Legume-infecting Begomoviruses: Diversity and
Host Interaction
A dissertation submitted to Quaid-i-Azam University, Islamabad in
partial fulfilment of requirements for the degree of
DOCTOR OF PHILOSPHY
IN
BIOTECHNOLOGY
By
Muhammad Ilyas
National Institute for Biotechnology and Genetic Engineering
(NIBGE), Faisalabad
and
Quaid-i-Azam University Islamabad, Pakistan
2010
ii
This thesis submitted by Muhammad Ilyas is accepted in its present form by Quaid-i-
Azam University Islamabad as satisfying the thesis requirements for the award of the
degree of Doctor of Philosophy in Plant Biotechnology.
Supervisor -------------------------------------------------
(Dr. Rob W. Briddon) HEC Foreign Faculty
National Institute for Biotechnology and Genetic
Engineering, Faisalabad
Co-Supervisor -------------------------------------------------
(Dr. Shahid Mansoor) National Institute for Biotechnology and Genetic
Engineering, Faisalabad
External Examiner 1 -------------------------------------------------
(Dr. Abdul Rauf Shakoori) Distinguished National Professor,
School of Biological Sciences, University of the
Punjab (Quaid-e-Azam Campus), Lahore
External Examiner 2 -------------------------------------------------
(Dr. Asif Ali) Department of Plant Breeding and Genetics,
University of Agriculture Faisalabad
Director -------------------------------------------------
(Dr. Zafar Mehmood Khalid) National Institute for Biotechnology and Genetic Engineering, Faisalabad
iii
ABSTRACT
The legume yellow mosaic viruses (LYMVs) are members of the proposed
sub-genus “Legumovirus” within the genus Begomovirus of the family
Geminiviridae; single-stranded DNA viruses transmitted by the whitefly Bemisia
tabaci. The legumoviruses are evolutionarily distinct from all other begomoviruses
and are of interest for this reason as well as for the losses they cause to leguminous
crops across southern Asia. There are four LYMVs (Mungbean yellow mosaic virus
[MYMV], Mungbean yellow mosaic India virus [MYMIV], Dolichos yellow mosaic
virus [DoYMV] and Horsegram yellow mosaic virus [HgYMV]) that have been
shown to be responsible for yellow mosaic disease (YMD) of legumes across southern
Asia.
An analysis of the genetic diversity of LYMVs across Pakistan was conducted.
Samples were collected from 11 districts across Pakistan and 48 full-length
begomovirus components (25 DNA-A, 21 DNA-B) were cloned and sequenced in
their entirety. Analysis of these sequences showed that MYMIV is the most prevalent
causal agent of YMD in legume crops in Pakistan and shows phylogeographic
segregation; no other virus species was shown to cause YMD of leguminous crops.
MYMV, which is the major pathogen responsible for YMD of legumes in southern
and western India, was also identified in Pakistan but this was identified only in a
leguminous weed, Rhynchosia capitata. In addition a novel begomovirus, with less
than 70% nucleotide sequence identity to all other begomoviruses, was isolated from
another leguminous weed, Rhynchosia minima. This newly identified begomovirus
was shown to belong to the LYMV cluster and was tentatively named Rhynchosia
yellow mosaic virus (RhYMV). As well as the LYMV components, two virus species
not commonly identified in legumes (Pedilanthus leaf curl virus [PedLCV] and
Papaya leaf curl virus [PaLCuV]) as well as a betasatellite (Tobacco leaf curl
betasatellite [TbLCB]) were isolated from some legumes infected with MYMIV and
showing typical YMD symptoms.
Constructs for the Agrobacterium-mediated inoculation of representative
isolates of all begomovirus species and two isolates of MYMIV were produced. The
MYMV was shown to infect blackgram, inducing very mild symptoms. RhYMV was
shown to be infectious to some lines of soybean but not any of the other leguminous
iv
crops tested. The limited host range of these two viruses possibly explains their
absence in crops. In contrast, two isolates of MYMIV, isolated from soybean
(MYMIV-Sb) and mungbean (MYMIV-Mg) showed differing infectivities to
legumes. The soybean isolate showed high levels of infectivity to soybean but low
levels in blackgram, whereas the mungbean isolate was highly infectious to
blackgram but poorly infectious to mungbean. This suggests that isolates of this virus
are adapted to distinct hosts. None of the LYMVs examined was infectious to the
non-legume Nicotiana benthamiana, a species which is commonly used as an
experimentally host for all other dicot-infecting begomoviruses for which infectivity
has been investigated. This is the first time this lack of infectivity to N. benthamiana
has been reported. Similarly the viruses were not infectious to N. tabacum.
The identification of a betasatellite in legumes is of grave concern due to the
possibility of it increasing disease severity. TbLCB was shown to have the capacity
to be maintained by MYMIV, MYMV and RhYMV, the first time a betasatellite has
been shown to be trans-replicated by a LYMV, and to extend the host range of these
viruses to N. benthamiana. Although DNA-B of all three viruses had some role to
play in such infections (co-inoculation of DNA-B or expression of the DNA-B
encoded MP under the control of the 35S promoter increased infectivity of MYMIV
DNA-A and TbLCB from 60% to 100%), in the absence of DNA-B, TbLCB
complemented the usual functions of DNA-Bs of all three viruses. This ability of
TbLCB to complement DNA-B functions was shown to be a function of the only gene
product encoded by betasatellites, βC1. Expression of TbLCB βC1 from PVX or
transiently under the control of the 35S promoter allowed MYMIV to move
systemically in N. benthamiana. However, when βC1 was expressed transiently using
the 35S promoter, virus levels in systemically infected tissues were low and no
symptoms ensued, suggesting that the βC1 function that assists MYMIV infection acts
only at the site of inoculation and does not spread.
The results obtained indicate that the lack of the infectivity of MYMIV to N.
benthamiana is due to a lack of adaptation of the DNA-B-encoded products to this
host. Thus when complemented by TbLCB, or by one of several monopartite
begomoviruses (including PedLCV), MYMIV was able to efficiently spread
systemically. In addition, plant host-defense mediated by RDR6 was shown to play a
small role in limiting infection in N. benthamiana. However, silencing of this gene by
VIGS did not allow MYMIV to induce a symptomatic infection.
v
At this time the transformation of many legumes, particularly the grain
legumes, is problematic, precluding the use of legume-transformation for the study of
pathogen derived resistance to the LYMVs. Using a novel system, based upon the
complementation of MYMIV movement using TbLCB, N. benthamiana was shown to
potentially be a useful model host for such studies. Using transient expression of an
antisense Rep gene construct, the infectivity of MYMIV (in the presence of TbLCB)
was reduced by 90%. This indicates that RNAi may be a useful tool in reducing losses
to LYMVs across Asia and that the betasatellite assisted infectivity system provides a
means of selecting the most efficient constructs prior to efficient transformation
protocols for local legume species becoming available.
vi
This Humble Effort is Dedicated
to
My Parents, Wife and Children
vii
Acknowledgements
All thanks are for “ALLAH” whose blessings enabled me to seek knowledge
and invigorate me for this task. Words can’t express my feelings of thankfulness for
“ALLAH” almighty. I offer my salutations to The Holy Prophet Muhammad
(peace be upon Him), the source of guidance for humanity as a whole forever.
Special gratitude is due to Higher Education Commission of Pakistan for
providing financial support to my studies and making my dreams come true. I offer
my special thanks to Dr. Zafar Mehmood Khalid, Director NIBGE, for providing
me 24h available laboratories and NIBGE transport facility for sampling tours across
the country. I am also thankful to Dr. Yusuf Zafar (ex-Director NIBGE) for his full
support in early part of my PhD. It is my utmost pleasure to avail this opportunity to
extend my heartiest gratitude to my supervisor Dr. Rob W. Briddon whose presence
was always a source of confidence for me. I want to thank him from the core of my
heart for his personal interest, ample support, valuable guidance and suggestions and
help during this research work and writing of this manuscript. I shall always be
thankful to him for his affectionate behaviour towards me. He has always been a
source of inspiration, guidance and encouragement for me. I wish to express my deep
sense of gratitude for my co-supervisor Dr. Shahid Mansoor who has made a great
contribution for the successful completion of this work. His skilful advices, sincere
cooperation, and learned guidance enabled me to complete this work. I learned a lot
from him and he has been a very kind teacher and for him no acknowledge could ever
adequately express my obligation.
I am deeply indebted to Mr. Imran Amin for his cooperation, encouragement
and useful suggestions in accomplishment of this work. I have respectful appreciation
for Dr. Muhammad Saeed and Ms. Javaria Qazi for their all time available help
and sincere cooperation. I want to thank all my colleagues, Muhammad Shafiq
Shahid, Muhammad Tehseen Azhar, Luqman Amrao, Aamir Humayun Malik,
Nazia Nahid, Saiqa Andleeb, Rohina Bashir, Huma Mumtaz, Musarrat Shaheen,
Atiq ur Rehman, Nouman Tahir, Sohail Akhter, Irfan Ali, Zafar Iqbal,
Muhammad Yusuf, Ghulam Rasool Baloch, Ghulam Rasool, Khadim Hussain
and Muhammad Mubin.
viii
In the end I want to acknowledge the most important people, the lab
supporting staff, Yasmeen, Muhammad Asif, Ghulam Mustafa and Muhammad
Akhtar for their cooperation in lab work.
ix
ABBREVIATIONS
µL micorlitre
AAP acquisition access period
AD Anno Domini
asRNA anti-sense RNA
AVRDC Asian Vegetable Research and Development Centre
AZPs artificial zinc finger proteins
BC Before Christ
BND benzoylated naphthoylated DEAE
BSA bovine serum albumin
CaCl2 calcium chloride
cccDNA covalently closed circular DNA
CIAP calf intestine alkaline phosphatase
CLCuD cotton leaf curl disease
CP coat protein
CR common region
CTAB cetyl trimethyl ammonium bromide
DEAE diethylaminoethyl cellulose
DNA deoxyribonucleic acid
DNAi DNA interference
dNTP deoxyribonucleotide triphosphate
dsDNA double-stranded DNA
dsRNA double-stranded RNA
DTT dithiothreitol
EDTA ethylene diamine tetraacetic acid
EU European Union
FeSO4.7H2O ferrous sulphate hepta hydrate
GFP green fluorescence protein
GUS beta-glucuronidase
hpRNA hairpin RNA
HR hypersensitive response
ICTV International Committee on Taxonomy of Viruses
IPTG isopropyl-beta-D-1-thiogalactopyranoside
IR intergenic region
IRD iteron related domain
K2HPO4 dipotassium phosphate
KCl potassium chloride
kDa kilo Dalton
kV kilo Volt
LB Lauria broth
LIR large intergenic region
LYMV legume yellow mosaic virus
MCS multiple cloning site
mg milligram
MgSO4 magnesium sulphate
MgSO4.7H2O magnesium sulphate heptahydrate
miRNA microRNA
mM millimolar
x
MP movement protein
mRNAs messenger RNA
NaCl sodium chloride
NaH2PO4 sodium phosphate
NaOH sodium hydroxide
NARC National Agricultural Research Centre
ng nanogram
NH4Cl ammonium chloride
NIGAB National Institute for Genomics and Advanced Biotechnology
NLS nuclear localization signals
NSP nuclear shuttle protein
nt. nucleotide
NW New World
OD optical density ORF open reading frame
OW Old World
PCNA proliferating cell nuclear antigen
PCR polymerase chain reaction
PDR pathogen derived resistance
pH paviour of hydrogen
pre-miRNA precursor miRNA
PVP polyvinyl pyrrolidone
RCA rolling circle amplification
RCR rolling circle replication
RDR recombination-dependent replication
RdRP RNA dependent RNA polymerase
REn replication enhancer protein
Rep replication associated protein
RISC RNA-induced silencing complex
RNA ribonucleic acid
RNAi RNA interference
rpm revolutions per minute
SBS School of Biological Sciences
SCR satellite-conserved region
SDS sodium dodecyl sulphate
SIR small intergenic region
siRNA small interfering RNA
SSC standard sodium citrate
ssDNA single-stranded DNA
TAE tris-acetate EDTA
Taq Thermus aquaticus
ta-siRNAs trans-acting siRNAs
TGS transcriptional gene silencing
TrAP transcriptional activator protein
T-Rep truncated Rep
UV ultra violet
VIGS virus induced gene silencing
X-Gal 5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside
YMD yellow mosaic disease
xi
VIRUSES AND BETASATELLITES
Abutilon mosaic virus (AbMV)
African cassava mosaic virus (ACMV)
Ageratum yellow leaf curl betasatellite (AYLCB)
Ageratum yellow vein betasatellite (AYVB)
Ageratum yellow vein Sri Lanka betasatellite (AYVSLB)
Ageratum yellow vein virus (AYVV)
Alternanthera yellow vein betasatellite (AlYVB)
Bean dwarf mosaic virus (BDMV)
Bean golden yellow mosaic virus (BGYMV)
Bean leaf curl China betasatellite (BLCCNB)
Bean yellow dwarf virus (BeYDV)
Beet curly top virus (BCTV)
Beet severe curly top virus (BSCTV)
Cabbage leaf curl virus (CabLCuV)
Cestrum yellow leaf curling virus (CmYLCV)
Chilli leaf curl betasatellite (ChLCB)
Chilli leaf curl virus (ChiLCV)
Citrus tristezia virus (CTV)
Corchorus golden mosaic virus (CoGMV)
Corchorus yellow vein virus (CoYVV)
Cotton leaf crumple virus (CLCrV)
Cotton leaf curl Gezira betasatellite (CLCuGB)
Cotton leaf curl Gezira virus (CLCuGV)
Cotton leaf curl Kokhran virus (CLCuKV)
Cotton leaf curl Multan betasatellite (CLCuMB)
Cotton leaf curl Multan virus (CLCuMV)
Cowpea golden mosaic virus (CPGMV)
Croton yellow vein mosaic betasatellite (CroYVMB)
Dolichos yellow mosaic virus (DoYMV)
East African cassava mosaic Cameroon virus (EACMCV)
East African cassava mosaic Zanzibar virus (EACMZV)
Erectites yellow mosaic betasatellite (ErYMB)
Eupatorium yellow vein betasatellite (EpYVB)
Euphorbia leaf curl virus (EuLCV)
Honeysuckle yellow vein betasatellite (HYVB)
Honeysuckle yellow vein Japan betasatellite (HYVJB)
Honeysuckle yellow vein Kobe betasatellite (HYVKB)
Honeysuckle yellow vein mosaic betasatellite (HYVMB)
Honeysuckle yellow vein Nara betasatellite (HYVNB)
Horesgram yellow mosaic virus (HgYMV)
Indian cassava mosaic virus (ICMV)
Kenaf leaf curl betasatellite (KLCuB)
Kudzu mosaic virus (KuMV)
Ludwigia leaf distortion betasatellite (LuLDB)
Maize streak virus (MSV)
Malvastrum leaf curl betasatellite (MaLCuB)
Malvastrum yellow vein Yunnan betasatellite (MaYVYnB)
xii
Mesta yellow mosaic betasatellite (MeYMB) Mungbean yellow mosaic India virus (MYMIV)
Mungbean yellow mosaic virus (MYMV)
Okra leaf curl betasatellite (OLCuB)
Papaya leaf curl betasatellite (PaLCuB)
Papaya leaf curl China virus (PaLCuCNV)
Papaya leaf curl Guangdong virus (PaLCuGuV)
Papaya leaf curl virus (PaLCuV)
Pedilanthus leaf curl virus (PedLCV)
Pepper leaf curl Bangladesh virus (PepLCBDV)
Potato virus X (PVX)
Rhynchosia yellow mosaic virus (RhYMV)
Sida leaf curl betasatellite (SiLCuB)
Sida yellow vein mosaic China betasatellite (SiYMCNB)
Siegesbeckia yellow vein betasatellite (SibYVB)
Soybean leaf crinkle virus (SbCLV)
Squash leaf curl virus (SqLCV)
Sri Lankan cassava mosaic virus (SLCMV)
Tobacco curly shoot betasatellite (TbCSB)
Tobacco leaf curl betasatellite (TbLCB)
Tobacco mosaic virus (TMV)
Tobacco yellow dwarf virus (TbYDV)
Tomato golden mosaic virus (TGMV)
Tomato leaf curl Bangalore betasatellite (ToLCBB)
Tomato leaf curl Bangalore virus (ToLCBV)
Tomato leaf curl Bangladesh betasatellite (ToLCBDB)
Tomato leaf curl Bangladesh virus (ToLCBDV)
Tomato leaf curl China betasatellite (ToLCCNB)
Tomato leaf curl China virus (ToLCCNV)
Tomato leaf curl Gujrat virus (ToLCGV)
Tomato leaf curl Karnatka virus (ToLCKV)
