Proc. Nadl. Acad. Sci. USAVol. 82, pp. 7374-7378, November 1985Genetics

korA function of promiscuous plasmid RK2: An autorepressor thatinhibits expression of host-lethal gene kilA and replicationgene trfA

(incompatibility group P pasId/promoter/operator/repflcatio4 control/maIntenance regulon)

CALVIN YOUNG, ALICE S. PRINCE*, AND DAVID H. FIGURSKItDepartment of Microbiology and Cancer Center, College of Physicians and Surgeons, Columbia University, 701 West 168th Street, New York, NY 10032

Communicated by Harold S. Ginsberg, July $, 1985

ABSTRACT In broad host-range plasmid RK2, korA func-tion prevents the lethal effect of kiLA on Escherichia cofl hostcells and inhibits expression of IrfA, the essential replicationgene. From gene fusion and promoter replacement studies, wedetermined that control of kiL4 Is also medated at the level ofgene expression and that the target resides in the kiM promoterregion. The nucleotide sequence of this region shows the sametwo operator-like palindromes present in the previously se-quenced promoters of IrfA and korA. One of the palindromes(5'-GTTTAGCTAAAC-3') at the -10 position Is sufficient toconfer sensitivity to korA function. The presence of the samesequences in the korA promoter region suggested that korAmight also regulate Its own expression. Using the structuralgene for chloramphenicol acetyltransferase (cat) fused to thekorA promoter, we found that korA gene expression is indeedautoregulated. The results show that korA gene product is verylikely a repressor that negatively regulates expression of at leastthree different genes by interacting with an operator-likesequence in their promoter regions. Coordinate regulation ofhost-lethal gene kilA and essential replication gene IrfA by acommon mechanism also supports our hypothesis that thesegenes are functionally related.

Plasmid RK2 is a member of incompatibility group P (1).Plasmids of this group, unlike those in most other groups,have the potential for stable maintenance in a broad range ofGram-negative bacterial species (2, 3). This implies thatincompatibility group P plasmids encode unique geneticdeterminants to allow maintenance in a variety of hosts.

Studies ofRK2 have shown that at least two determinantsare required for replication: oriV, the vegetative origin ofreplication (4, 5); and trfA, which encodes a trans-actingfunction required for replication initiated at oriV (6, 7). oriVand trfA regions can provide replication in several Gram-negative hosts (8, 9).RK2 also encodes a set of kil determinants (kilA, kitBi,

kilB2, kitC), which are lethal to the host cell, and kordeterminants (korA, korB, and korC), which prevent theeffects of kit genes on the host (10, 11). All incompatibilitygroup P plasmids encode kor-like functions, which controlRK2 kitA and kilB (kitlE and kitB2), while plasmids fromother incompatibility groups do not (10). Thus, genes relatedto RK2 kor (and probably kit) genes are specifically con-served on incompatibility group P broad host-range plasmids.It is now clear the RK2 kil and kor genes are involved inplasmid replication control. Both korA and korB inhibitexpression ofthe essential replication gene trfA (11-14). kitB)opposes the strong inhibitory effects of korA and korB, suchthat it can be considered an essential replication determinantwhen either korA or korB is present (11, 12). It has been

suggested that kitA may influence stable maintenance ofRK2in Escherichia coli (15), and other studies have revealed a rolefor the korA-korB region in the ability of RK2 and theidentical plasmid RP4 to replicate in Pseudomonas (16-18).Here we report studies on the mechanism of korA control

of kiUA. We have identified the kilA promoter region and thedirection of kilA transcription. We found that the kilApromoter region encodes elements for korA control of kiAand that this control is exerted at the level of kilA expression.Sequence analysis of the kitA promoter region revealedstriking homology with the promoter regions for korA andtfA, including two palindromes first observed in korA andtrfA by Smith et al. (19), who predicted a regulatory functionfor them. Our results show that the palindrome that overlapsthe -10 position of the kiA promoter is sufficient to confersensitivity to korA function. In addition, the remarkablehomology in the promoter regions of these genes led us to yetanother function of korA: its autoregulation.

MATERIALS AND METHODS

Nomenclature. Coordinates of the RK2 physical map (Fig.1) are defined as the distance from the EcoRI site in kilobasesand are designated by a prime (') (e.g., 0'-2.3' region).Superscript "0" indicates that a relevant plasmid gene is notpresent (e.g., korA0).

