., Talbot, N.J., Toquin, V., Walther,A., Wendland, J., 2014. Fungal model systems and the elucidation ofpathogenicity determinants. Fungal Genet. Biol. 70, 42–67.

Raymond, C.K., Pownder, T.A., Sexson, S.L., 1999. General method for plasmidconstruction using homologous recombination. Biotechniques 26, 134–141.

Rohel, E.A., Payne, A.C., Fraaije, B.A., Hollomon, D.W., 2001. Exploring infection ofwheat and carbohydrate metabolism in Mycosphaerella graminicolatransformants with differentially regulated green fluorescent proteinexpression. Mol. Plant Microbe Interact. 14, 156–163.

Roohparvar, R., De Waard, M.A., Kema, G.H., Zwiers, L.H., 2007. MgMfs1, a majorfacilitator superfamily transporter from the fungal wheat pathogenMycosphaerella graminicola, is a strong protectant against natural toxiccompounds and fungicides. Fungal Genet. Biol. 44, 378–388.

Rudd, J.J., Keon, J., Hammond-Kosack, K.E., 2008. The wheat mitogen-activatedprotein kinases TaMPK3 and TaMPK6 are differentially regulated at multiplelevels during compatible disease interactions with Mycosphaerella graminicola.Plant Physiol. 147, 802–815.

Scalliet, G., Bowler, J., Luksch, T., Kirchhofer-Allan, L., Steinhauer, D., Ward, K.,Niklaus, M., Verras, A., Csukai, M., Daina, A., Fonne-Pfister, R., 2012. Mutagenesisand functional studies with succinate dehydrogenase inhibitors in the wheatpathogen Mycosphaerella graminicola. PLoS ONE 7, e35429.

Schuster, M., Kilaru, S., Ashwin, P., Lin, C., Severs, N.J., Steinberg, G., 2011a.Controlled and stochastic retention concentrates dynein at microtubule ends tokeep endosomes on track. EMBO J. 30, 652–664.

Schuster, M., Kilaru, S., Fink, G., Collemare, J., Roger, Y., Steinberg, G., 2011b. Kinesin-3 and dynein cooperate in long-range retrograde endosome motility along anonuniform microtubule array. Mol. Biol. Cell 22, 3645–3657.

Schuster, M., Treitschke, S., Kilaru, S., Molloy, J., Harmer, N.J., Steinberg, G., 2012.Myosin-5, kinesin-1 and myosin-17 cooperate in secretion of fungal chitinsynthase. EMBO J. 31, 214–227.

Shanks, R.M., Caiazza, N.C., Hinsa, S.M., Toutain, C.M., O’Toole, G.A., 2006.Saccharomyces cerevisiae-based molecular tool kit for manipulation of genesfrom gram-negative bacteria. Appl. Environ. Microbiol. 72, 5027–5036.

Singh, M.V., Weil, P.A., 2002. A method for plasmid purification directly from yeast.Anal. Biochem. 307, 13–17.

Skinner, W., Bailey, A., Renwick, A., Keon, J., Gurr, S., Hargreaves, J., 1998. A singleamino-acid substitution in the iron-sulphur protein subunit of succinatedehydrogenase determines resistance to carboxin in Mycosphaerellagraminicola. Curr. Genet. 34, 393–398.

Steinberg, G., Schuster, M., Theisen, U., Kilaru, S., Forge, A., Martin-Urdiroz, M., 2012.Motor-driven motility of fungal nuclear pores organizes chromosomes andfosters nucleocytoplasmic transport. J. Cell Biol. 198, 343–355.

Stewart, E.L., McDonald, B.A., 2014. Measuring quantitative virulence in the wheatpathogen Zymoseptoria tritici using high-throughput automated image analysis.Phytopathology 104, 985–992.

Tang, X., Halleck, M.S., Schlegel, R.A., Williamson, P., 1996. A subfamily of P-typeATPases with aminophospholipid transporting activity. Science 272, 1495–1497.

Tu, Z., He, G., Li, K., Chen, M.J., Chang, J., Chen, l., Yao, Q., Liu, D.P., Ye, H., Shi, J., Wu,X., 2005. An improved system for competent cell preparation and highefficiency plasmid transformation using different Escherichia coli strains.Electron. J. Biotechnol. 8, 113–120.

van den Ent, F., Lowe, J., 2006. RF cloning: a restriction-free method for insertingtarget genes into plasmids. J. Biochem. Biophys. Methods 67, 67–74.

S. Kilaru, G. Steinberg / Fungal Genetics and Biology 79 (2015) 76–83 83

Waldron, C., Murphy, E.B., Roberts, J.L., Gustafson, G.D., Armour, S.L., Malcolm, S.K.,1985. Resistance to hygromycin B: a new marker for plant transformationstudies. Plant Mol. Biol. 5, 103–108.

Youssef, F., Marais, A., Faure, C., Gentit, P., Candresse, T., 2011. Strategies to facilitatethe development of uncloned or cloned infectious full-length viral cDNAs: applechlorotic leaf spot virus as a case study. Virol. J. 8, 488.

Zwiers, L.H., De Waard, M.A., 2001. Efficient Agrobacterium tumefaciens-mediatedgene disruption in the phytopathogen Mycosphaerella graminicola. Curr. Genet.39, 388–393.

Zwiers, L.H., Roohparvar, R., de Waard, M.A., 2007. MgAtr7, a new type of ABCtransporter from Mycosphaerella graminicola involved in iron homeostasis.Fungal Genet. Biol. 44, 853–863.