Tomato leaf curl New Delhi virus (ToLCNDV)
Tomato leaf curl Philippines virus (ToLCPV)
Tomato leaf curl virus (ToLCV)
Tomato mottle virus (ToMoV)
Tomato pseudo-curly top virus (TPCTV)
Tomato yellow leaf curl China betasatellite (TYLCCNB)
Tomato yellow leaf curl China virus (TYLCCNV)
Tomato yellow leaf curl virus (TYLCV)
Turnip crinkle virus (TCV)
Wheat dwarf virus (WDV)
xiii
Table of Contents CHAPTER 1: INTRODUCTION AND REVIEW OF LITERATURE ................................................. 1
1.1 Plant viruses ................................................................................................................ 1 1.2 Geminiviruses .............................................................................................................. 1 1.3 Classification of geminiviruses ..................................................................................... 4
1.3.1 Mastrevirus .......................................................................................................... 4 1.3.2 Curtovirus ............................................................................................................. 6 1.3.3 Topocuvirus .......................................................................................................... 7 1.3.4 Begomovirus ........................................................................................................ 8
1.4 Proteins encoded by geminiviruses ............................................................................ 14 1.4.1 Replication associated protein ............................................................................ 14 1.4.2 Transcriptional activator protein......................................................................... 15 1.4.3 Replication enhancer protein .............................................................................. 18 1.4.4 AC4..................................................................................................................... 19 1.4.5 Pre-coat protein ................................................................................................. 19 1.4.6 Coat protein ....................................................................................................... 20 1.4.7 Nuclear shuttle protein ....................................................................................... 21 1.4.8 Movement protein ............................................................................................. 22
1.5 DNA replication of geminiviruses .............................................................................. 23 1.6 Evolution of geminiviruses ......................................................................................... 26 1.7 Legumes .................................................................................................................... 29 1.8 Legume-infecting begomoviruses .............................................................................. 35
1.8.1 History of yellow mosaic disease of legumes in southern Asia ............................ 36 1.8.2 Host adaptation of the legume yellow mosaic viruses ........................................ 36 1.8.3 Relationship of legume yellow mosaic viruses to other begomoviruses .............. 38
1.9 Strategies for engineering resistance to geminiviruses .............................................. 38 1.9.1 Resistance by the expression of proteins ........................................................... 38 1.9.2 DNA interference ............................................................................................... 40 1.9.3 RNA interference ............................................................................................... 41 1.9.4 Aims and objectives of the study ....................................................................... 43
CHAPTER 2: MATERIALS AND METHODS ........................................................................... 44 2.1 Sample collection ...................................................................................................... 44 2.2 DNA extraction from plant tissue ............................................................................... 44
2.2.1 DNA extraction from legumes ............................................................................ 44 2.2.2 DNA extraction from Nicotiana benthamiana and N. tabacum ........................... 45
2.3 Quantification of DNA ............................................................................................... 46 2.4 Amplification of DNA ................................................................................................. 46
2.4.1 PCR amplification of DNA ................................................................................... 46 2.4.2 Rolling-circle-amplification ................................................................................ 49
2.5 Cloning of amplified DNA ........................................................................................... 49 2.5.1 Cloning of PCR product ...................................................................................... 49
2.6 Transformation of competent cells ............................................................................ 50 2.6.1 Transformation of heat-shock competent E. coli cells ......................................... 50 2.6.2 Transformation of competent Agrobacterium tumefaciens cells ......................... 50
2.7 Preparation of competent cells .................................................................................. 51 2.7.1 Preparation of heat-shock competent Escherchia coli cells ................................. 51 2.7.2 Preparation of electro competent Agrobacterium tumefaciens cells .................. 51
2.8 Plasmid isolation ....................................................................................................... 51 2.9 Digestion of plasmid DNA .......................................................................................... 52 2.10 Agarose-gel electrophoresis .................................................................................... 53 2.11 Preparation of glycerol stocks .................................................................................. 53 2.12 Purification of DNA .................................................................................................. 53
xiv
2.12.1 Gel extraction and PCR product purification ..................................................... 53 2.12.2 Phenol-chloroform extraction of DNA ............................................................... 54
2.13 Agroinoculation ...................................................................................................... 54 2.14 Plant growing conditions ........................................................................................ 55 2.15 Southern blot analysis ............................................................................................ 55 2.16 Sequencing and sequence analysis .......................................................................... 57 2.17 Photography and graphics ...................................................................................... 58
CHAPTER 3: BEGOMOVIRUSES OF LEGUMES IN PAKISTAN ............................................ 59 3.1 Introduction ............................................................................................................. 59 3.2 Methodology ............................................................................................................ 61 3.3 Results ...................................................................................................................... 62
3.3.1 Mungbean yellow mosaic India virus .................................................................. 72 3.3.2 Mungbean yellow mosaic virus ......................................................................... 81 3.3.3 Rhynchosia yellow mosaic virus ......................................................................... 84 3.3.4 Pseudo-recombination in legume-infecting begomoviruses ............................... 87 3.3.5 Non-legume viruses and betasatellite ................................................................ 89
3.4 Discussion ................................................................................................................. 96 CHAPTER 4: ANALYSIS OF THE INFECTIVITY OF LEGUME YELLOW MOSAIC VIRUS CLONES ......................................................................................................................................... 102
4.1 Introduction ........................................................................................................... 102 4.2 Methodology .......................................................................................................... 103 4.3 Results ........................................................................................................... 108
4.3.1 Infectivity of Mungbean yellow mosaic India virus isolated from mungbean .... 108 4.3.2 Infectivity of Mungbean yellow mosaic India virus isolated from soybean ........ 108 4.3.3 Infectivity of Mungbean yellow mosaic virus ..................................................... 109 4.3.4 Infectivity of Rhynchosia yellow mosaic virus ................................................... 109 4.3.5 Infectivity of Pedilanthus leaf curl virus, Papaya leaf curl virus and Tobacco leaf curl betasatellite ...................................................................................................... 113
4.4 Discussion ............................................................................................................... 116 CHAPTER 5: INTERACTION OF LYMVs WITH OTHER BEGOMOVIRUSES AND BETASATELLITES ......................................................................................................................................... 120
5.1 Introduction ........................................................................................................... 120 5.2 Methodology .......................................................................................................... 122 5.3 Results .................................................................................................................... 123
5.3.1 Interaction of MYMIV with betasatellites ......................................................... 123 5.3.2 Interaction of TbLCB with RhYMV and MYMV .................................................. 129 5.3.3 Interaction of MYMIV with Pedilanthus leaf curl virus ...................................... 135 5.3.4 Pseudo-recombination among legume-infecting begomoviruses ..................... 138
5.4 Discussion ............................................................................................................... 140 CHAPTER 6: PLANT RESPONSES TO TRANSIENT EXPRESSION OF MYMIV GENES AND A STUDY OF RNAi-MEDIATED RESISTANCE ...................................................... 146
6.1 Introduction ........................................................................................................... 146 6.2 Methodology .......................................................................................................... 148 6.3 Results .................................................................................................................... 150
6.3.1 Transient expression of MYMIV genes from the PVX vector ............................. 150 6.3.2 Expression of TbLCB βC1 gene from the PVX vector ......................................... 156 6.3.3 Mutation of MYMIV AV2 and replacement of CP gene with the GFP gene ........ 157 6.3.4 Silencing of RdR6 in Nicotiana benthamiana .................................................... 158 6.3.5 Investigation of the use of RNAi to provide resistance against MYMIV in plants 158
6.4 Discussion ............................................................................................................... 160 CHAPTER 7: GENERAL DISCUSSION................................................................................... 171 CHAPTER 8: REFERENCES .................................................................................................. 178
xv
FIGURES
Figure 1.1 Cryo-electron microscopy image reconstruction of a Maize streak virus
particle.
Figure 1.2 Diagram showing the typical genome arrangement of mastreviruses.
Figure 1.3 Genome organization of curtoviruses.
Figure 1.4 Genome organization of topocuviruses.
Figure 1.5 Genomic organization of begomoviruses.
Figure 1.6 Steps in DNA replication of geminiviruses.
Figure 1.7 Map showing the world production of grain legumes.
Figure 1.8 Map showing the world production of soybean.
Figure 1.9 Major legume-exporting countries in the world.
Figure 1.10 Major legume-importing countries in the world.
Figure 2.1 Southern blot assembly for the capillary transfer of DNA from agarose
gels to nylon membranes.
Figure 3.1 Map of Pakistan showing areas where virus infected legumes were
collected.
Figure 3.2 Field-collected legumes infected with begomoviruses.
Figure 3.3 Alignment of the intergenic regions of the DNA-A and DNA-B
components of the MYMIV isolates characterised in the present study
and an isolate from the database.
Figure 3.4 Alignment of the N-terminal amino acid sequences of the Rep proteins
of MYMIV isolates obtained in this study.
Figure 3.5 Phylogenetic dendrogram based upon an alignment of the complete
nucleotide sequences of the DNA-A components of legume-infecting
begomoviruses from the Old World and distribution of all MYMIV
isolates is shown on a geographical map of the southern Asia.
Figure 3.6 Phylogenetic dendrogram based upon an alignment of the complete
nucleotide sequences of the DNA-B components of legume-infecting
begomoviruses from the Old World and distribution of all MYMIV
isolates is shown on a geographical map of the southern Asia.
Figure 3.7 Distribution of MYMIV with DNA-A and DNA-B belong to group to
group I, group II and MYMIV with DN-A belongs to group I and
DNA-B belongs to group II in Indian sub-continent.
Figure 3.8 Alignment of the intergenic regions of DNA-A and DNA-B
components of MYMV characterized in this study and those of
obtained from the NCBI database.
Figure 3.9 N-terminal amino acid sequence of the Rep protein of MYMV isolated
from Rhynchosia capitata is aligned with that of selected MYMV from
data bank for comparison.
Figure 3.10 An alignment of the sequences of the common regions of the DNA-A
and DNA-B component sequences that are representative of the
LYMV species DoYMV, HgYMV, KuMV, MYMIV and MYMV in
comparison to RhYMV.
Figure 3.11 Comparison of N-terminal amino acid sequence of the Rep proteins of
RhYMV isolate obtained in this study with that of MYMIV, MYMV,
KuMV, HgYMV and DoYMV.
xvi
Figure 3.12 Comparison of the phylogenetic trees of the DNA-A and DNA-B of
LYMVs.
Figure 3.13 Alignment of the intergenic regions in genome of Pedilanthus leaf curl
virus and Papaya leaf curl virus characterized in this study and isolates
from the database.
Figure 3.14 Alignment of the N-terminal amino acid sequences of the Rep proteins
of PedLCV and PaLCuV isolates obtained in this study.
Figure 3.15 Phylogenetic dendrogram based upon alignments of complete
nucleotide sequences of Pedilanthus leaf curl virus and Papaya leaf
curl virus from Pakistan and selected monopartite viruses from NCBI
database.
Figure 3.16 Phylogenetic dendrograms based upon alignments of complete
nucleotide sequences of TbLCB from soybean and selected
betasatellites from NCBI database.