Bacterial Strains and Plasmids. E. coli MV10 (6) andBMH71-18 (26) have been described. CY1002 is a MV10mutant partially resistant to kiUA (this work). Constructedplasmids containing RK2 DNA are presented in Fig. 1.Media and Reagents. LB, LB-glu, and M9 (±CAA) have

been described (10). M9-CAA was supplemented with L-tryptophan at 50 pg/ml as required. Antibiotics were used asfollows: chloramphenicol (Cm) and kanamycin (Km), 50pg/ml; trimethoprim (Tp), 50 pug/ml; ampicillin (Ap), 100pg/ml. Isopropyl f-D-thiogalactoside and 5-bromo-4-chloro-3-indolyl f3-D-galactoside were used as suggested (27). Re-striction enzymes, BAL-31 exonuclease, T4 DNA ligase, andpolynucleotide linkers were purchased from commercialsuppliers and used as recommended.

Procedures. Preparation of plasmid DNA, agarose gelelectrophoresis, and polyacrylamide gel electrophoresis havebeen described (24). Transformation of E. colti was by themethod of Cohen et al. (28). Nucleotide sequence wasdetermined by the dideoxy-chain-termination method (29).

Abbreviations: Ap, ampicillin; Cm, chloramphenicol; Kin, kanamy-cin; r, resistant; Tp, trimethoprim.*Present address: Departments of Medicine and Microbiology,College of Physicians and Surgeons, Columbia University, 630West 168th Street, New York, NY 10032.tTo whom reprint requests should be addressed.

7374

The publication costs of this article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Janu

ary

28, 2

020

Proc. Natl. Acad. Sci. USA 82 (1985) 7375

kilB kiC C kilAjKm' tra2 tro3 trfATc'oriV -AV/,'

it_- - - korC k ilIA

5' Cm- 2-2ptet

korC \ k kilA5. 0'-i.L2I

pRK226075I ilA

pRK24O118 kilA I

pRK 2275 Po lac I kilA ,

pRK2276 .1iAa ~a

pRK2408a

FIG. 1. Relationship of RK2 to plasmids used in this study. Thegenetic and physical map ofRK2 is linearized at its unique EcoRI site(0'/56.4'). The numbers refer to RK2 coordinates (in kilobases) fromthe EcoRI site. Only relevant restriction endonuclease cleavage sitesare shown. The segments of RK2 present in pRK2219 and pRK2086are enlarged heavy lines flanked by dashed lines. pRK2219 has beendescribed (20). korA' represents the truncated gene that lacks korAactivity. pRK2237 contains this same segment of RK2 DNA clonedinto pUC8 (21) with a promoter-less cat gene (22) inserted at the SalI site in the orientation shown. Plasmids pRK2086 (10) and pRK2260(23) have RK2 DNA cloned into a pMK20 vehicle (24). pRK2092 hasthe Cmr-encoding HincHI fragment from pACYC184 (25) inserted atthe HincIl site of pRK2086. pRK2411 has a BamHI linker (5'-CGGATCCG-3') inserted at the HincII site of pRK2260. pRK2275and pRK2276 contain the BamHI/EcoRI fragment cloned in theorientations shown with respect to the lac regulatory region ofpUC8.pRK2408 is an exonuclease BAL-31-generated deletion of pRK2260with a BamHI linker placed at the endpoint of the deletion and thepromoter-less cat gene inserted at this site in the designated orien-tation. "p" indicates the position of active promoters. Arrowsindicate direction of transcription.

RESULTS

kilA Is Near the HincI Site at RK2 2.2'. Plasmid pRK2086(ref. 10; Fig. 1) contains the RK2 0'-5.5' region, whichencodes both kilA and korC (10, 23). kilA maps to the 0'-2.3'region (Fig. 1); any plasmid carrying this region requires korAto be in the cell to prevent death ofthe host cell. pRK2086 hasa unique HincIl site at RK2 2.2' (23). To determine if this siteoccurs within the kilA coding region, we interrupted it witha Cm-resistant (Cm9-encoding HincII fragment. One suchplasmid is pRK2092 (Fig. 1).

