+ All Categories
Home > Documents > Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan...

Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan...

Date post: 08-Aug-2020
Category:
Upload: others
View: 0 times
Download: 0 times
Share this document with a friend
32
Webinar: Genetic Considerations in Having Children December 4, 2019 All rights reserved. 1 Genetic Considerations in Having Children Lauren Puryear, MS, CGC Genetic Counselor Genetic Medicine Clinic at the University of Washington Hereditary cancer syndromes Connective tissue disorders Dermatology genetics Neurogenetics Cardiogenetics Autism genetics Mitochondrial genetics Metabolic disorders Vision and hearing disorders Bleeding/clotting disorders …and many more!
Transcript
Page 1: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 1

Genetic Considerations in Having Children

Lauren Puryear, MS, CGCGenetic Counselor

Genetic Medicine Clinic at the University of Washington

• Hereditary cancer syndromes• Connective tissue disorders• Dermatology genetics• Neurogenetics• Cardiogenetics• Autism genetics

• Mitochondrial genetics• Metabolic disorders• Vision and hearing disorders• Bleeding/clotting disorders

…and many more!

Page 2: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 2

Outline• How babies are made (genetics refresher)

• Genetics of EDS

• Genetic testing basics

• Prenatal testing options

• Considerations for anyone having children

Terminology

• EDS: Ehlers-Danlos syndrome• HSD: hypermobility spectrum disorder• Genetic variant: difference in a gene from the typical

genetic sequence• Pathogenic: disease-causing• Mutation: a new genetic variant (may or may not be

pathogenic)

Page 3: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 3

How Babies Are Made (Genetics)

Adapted from Greenwood Genetic Center

Page 4: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 4

Gene

Shutterstock.com

Page 5: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 5

Inheritance Patterns

• Autosomal dominant (AD)

• Autosomal recessive (AR)

• De novo (not inherited)

• Other (X-linked, mitochondrial, multifactorial)

Inheritance Patterns

• Autosomal dominant (AD)

• Autosomal recessive (AR)

• De novo (not inherited)

• Other (X-linked, mitochondrial, multifactorial)

Autosomal means not sex-linked

Page 6: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 6

Autosomal Dominant (AD) Inheritance

Adapted from Greenwood Genetic Center

Autosomal Dominant (AD) Inheritance

Adapted from Greenwood Genetic Center

Page 7: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 7

Autosomal Dominant (AD) Inheritance

Adapted from Greenwood Genetic Center

Autosomal Recessive (AR) Inheritance

Adapted from Greenwood Genetic Center

Page 8: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 8

Autosomal Recessive (AR) Inheritance

Adapted from Greenwood Genetic Center

Autosomal Recessive (AR) Inheritance

Adapted from Greenwood Genetic Center

Page 9: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 9

De novo variants (mutations)

• Every time cells divide to make new cells they copy their genetic information

• Sometimes the copy is not exact

https://www.calpaclab.com/science-jokes/

De novo variants (mutations)

• Every time cells divide to make new cells they copy their genetic information

• Sometimes the copy is not exact

• De novo variants happen when germ cells (sperm and egg) are produced

• We all have a few new variants in our genome that were not inherited from either parent

https://www.calpaclab.com/science-jokes/

Page 10: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 10

De novo variants (mutations)

Some conditions have higher rates of de novo mutations than others

Polycystic kidney disease 5% de novoMarfan syndrome 25% de novoClassical EDS 50% de novo

https://www.calpaclab.com/science-jokes/

De novo variants (mutations)

De novo variants are typically seen in dominant conditions

Once a person has a pathogenic variant it can be passed to their children

https://www.calpaclab.com/science-jokes/

Page 11: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 11

Summary

• For most genes, children inherit one copy from mom and one copy from dad

• Dominant conditions are caused by a pathogenic variant in one copy of a gene

• Recessive conditions are caused by pathogenic variants in both copies of a gene