Figure 4.1 Structures of the partial direct repeat constructs in pBin19 produced for
the Agrobacterium-mediated inoculation of MYMIV-[PK:Isl:Mg:07]
DNA-A (clone MI15) and DNA-B (clone MI21).
Figure 4.2 Structures of the partial direct repeat constructs for the agroinoculation
of MYMIV-[PK:Nsh:Sb:07] DNA-A (clone MI18) and DNA-B (clone
MI17).
Figure 4.3 Structures of clones produced in the binary vector pBin19 for
agroinoculation of RhYMV-[PK:Lah:Rh:07] DNA-A (clone MI32)
and DNA-B (clone MI34).
Figure 4.4 Structures of the partial direct repeat constructs of the DNA-A and
DNA-B components of MYMV-[PK:Kun:Rh:06] which were
produced in the binary vector pBin19 for agroinoculation.
Figure 4.5 Structures of the partial direct repeat constructs of PedLCV-
[PK:Nsh:Sb:07] (clone MI1), PaLCuV-[PK:Kun:Rh:06] (clone MI69)
and TbLCB-[PK:Nsh:Sb:07] (clone MI22) in binary vector pBin19 for
Agrobacterium-mediated inoculation.
Figure 4.6 Symptoms exhibited by plants infected with Mungbean yellow mosaic
India virus isolated from mungbean (MYMIV-[PK:Isl:Mg:07]).
Figure 4.7 Symptoms exhibited by plants infected with Mungbean yellow mosaic
India virus isolated from soybean (MYMIV-[PK:Nsh:Sb:07]),
Mungbean yellow mosaic virus isolated from Rhynchosia capitata
(MYMV-[PK:Kun:Rh:06]) and Rhynchosia yellow mosaic virus
isolated form Rhynchosia minima (RhYMV-[PK:Lah:Rh:07]).
Figure 4.8 Symptoms exhibited by plants infected Pedilanthus leaf curl virus and
Tobacco leaf curl betasatellite.
Figure 5.1 Symptoms induced following the inoculation of Nicotiana
benthamiana with Mungbean yellow mosaic India virus (MYMIV) and
Tobacco leaf curl betasatellite (TbLCB) and its derivatives.
Figure 5.2 Southern hybridization of blots probed with MYMIV DNA-A, DNA-B
and TbLCB.
Figure 5.3 Southern hybridization of a blot probed with MYMIV DNA-B.
Figure 5.4 Phenotypic behaviour of N. benthamiana plants inoculated with (a)
MYMIV DNA-A, TbLCB and DNA-BΔNSP
(b) DNA-A, TbLCB and
DNA-BΔMP
(c) RhYMV DNA-A and TbLCB (d) RhYMV DNA-A,
DNA-B and TbLCB (e) MYMV DNA-A and TbLCB and (f) MYMV
DNA-A, DNA-B and TbLCB.
xvii
Figure 5.5 Southern hybridization of blots probed with RhYMV DNA-A MYMV
DNA-A and TbLCB.
Figure 5.6 Symptoms induced following agroinoculation of N. benthamiana
plants with (a) MYMIV and PedLCV, (b) MYMIV, PedLCV and
TbLCB, (c) MYMIV and CLCuMV and (d) PedLCV and TbLCB.
Figure 5.7 Southern blot analyses with probes of PedLCV, MYMIV DNA-A,
DNA-B and CLCuMV to show their presence in infected plants.
Figure 6.1 Photographs of healthy plants of N. benthamiana, N. tabacum and
plants of each species infected with PVX.
Figure 6.2 Photographs of N. benthamiana plants infected with PVX expressing
MYMIV AV2, PVX expressing the MYMIV coat protein and PVX
expressing the MYMIV AC5.
Figure 6.3 Symptoms induced by PVX expressing the TrAP of MYMIV in N.
benthamiana and in N. tabacum or the Rep of MYMIV in N.
benthamiana.
Figure 6.4 Symptoms induced by expression of AC4 and MP of MYMIV and βC1
of TbLCB from the PVX vector in N. benthamiana.
Figure 6.5 Southern blot probed for the presence of MYMIV DNA-A.
xviii
TABLES
Table 2.1 Names, sequences and brief description of primers used in this study.
Table 3.1 List of the begomovirus clones obtained in this study and a summary
of their features.
Table 3.2 Percent nucleotide sequence identity for pair wise sequence
comparisons of the sequences of the genomes (or DNA-A components)
of viruses isolated in this study and selected sequences from the
databases.
Table 3.3 Percent nucleotide sequence identity for pair wise sequence
comparisons of the sequences of DNA-B component of viruses
isolated in this study and selected sequences from the databases.
Table 4.1 Infectivity of the cloned viruses and betasatellite obtained in this study.
Table 5.1 Study of interaction of legume-infecting begomoviruses with
betasatellites.
Table 5.2 Results of the co-inoculation of the components of MYMIV with
PedLCV and CLCuMV.
Table 5.3 Study of infectivity of MYMIV, MYMV and RhYMV to legumes by
exchanging their components.
Table 6.1 Summary of the results of the expression of MYMIV genes from the
PVX vector in N. benthamiana.
Table 6.2 Study of mutation of CP and AV2 and their effect on infectivity of
MYMIV to plants.
1
Chapter 1
Introduction and review of literature
1.1 Plant viruses
Like all other viruses plant viruses are obligate intracellular parasites and they
are dependent on the molecular machinery of their host for their replication. The first
virus to be discovered was Tobacco mosaic virus (TMV). The discovery of TMV is
often attributed to Martinus Beijerinck who determined, in 1898, that plant sap
obtained from tobacco leaves with "mosaic disease" remained infectious when passed
through a porcelain filter. This was in contrast to bacteria, which were retained by the
filter. Beijerinck referred the infectious filtrate as a "contagium vivum fluidum",
which coined the modern term "virus". The purification (crystallization) of TMV was
first carried out by Wendell Stanley, who published his findings in 1935, although he
did not determine that RNA was the encapsidated nucleic acid. However, he received
the Nobel Prize in Chemistry in 1946.
In 1978 Luria gave a very reasonable definition of viruses as “entities whose
genomes are elements of nucleic acid that replicate in living cells using cellular
synthetic machinery and causing the synthesis of specialized elements that can
transfer the viral genome to other cells” (Luria et al., 1978). The International
Committee on Taxonomy of Viruses (ICTV) in its 8th report of classification and
nomenclature of viruses (edited by C. M. Fauquet, M. A. Mayo, J. Maniloff, U.
Desselberger and L. A. Ball., 2005) has approved 3 orders, 73 families, 9 subfamilies,
287 genera and ~1950 species of viruses. Of these, the plant viruses encompass 20
families, 88 genera and ~750 species. The genomes of some plant viruses are single-
stranded (ss) DNA or double-stranded (ds) DNA, whereas others have dsRNA
genomes. However, over 90% of plant viruses have ssRNA genomes. Caulimoviruses
(family Caulimoviridae) are dsDNA viruses whereas nanoviruses (Nanoviridae) and
geminiviruses (Geminiviridae) are ssDNA viruses.
1.2 Geminiviruses
The first description of a geminivirus disease may well have been documented
as early as 752 AD in the Man‟yoshu, a classical anthology of Japanese poetry. A
poem attributed to the Empress Koken which described the autumnal appearance of
2
Eupatorium plants in the summer, an observation that has been linked with yellow
vein disease of this perennial shrub (Inouye and Osaki, 1980). The disease of
Eupatorium has recently been shown to be caused by a geminivirus/betasatellite
disease complex (Saunders et al., 2003). Although diseases caused by geminiviruses
represent serious constraints to agriculture, little was known about the causal agents
of the diseases until the isolation of virus particles with a unique twinned, quasi-
isometric morphology associated with maize streak and beet curly top diseases (Bock
et al., 1974; Mumford, 1974). This characteristic provided the name “geminivirus”,
from Gemini, the sign of the zodiac symbolized by twins (Harrison et al., 1977), and
it has remained the unifying feature of this family of viruses (Fig.1.1).
Fig.1.1 Cryo-electron microscopy image reconstruction of a Maize streak virus particle. Image
reproduced from Zhang et al. (2001).
Recent structural analysis has demonstrated that the 22 x 38 nm particles
associated with Maize streak virus (MSV) consist of two incomplete T = 1 icosahedra
(Zhang et al., 2001), and a similar structure was subsequently observed for African
3
cassava mosaic virus (ACMV) (Böttcher et al., 2004). In groundbreaking research,
Harrison et al. (1977) and Goodman (1977a) demonstrated that the geminate particles
associated with cassava latent virus (now known as ACMV), MSV and Bean golden
mosaic virus (now known as Bean golden yellow mosaic virus [BGYMV]) contained
circular ssDNA, and that this genomic DNA was infectious when re-introduced to
plants by mechanical inoculation (Goodman, 1977b), setting geminiviruses apart from
all other plant viruses that had been characterized at that time. Evidence was provided
for BGYMV and Tomato golden mosaic virus (TGMV) to suggest that at least some
geminiviruses had divided genomes (Haber et al., 1981; Bisaro et al., 1982; Hamilton
et al., 1982). Shortly afterwards, the nucleotide sequence of ACMV was established,
and infectious clones were used to demonstrate a bipartite genomic structure (Stanley,
1983; Stanley and Gay, 1983). Later on the monopartite geminiviruses, MSV, Beet
curly top virus (BCTV) and Tomato pseudo-curly top virus (TPCTV) were similarly
characterized (Howell, 1984; Mullineaux et al., 1984; Grimsley et al., 1987; Stanley
et al., 1986a; Briddon et al., 1996), which resulted in the present-day recognition of
four genera (Mastrevirus, Begomovirus, Curtovirus and Topocuvirus) on the basis of
genome organization, insect vector and host range, in the family Geminiviridae by the
ICTV (Stanley et al., 2005).
Geminiviruses infect a wide variety of crop plants causing great economic
losses, and are the subject of immense concern worldwide. These viruses encode only
a few proteins for their replication and recruit most of their replication machinery
from their plant hosts (Hanley-Bowdoin et al., 1999). The geminivirus group was
established in 1979 (Matthews, 1979) and upgraded to the family Geminiviridae in
1995 (Murphy et al., 1995). Geminiviruses are widely distributed plant viruses
infecting everything from monocots, such as wheat and maize, to dicots, such as
cassava and tomato (Hanley-Bowdoin et al., 1999). There are now 199 officially
recognized geminivirus species of which 181 belong to the genus Begomovirus and
there are over 672 complete nucleotide sequences deposited in databases (Fauquet et
al., 2008), reflecting their economic importance and enormous diversity resulting
from their widespread geographic distribution and host adaptation.
Geminiviruses have been used for studying basic processes in plants and for
producing useful products. Virus induced gene silencing (VIGS) is based on a
silencing mechanism that regulates gene expression by the specific degradation of
RNA. Through this mechanism TGMV (Peele et al., 2001; Kjemtrup et al., 1998 ),
4
Cabbage leaf curl virus (CabLCuV) (Muangsan et al., 2004; Turnage et al., 2002),
ACMV (Fofana et al., 2004) and Tomato yellow leaf curl China betasatellite
(TYLCCNB) (Tao and Zhou 2004) have been used as silencing vectors. By over
expressing or downregulating the genes through geminivirus based vectors basic plant
processes can be studied. Geminivirus based vectors have been used for high level
expression of foreign proteins in plant cells. A high-level expression system has been
developed that utilizes elements of the replication machinery of Bean yellow dwarf
virus (BeYDV). The replication-associated protein (Rep) mediates release and
replication of a replicon from a DNA construct (LSL vector) that contains an
expression cassette for a gene of interest flanked by cis-acting elements of the virus.
By codelivery of a Rep-supplying vector and a GUS reporter-LSL vector, up to 40-
fold increase in expression levels was obtained when compared to delivery of the
reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated
with enhanced expression of GUS (Mor et al., 2003). Similarly an expression system
based on BeYDV has been established which replicates and expresses foreign
proteins at high levels in tobacco, Arabidopsis, and other dicotyledonous plants. This
expression system is more universal than plant RNA virus-based expression systems,
which have restricted host ranges. The DNA-based nature of the BeYDV genome
renders it stable for the incorporation of large open reading frames. Using this
expression system, the rapid accumulation of a novel Arabidopsis-derived mitogen-
activated protein kinase to levels sufficient for standard biochemical analysis was
demonstrated (Hefferon et al., 2004).
1.3 Classification of geminiviruses
Geminiviruses are classified into four genera on the basis of host range,
genome organization and type of insect vector.
1.3.1 Mastrevirus
The genus Mastrevirus includes leafhopper-transmitted viruses with
monopartite genomes that infect either monocot or dicot plants (Boulton, 2002). MSV
and Wheat dwarf virus (WDV) are two well-studied monocot-infecting members in
this genus. BeYDV and Tobacco yellow dwarf virus (TbYDV) are dicot-infecting
mastreviruses. The genomes of mastreviruses are typically 2.6-2.8 kb from which four
5
conserved proteins are translated (Wright et al., 1997). The proteins associated with
viral replication, Rep and Rep A, are required early in the infection cycle, and are
produced from the complementary-sense transcripts. Rep A is encoded by open
reading frame (ORF) Rep A whereas Rep is encoded by ORFs Rep A and Rep B after
splicing of an intron (Fig. 1.2). Proteins associated with the later functions of
encapsidation and viral transport within, and between host cell (the coat protein [CP],
and movement protein [MP]) are translated from the virion-sense transcripts. A
characteristic feature of mastrevirus genomes is that virion- and complementary-sense
ORFs are separated by a large intergenic region (LIR) and a small intergenic region
(SIR), which are non-coding and contain regulatory elements (Fig. 1.2).