If kilA is unchanged by the insertion, it should not bemaintained in a strain lacking the korA control gene. When akorA° strain was transformed with pRK2092, colonies didappear (Table 1). However, they were considerably smallerthan colonies arising after transformation with a controlplasmid lacking kilA. The small colonies suggested that kilAis expressed in pRK2092, but at a lower level than wild type.This phenotype (Kil+) expressed by pRK2092 indicates thatthe HinclI site at 2.2' is within or near kilA.

kiUl of pRK2092 Is Not Under korA Control. Normally,korA in the cell will control kilA. We therefore expected thatpRK2092 transformants of a korA+ strain would show largehealthy colonies, instead of the small colonies observed withthe korA° strain. However, the pRK2092 transformants ofthekorA+ strain were also small (Table 1). Thus, korA is not ableto control the modified kilA expressed by pRK2092.

It is interesting that pRK2092 was obtained from a korA+host that grew with a normal healthy phenotype, yet theplasmid was not controlled by korA+ hosts in subsequenttransformations. We isolated a plasmid-less segregant(CY1002) of the original transformant and found that it ispartially kil-resistant (Kilr). It provides sufficient protection

Table 1. Relative transformation efficiencies ofpRK2086 derivatives

Recipient strainMV1O- CY1002-

MV10 (pRK2108) CY1002 (pRK2108)Plasmid (korA0) (korA+) (Kilr korA0) (Kilr korA1

pRK2086 <0.001 1.0 <0.001 1.0pRK2092 0.8* 1.5* 0.7 1.0pRK2411 1.2 1.0

Recipient strains were transformed with the test plasmids and Kmrcolonies were selected. The relative competence of each strain wasmonitored by transformation with pMK20 as described (10). Valuesare adjusted for competence differences, which were never morethan 2-fold. Efficiencies of transformation for pRK2086 andpRK2411 are normalized to that of strain MV10(pRK2108); efficien-cy for pRK2092 is normalized to that of strain CY1002(pRK2108).Plasmids are shown in Fig. 1.*Small variable-sized colonies.

from the kilA expressed from pRK2092 but not from wild-type kilA of plasmid pRK2086 (Table 1).An IntactHincH Site at 2.2' Is Required for kiL4 Expression.

A simple explanation for the lack of korA control ofpRK2092is that the tet promoter (ptet) from the inserted fragment (Fig.1) has replaced the natural kilA promoter (pkilA) and that kilAexpressed from another promoter is no longer under korAcontrol. This idea predicts that insertion of a DNA segmentthat does not encode a promoter will result in loss ofexpression of kilA. We therefore inserted a synthetic BamHIlinker at this site in plasmid pRK2260 (Fig. 1). The alteredplasmid was selected in the kilA-resistant mutant strainCY1002 with a resident korA+ plasmid to provide all possiblecontrol of any kilA expression that might result.One clone yielded pRK2411 (Fig. 1). Table 1 shows that

this plasmid gives normal, healthy transformants of a kilA-sensitive and korA° strain. Thus, kilA is not expressed. Anintact HincII site is therefore necessary for kilA expression.

Expression of kiL4 from the lac Promoter. If the HincII siteis within the kilA promoter, then adding a promoter in placeof the BamHI linker in the Kil- plasmid pRK2411 shouldrestore expression of kilA. We used the inducible promoter ofthe E. coli lac operon (plac) and constructed the plasmidspRK2275 and pRK2276 (Fig. 1), which have the kilA regioninserted in opposite orientations.When grown under repressed conditions, strains contain-

ing either plasmid showed a steady increase in number ofviable cells (Fig. 2). However, strains containing pRK2275grown with isopropyl /-D-thiogalactoside to induce placshowed a dramatic decrease in the number of viable cells.This was not observed with pRK2276, in which the kilAregion is transcribed in the opposite direction, or from thepUC8 cloning vehicle itself. In addition, the kilA-resistantstrain CY1002 with pRK2275 exhibited no decrease in viablecell count upon induction. This demonstrates that the loss ofviability by induction of pRK2275 is mediated by kilAspecifically. Therefore, insertion of a heterologous promoter(plac in pRK2275; ptet in pRK2092) at the HincII site at RK22.2' restores expression of kilA. Thus, the site is very likelywithin the promoter, and the direction of kilA transcription isfrom 2.2' toward 0' on the RK2 map.

korA Controls Expression of kiLA. If replacement of the kilApromoter by ptet in pRK2092 removes kilA expression fromkorA control, then kilA expressed from the plac fusion mightlikewise be insensitive to korA control. In fact, korA did notprevent death of the sensitive host MV10 after induction ofthe plac-kilA fusion in pRK2275 (unpublished data). Theseresults suggest that the korA gene product does not interactwith the kilA gene product to prevent the lethal effect, butinstead acts to regulate expression of the kilA gene.

