Date post: | 11-Jan-2016 |
Category: |
Documents |
Upload: | muriel-porter |
View: | 213 times |
Download: | 0 times |
KEYS Lab Training – DNA Barcoding: Identification of Species
• Pipetting: Measuring Volumes Accurately• DNA Extraction• PCR and Gel Electrophoresis• Sequencing and Analysis
– Protein Profile: Evolutionary Relationships• Protein Extraction• Determine Protein Concentrations• SDS-PAGE• Stain Protein Gels and Analyze
THE INS AND OUTS OF PIPETTINGPush Button• First Stop: Measurement• Second Stop: Expel volume
Sizes & Volumes• P10 Measures 0.5-10 l• P20: Measures 2-20 l• P200: Measures 20-200l• P1000: Measures 200-1000l
Tips & Tip Ejectors• Match the tip to the Pipet
Tip ejector button
Volume Adjustment Knob
MEASURING VOLUMES
DNA Sequence Data is Obtained for Genetic Research
…TTCACCAACAGGCCCACA…
Extract DNA from Cells
Sequence DNA
Identify matching DNA sequence(s) in
databases
Obtain DNA-bearing tissue samples:
blood , saliva, hair follicles, feathers,
scales
TTCAACAACAGGCCCACTTCACCAACAGGCCCACTTCATCTACAGCCCCAC
• Sample• Extract the DNA• Amplify R.O.I.• Ensure amplification ok• Analyze DNA
– Restriction analysis– Hybridization– Sequencing
• Various Sushi Fish• Dilution Buffer cracks cells• Release Cores pick DNA• Phire Animal Tissue Direct PCR
Kit uses primers to amplify DNA R.O.I.
• Agarose Gel Electrophoresis• DNA Sequencing
From Sample to Sequence
…TTCACCAACAGGCCCACA…
Fish DNAbarcode Primers
Primer mix: 2 forward, 2 reverse•5’- TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC-3’•5’- TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC-3’ •5’- CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA-3’•5’- CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA-3’
From Sequence to Conclusion
PCR is like DNA replication
• DNA Replication• Nuclear DNA • DNA polymerases • Helicase• Primers (from Primase)• dNTPs
• Polymerase Chain Reaction• Sample DNA (from fish)• DNA polymerase• Heat• Primers (specific to COI gene)• dNTPs
PCR Ingredients• 1. DNA “template” Your purified DNA sample
• 2. DNA Polymerase Special DNA polymerase enzyme that is heat stable
• 3. Deoxynucleotides (dNTPs) Building blocks of DNA
• 4. Primers Small pieces of DNA that match the flanks of your
gene or DNA region of interest
• 5. Buffer and water Environment necessary for DNA Polymerase to work; mimics conditions in nucleus
The Power of PCR
http://www.nature.com/scitable/topicpage/the-biotechnology-revolution-pcr-and-the-use-553
View the animation at http://www.dnalc.org/resources/animations/pcr.html
(may require Flash player or Shockwave player)
Fish DNA extraction for PCR• Add 20 µl of Dilution Buffer to a 0.2 ml tube.• Place your fish sample on a clean weigh boat, or other clean surface.• Remove the protective cap of the Uni-Core tool.• Gently push the cutting edge downward into the sample, rotating
gently. Do not press the plunger while cutting.• Lift the tool from the sample, position tool over tube and press the
plunger so that the tissue drops directly into the dilution solution (make sure that you can see the sample in the solution).
• Add 0.5 µl of DNA release solution and vortex briefly, then spin down the solution (make sure the tissue is covered).
• Incubate 2-5 minutes at room temperature, then 2 minutes at 98°C.• Spin down the tissue and move supernatant to a clean 0.65 ml tube.
PCR Ingredients1. Label top of tube 2. Add 20.5 l of nuclease free H203. Add 25 l of 2X Phire PCR Buffer4. Add 2.5 l of DNA sample in Dilution buffer5. Add 2 l of primer mix (both forward and reverse)6. Add 1 l of Phire Hot Start DNA polymerase
PCR Reaction1. 98°C 5 min-denaturation of all DNA in tube2. 98°C 5 sec-denaturation 3. 52°C 20 sec-anneal4. 72 °C 20 sec-extension5. Repeat steps 2-4 30 times6. 72°C 10 min-final extension
Agarose Gel ElectrophoresisMolecular Weight
Standard (DNA of Known Sizes)
1 2 3 4 5 6
Samples of DNA
2000 bp
1000 bp750 bp
Lanes:
Agarose Gel Electrophoresis
• 1. Make the agarose gel: prepare TAE and agarose
• 2. Prepare your sample: mix 10ul DNA with Loading Dye
• 3. Load your sample on the gel
• 4. Run the gel
• 5. Stain and view the gel
Agarose Gel Electrophoresis• Agarose: from agar (seaweed)• Melt the agarose and pour
into a form or gel mold• Small wells in the top of the
gel for DNA samples
• 1. Prepare agarose gel
• 2. Prepare your sample
• 3. Load your sample
• 4. Run gel
• 5. Stain & view gel
Agarose Gel Electrophoresis• 1. Prepare agarose gel
• 2. Prepare your sample
• 3. Load your sample
• 4. Run gel
• 5. Stain & view gel
• 10 L DNA• Loading Buffer
– 6X concentrated– Color– Glycerol
Agarose Gel Electrophoresis
• 1. Prepare agarose gel
• 2. Prepare your sample
• 3. Load your sample on the gel
• 4. Run gel
• 5. Stain & view gel
http://oceanexplorer.noaa.gov/explorations/03bio/background/molecular/media/gel_plate.html
Agarose Gel Electrophoresis
• 1. Prepare agarose gel
• 2. Prepare your sample
• 3. Load your sample
• 4. Run gel
• 5. Stain & view gel
http://bristoluniversityfacultyofscience.blogspot.com/2010/06/tanias-tales-from-lab-part-3.html
Power Supply
Gel Box with Gel
ElectrodesRed = PositiveBlack = Negative
Voltage/Amps
Molecular Weight
500bp
1000bp
2000bp
Samples 2 3 4 5 6
Agarose Gel Electrophoresis• 1. Prepare agarose gel• 2. Prepare your sample• 3. Load your sample• 4. Run gel• 5. Stain & view the gel
Ethidium Bromide & UV Light
http://scienceblogs.com/moleculeoftheday/2/10/ethidium_glowing_dna.php http://www.vernier.com/biotech/wht-dbs.html http://www.vernier.com/biotech/wht-dbs.html
Fast BlastBlack & White image of UVSeparating pieces of DNA
based on size
DNA Sequencing
http://www.scq.ubc.ca/genome-projects-uncovering-the-blueprints-of-biology/
• 1. DNA “template”Your PCR fragment, purified
• 2. Taq PolymeraseHeat-stable DNA polymerase
• 3. Deoxynucleotides (dNTPs) and DideoxynucleotidesBuilding blocks of DNA; regular and altered
• 4. PrimersSpecific for your gene of interest
• 5. Buffer and water
Genetic Researchers Developed Primers for Barcoding
Pool COI-2: mammals, and insects
Pool COI-3: fish
Ivanova et al. 2007. Universal primer cocktails for fish barcoding. Mol Ecol Notes.