Fig. 1.2 Diagram showing the typical genome arrangement of mastreviruses. The position and
orientation of genes is indicated by arrows. The genes in the virion-sense encode the coat protein (CP)
and the movement protein (MP). The complementary-sense encodes the replication-associated protein
(Rep) which is translated from a spliced mRNA product of the Rep A and Rep B ORFs. The position of
the intron removed by splicing is indicated. The Rep A protein is translated from an unspliced
messenger RNA. Also indicated are two non-coding intergenic regions, the large intergenic region
(LIR), which contains a predicted hairpin structure with the nonanucleotide sequence (TAATATTAC)
forming part of the loop, and small intergenic region (SIR).
6
1.3.2 Curtovirus
Viruses of the genus Curtovirus are leafhopper-transmitted with monopartite
genomes that infect dicots. The genome of curtoviruses consists of one circular
ssDNA molecule of ~3.0 kb (Hur et al., 2007). In the genus Curtovirus, BCTV is the
well-studied example. Seven ORFs are transcribed in a bidirectional fashion from an
approximately 450 nt. intergenic region (IR) that contains the origin of viral DNA
replication (Baliji et al., 2004; Briddon et al., 1998; Klute et al., 1996; Stanley et al.,
1986a; Stenger, 1994a) (Fig. 1.3). The three virion-sense ORFs, V1, V2 and V3, are
highly conserved and encode the CP, a ss/dsDNA regulator and a MP, respectively.
The four complementary sense ORFs, C1, C2, C3 and C4, are more divergent and
encode the Rep, a product involved in a recovery phenotype, an enhancer of
replication and a product involved in symptom development, respectively (Briddon et
al., 1989; Hormuzdi and Bisaro, 1993; Latham et al., 1997; Stanley et al., 1992;
Stenger and Ostrow, 1996). The IR is also divergent among curtovirus species and
contains species-specific cis-acting sequences involved in replication and control of
gene expression.
Fig.1.3 The genomes of curtoviruses encode the coat protein (CP), a ss/dsDNA regulator (V2) and a
putative movement protein (V3) in the virion-sense and the replication-associated protein (Rep), a
product involved in a recovery phenotype (C2), an enhancer of replication (REn) and a product
involved in symptom development (C4) in the complementary-sense. The intergenic region contains a
putative hairpin structure with the nonanucleotide sequence (TAATATTAC) forming part of the loop.
7
1.3.3 Topocuvirus
The most recently established genus of the Geminiviridae, Topocuvirus,
contains a single dicot-infecting virus; Tomato pseudo-curly top virus (TPCTV)
isolated from Florida (Briddon et al., 1996). This virus is transmitted by the
treehopper (Micrutalis malleiffera) and has a monopartite genome. It encodes two
ORFs (CP and V2) in the virion-sense and four ORFs (Rep, C2 to C4) in the
complementary-sense (Fig. 1.4).The functions of these genes have not been
investigated. However, their similarity to the genes of the other dicot-infecting viruses
suggests that they encode similar functions. Analysis of TPCTV genome reveals
features typical of both mastreviruses and begomoviruses, consistent with it being a
natural recombinant (Briddon et al., 1996). In line with this hypothesis, TPCTV can
trans-complement the movement of the DNA-A component of two bipartite
begomoviruses (ACMV and TGMV), in the absence of their cognate DNA-B
components (Briddon and Markham, 2001b).
Fig. 1.4 The genome of Tomato pseudo-curly top virus encodes two ORFs (CP, V2) on virion-sense
strand, four ORF (Rep, C2, C3 and C4) on complementary-sense strand and contains a putative hairpin
structure in the intergenic region with the nonanucleotide sequence (TAATATTAC) forming part of
the loop.
8
1.3.4 Begomovirus
The largest genus of the family Geminiviridae, Begomovirus, derives its name
from Bean golden mosaic virus (van Regenmortel et al., 1997) which is now called
Bean golden yellow mosaic virus (BGYMV). These are dicotyledon-infecting,
whitefly-transmitted viruses. On the basis of genome organization begomoviruses are
divided into two main groups: bipartite and monopartite. Bipartite begomoviruses
contain two genomic components known as DNA-A and DNA-B and monopartite
begomoviruses genome consists of a single component homologous to the DNA-A
components of bipartite begomoviruses. Each component is 2.6–2.8 kb in length and
transcribed bidirectionally (Fig. 1.5). The DNA-A component of bipartite
begomoviruses and the genomes of monopartite begomoviruses encode four genes,
termed AC1 to AC4 (C1 to C4 in monopartite viruses), on the complementary-sense
strand. AC1 to AC3 encode the Rep, the transcriptional activator protein (TrAP), and
the replication enhancer protein (REn), respectively. AC4 is involved in host range
determination, symptom severity, and virus movement (Jupin et al., 1994; Laufs et
al., 1995c; Wartig et al., 1997). There are two genes termed AV1 and AV2 (V1 and
V2 in monopartite viruses) encoded on the virion-sense strand but the begomoviruses
from the New World lack the AV2. AV1 encodes the CP and AV2 may be involved
in movement. There is one gene (BV1) encoded on the virion-sense strand and one
gene (BC1) encoded on the complementary-sense strand of the DNA-B components.
BV1 encodes the nuclear shuttle protein (NSP) and BC1 encodes the MP, which act
cooperatively to move the virus cell-to-cell within plants. The DNA-A and DNA-B
components share little sequence similarity, except for ~170 nt. of sequence in the
intergenic region (IR), termed the common region (CR) (reviewed by Hanley-
Bowdoin et al., 1999). Although the CR sequence is usually almost identical in both
components, there are examples where the CRs differ substantially between DNA-A
and DNA-B. For example, the DNA-A and DNA-B CRs of Tomato leaf curl Gujarat
virus (ToLCGV) and Cotton leaf crumple virus (CLCrV) differ by 40% and 37%,
respectively (Chakraborty et al., 2003; Idris and Brown, 2004). Despite these
differences, sequences critical for replication are identical between components of
each individual virus.
Phylogenetic studies have shown that begomoviruses can be broadly divided
into two groups, the Old World viruses (those originating from Europe, Africa, Asia
and Australasia) and the New World viruses (those originating from the Americas)
9
(Padidam et al., 1999; Paximadis et al., 1999; Rybicki, 1994). Begomovirus genomes
have a number of characteristics that can distinguish Old World and New World
viruses. All New World begomoviruses are bipartite, whereas in the Old World most
of the viruses are monopartite and the majority of these associated with recently
identified satellite molecules (as described later) and very few are bipartite. In
addition, all Old World begomoviruses, with the exception of two viruses which will
be described shortly, have an extra ORF (AV2) in the DNA-A component that is not
present in New World begomoviruses (Rybicki, 1994; Stanley et al., 2005). New
World begomoviruses also have an N-terminal PWRLMAGT motif (a conserved
sequence of amino acids) in the CP encoded by AV1, which is absent from Old World
begomoviruses (Harrison et al., 2002). In most Old World begomoviruses, there are
two iterons (repeated elements in the CR specifically recognized by the Rep)
upstream of the AC1 TATA box, with a complementary iteron downstream. This
downstream iteron is not found in most New World begomoviruses (Arguello-Astorga
et al., 1994).
Rybicki (1994) proposed that most New World beomoviruses arose more
recently than Old World viruses and suggested that they may have evolved after the
continental separation of the Americas from Gondwana, approximately 130 million
years ago. The lack of diversity of New World begomoviruses, in comparison to those
originating from the Old World, supports this suggestion. He hypothesized that
whiteflies moving from Asia to the Americas may have transmitted viruses that were
the ancestors of New World viruses that we observe today. These viruses evolved
separately from Old World viruses and this evolution would also have been
accompanied by the early loss of the AV2 gene, which would explain its absence
from all New World viruses characterized to date. However, some recent findings
have shown that New World-like begomoviruses are present in the Old World.
Corchorus yellow vein virus (CoYVV) and Corchorus golden mosaic virus (CoGMV)
were identified in Vietnam and have characteristics typical of the New World viruses,
including the absence of the AV2 gene and N-terminal PWRLMAGT motif in the
CP. It has been suggested that these may be last remnants of a distinct lineage of Old
World begomoviruses which were introduced into the New World and subsequently
diverged to yield all extant New World begomoviruses (Ha et al., 2006; 2008).
10
Fig. 1.5 Genomic organization of begomoviruses. Bipartite begomoviruses have genomes consisting of
two components known as DNA-A (encoding replication-associated protein [Rep], coat protein [CP],
replication enhancer protein [REn], transcriptional activator protein [TrAP] and proteins possibly
involved in virus movement [AV2], pathogenicity determinat and a suppressor of RNA silencing
[AC4], viral genome replication [AC5]) and DNA-B (encoding nuclear shuttle protein [NSP] and
movement protein [MP]). The genomes of monopartite begomoviruses consist of one component
homologous to the DNA-A of the bipartite viruses and the majority of these are associated with
alphasatellites and betasatellites. Alphasatellites are self replicating molecules encoding their own Rep.
Betasatellites are dependent on their helper viruses for their replication and encode a single protein,
βC1, which upregulate replication of helper virus and suppress host defense. Both satellites have an A-
rich region and in addition to this betasatellites have a region of sequence conserved between all
examples known as the satellite conserved region (SCR).
Satellites are defined as viruses or nucleic acids that depend on a helper virus
for their replication but lack extensive nucleotide sequence identity to the helper virus
and are dispensable for its proliferation (Mayo et al., 2005). It was ToLCV-sat, the
first begomovirus satellite to be discovered, was isolated from tomato plants infected
with the monopartite begomovirus Tomato leaf curl virus (ToLCV) (Dry et al., 1997).
The circular satellite is small (682 nucleotides), encodes no proteins and has little
sequence similarity to its helper virus with the exception of sequences within the apex
of two stem-loop structures, one containing the ubiquitous geminivirus TAATATTAC
motif and the other containing a putative ToLCV Rep binding motif (Behjatnia et al.,
1998). ToLCV-sat is not required for ToLCV infectivity and has no effect on the
11
symptoms induced by the helper virus but is dependent on the helper begomovirus for
its replication and encapsidation and hence has the hallmarks of a satellite DNA.
Ageratum yellow vein virus (AYVV), the monopartite begomovirus, was isolated
from infected Ageratum conyzoides, and the single genomic component was shown to
be infectious in Nicotiana benthamiana (Tan et al., 1995). However, re-introduction
of the cloned genome into Ageratum produced only an asymptomatic infection
(Saunders and Stanley, 1999; Saunders et al., 2000) suggesting that, in contrast to
ToLCV, another factor was required to provide pathogenicity in the natural host. A
novel ssDNA component of approximately half the size of the helper begomovirus
was isolated and shown to induce the yellow vein phenotype when re-introduced with
AYVV into Ageratum conyzoides (Saunders et al., 2000). The component was named
DNA-β and more recently betasatellite (Briddon et al., 2008) because, in many
respects, it functionally resembled the DNA-B component of bipartite begomoviruses.
Transmission of these two components and propagation of the disease in Ageratum
using the whitefly vector confirmed the aetiology of the disease. Soon afterwards, a
betasatellite homologue isolated from cotton was used to show that CLCuD was
caused by a similar monopartite begomovirus/betasatellite complex (Briddon et al.,
2001a). Since then, many more such complexes have been identified in a wide variety
of plant species growing throughout Africa and Asia (Mansoor et al., 2001; Amin et
al., 2002; Briddon et al., 2003; Jose and Usha, 2003; Saunders et al., 2003; Shih et
al., 2003; Zhou et al., 2003a; 2003b; Bull et al., 2004; Cui et al., 2004a; 2004b; Jiang
and Zhou, 2004, 2005; Rouhibakhsh and Malathi, 2005; Were et al., 2005a, 2005b;
Wu and Zhou, 2005; Xiong et al., 2005).
Begomoviruses associated with betasatellites have been shown to be numerous
but, apparently, are confined to the Old World. Betasatellites encode an essential
pathogenicity determinant that has a role in increasing helper DNA replication and
overcoming host plant defences (Cui et al., 2005b; Saeed et al., 2004; Saunders et al.,
2004). Comparison of the growing number of betasatellites components has indicated
that they have a highly conserved structure (Fig. 1.4) with a region rich in adenine (A-
rich), a single gene (known as βC1) and a highly conserved sequence of
approximately 100 nucleotides, referred to as the satellite-conserved region (SCR).
The SCR includes a putative stem-loop structure which contains the TAA/GTATTAC
motif which, by analogy to geminiviruses and nanoviruses, is likely the site where
Rep introduces a nick during the initiation of virion-sense DNA replication.
12
Besides betasatellites, the majority of monopartite begomovirus-betasatellite
complexes are also associated with a further circular, ssDNA molecule termed DNA 1
(now referred to as alphasatellites). This satellite-like molecule, in common with
betasatellites, requires the helper begomovirus for movement within plants.
Alphasatellites encode a single product with similarity to the Rep-encoding
components of nanoviruses (Mansoor et al., 1999; Saunders and Stanely, 1999;
Briddon et al., 2004). Alphasatellites and nanoviruses also share a hairpin structure
with the loop sequence TAGTATTAC that likely forms the origin of virion-strand
DNA replication. Alphasatellites are capable of autonomous replication in host cells
and appear to have no role in symptom induction (Briddon et al., 2004).
Begomoviruses are transmitted by the whitefly, Bemisia tabaci (Gennadius).
Whiteflies were first described in the genus Aleyrodes (Homoptera) in 1889
(Gennadius, 1889), and was first reported as a pest in 1919 in India (Husain and
Trehan, 1933). It has a very wide host range, consisting of 500 species in 74 plant
families (Greathead, 1986). The whitefly is a vector of viruses in the Geminiviridae,
Potyviridae and Comoviridae families and the genera Carlavirus and Closterovirus.
Whitefly-transmitted diseases have been reported mostly on herbaceous plants, more
rarely on shrubs and trees. The main food crops affected by whitefly transmitted
geminiviruses are tomato, pepper, tobacco, bean, cotton, squash, beet and cassava
(Monsalve-Fonnegra et al., 2001). They are present mainly in tropical countries, but
are also known to occur in sub-tropical and more temperate agricultural areas.