• De novo variants can cause a dominant condition in a person with no family history

Genetics of EDS

Page 12: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 12

Inheritance of EDS

Arthrochalasia EDS (AD)Cardiac-valvular EDS (AR)Classical EDS (AD)Classical-like EDS (AR)Dermatosparaxis EDS (AR)Kyphoscoliotic EDS (AR)Musculocontractural EDS (AR)Myopathic EDS (AD or AR)Periodontal EDS (AD)Spondylodysplastic EDS (AR)Vascular EDS (AD)

Hypermobile EDS (AD)Hypermobility spectrum disorder (AD)

Inheritance of EDS

Arthrochalasia EDS (AD) COL1A1, COL1A2Cardiac-valvular EDS (AR) COL1A2Classical EDS (AD) COL5A1, COL5A2Classical-like EDS (AR) TNXBDermatosparaxis EDS (AR) ADAMTS2Kyphoscoliotic EDS (AR) PLOD1Musculocontractural EDS (AR) CHST14Myopathic EDS (AD or AR) COL12A1Periodontal EDS (AD) C1S, C1RSpondylodysplastic EDS (AR) SLC39A13Vascular EDS (AD) COL3A1

Page 13: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 13

Points to Remember

• Even in the same family with the same genetic variant, people can have very different clinical features of the condition.

Points to Remember

• Even in the same family with the same genetic variant, people can have very different clinical features of the condition.

• Inheritance pattern (dominant or recessive) determines the chance that a person with a type of EDS will have a child who also has that type of EDS.

Page 14: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 14

Points to Remember

• Even in the same family with the same genetic variant, people can have very different clinical features of the condition.

• Inheritance pattern (dominant or recessive) determines the chance that a person with a type of EDS will have a child who also has that type of EDS.

Points to Remember

• Even in the same family with the same genetic variant, people can have very different clinical features of the condition.

• Inheritance pattern (dominant or recessive) determines the chance that a person with a type of EDS will have a child who also has that type of EDS.

• Each type of EDS is a different condition. Having one type of EDS does not increase your risk to have a child with a different type of EDS.

Page 15: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 15

Genetic Testing Basics

Gene

Page 16: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 16

Gene

GTAGTACCTCTTATGAACGAAAGG

Gene

GTAGTACCTCTTATGAACGAAAGG

Reference: GTAGTACCTCTTATGAACGAAAGG

Page 17: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 17

Gene

GTAGTACCTCTGATGAACGAAAGG

Reference: GTAGTACCTCTTATGAACGAAAGG

Gene sequencing

Gene

GTAGTACCTCTGATGAACGAAAGG

Reference: GTAGTACCTCTTATGAACGAAAGG

Deletion/duplication testing

Page 18: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 18

Gene

GTAGTACCTCTTATGAACGAAAGG

Reference: GTAGTACCTCTTATGAACGAAAGG

Genotyping (most consumer ordered tests)

• Accuracy is less certain (false positives, false negatives, failed reads)

• Health risks identified are often small or do not account for personal/family history

• Third party interpretation services are totally unregulated

Genotyping (most consumer ordered tests)

Page 19: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 19

If you choose to have genetic testing

• Get help from someone who has experience with genetic testing

• Ask about cost and insurance coverage

• Choose a lab that offers clinical testing

Possible test results

Positive: A pathogenic genetic variant is identified

Page 20: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 20

Possible test results

Negative: No genetic variant is found (or only common and clearly benign variants)

Possible test results

Variant of uncertain significance: A genetic variant is found but there is not enough evidence to classify it as pathogenic (harmful) or benign (harmless)

Page 21: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 21

Possible test results

Variant of uncertain significance: A genetic variant is found but there is not enough evidence to classify it as pathogenic (harmful) or benign (harmless)

Variants of uncertain

significance are common

Possible test results

Variant of uncertain significance: A genetic variant is found but there is not enough evidence to classify it as pathogenic (harmful) or benign (harmless)

Variants of uncertain

significance are common

The lab will notify your provider if they

reclassify the VUS

Page 22: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 22

Possible test results

Variant of uncertain significance: A genetic variant is found but there is not enough evidence to classify it as pathogenic (harmful) or benign (harmless)

Variants of uncertain

significance are common

The lab will notify your provider if they

reclassify the VUS

90% of VUS’s turn out to be benign

(harmless)

What can you do with test results?