RK25 korA korB656.4"% tral

I

IR pRK2086I59 korA5

pRK2219 -55 9' 552' pRK2092

pRK2237 srat

* EcoRI

T PstI

1 Hinc 1I

4 Hoe II

t BamHI

i SailI

Genetics: Young et al.

Dow

nloa

ded

by g

uest

on

Janu

ary

28, 2

020

Proc. Natl. Acad. Sci. USA 82 (1985)

103

(I)

z

0LA-

z0-J

0

LLI

w

0 60 120 180 240 300TIME AFTER INDUCTION (min)

FIG. 2. Relative viable counts after induction of the plac-kiIAfusions. Cells were grown in M9-CAA medium (supplemented withtryptophan and containing 0.2% glucose) to a density of 4107 cellsper ml. The cultures were split, washed with medium containing0.5% glycerol, and resuspended in the original medium (repressedconditions) or in medium containing 1 mM isopropyl P-D-thiogalac-toside and 0.5% glycerol (induced conditions). All cultures weregrown under selection for resident plasmids with shaking at 37C. Toindicates time at which cells were resuspended. At intervals indi-cated, the cultures were titered for colony-forming units (cfu) onselective and nonselective plates under repressed conditions. Viablecounts on either type ofplates were comparable. c, MV1O(pRK2275)-repressed; *, MV10(pRK2275)induced; v, MV1O(pRK2276)re-pressed; v, MV1O(pRK2276)induced; o, MV1O(pUC8)repressed; *,MV10(pUC8)induced; &, CY1002(pRK2275)repressed; *, CY1002-(pRK2275)induced. The average range ofcfu at To was - 107 cells perml. All counts were normalized after washing to account forvariations in To values.

This predicts that any gene expressed from the kiA

promoter may be under control of korA. Therefore, weintroduced a promoter-less cat gene downstream of the kiApromoter. Since expression ofthe cat gene confers resistanceto Cm upon the host, we could test the effect of korA onexpression from the kilA promoter by-examining the Cmrphenotype of the strains.

Plasmid pRK2408 (Fig. 1) carries such a pkilA-cat fusionand a separate Kmr marker, which provides an internalcontrol. As expected, the ratio of Cmr to Kmr colonies aftertransformation of a korA0 strain was wl.0 (Table 2), indicat-ing that the cat gene is expressed well from the kilA promoter.In addition, transformants of the kilA-resistant strain CY1002also produce a ratio close to 1.0, showing that the mutationin CY1002 that allows it to tolerate kiA does not affect theexpression of kiA. In contrast, when korA' strains aretransformed with pRK2408, the ratios are <0.01. Thus, catgene expression is clearly reduced in the presence of korA.We conclude that korA regulates kilA by controlling expres-sion initiated from the kilA promoter.

Nucleotide Sequence of the kiL4 Promoter. We sequencedthe region surrounding the HincII site ofpRK2086 to identifythe putative promoter for kilA and to detect any potentialregulatory elements that might be sites for the predictedinteraction with the korA product (Fig. 3). There is stronghomology to the consensus sequence for promoters function-al in E. coli (30). The distance between the putative -35 and-10 regions is 18 base pairs (bp), which is acceptable (30);and downstream of the -10 region is the potential transcrip-

Table 2. Expression of pkiLA-cat and pkorA-cat fusions inpresence and absence of korA

Recipient strain, relativetransformation efficiency with

Cm selectionPlasmid Fusion korA0 korA + korA

pRK2408 pkiIA-cat 1.2 0.004 1.6pRK2419 pkilAAI-cat 0.7 0.006 0.7pRK2237 pkorA-cat 1.5 <0.002 0.9