Begomovirus particles ingested through the whiteflies stylet enter the
oesophagus and the digestive tract, penetrate the gut membranes into the
haemolymph, reach the salivary glands and finally enter the salivary glands from
where they are egested with the saliva. Using TYLCV-specific antiserum,
immunogold label was found in the stylets and was associated mainly with lumen of
the food canal. Label was also detected in the proximal part of the descending
midgut associated with food in the lumen and with electron-dense material in
microvilli-rich gut wall epithelial cells (Czosnek et al., 2002). Another study
reported the immunolocalization of TYLCV to the filter chamber and the distal part
of the descending midgut (Brown and Czosnek, 2002). These results suggest that the
microvilli are the sites rich in begomovirus receptors and may serve as the primary
site allowing internalization of virus particles. Geminiviruses do not replicate in
their insect vectors (Boulton and Markham, 1986). The CP is the only begomoviral
13
gene product that interacts with whitefly factors during the circulative transmission
of the virus and the specificity of geminivirus transmission from insect to plant
resides with the CP as replacement of CP gene of ACMV with that of BCTV alters
insect specificity (Briddon et al., 1990). Mutagenesis of CP of a non transmissible
isolate of AbMV showed that the exchange of two amino acids, at positions 124 and
149, was sufficient to obtain a whitefly-transmissible AbMV mutant (Höhnle et al.,
2001). In a similar study with Beat mild curly top virus, most CP C-terminal alanine
scanning mutants were not leaf-hopper transmittable (Soto et al., 2005). Whiteflies
feed on phloem sap by inserting its stylet into plant tissue and locating the vascular
tissue (Pollard, 1955). Whitefly mediated transmission of Tomato yellow leaf curl
virus (TYLCV) to tomato plants and observation of disease symptoms have
indicated that the minimum acquisition access period (AAP) and inoculation access
period were 15 to 30 minutes. A single insect is able to infect a tomato plant with
TYLCV following a 24 h AAP. However, using PCR TYLCV DNA can be detected
in a single insect as early as 5-10 minute after the beginning of the AAP (Atzmon et
al., 1998; Ghanim et al., 2001; Navot et al., 1992). Similarly, the viral DNA can be
detected at the site of inoculation in tomato after a 5 minute inoculation access
period (IAP; Atzmon et al., 1998). A single insect is able to infect a tomato plant
with TYLCV following a 24 h AAP, although not all plants inoculated in this way
will become infected. The efficiency of transmission reaches 100% when 5 to 15
insects are used (Cohen and Nitzany, 1966; Mansour and Al-Musa, 1992; Mehta et
al., 1994). A similar number of insects are necessary to achieve 100% transmission
of the New World bipartite geminivirus, Squash leaf curl virus (SqLCV) (Cohen et
al., 1983). The efficiency of acquisition and transmission of TYLCV varies with the
gender and age of whitefly. Nearly all 1-2 week old adult females were able to cause
an infection in tomato plants following a 48 h IAP. In comparison, only about 20%
of males of the same age were able to produce infected plants. Inoculation capacity
decreased with the age of the insect; 60% of 3 week old females were able to cause
an infection in plants, whereas no infected plants were obtained following
inoculation by males of the same age. Only 20% of the 6 week old females were
able to infect tomato plants. Although the rate of TYLCV translocation is similar in
males and females, it is possible that different amounts of virus translocate in two
genders (Ghanim et al., 2001), and the putative begomovirus receptors in males and
14
females differs. In contrast, male and female whiteflies transmitted SqLCV with the
same efficiency (Polston et al., 1990). The reason for these differences is unclear.
1.4 Proteins encoded by geminiviruses
1.4.1 Replication-associated protein (Rep)
This protein, of about 41 kDa, is encoded by ORF C1 (also called AC1 or
AL1) in all whitefly-transmitted geminiviruses and, due to its similarities with rolling
circle DNA replication initiator proteins of some prokaryotic plasmids (Koonin and
Ilyina, 1992), has been called „„Rep‟‟ protein (Laufs et al., 1995c). Rep is known to
possess modular functions (Campos-Olivas et al., 2002; Orozco et al., 1997). The N-
terminal part of Rep contains DNA-binding, nicking-ligation and oligomerization
domains, while the C-terminal half contains ATP-binding and ATPase activity
domains (Raghavan et al., 2004; Orozco et al., 1996; Desbiez et al., 1995). It helps
viral genome in replication (Lazarowitz et al., 1992; Fontes et al., 1992; 1994), and
represses its own expression (Sunter et al., 1993; Eagle et al., 1994). During rolling
circle replication (RCR), Rep binds to repeat elements near the stem loop structure,
makes a site-specific nick at TAATATT↓AC of the loop region of the hairpin
structure of the plus strand to initiate replication and binds to the 5′ end of the nicked
DNA via tyrosine residue. The 3′-OH end of the DNA is probably then used as a
primer for synthesis of the viral DNA (Heyraud-Nitschke et al., 1995). Rep also acts
as a replicative helicase by forming a large oligomeric complex and the helicase
activity is dependent on the oligomeric conformation (~24 mer) (Choudhury et al.,
2006). Mastreviruses encode two replication-associated proteins, RepA and Rep,
which are translated from messenger RNA splicing variants. The Rep protein of
mastreviruses is the functional homologue of Rep of begomoviruses (Heyraud-
Nitschke et al., 1995).
The three dimensional solution NMR structure has been elucidated for the
catalytic domain of the Rep protein of the begomovirus TYLCV (Campos-Olivas et
al., 2002). Structural analysis points towards a conserved architecture of the above
domain in prokaryotic and eukaryotic Rep proteins and in number of functionally
diverse proteins. Rep is also known to induce host replication machinery presumably
to enable the virus to replicate in differentiated cells (Egelkrout et al., 2002; Kong et
al., 2000). The protein binds with retinoblastoma related proteins (pRBR) involved in
15
cell cycle that prevent cell entry into S phase by sequestering transcription factors
(Collin et al., 1996). The Rep protein of TGMV binds to pRBR through an 80-amino
acid region that contains two predicted α-helices designated 3 and 4 (Arguello-
Astorga et al., 2004). It activates host transcription in mature leaves by relieving
pRBR/E2F repression. The pRBR binding activity of Rep and the ability of TGMV
infection to overcome E2F-mediated repression of the proliferating cell nuclear
antigen (PCNA; the processivity factor for DNA polymerase δ [Castillo et al., 2003])
promoter support a model whereby geminivirus replication proteins modulate host
gene expression through the pRBR/E2F pathway. According to this model, in mature
plant cells, E2F binds to the PCNA promoter and recruits pRBR, which in turn
recruits chromatin remodelling activities, such as histone deacetylases and SWI/SNF
like enzyme, to create a repressor complex (Zhang and Dean, 2001). In this case host
gene expression is activated, leading to the production of the requisite host DNA
replication machinery. Geminivirus replication proteins also interact with the
replication factor C (RFC) complex, the clamp loader that transfers PCNA to the
replication fork (Castillo et al., 2003; Luque et al., 2002). These interactions are likely
to represent early steps in the assembly of a DNA replication complex on the
geminivirus origin. ACMV Rep protein induces re-replication in fission yeast. Upon
expression of Rep, cells exhibited morphological changes. They were elongated
threefold on average and possessed a single, but enlarged and less compact nucleus in
comparison to non-induced cells. Rep expressing cells exhibited DNA contents
beyond 2C indicating ongoing replication without intervening mitosis (Kittelmann et
al., 2009). TGMV Rep also binds histone H3, a mitotic kinesin, a novel protein kinase
(GRIK) (Kong and Hanley-Bowdoin, 2002), and Ubc9, a component of the
sumoylation pathway (Castillo et al., 2004).
1.4.2 Transcriptional Activator Protein (TrAP)
The transcriptional activator protein (TrAP) resembles a typical transcription
factor in several respects: it has a nuclear localization signal (NLS), a zinc finger-like
domain composed of cysteine and histidine residues, and an acidic activation domain
(Dong et al., 2003; Hartitz et al., 1999; Shivaprasad et al., 2005; Van Wezel et al.,
2003). The TrAP protein encoded by begomoviruses is a transcriptional activator, a
silencing suppressor, and a suppressor of a basal defense. TrAP is a nuclear protein
(Sanderfoot and Lazarowitz, 1995) that transactivates virion-sense gene expression
16
(Sunter and Bisaro, 1992; Sunter et al., 1994). TrAP-mediated stimulation of these
promoters is complex and involves both activation and derepression mechanisms
(Sunter and Bisaro, 2003; 1997; 1992). This function of TrAP is in the case of
bipartite begomoviruses and curtoviruses while in the case of mastreviruses this
function is provided by Rep A (Collin et al., 1996). Various experiments established
that activation is at the level of transcription (Sunter and Bisaro, 1992). For example,
in transgenic plants containing virion-sense promoter-reporter fusions, TrAP activated
the promoter in mesophyll cells and derepressed it in phloem tissue (Sunter and
Bisaro, 1997). Similarly, ACMV infection activated a transgene that was under the
control of the promoter inducible by TrAP (Hong et al., 1997). Noris et al., (1996)
studied the in vitro binding activity of TYLCV TrAP. The protein was found to bind
both ssDNA and dsDNA but preferably ssDNA. Binding activity of TrAP was
sequence independent and might be unrelated to its trans-activation activity.
In addition to its core role in viral transcription, TrAP also is a pathogenicity
factor that suppresses more than one host defense pathway. Constitutive expression of
TGMV TrAP and C2 of BCTV (the TrAP homolog that is, for BCTV, not involved in
upregulation of the virion-sense promoter) in transgenic N. benthamiana plants
developed a novel enhanced susceptibility phenotype characterized by a reduction in
mean latent period (time to first appearance of symptoms) and by a decrease in the
inoculum concentration required to elicit infection without a significant increase in
disease symptoms or virus replication (Sunter et al., 2001). Enhanced susceptibility
correlates with the ability of TrAP/C2 to interact with and inactivate SNF1 kinase, a
global regulator of metabolism that responds to the cellular energy charge (Hao et al.,
2003). However, the exact nature of the defences mediated by SNF1, which appears
to influence the property of viral infectivity rather than virulence, remains
uncharacterized.
Begomovirus TrAP proteins and BCTV C2 protein also are suppressors of
RNA silencing, an antiviral defense first observed in plants (Baulcombe, 2004; Ding
et al., 2004; Roth et al., 2004; Voinnet, 2005). TrAP can reverse previously
established silencing when expressed from an RNA virus vector such as Potato virus
X (PVX) and also can inhibit silencing when expressed from plasmids delivered by
particle bombardment or by agroinfiltration of leaves (Trinks et al., 2005; Vanitharani
et al., 2004; Voinnet et al., 1999; Wang et al., 2005). TrAP of East African cassava
mosaic Cameroon virus (EACMCV), Tomato yellow leaf curl China virus
17
(TYLCCNV) and Indian cassava mosaic virus (ICMV) are suppressors of post-
transcriptional gene silencing (PTGS) (Vanitharani et al., 2004; van Vezel et al.,
2002a). The available evidence suggests that TrAP suppresses silencing of a gene by
both transcription-dependent and transcription-independent mechanisms (Bisaro,
2006). The transcription-dependent mechanism is supposed to involve the activation
of host genes (e.g., WEL-1) that may act as endogenous, negative regulators of RNA
silencing (Trinks et al., 2005). Not surprisingly, this mechanism requires an intact
NLS and activation domain, as well as the zinc- and DNA binding activities (Dong et
al., 2003; Trinks et al., 2005; Van Wezel et al., 2003). The second mechanism does
not require the activation domain and correlates with the ability of TrAP to interact
with and inactivate adenosine kinase (ADK), an enzyme primarily localized in the
cytoplasm (Wang et al., 2005; 2003). Because ADK is required for efficient
production of the methyltransferase cofactor S-adenosylmethionine, ADK deficiency
reduces cellular transmethylation activity ((Buchmann et al., 2009; Moffatt et al.,
2002). Methylation of DNA sequences complementary to target RNA or target gene
promoters is associated with PTGS and transcriptional gene silencing, respectively.
Thus, it is possible that TrAP acts in a transcription-independent manner to interfere
with RNA-directed methylation of the viral genome. Methylation has been shown to
markedly reduce the replication of geminivirus DNA in transfected protoplasts and to
inhibit the activity of geminivirus promoters when they are used in transgenes
(Brough et al., 1992; Seemanpillai et al., 2003).
TrAP interacts with itself and the zinc finger-like motif (CCHC) is required
but is not sufficient for TrAP self-interaction. Using bimolecular fluorescence
complementation, it was shown that TrAP:TrAP complexes accumulate primarily in
the nucleus, whereas TrAP:ADK complexes accumulate mainly in the cytoplasm.
Thus, TrAP self-interaction correlates with nuclear localization and efficient
activation of transcription, whereas TrAP monomers can suppress local silencing by
interacting with ADK in the cytoplasm (Yang et al., 2007). Following expression in
insect cells from a baculovirus vector, phosphorylated TrAP accumulates
predominately in the nucleus, while nonphosphorylated forms are found in both the
nucleus and the cytoplasm, suggesting that subcellular localization is influenced by as
yet unidentified cellular kinases (Wang et al., 2003).
TrAP is also reported to counter hypersensitive cell death. The NSP of
Tomato leaf curl New Delhi virus (ToLCNDV) is an avirulence determinant and
18
induces a hypersensitive response (HR) in N. tabacum and Lycopersicum esculentum
plants when expressed under the control of the Cauliflower mosaic virus 35S
promoter. Co-inoculation of all ToLCNDV-encoded genes pinpointed the TrAP as the
factor mediating the inhibition of cell death and deletion mutagenesis showed the
central region of TrAP, containing a zinc finger domain and NLS, to be important in
this inhibition (Hussain et al., 2007).