• Confirm or rule out a diagnosis

• Reproductive planning

• Test family members

• Participate in research or clinical trials

Page 23: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 23

Prenatal Testing Options

Prenatal testing options

1sttrimester

2ndtrimester

3rdtrimester

Page 24: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 24

Prenatal testing options

1st

trimester2nd

trimester3rd

trimester

PGD CVS Amnio Genetic testing

Preimplantation genetic diagnosis (PGD)

• May also be called PGT-M (preimplantation genetic testing – monogenic)

• In vitro fertilization to create embryos in a lab

• Embryos are tested for the known genetic variant

• An embryo without the variant can be transferred

Page 25: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 25

https://www.kitazato-dibimed.com/vitrification/

Preimplantation genetic diagnosis (PGD)

• PGD is expensive ($15,000 per IVF cycle)

• Insurance rarely covers IVF or embryo testing

• Some couples will not have any unaffected embryos to transfer

• Some couples will have embryos left after they are done having children

Preimplantation genetic diagnosis (PGD)

Page 26: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 26

Chorionic villus sampling (CVS)

• Sample of cells from the placenta

• Around 11 weeks of pregnancy (first trimester)

• Can also screen for missing/extra chromosomes

Page 27: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 27

Amniocentesis

• Sample of amniotic fluid from around the fetus

• Around 16-20 weeks of pregnancy (second trimester)

• Can also screen for missing/extra chromosomes and open neural tube defects

Page 28: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 28

Cell-free DNA

• Not used for single gene disorders (yet) but often offered in pregnancy to screen for missing/extra chromosomes

• Uses a blood sample from mother

• Anytime after 10 weeks of pregnancy

What else to know?

• Some families choose to have a child without testing for a known genetic condition in the family

• Even if testing determines that a pregnancy is affected with a condition, it doesn’t tell us what the condition will look like for that child

• There are many ways to become a parent – some families choose to use a sperm/egg donor, adopt, or become foster parents

Page 29: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 29

Pregnancy management

• Talk about your plan for pregnancy with your health care providers

• Talk about your diagnosis with your OB/GYN provider

• Ask about your medications, including non-prescription supplements

• Pregnancy is hard on all bodies – take care of yourself!

Considerations for Anyone Having Children

Page 30: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 30

Carrier screening

Carrier screening for recessive and X-linked genetic conditions is usually offered to all couples• Carrier frequency for cystic fibrosis is 1/25• Carrier frequency for spinal muscular atrophy is 1/50

Some ethnic groups have higher carrier frequencies for certain conditions

Risks in any pregnancy…

• Congenital heart defect (1/100)• Down syndrome (1/700)• Cleft lip (1/940)• Spina bifida (1/2800)

We don’t understand all the genetic/environmental factors that affect risk

Page 31: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 31

Resources

• National Society of Genetic Counselors (www.nsgc.org)

• American College of Medical Genetics and Genomics (www.acmg.net)

• American College of Obstetricians and Gynecologists (www.acog.org)

https://www.healthymiamidade.org/committees/florida-healthy-babies/

Page 32: Lauren Puryear: Genetic Considerations in Having Children · 2020-01-13 · •Talk about your plan for pregnancy with your health care providers •Talk about your diagnosis with

Webinar: Genetic Considerations in Having Children

December 4, 2019

All rights reserved. 32

Thank You!

Lauren Puryear, MS, [email protected]


Recommended