Recipient strains were transformed and plated for Cmr (50 pg/mlfor pRK2408 and pRK2237; 15 pg/ml for pRK2419) or the consti-tutively expressed marker on each plasmid (pRK2408, Kmr;pRK2419, Tpr; pRK2237, Ap9. Values indicate the ratios of thenumber of Cmr transformants to the number of Kmr, Tpr, or Aprtransformants. MV10 is the korA0 recipient strain. MV10(pRK2240)is the korA+ strain used with pRK2408 and pRK2419; MV10-(pRK2241) is the korA strain. MV10(pRK2292) is the korA + strainused with pRK2237; MV10(pRK2291) is the korA strain. PlasmidspRK2240 and pRK2241 (20) have P15A replicons and contain asequenced minimal korA fragment cloned into a cat gene in oppositeorientations. pRK2292 and,-pRK2291 are similar but have pSM1replicons. In pRK2240 anrd pRK2292, expression of korA is depen-dent on transcription from the cat promoter. In pRK2241 andpRK2291, the orientation of the korA structural gene is opposite tothe direction of transcription, so the korA gene product is notexpressed (20).

tion initiation site "CAT." The HincII site overlaps the -35region of the kilA promoter. This explains why interruptionof this site with a BamHI linker abolishes kilA expression.

Autoregulation of korA. The kiUA promoter region hasstriking homology to the promoter regions of the RK2replication gene trfA, known to be regulated by korA, and ofkorA (Fig. 3). The homology includes two related palin-dromes (I and II, 5'-TTTAGCGGCTAAA-3' and 5'-GTTT-CAGCTAAAC-3', respectively) first seen in the korA and trfApromoter regions (19). Because the sequence of the kilApromoter region is nearly identical to that of the korApromoter region, it seemed possible that korA might alsonegatively regulate its own expression.To test this, we fused the korA promoter to the promoter-

less cat cassette. The resulting plasmid, pRK2237 (Fig. 1),expresses cat but does not express a functional korA productbecause part of the korA structural gene is deleted (20).Plasmid pRK2237 was then used to transform korA° andkorA+ strains. In each case, the number of transformants

-35 -10TTGACA TATAAT CAT

IorA oCgAgTTTTAGCGGCTAAAGGTGTTGACG GcGA GAAAIGTTTAGC TAAACT TCTcI CAT9II ). * Hindl 4-- 11 04 )....~

li/A CCAAATTTTAGCGGCTAAAGGTG TTGACG AGGGATAGAAA GTTTAGC TAAACT TCTTC CAT CG

Ir/A CoAAATTTTAGCcGCTAAAGtTc gcGGAoccAAt 6TTTA6C ACT agogl Ct

TTTAGCGGCTAAA GTTTAGC TAAAC

I I

FIG. 3. Comparison of promoter sequences of RK2 genes korA,kilA, and trfA. The region encompassing the kilA promoter iscompared to the analogous promoter regions ofkorA (19, 20) and trfA(19). All sequences are shown 5'-3'. The kilA sequence is given inboldface letters. Exact matches in the korA and trfA sequences arerepresented by boldface letters in these sequences. The -35, -10,and transcription initiation consensus sequences (30) are listed abovethe korA sequence and are boxed to show the analogous regions inthe promoter sequences. Listed below are the sequences of the twopalindromes discussed in the text. Broken arrows over the kilAsequence indicate the entire palindromic sequence in the promoter.*, Guanine residue represents the junction in the construction ofpRK2419.

7376 Genetics: Young et al.

Dow

nloa

ded

by g

uest

on

Janu

ary

28, 2

020

Proc. Natl. Acad. Sci. USA 82 (1985) 7377

expressing Cmr (dependent on expression from the korApromoter) was compared to the number expressing Apr, theconstitutively expressed marker ofpRK2237 (Table 2). Whena korA0 strain is transformed with pRK2237, the ratio ofCmr/Apr transformants is close to 1.0. In contrast, whenpRK2237 is introduced into a korA' strain, the ratio isreduced by a factor of several hundred. Thus, in the presenceof korA, expression of cat from the korA promoter is severelyreduced.