1.4.3 Replication Enhancer Protein (REn)
The replication enhancer protein (REn) facilitates the accumulation of high
levels of viral DNA (Sunter et al., 1990), possibly by modifying the activity of Rep
and/or aiding in the recruitment of the host replication enzymes (Castillo et al., 2003;
Settlage et al., 1996). It has been observed that REn protein is located in nuclei of
infected plant cells at levels similar to the Rep (Nagar et al., 1995), suggesting that it
might act with Rep during initiation of viral DNA replication. Experimental
observation suggested that REn protein might increase the affinity of Rep for the
origin (Mohr et al., 1990) while in the case of mastreviruses, it is possible that their
unique Rep A protein might serve a similar function since mastreviruses do not
encode the REn protein (Laufs et al., 1995b; Orozco and Hanley-Bowdoin, 1996).
REn is a highly hydrophobic small protein of only 134 amino acids, which is very
well conserved among all begomoviruses and most curtoviruses (Castillo et al., 2003).
REn also homo-oligomerizes and interacts with at least two host-encoded proteins,
PCNA and the pRBR. Analysis of REn of TYLCV in yeast two-hybrid assays
indicated that mutations that inactivate REn replication enhancement activity also
reduce or inactivate REn oligomerization and interaction with Rep and PCNA. In
contrast, mutated REn proteins impaired for pRBR binding were fully functional in
replication assays. Hydrophobic residues in the middle of the REn protein were
implicated in REn interaction with itself, Rep and PCNA, while polar residues at both
the C and N termini of the protein were shown to be important for REn-pRBR
interaction. These experiments established the importance of REn-REn, REn-Rep, and
REn-PCNA interactions in geminivirus replication. While REn-pRBR interaction is
not required for viral replication in cycling cells, it may play a role during infection of
differentiated cells in intact plants (Settlage et al., 2005). A recent study shows that
both ToLCV and TGMV REn interact with a transcription factor in the NAC family
and this interaction is necessary for enhancement of replication (Selth et al., 2005).
19
1.4.4 (A)C4
(A)C4 is present in dicot-infecting geminiviruses, except those in the genus
Mastrevirus, and overlaps with Rep. Mutation analysis of C4 of BCTV has shown
that this protein is involved in symptom development. Stanley and Latham (1992)
introduced a stop codon at two different locations in the C4 gene without affecting the
amino acid sequence of Rep. When inoculated into N. benthamiana, the mutant
produced stunting and yellowing of leaves and downward leaf curling but not vein
swelling and upward curling which are characteristic symptoms produced by the wild
type virus. The level of viral DNA of mutant virus was similar to the wild type virus.
The mutant caused symptomless infection in Beta vulgaris, although the levels of
viral DNA often reached those of wild type and the mutant virus was able to move
systemically in plants. The results suggested that C4 is the major determinant of
pathogenesis of the virus. The expression of C4 protein in transgenic N. benthamiana
produced virus-like symptoms which further confirmed its role in symptom
development (Latham et al., 1997).
Mutation analysis of this ORF in monopartite begomoviruses has shown that
it is involved in symptom development (Rigden et al., 1994; Jupin et al., 1994). Agro-
inoculation of a mutant of ToLCV produced drastically reduced symptoms, although
the level of viral DNA was similar to the wild type virus and suggests that C4 is not
required by ToLCV to replicate or to spread through the host plant but is involved in
symptom development (Rigden et al., 1994). Like the MP of bipartite begomoviruses,
C4 of TYLCV was localized to the cell periphery (Rojas et al., 2001). Mutation
analysis of C4 in bipartite geminiviruses such as ACMV and TGMV resulted in wild
type symptoms and no role could be ascribed to product of this gene (Etessami et al.,
1989; Elmer et al., 1988). However AC4 of ACMV and Sri Lankan cassava mosaic
virus (SLCMV) were found to be suppressors of PTGS (Vanitharani et al., 2004).
1.4.5 Pre-Coat Protein ([A]V2)
This gene is unique to Old World begomoviruses but absent in begomoviruses
from the New World. However, two newly discovered begomoviruses, CoYVV (Ha
et al., 2006) and CoGMV (Ha et al., 2008) from the Old World lack this gene. The
unusual nature and hypotheses regarding their relationship to New World
begomoviruses was described earlier. Padidam et al. (1996) showed by mutation
analysis that the pre-coat protein ([A]V2) is involved in the movement of bipartite
20
geminiviruses. The TYLCV V2 localized around the nucleus and at the cell periphery
and co-localized with the endoplasmic reticulum. These patterns of localization were
similar to that of the MP of bipartite begomoviruses (Rojas et al., 2001). Mutation of
the V2 of MSV resulted either in low levels of replication, in which all the DNA
forms associated with wild type infection were produced, or in no infection, in which
case CP production may also have been affected (Boulton et al., 1989). Disruption of
the V2 gene of ToLCV lead to symptomless, systemic infection with a reduced titre of
all viral DNA forms (Rigden et al., 1993). Mutagenesis of EACMZV has
demonstrated that AV2 is not essential for symptomatic infection of cassava, however
symptoms were attenuated. Furthermore both AV1 and AV2 mutants were
compromised for CP production suggesting a close structural and/or functional
relationship (Bull et al., 2007).
1.4.6 Coat Protein
The coat protein (CP) of geminiviruses is a multifunctional protein required
for a range of functions associated with encapsidation, accumulation of viral ssDNA,
insect transmission and both intracellular and intercellular movement. The most
important function of CP is to form the shell in which genomic ssDNA is
encapsidated. A study based on MSV revealed that geminate particles are assembled
from 110 protein subunits, organized as 22 pentameric capsomers (Zhang et al.,
2001). For geminiviruses, CP is also involved in the systemic movement of the virus.
Mutation in this gene lead to a decreased level of viral DNA in the infected plants
while the level of viral DNA is not affected in protoplast, suggesting impairment of
movement function (Boulton et al., 1991). The localization of the product of this ORF
in secondary plasmodesmata with the onset of viral lesions is consistent with its role
in the movement of monopartite geminiviruses (Dickinson et al., 1996). The TYLCV
CP localized to the nucleus and nucleolus and acted as nuclear shuttle, facilitating
import and export of DNA (Rojas et al., 2001). The CP of MYMV is thought to be
involved in transport of the viral genome in the nucleus. In this study two nuclear
localization signals were identified within the N-terminal part of CP. In vitro pull
down assays revealed interaction of MYMV CP with the nuclear import factor
importin α suggesting that CP is imported into the nucleus via an importin α-
dependent pathway (Guerra-Peraza et al., 2005). Nuclear localization of geminivirus
CPs has been described in TYLCV (Kunik et al., 1998; Rojas et al., 2001), MSV (Liu
21
et al., 1999) and ACMV (Unseld et al., 2001). Interruption in the CP of ToLCV
disrupted spread of the virus (Rigden et al., 1993). CP of BCTV is essential for its
infectivity (Briddon et al., 1989). MSV requires CP to produce symptomatic systemic
infection and mutants containing insertions or deletions in CP gene were able to
replicate to low levels, producing dsDNA although virion ssDNA was not detected
and symptoms were not observed (Boulton et al., 1989). Insect vector specificity of
geminiviruses is associated with the CP. Replacement of CP of ACMV with that of
BCTV changed to insect vector from whitefly to leafhopper (Briddon et al., 1990).
1.4.7 Nuclear shuttle protein
Since geminiviruses replicate in the nucleus, they require movement from cell-
to cell and from cytoplasm into the nucleus. DNA-B of bipartite geminiviruses
encodes two proteins called nuclear shuttle protein (NSP) and movement protein
(MP). These gene products have been implicated in local and systemic spread,
symptom development, host-range determination and virus transmission (putting the
virus where the insect feeds) by whiteflies. The requirement of DNA-B products for
above functions varies for different viruses and specific host-virus combinations.
Mutation in either of these genes eliminated virus infectivity but did not affect virus
replication or encapsidation (Brough et al., 1988; Etessami et al., 1988). Pascal et al.,
(1994) provided direct evidence that NSP binds strongly to ssDNA with high affinity
and localizes to the cell nucleus. NSP is also shown to have sequence independent
affinity for dsDNA (Hehnle et al., 2004). NSP is a very basic protein and contains two
NLSs. A mutation in either of the potential NLSs severely impaired or eliminated
viral infectivity. The C-terminus of NSP is required for interaction with MP
(Sanderfoot et al., 1996). A number of host factors that interact with NSP have now
been identified, including an Arabidopsis acetyltransferase and a receptor-like protein
kinase from tomato and soybean (Mariano et al., 2004; McGarry et al., 2003). Based
on differential interaction with NSP and CP, it has been proposed that acetylation may
be involved in the segregation of ssDNA for movement and encapsidation,
respectively (McGarry et al., 2003). Phosphorylation of NSP by the kinase may
regulate the movement of viral DNA, or mask the protein from triggering a host
resistance response (Mariano et al., 2004). In this regard, NSP has been shown to act
as an avirulence factor in common bean (Garrido-Ramirez et al., 2000). The synthesis
of NSP is regulated at the transcriptional level by TrAP transactivation (Sunter and
22
Bisaro, 1991) and unlike other begomoviruses NSP of ToLCNDV is a pathogenicity
determinant (Hussain et al., 2005).
1.4.8 Movement protein
The movement protein (MP) of begomoviruses is involved in virus
movement from cell to cell. It binds cooperatively to DNA in a form- and size-
specific manner (Noueiry et al., 1994; Rojas et al., 1998). MP is a plasmodesmatal
movement protein and mediates the movement of dsDNA (Noueiry et al., 1994;
Sudarshana et al., 1998). There are two hypotheses about the role of MP in viral DNA
movement. According to “relay race model” NSP transfers dsDNA from nucleus to
the cytoplasm from which it is delivered to the MP for plasmodesmatal crossing.
According to a second model which may be called “couple-skating model” viral
ssDNA is shuttled between the nucleus and the cytoplasm in an NSP-containing
complex, which then interact with MP to move from cell to cell. The requirement of
both proteins for intercellular movement was demonstrated for BDMV, where
mutation of the NSP and MP proteins restricted the cell to cell movement of viral
DNA (Sudarshana et al., 1998). Electron microscopic studies have shown that MP
promotes redirection of NSP of ABMV to plasma membrane in fission yeast
(Frischmuth et al., 2007). A minimal domain of MP (amino acids 117-160) has been
identified that is necessary and sufficient to target a reporter to the cell periphery
(Zhang et al., 2002). Sequence analysis of this domain revealed a putative
amphiphilic helix which could serve as an anchor of the protein in one leaflet of the
membrane, whereas no transmembrane helices or signal peptides were recognizable
(Zhang et al., 2002). The MP protein of BDMV increases the size exclusion limit
(SEL) of plasmodesmata of cells into which it is injected, and the protein mediates
viral DNA transport from cell to cell (Noueiry et al., 1994; Rojas et al., 1998). The
combined properties of the geminivirus-encoded MP and plasmodesmata were shown
to impose a strict limitation on the size of the viral genome at the level of cell-to-cell
movement (Gilbertson et al., 2003).
The MP of begomoviruses has been reported to be involved in symptom
development. The importance of the movement protein as a key pathogenicity factor
was demonstrated by constitutively expressing MP of SqLCV in N. benthamiana
(Pascal et al., 1993 ) and MP of Tomato mottle virus (ToMoV) in N. tabacum (Duan
et al., 1997), in which they induced phenotypes reminiscent of the wild-type virus
23
disease symptoms. In a related study, Pascal et al. (1993) expressed both MP and NSP
of SqLCV in transgenic plants. Their results showed that the expression of MP alone
is sufficient to cause mosaic and leaf curl symptoms, typical of SqLCV infection.
These results suggest a role of MP in symptom development in bipartite
geminiviruses.
1.5 DNA replication of geminiviruses
Geminiviruses replicate in the nucleus of infected cells by a rolling circle
mechanism (Saunders et al., 1991; Stenger et al., 1991) from a dsDNA intermediate,
produced by complementary-sense DNA synthesis that is initiated from a short RNA
primer (Donson et al., 1984; Saunders et al., 1992). A multifunctional Rep is
indispensable for the precise initiation and termination of this process. RCR occurs in
two stages; first by conversion of the genomic ssDNA into a dsDNA intermediate and
then replication by the RCR mechanism analogous to that found in a class of
eubacterial plasmids and in some bacteriophages and prokaryotic ssDNA replicons
(Bisaro, 1996; Noris et al., 1996; Saunders et al., 1991; Stenger et al., 1991;
Timmermans et al., 1994). The iterons are Rep binding sites in the
intergenic/common region that participate in the initiation of replication as well as the
control of complementary-sense gene expression (reviewed by Hanley- Bowdoin et
al., 1999). It has been proposed that iteron binding occurs prior to the introduction of
a nick within the virion-sense strand of the loop sequence (Laufs et al., 1995a; Orozco
and Hanley-Bowdoin, 1996), covalent attachment of Rep to the exposed 5′-terminus
(Laufs et al., 1995b) and elongation of the 3′-terminus using the complementary-sense
template following the recruitment of host factors (Nagar et al., 1995; Kong et al.,
2000; Luque et al., 2002; Selth et al., 2005). The sequence-specific nature of the high-
affinity binding site explains why Rep and the origin of replication of distinct
begomoviruses are usually incompatible.
For mastreviruses, the primer for complementary-strand DNA synthesis is
encapsidated in virions. The primer DNA fragments of MSV (Donson et al., 1984)
and WDV (Hayes et al., 1988) are about 80 nucleotides containing 5′ terminal
ribonucleotides. An RNA primer preceding the synthesis of the complementary DNA
of ACMV has been identified in the DNA replication intermediates of ACMV
infected tobacco plants (Saunders et al., 1992). Synthesis of the putative RNA primer
24
initiates somewhere between nucleotide 2581 to 221 of ACMV, a region that includes
the intergenic region (Saunders et al., 1992).
