Lecture 6. Functional Genomics: DNA microarrays and re-sequencing individual genomes by hybridization

Goals of Functional Genomics:1)DNA2)RNA3) Protein4) Whole organism5) Society

Lander, E. 1996. The New Genomics: Global Views of Biology. Science 274: 536-539.

1. DNA level:

a) Systematic identification of all common variants in human genes, both the coding and non-coding regions.

These are the "isotopes" to gene "elements"

b) resequencing of entire genomes of individuals

c) comparison of fully sequenced genomes of related (and unrelated) species

EG: man and chimpThis requires sequencing of many genomes.

Defining the COMMON DIFFERENCES within the Human Population

Polymorphism: a variant in sequence that occurs in >1% of the population. Can be a single nucleotide change, a deletion or insertion.Mutation: a variant that occurs at a frequency of <1% and that is responsible for a disease in the human population.

Mutations in general have occurred at a more recent evolutionary time than polymorphisms.

The most common variations among individual humansare single nucleotide polymorphisms (SNPs), which occur approximately once every 500 to 2000 bases. “Isotopes” to normal base “elements”.

Why identify human polymorphisms?

Human polymorphisms, including SNPs, are associated with a higher risk for common human genetic diseases, for example, heart disease, diabetes, alzheimers disease, osteoporosis and cancer.Examples of SNPs identified by studyingone gene at a time (age of cloning approach):-leukocyte antigen complex : type I diabetes-ApoE4 allele : Alzheimer's disease-insulin promoter polymorphism: type I diabetes-Collagen1A1 gene polymorphism: osteoporosis.

These common diseases are complex, likely involving many genes, and different combinations of gene isotopes and elements will present different risks of disease, different prognoses, and, perhaps eventually, even different treatments

Genome-wide surveys of polymorphisms in affected individuals might reveal such combinations

Molecular Markers can be linked to a phenotypic trait

Re-sequencing the genome of individuals will be required to identify combinations of gene polymorphisms contributing to common human diseases.

Phase I: Draft Sequence of Human Genome (5-7 Individuals; capillary sequencers)

Phase II: Identification of All Common Polymorphisms(~30 individuals, capillary sequencers)

Phase III: Comparison of a Group of Affected Individuals(e.g., heart disease patients) with normal siblings(~180-200 sib pairs; Microarrays)

Phase IV: Survey of large populations (Microarrays)

Double-stranded DNA can be MELTED and REANNEALED

T(M)=temperature at which 1/2 of a DNA sequence of known composition will be denatured (single stranded): directly proportional to G:C content

T(M) Depends on the STRINGENCY under which it is measured

T(M) of the same DNAdetermined underdifferent conditions

Under Stringent Conditions, Hybridization of 2 DNA strands is a measure of IDENTITY Complete hybridization=identical sequence

5’TCGGATCGACTT3’

3’AGCCTAGCTGAA5’

HYBRIDIZATION=Identical (complementary) sequence

5’TCGGATCGACTT3’

3’AGCCTAACTGAA5’

A)

B)

NO HYBRIDIZATION=Sequence Difference(s)

Simple Example of Sequencing by Hybridization:Consider the 12-mer TCGGATCGACTT.

Simple Example of Sequencing by Hybridization:Consider the 12-mer TCGGATCGACTT.Hybridize this 12-mer to a library of 8-mers of all possible sequences (48 possible unique combinations, or 65,536 oligonucleotides), one at a time.

Simple Example of Sequencing by Hybridization:Consider the 12-mer TCGGATCGACTT.Hybridize this 12-mer to a library of 8-mers of all possible sequences (48 possible unique combinations, or 65,536 oligonucleotides) one at a time.

If high stringency hybridization is used, only 5 overlapping 8-mers (out of 65,536) will hybridize:

Simple Example of Sequencing by Hybridization:Consider the 12-mer TCGGATCGACTT.Hybridize this 12-mer to a library of 8-mers of all possible sequences (48 possible unique combinations, or 65,536 oligonucleotides) one at a time.

If high stringency hybridization is used, only 5 overlapping 8-mers (out of 65,536) will hybridize:TCGGATCG CGGATCGA GGATCGAC GATCGACT ATCGACTT

Simple Example of Sequencing by Hybridization:Consider the 12-mer TCGGATCGACTT.Hybridize this 12-mer to a library of 8-mers of all possible sequences (48 possible unique combinations, or 65,536 oligonucleotides) one at a time.

If high stringency hybridization is used, only 5 overlapping 8-mers (out of 65,536) will hybridize:TCGGATCG CGGATCGA GGATCGAC GATCGACT ATCGACTTTCGGATCGACTTAlignment of these 5 gives the sequence of the 8-mer.

Simple Example of Sequencing by Hybridization:Consider the 12-mer TCGGATCGACTT.Hybridize this 12-mer to a library of 8-mers of all possible sequences (48 possible unique combinations, or 65,536 oligonucleotides) one at a time.

If high stringency hybridization is used, only 5 overlapping 8-mers (out of 65,536) will hybridize:TCGGATCG CGGATCGA GGATCGAC GATCGACT ATCGACTTTCGGATCGACTTAlignment of these 5 gives the sequence of the 8-mer.

If all 65,536 oligos are each synthesized on a single glass chip, then a single hybridization reaction can be used to determine the sequence of the 8-mer.

Synthesis of Oligonucleotides on Solid Supports

Multiple Oligonucleotides synthesized in situ on glass slides using light directed combinatorial chemistry

Pease, Solas, Sullivan, Cronin, Holmes, and Fodor. 1994. Light-generated oligonucleotide arrays for rapid DNA sequence analysis. PNAS USA 91:5022-5026

In the end, 70,000 copies of oligo synthesized per each slot

Hybridization to a DNA chip is temp. dependent

Hybridization to a DNA chip is sequence specific:

Detection of a single 8-mer by hybridization to an array of 256 octomers

Format for the DNA sequencing chip:overlapping oligonucleotides that vary at the center position.

1500 bp of hymn HIV pol and protease genes representedon a single array with polymorphism at every position scored

Fragmented, labeled cDNAfrom HIV isolate

Wild-type

Example: Detecting a mutation in human mitochondrial DNA

Wild-type sequence Mutated sequence

Step 3-4: Genome-wide surveys of polymorphisms

SNPs are defined, now design chips to look at only the regions with knwn SNPs

(SNP Chips)

Wang DG., et al. (1998). Large‑scale identification, mapping,and genotyping of single‑nucleotide polymorphisms in the human genome. Science 280:1077‑1082.

Use mulitplex PCR toamplify many possible SNP sites from a single individual;label and hybridizeto chips designedto detect the knownSNPs

Example of a SNP Chip