PalindromeI Is Sufficient for Control by korA. We replacedthe segment of thekilA promoter region upstream of theguanine residue (* in Fig. 3). The resulting construction,pRK2419 (Fig. 4), contains a promoter identical to pkilA fromthe -35 region downstream, but it has a different sequenceupstream and thus is missing palindrome I. korA0 and korA'strains were transformed with pRK2419 and the numbers oftransformants expressing Cmr (dependent on expressionfrom this modified promoter) were compared to the numbersexpressing Tpr (constitutively expressed marker of pRK-2419). As can be seen in Table 2, when pRK2419 is introducedinto the korA0 and mutant korA strains, the ratios of Cmr/Tprtransformants are close to 1.0. In contrast, when the recipientstrain is korA+, the ratio is reduced by a factor of >100. Thus,expression of the cat gene from the modifiedkilA promoteris severely reduced in the presence of korA. These resultsindicate that the presence of palindrome II in the promoterregion is sufficient for sensitivity to korA regulation.

DISCUSSION

We have learned the following: (i) korA exerts its control onkilA by regulating gene expression from thekilA promoter;(ii) the korA gene is autoregulated; (iii) kilA, korA, and theessential replication gene trfA are related by the mechanismof their sensitivity to korA regulation; and (iv) there is strictcorrelation between a promoter's sensitivity to korA controland the presence of the operator-like palindrome 5'-GTTT-AGCTAAAC-3' at the -10 position. These results indicatestrongly that korA negatively regulates gene expression byacting as a repressor that inhibits initiation of transcription.Our studies on the expression and control of kilA have

focused on a HincII site at coordinate 2.2' of RK2. The regionsurrounding this site shows a good promoter-like sequencewith the HincII site overlapping the putative -35 region. Thelocation of this promoter corresponds to a strong RNApolymerase binding site mapped previously on RP4 (identicalto RK2) by electron microscopy (31).The sequence also shows possible regulatory signals: a

hyphenated palindrome (I) preceding the putative -35 se-quence and a related true palindrome (II) that overlaps the-10 position (Fig. 3). These are virtually identical to thepalindromes identified by Smith et al. (19) in both the trfA andkorA promoter regions. In addition, palindrome I was found

A

B

-35 -10

4- -* --

-35 -10A _~ _

FIG. 4. Schematic representation of kilA promoter deleted forpalindrome I. A synthetic Hpa I/HincII linker (5'-GTTAAC-3') wasinserted at the Sma I site within the Kmr-encoding gene of pRK2408.Digestion with HincII and subsequent ligation yielded pRK2419,deleted for the smaller of the HincII fragments and thus regeneratingthe HincII site overlapping the -35 region of the kilA promoter. ThekilA promoter of pRK2408 (A) encodes both palindromes; thepromoter ofpRK2419 (B) encodes palindrome II, but not palindromeI. RK2 DNA is represented by straight lines; non-RK2DNA is shownas a wavy line. The positions of the -35 and -10 regions are shown.

The palindromes are indicated by arrows.

in a putative kilB promoter. They predicted that the palin-dromes are regulatory signals for these genes.Our findings support this hypothesis. First, thekilA pro-

moter region, shown by gene fusion studies to contain thetarget for korA regulation, has the same arrangement of thepalindromes as those in the trfA and korA promoter regions.Second, we show that korA, whose promoter was found to benearly identical to thekilA promoter, is regulated by its ownproduct. Evidence of korA autoregulation has also been seenin transcriptional fusions tolacZ (S. Sullivan and M. Gottes-man, personal communication) and at the polypeptide level inmaxicells (J. Kornacki and W. Firshein, personal communi-cation). With these results and the recent finding on korAcontrol of trfA gene expression (11-13), it is clear that allthree genes with the same putative regulatory sequences areregulated by korA.Only one of the palindromes is needed to confer sensitivity

to korA function. We found that akilA promoter deleted forpalindrome I but retaining palindrome II at the -10 positioncan still be regulated by korA. This complements the findingof Smith et al. (19) that a promoter missing palindrome II butspecifying palindrome I at the -10 position is not sensitive tokorA regulation. Thus, there is a striking correlation betweenthe presence of palindrome II and sensitivity to korA control.The simplest model is that korA product, predicted from thekorA sequence to be a small basic polypeptide (20) withhomology to DNA binding proteins (32), can act as arepressor whose operator is palindrome II. We note that inthe kilA promoter, the palindrome extends beyond theconsensus sequence for palindrome II. It is possible that thisis a better target for korA product, suggesting korA may bemore effective in the control ofkilA expression than it is inthe control of trfA or korA expression.The presence of palindrome I in the promoter regions of