At the onset of virion-sense DNA synthesis, a nick is introduced in the plus
strand within the nonanucleotide TAATATT/AC (slash indicates nicking site) at the
origin of replication which is identical among all geminiviruses. This function is
provided by the Rep proteins (Laufs et al., 1995a) that remains bound to the 5' end of
the cleaved strand. The 3' terminus of the nicked DNA serves as a primer for DNA
synthesis; displacing the original virion-sense DNA as the template (complementary)
strand is copied. DNA polymerases that synthesize the virion strand continuously
circles around the complementary DNA template. As a unit-length virion strand is
synthesized, it is cut and ligated to form a close circular single stranded virion DNA
(Fig. 1.6). Laufs et al. (1995c) reported that the Rep protein also has a joining activity
that acts as a terminase and resolves the nascent viral single strand into genome sized
units. This close-circular ssDNA can either serve as template for replication or can be
encapsidated into virions. The cleavage activity is initiated by tyrosine-103 and this
tyrosine is the physical link between the Rep protein and its DNA origin (Laufs et al.,
1995a). However the RCR model is unusual as geminiviruses transcribe
bidirectionally, thus risking collision between replication and transcription complexes
(Brewer, 1988). Jeske et al. (2001) confirmed by two-dimensional gel analysis and
electron microscopy that AbMV uses rolling circle replication. However, only a
minority of DNA intermediates detected were consistent with this model. The
majority were compatible with a recombination-dependent replication (RDR)
mechanism (Fig. 1.6) (Jeske et al., 2001). During development of naturally infected
leaves viral intermediates compatible with RCR and RDR appeared simultaneously
whereas agroinoculation of leaf discs with AbMV lead to an early appearance of RDR
forms but no RCR intermediates. Inactivation of viral genes TrAP and REn delayed
replication, but produced the same DNA types seen in wild-type infection, indicating
that these genes were not essential for RDR in leaf discs. Geminiviruses from
different genera and geographic origins were analysed by using BND (benzoylated
naphthoylated DEAE) cellulose chromatography in combination with improved high
resolution two dimensional gel electrophoresis, and it was concluded that multitasking
(utilisation of both RCR and RDR mechanisms) in replication is widespread amongst
geminiviruses (Preiss and Jeske, 2003).
25
Fig. 1.6 DNA replication of geminiviruses. During rolling circle replication Rep recognises the origin
of replication (ori) (a), nicks the virion strand and binds to the 5′ end (b). New DNA is synthesised
using the 3′ end of the nicked virion strand as a primer, the complementary-sense strand as a template
and the host DNA replication machinery displacing the original virions-strand (c). Rep recognises the
next ori repeat and releases a ssDNA copy by nicking and joining. Whereas during recombination-
dependent replication an incomplete ssDNA (a) interacts with a covalently closed circular DNA
(cccDNA) at homologous site for homologous recombination (b). The loop form in this way migrates
and ssDNA elongates (c). After the elongation of ssDNA and formation of complementary DNA a
dsDNA is produced (d).
26
1.6 Evolution of geminiviruses
ToLCV has been shown to replicate in Agrobacterium tumefaciens, a soil-
borne prokaryote that can transfer exogenous DNA into plants where it becomes
integrated into the genome (Rigden et al., 1996). This observation implies that similar
fundamental processes occur in prokaryotic and eukaryotic backgrounds, prompting
the suggestion that geminiviruses may have originated from prokaryotic episomal
replicons that undergo RCR. Intriguingly, AbMV DNA has been shown to be
associated with plastids as well as the nucleus (Gröning et al., 1987), an observation
that may reflect a past functional relationship with these putative prokaryotic-like
endosymbionts. Various ssDNA viruses, geminiviruses and nanoviruses in plants and
circoviruses in animals, replicate by RCR. All share sequence and structural features
with prokaryotic RC replicators and their Rep is evolutionarily related, leading to
speculation that these viruses evolved from prokaryotic ssDNA replicons (Koonin and
Ilyina, 1992; Gibbs and Weiller, 1999). Kapitonov and Jurka (2001) suggest that
Helitrons (a new class of transposable elements; Poulter et al., 2003) are the missing
evolutionary link between prokaryotic RC elements and geminiviruses.
The evolutionary relationships between the different genera of geminiviruses
are difficult to sort out due in large part to the fact that genetic recombination has
probably featured prominently in the evolution of these genera. It is clear, for
example, that Rep sequences of begomovirus, topocuvirus and curtovirus share a far
more recent common ancestor than their CP sequences. As the CP sequences of
topocuviruses and curtoviruses share a slightly higher degrees of sequence similarity
with mastreviruses than with begomoviruses this has been interpreted as indicating
that the Topocuvirus and Curtovirus genera may have arisen through separate
recombination events between ancestral begomovirus and mastrevirus lineages
(Briddon et al., 1996; Stanley et al., 1986b; Rybicki, 1994). It has been determined,
for instance, that since the divergence of the Old and New World begomoviruses there
have been at least five separate inter-genus recombination events between
curtoviruses and begomoviruses in which viruses in both genera have served as either
donors or recipients of Rep sequences (Lefeuvre et al., 2007a; 2007b). Even if the
curtoviruses, begomoviruses and topocuviruses do share a more recent Rep common
ancestor and the mastreviruses, curtoviruses and topocuviruses share a more recent
CP common ancestor, this does not necessarily imply that topocuviruses and
curtoviruses are the recombinant offsprings of mastreviruses and begomoviruses. It is,
27
for example, possible that the ancestral mastrevirus had obtained a divergent Rep
from a geminivirus lineage that remained unsampled. Similarly, transfer of a
divergent CP from such a geminivirus lineage to the ancestral begomovirus might
explain the apparent uniqueness of this gene in begomoviruses.
Until recently, it was thought that New World viruses arose more recently than
Old World viruses and they evolved after continental separation of the Americas from
Gondwana (Rybicki, 1994). More recent studies have provided the evidence of New
World begomoviruses in the Old World and vice versa, which is probably due to the
increased range of the B-biotype of the whitefly vector and/or the distribution of
infected propagating material. For example, strains of TYLCV have been identified in
the New World (Caribbean Islands and Florida; reviewed by Czosnek and Laterrot,
1997; Polston et al., 1999) and the New World virus AbMV has been identified in
Abutilon spp. in the UK (Brown et al., 2001) and New Zealand (Lyttle and Guy,
2004). But these were apparently recent introductions and there were no known
examples of indigenous viruses from the Old World with genome organization similar
to the New World viruses and vice versa. Recently two viruses CoYVV (Ha et al.,
2006) and CoGMV (Ha et al., 2008) were identified indigenous to Vietnam and they
resemble New World begomoviruses more closely than those of the Old World. This
was based on absence of an AV2 ORF, presence of an N-terminal PWRLMAGT
motif in the CP and phylogenetic analysis. The presence of CoYVV and CoGMV in
Vietnam indicates that New World-like viruses were probably present in the Old
World for some considerable time and that the common ancestor of New World
viruses originated in the Old World. Both the New World and Old World
begomoviruses had evolved prior to continental separation and CoYVV and CoGMV
may be remnants from the population of New World begomoviruses that previously
existed in the Old World. Another possibility is the begomoviruses may have evolved
in the Old World, and a progenitor of the current New World begomoviruses moved
to the New World by whiteflies or by Asian ancestors of American Indians or very
early Chinese traders (Ha et al., 2008).
Bipartite begomoviruses might have evolved from an ancestral monopartite
virus by component duplication and the acquisition of novel genetic material. Thus,
homology between the CP and NSP and their similar locations on DNA-A and DNA-
B, respectively, could indicate a common evolutionary origin (Kikuno et al., 1984).
The propensity of DNA-A to rescue components by donating its origin of replication
28
(Roberts and Stanley, 1994) might provide a mechanism (component capture) to
acquire additional genetic material. For example, on the basis of the sequence and
biological properties of the DNA-A component, it has been suggested that SLCMV
evolved from a monopartite begomovirus by capturing the DNA-B component of the
bipartite begomovirus, ICMV in this manner (Saunders et al., 2002; Chakraborty et
al., 2003). In the same way, Ageratum yellow vein virus (AYVV), CLCuMV and
TYLCCNV have been shown to donate their origin of replication to their cognate
betasatellites (Saunders et al., 2001; Briddon et al., 2001a; Tao and Zhou, 2008), to
produce a biologically active recombinant that can induce a phenotype in plants. The
propensity for recombination between such diverse entities provides enormous scope
for diversification and modification of biological properties to allow adaptation to
new ecological niches.
Begomoviruses acquired betasatellite components at some point during their
evolution, although the origin of betasatellites remains unknown. However, the
presence of an A-rich region could indicate that betasatellite adapted from a
preexisting component, as suggested for the nanovirus-like alphasatellites. This might
have occurred either by association of betasatellite with a monopartite begomovirus or
by displacement of DNA-B from an Old World bipartite begomovirus as
demonstrated experimentally for SLCMV (Saunders et al., 2002). Irrespective of the
mechanism, the emergence of betasatellites as part of disease complexes probably
occurred after the divergence of New and Old World begomoviruses because, to date,
satellites have only been found in association with monopartite begomoviruses that,
until recently, have been confined to the Old World. Phylogenetic analyses of
betasatellite components and their associated begomoviruses suggest that the satellites
and their helper viruses have co-evolved as a consequence of geographic isolation and
host adaptation (Zhou et al., 2003a). The presence of a betasatellite remnant
associated with ToLCV (Dry et al., 1997) suggests that this monopartite begomovirus
derives from a disease complex following adaptation to a more permissive host. The
possibility that other tomato-infecting monopartite begomoviruses such as TYLCV
have also been associated with a betasatellite component at some point during their
evolution cannot be excluded. The recent identification of a TYLCV isolate that is
associated with a betasatellite supports this argument (Khan et al., 2008).
Available evidence suggests that these disease complexes are rapidly
expanding in terms of their geographical distribution and host range. For example,
29
CLCuD was originally a major problem in central Pakistan but is now causing
extensive damage in India. In the same region, new diseases are emerging in crops
such as tomato, tobacco, chillies and papaya. The presence of such a diverse
population of begomoviruses in a single region, coupled with the propensity of these
viruses to exchange genetic material by recombination (Padidam et al., 1999; Roberts
and Stanley, 1994; Saunders et al., 2002), increases the probability of new virus
diseases emerging to cause epidemics in previously unaffected crops, a problem that
will be compounded by monoculture, the movement of infected material and the
widespread introduction of the whitefly vector. In view of the continual growth in
international trade and travel, it might be only a matter of time before whitefly-
transmissible disease complexes reach the New World as recently happened with
TYLCV with such serious consequences (Polston et al., 1999).
Although arthropod-infecting circular ssDNA viruses have not yet been
identified, the intimate association of geminiviruses with their insect vectors during
circulative transmission (Czosnek et al., 2001) might also have provided the
opportunity to acquire genetic material. Phylogenetic analysis provides compelling
evidence to suggest that vertebrate circoviruses may have originated from plant
nanoviruses (Gibbs and Weiller, 1999), possibly facilitated by arthropod vector
intermediaries. Hence, it is not inconceivable that genetic material can also be
transferred in the opposite direction, to plants from animals or sap-sucking
arthropods.
1.7 Legumes
The history of legumes (family Fabaceae, also known as the Leguminosae) is
tied in closely with that of human civilization, appearing early in Asia, the Americas
(common bean) and Europe (broad beans) by 6,000 BC, where they became a staple,
essential for supplementing protein where there was not enough meat. Carbonized
remains indicate that chickpeas, lentils and peas were domesticated in the Near East
arc and were cultivated with the cereals as early as the seventh millennium BC
(Smartt, 1990). Legume plants are well known for their ability to fix atmospheric
nitrogen, an accomplishment attributable to a symbiotic relationship with certain
bacteria known as Rhizobia found in root nodules of these plants (Dixon and Kahn,
2004). The ability to form this symbiotic association reduces fertilizer costs for
30
farmers and gardeners who grow legumes, and means that legumes can be used in a
crop rotation to replenish soil that has been depleted of nitrogen (Fox et al., 2007).
Legume seeds and foliage have comparatively higher protein content than
non-legume material, probably due to the additional nitrogen that legumes receive
through nitrogen-fixation symbiosis. This high protein content makes them desirable
crops in agriculture (Modernell et al., 2008). Forage legumes are grown so that the
whole crop can be used to nourish animals, either by grazing or by the production of
silage or hay, or sometimes for industrial purposes. The clovers (Trifolium spp.) and
medics (Medicago spp.) and especially lucerne (alfalfa), are examples of forage
legumes. Grain legumes are crop plants which are cultivated for their seeds, harvested
at maturity and are rich in protein and energy. In the trade and industry sectors the
mature dry seeds of grain legumes are usually called pulses and they are used either
for human consumption or for animal feed. The term pulses excludes the „leguminous
oilseeds‟ such as soybeans that are used primarily for their high oil content.
Three-quarters of the world production of grain legumes (185 million tonnes)
is soybeans, grown primarily in the USA, Brazil, Argentina, Paraguay and Uruguay
(Fig. 1.8), for their fat content (20%) and the high-protein by-product soybean meal
destined for the animal feed industry. The world production of soybeans has increased
by 215% over the last 30 years compared with just 50% for other grain legumes. The
world production of grain legumes other than soybeans amounts to 57 million tones,
growing primarily in southern Asia and China (Fig. 1.7). Data from countries
involved in export and import of legumes is shown in Fig. 1.9 and 1.10.
31
Fig. 1.7 The world production of grain legumes shown by vertical bars. Colours in each bar represent
different legumes indicated in the key given on the left. The data is the average of five years (2000 to
2004) research provided by UNIP with Eurostat and FAO.