kilA, korA, and trfA suggests that expression of thesepromoters may be under control of yet another regulatoryfunction. In fact, trfA expression has been shown to beinhibited by korB function (11-14). Also, Smith et al. (19)reported that a promoter with palindrome I in the -10 regionis under negative control of korA plus korB, but not korAalone. These results suggest the possibility that palindrome Iis an operator for korB function. If so, then korA and kilAshould also show some control by korB. We are currentlytesting this prediction.The finding that korA regulates its own expression is

significant because korA is central to several regulatoryinteractions (Fig. 5). As discussed above, it negativelyregulates kilA (10) and trfA (11-13). In addition, it controlskilBI (11), whose sequence is not yet known, and it isrequired for korC control ofkilC (23). korA is at the beginningof an operon that includes the regulatory gene korB (11, 33),which is known to control kilBi, kilB2, and trfA (11-14).Therefore, any oscillations in the level of korA gene productresulting from autoregulation should directly affect the levelsof korB and korC and thus indirectly affect genes under theircontrol.korA autoregulation also offers a new variation of the

autorepressor model for control of DNA replication (34).Studies with several different plasmids show that an auto-regulatory strategy for initiation of replication may be com-mon. In Xdv (35), the cro repressor acts on a transcriptionalunit, which includes cro and the replication genes 0 and P.In R6K (36), P1 (37), and F (38), the product of the replicationinitiator gene also represses its own transcription. RK2, incontrast, uses an autoregulated repressor gene (korA) that isnot in the same transcriptional unit as the replication initiatorgene (trfA). Although the net effect should be similar-i.e.,maintenance ofa certain level of trfA product in the cell-thisunique arrangement may reflect the central position of korAin the regulation of several RK2 genes. It provides the

Genetics: Young et al.

Dow

nloa

ded

by g

uest

on

Janu

ary

28, 2

020

Proc. Natl. Acad. Sci. USA 82 (1985)

tro2

trfA

Tcr

tra3

kiIA korA korB

_,- f

FIG. 5. Interactions of korA with other RK2 genes. Genetic mapof RK2 indicating known interactions of RK2 korA gene. Negativeinteractions of korA are given as boldface black arrows; positiveinteraction is shown as an unfilled arrow. Known directions oftranscription of affected genes are shown as thin arrows outside thecircle.

opportunity to vary the expression of trfA, either by otherplasmid or host factors or even by mutation, without per-turbing expression of korA.

We thank D. Panagis and H. Spivak for excellent technicalassistance, P. Matsumura for generous help in setting up thedideoxy-sequencing method, and R. Rodriguez for the cat cartridges.This work was supported by National Institutes of Health GrantsGM26863 and GM29085 to D.H.F. and Cancer Center Support GrantCA13696 to Columbia University. D.H.F. is the recipient of Amer-ican Cancer Society Faculty Research Award FRA-285. A.S.P. was

a postdoctoral fellow supported by National Institutes of HealthTraining Grant A107161.

1. Ingram, L., Richmond, M. H. & Sykes, R. B. (1973) Antimi-crob. Agents Chemother. 3, 279-288.

2. Datta, N. & Hedges, R. W. (1972) J. Gen. Microbiol. 70,453-460.

3. Olsen, R. H. & Shipley, P. (1973) J. Bacteriol. 113, 772-780.4. Meyer, R. & Helinski, D. R. (1977) Biochim. Biophys. Acta

478, 109-113.5. Stalker, D. M., Thomas, C. M. & Helinski, D. R. (1981) Mol.

Gen. Genet. 181, 8-12.6. Figurski, D. H. & Helinski, D. R. (1979) Proc. Natl. Acad.

Sci. USA 76, 1648-1652.7. Thomas, C. M., Meyer, R. & Helinski, D. R. (1980) J. Bacte-

riol. 141, 213-222.8. Schmidhauser, T. J., Filutowicz, M. & Helinski, D. R. (1983)

Plasmid 9, 325-330.9. Schmidhauser, T. J. & Helinski, D. R. (1985) in Plasmids in

Bacteria, eds. Helinski, D. R., Cohen, S. N., Clewell, D. B.,Jackson, D. A. & Hollaender, A. (Plenum, New York), p. 874(abstr.).

10. Figurski, D. H., Pohlman, R. F., Bechhofer, D. H., Prince,A. S. & Kelton, C. A. (1982) Proc. Nati. Acad. Sci. USA 79,1935-1939.

11. Figurski, D. H., Young, C., Schreiner, H. C., Pohlman, R. F.,Bechhofer, D. H., Prince, A. S. & D'Amico, T. F. (1985) inPlasmids in Bacteria, eds. Helinski, D. R., Cohen, S. N.,Clewell, D. B., Jackson, D. A. & Hollaender, A. (Plenum,New York), pp. 227-241.

12. Schreiner, H. C., Bechhofer, D. H., Pohlman, R. F., Young,C., Borden, P. A. & Figurski, D. H. (1985) J. Bacteriol. 163,228-237.

13. Shingler, V. & Thomas, C. M. (1984) Mol. Gen. Genet. 195,523-529.

14. Thomas, C. M. & Hussain, A. A. K. (1984) EMBO J. 3,1513-1519.

15. Meyer, R. & Hinds, M. (1982) J. Bacteriol. 152, 1078-1090.16. Barth, P. T. (1979) in Plasmids ofMedical, Environmental and

Commercial Importance, eds. Timmis, K. N. & Pfihler, A.(Elsevier/North-Holland, Amsterdam), pp. 399-410.

17. Barth, P. T., Ellis, K., Bechhofer, D. H. & Figurski, D. H.(1984) Mol. Gen. Genet. 197, 236-243.

18. Thomas, C. M., Hussain, A. A. K. & Smith, C. A. (1982)Nature (London) 298, 674-676.

19. Smith, C. A., Shingler, V. & Thomas, C. M. (1984) NucleicAcids Res. 12, 3619-3630.

20. Bechhofer, D. H. & Figurski, D. H. (1983) Nucleic Acids Res.11, 7453-7469.

21. Vieira, J. & Messing, J. (1982) Gene 19, 259-268.22. Close, T. J. & Rodriguez, R. L. (1982) Gene 20, 305-316.23. Young, C., Bechhofer, D. H. & Figurski, D. H. (1984) J.

Bacteriol. 147, 247-252.24. Kahn, M., Kolter, R., Thomas, C., Figurski, D., Meyer, R.,

Remaut, E. & Helinski, D. R. (1979) Methods Enzymol. 68,268-280.

25. Chang, A. C. Y. & Cohen, S. N. (1978) J. Bacteriol. 134,1141-1156.

26. Ruther, U. (1980) Mol. Gen. Genet. 178, 475-477.27. Miller, J. H. (1972) Experiments in Molecular Genetics (Cold

Spring Harbor Laboratory, Cold Spring Harbor, NY), pp.356-359.

28. Cohen, S. N., Chang, A. C. Y. & Hsu, L. (1972) Proc. NatI.Acad. Sci. USA 69, 2110-2114.

29. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl.Acad. Sci. USA 74, 5463-5467.

30. Siebenlist, U., Simpson, R. B. & Gilbert, W. (1980) Cell 20,269-281.

31. Burkhardt, H.-J. & Wohlleben, W. (1981) J. Gen. Microbiol.125, 189-193.

32. Pabo, C. 0. & Sauer, R. T. (1984) Annu. Rev. Biochem. 53,293-321.

33. Smith, C. A. & Thomas, C. M. (1984) J. Gen. Microbiol. 130,1651-1663.

34. Sompayrac, L. & Maal0e, 0. (1973) Nature (London) NewBiol. 241, 133-135.

35. Matsubara, K. (1981) Plasmid 5, 32-52.36. Schafferman, A., Kolter, R., Stalker, D. & Helinski, D. R.

(1982) J. Mol. Biol. 161, 57-76.37. Chattoraj, D. K., Abeles, A. L. & Yarmolinsky, M. B. (1985)

in Plasmids in Bacteria, eds. Helinski, D. R., Cohen, S. N.,Clewell, D. B., Jackson, D. A. & Hollaender, A. (Plenum,New York), pp. 355-381.

38. S0gaard-Anderson, L., Rokeach, L. A. & Molin, S. (1984)EMBO J. 3, 257-262.

7378 Genetics: Young et al.

Dow

nloa

ded

by g

uest

on

Janu

ary

28, 2

020