Fig. 1.8 The world production of soybean compared with other grain legumes (GL) shown by vertical
bars. Red colour in each bar indicates soybean and orange colour represents other legumes. The data
provided by UNIP with Eurostat and FAO is the average of five years (2000 to 2004) collection.
32
Fig. 1.9 Major legume-exporting countries in the world. Contribution of each country is indicated by
vertical bars and distinct colours in each bar are used to represent different legumes. Key of the colours
used to represent legume species is given on the left side. The data is the average of five year (2000 to
2004) study conducted by UNIP with Eurostat and FAO.
Fig. 1.10 Major legume-importing countries in the world. Import of each country in shown by vertical
bars and colours in each bar represent different legume species. The key for the colours associated with
each legume species is given. The data is the average of five year (2000 to 2004) work conducted by
UNIP with Eurostat and FAO.
33
Legumes are a significant component of nearly all terrestrial biomes. Some are
fresh water aquatics, but there are no truly marine species. The species within the
family range from dwarf herbs of arctic and alpine vegetation to massive trees of
tropical forests. The principal unifying feature of the family is the fruit, a pod,
technically known as a Legume. In terms of economic importance the Leguminosae is
the most important family in the Dicotyledonae. Legumes are second only to
Graminae (cereals) in providing food crops for world agriculture. The economic
importance of the family is likely to increase as human pressure places greater
demand on marginal land. Many legume species are characteristic of open and
disturbed places and are thus well adapted to grow under poor conditions.
In recent decades, cereal research and improved cultivation have led to more
cereals and fewer pulses being grown. This has meant that people, particularly the
poor, have lost a valuable source of protein. At the same time, monocropping of
cereals has exhausted soils and made cereal cultivation less sustainable. In Asia, the
green revolution concentrated exclusively on increasing cereal production and
neglected all other food crops, including pulses that had previously played an
important part in cereal cropping systems. Far less land was given over to pulses,
which were relegated to marginal areas where soils were less productive. Per capita
pulse yields (and therefore soil protein availability) declined. Consequently, soils that
supported one cereal crop after another started to lose their nutrients and deteriorate.
Continuous cereal production also made it easier for diseases and insects to establish
themselves on farmland, despite the increased use of fertilizers and pesticides. The
ratio of farm outputs to inputs (total factor productivity) attained by cereal farmers
declined dramatically. So, for developing countries of Asia, legumes are very
important crops and need more attention as they are not only a good source of protein
for nutrient deficient people but also prove to be excellent rotation crops to improve
soil fertility.
Legumes as food are consumed in varied forms. They are consumed as
vegetables and their seeds are consumed as fresh or in dried forms and their sprouts
are also eaten. Some of them are grown to yield edible oil. In Pakistan the most
common use of legumes as food is in the form of pulses. These are the dry beans of
legumes. Leguminous crops harvested green for food like snap beans and green peas
are classified as vegetable crops. Winter legumes grown in Pakistan are chickpea
(Cicer arietinum), grasspea (Lathyrus sativus) and lentil (Lens culinaris), while
34
summer food legumes are mungbean (Vigna radiata) and blackgram (Vigna mungo).
Fababean (Vicia faba), pigeonpea (Cajanus cajan), cowpea (Vigna unguiculata),
mothbean (Vigna aconitifolia) and kidneybean (Phaseolus vulgaris) are grown on a
very small scale.
Mungbean, Vigna radiata (L.) Wilczek belongs to subfamily Papilionoideae
of the Leguminosae. It is also referred to as green gram, golden gram and chop suey
bean. It is a widely adaptable, high yielding pulse and a major source of dietary
protein. Its seeds and sprouts are consumed as food and its shoots and leaves are
consumed as a vegetable. They are grown widely for use as human food but can be
used as a green manure crop and as forage for livestock. It is an early maturing bush
or vine like herb. The mungbean ancestors are annual plants with both short and long
day cultivars. They are warm season annuals, highly branched and having trifoliate
leaves like other legumes. Mungbean is a short duration crop that can be grown in
different soil conditions. Depending upon variety it takes about 90-120 days from
planting till maturity. Mungbean probably originated in India (De Candole, 1886;
Zhukovsky, 1950; Bailey, 1970) or the Indo-Burmese region (Vavilov, 1951; Sing et
al., 1970) and has been grown in India since ancient times. It is still widely grown in
Southeast Asia, Africa, South America and Australia. Mungbean seeds are sprouted
for fresh use or canned for shipment to restaurants. Sprouts are high in protein (21%–
28%), calcium, phosphorus and certain vitamins. Because they are easily digested
they replace scarce animal protein in human diets in tropical areas of the world.
Because of their major use as sprouts, a high quality seed with excellent germination
is required. The food industry likes to obtain about 9 or 10 grams of fresh sprouts for
each gram of seed. Larger seed with a glassy, green color seems to be preferred. If the
mungbean seed does not meet sprouting standards it can be used as a livestock food.
Mungbean can be processed into flour, candies, and sweets, both at the household and
industrial levels. Nearly 75% of world mungbean area and 58% of world mungbean
production are in southern Asia (AVRDC Report, 2001). In Pakistan mungbean is
grown during July to October and March to June seasons. In year 2000-2005, average
mungbean cultivated area was 239,500 hectares, average production was 125,800
tonnes, and per acre yield was 500 kg per hectares (Agricultural Statistics of Pakistan,
2005-2006). Mungbean cultivated area, production, and per acre has increased over
the years.
35
1.8 Legume-infecting begomoviruses
The viruses causing yellow mosaic disease of legumes across southern Asia,
four of which have been identified so far, are bipartite begomoviruses. Mungbean
yellow mosaic virus (MYMV), Mungbean yellow mosaic India virus (MYMIV),
Horsegram yellow mosaic virus (HgYMV) and Dolichos yellow mosaic virus
(DoYMV), collectively called the legume yellow mosaic viruses (LYMVs), like all
members of the Geminiviridae, have geminate twinned particles, 18-20 nm in
diameter, 30 nm long, apparently consisting of two incomplete T=1 icosahedra joined
together in a structure with 22 pentameric capsomers and 110 identical protein
subunits. Symptoms caused by LYMVs are largely dependent on host species and
susceptibility. In mungbean, for example, the first symptoms typically appear in
young leaves in the form of mild yellow specks or spots. The next leaf emerging from
the growing apex shows irregular bright yellow and green patches. Yellow areas
increase in the subsequent new growth and ultimately some of the apical leaves turn
completely yellow (Ahmad et al., 1973; Nariani, 1960). Diseased plants produce
fewer flowers and pods; pods remain small contain fewer and smaller seeds (Nariani,
1960). In blackgram the symptoms produced are of two kinds depending on variety:
“yellow mottle” (generalized yellowing of the leaves) and “necrotic mottle”
(yellowing restricted to small spots which turn necrotic) (Nene, 1973; Nair et al.,
1974). In dolichos initial symptoms include faint chlorotic specks on leaf lamina,
which later develop into bright yellow mosaic patches with small islands of green
tissue. The leaves are seldom deformed, but yields are reduced significantly (Capoor
and Varma, 1950). The symptoms in soybean appear as small yellow specks along the
veinlets developing into mosaic. In French bean young systemically infected leaflets
show downward curling without yellow mosaic and irregular chlorotic spots develop
rarely.
The LYMVs are closely related and have distinct but overlapping host ranges.
MYMV and MYMIV occur across the Indian subcontinent, with MYMV also
reported from Thailand and Cambodia, and affect the majority of legume crops
including mungbean, blackgram, pigeonpea, soybean (Glycine max), mothbean and
common bean (Phaseolus vulgaris). Additionally, MYMV is reported to infect yard-
long bean (Vigna sesquipedalis) and MYMIV to infect dolichos (Lablab purpureus).
DoYMV has only recently been recognized as a distinct species of begomovirus
(Maruthi et al., 2006). The virus is reported to have a very narrow host range
36
consisting of only the host from which it was isolated, dolichos. HgYMV is the least
well characterized of the four viruses; four complete sequences are available in the
databases but no publication has yet reported the infectivity or host range of the virus.
This virus occurs in horsegram (Macrotyloma uniflorum). LYMVs have gene
arrangements just like other begomoviruses as discussed earlier. However for
MYMIV the AC5 protein, encoded by a gene on the DNA-A component which is not
well conserved between begomoviruses, has been shown to have a possible function
in viral DNA replication (Raghavan et al., 2004). A recent in-depth analysis of the
gene expression strategy of MYMV has shown for the first time for a begomovirus
splicing of transcripts (Shivaprasad et al., 2005). Well documented for mastreviruses,
in being essential to express Rep (Wright et al., 1997), splicing in the case of MYMV
occurs in the leader sequence of the MP, removing some potentially inhibitory
sequences from the leader, which may up-regulate translation.
1.8.1 History of yellow mosaic disease of legumes in southern Asia
Yellow mosaic disease (YMD) was first reported from western India in the
late 1940s in Lima bean and later in mungbean in northern India (Capoor and Varma,
1948; Nariani, 1960). Similarly, in the regions of the subcontinent now forming part
of Pakistan, YMD was first reported in cowpea in the vicinity of Lyallpur (now
known as Faisalabad; Vasudeva, 1942). Virus particles were observed for the first
time in 1981 (Thongmeearkom et al., 1981) and purified later on by Honda et al.,
(1983). Across the subcontinent, including India, Bangladesh, Pakistan and Sri Lanka,
YMD is a major constraint to the production of most of the major legume crops. In
Thailand YMD is a minor sporadic problem in legumes. However, in northern
Thailand a severe outbreak of YMD in mungbean occurred in 1997. This caused
major losses to production and initiated a shift in cropping practices. Since this time
YMD has remained a minor problem and the first complete sequence of a YMD virus
was isolated from mungbean originating from this country (Morinaga et al., 1993).
1.8.2 Host adaptation of the legume yellow mosaic viruses
MYMV and MYMIV (the only LYMVs which have been studied in any
detail) are unusual in having highly variable DNA-B components, likely due to
pseudo-recombination. A blackgram isolate of MYMV (MYMV-[IN:Vig]) was
shown to be associated with two distinct types of DNA-B. The first type (KA27)
37
showed 97% sequence identity to the DNA-B of the MYMV isolate from Thailand.
The other type (represented by four clones, KA21, 22, 28 and 34) was only 71–72%
identical to the Thai isolate (Karthikeyan et al., 2004). Infectivity analysis showed the
DNA-A component of this virus to be able to support both DNA-B components at the
same time and to induce only mild symptoms in blackgram in the presence of DNA
KA27 but typical disease symptoms in this host in the presence of the other DNA-B
components. In agroinoculation experiments, symptom severity depended on the
DNA-B component used (Balaji et al., 2004; Karthikeyan et al., 2004). For an isolate
of MYMIV (MYMIV-[Cp]) from cowpea, the presence of a distinct DNA-B was
shown to extend the host range of this virus to cowpea. These clones were not well
adapted to blackgram, inducing severe symptoms but accumulating to only low levels
in this species (Malathi et al., 2005). Furthermore, an isolate of MYMV isolated from
soybean (MYMV-[IN:Mad:Sb]) is associated with a DNA-B with high sequence
identity to the DNA-B of HgYMV (96%). The DNA-B of HgYMV is the most
distinct amongst the LYMV DNA-Bs, showing only 70–73% identity to the DNA-B
components of MYMV and MYMIV. These findings indicate that component
exchange (so called pseudo-recombination) is common-place for the LYMVs, both
within and between species, and is probably an adaptation allowing a change in host
range. For bipartite begomoviruses the DNA-A and DNA-B components share a
region of sequence (~200 nucleotides) with high sequence identity that contains the
origin (ori) of virion-strand DNA replication.
The ori consists of a conserved hairpin structure containing the ubiquitous (for
geminiviruses) nonanucleotide motif (TAATATTAC; which is nicked by the virus-
encoded Rep to initiate virion-sense, rolling-circle DNA replication) and repeated
motifs „iterons‟ that are the sequence specific recognition sequences for Rep
(Argüello-Astorga et al., 1994). The interaction between Rep and the iteron is highly
specific, in most cases preventing interaction between components of distinct
begomovirus species (Chatterji et al., 2000; Fontes et al., 1992; 1994; Orozco et al.,
1998). Thus, the integrity of the bipartite genomes of begomoviruses is maintained by
each component having the same (or at least a closely related) ori containing the same
iterons. However, component capture between distinct species does occur if, by
recombination, the ori of DNA-B is replaced by that of the DNA-A (so-called „origin
donation‟). This appears to be the case for the HgYMV-like DNA-B of MYMV-
[IN:Mad:Sb], which contains the MYMV/MYMIV iteron motifs GGTGT (Girish and
38
Usha, 2005). However, this isolate was also associated with a DNA-B typically
associated with this species.
1.8.3 Relationship of legume yellow mosaic viruses to other begomoviruses
The four geminiviruses so far identified infecting legumes in southern Asia are
amongst the most unusual of the begomoviruses. They are distinct from the numerous
legume-infecting begomoviruses that occur in the Americas (as are all Old World
begomoviruses; Stanley et al., 2004). In phylogenetic analyses the LYMVs are always
basal to the Old World begomoviruses (Padidam et al., 1995). This is a feature the
LYMVs share with two other legume-infecting viruses, Cowpea golden mosaic virus
(CPGMV) (from Nigeria) and Soybean crinkle leaf virus (SbCLV) (a monopartite
begomovirus occurring in Japan; Samretwanich et al., 2001), as well as a group of
presumed monopartite viruses isolated from Ipomoea spp. (including sweet potato),
which are widespread and whose precise geographical origins remain unclear
(Lotrakul et al., 2002).
1.9 Strategies for engineering resistance to geminiviruses
1.9.1 Resistance by the expression of proteins
Both viral and non viral proteins can be used to engineer resistance against
viruses. Among the proteins encoded by geminiviruses the Rep is of prime
importance as some of the functions of Rep are virus non-specific and targeting of
Rep may provide broader resistance against different geminiviruses. Virus replication
was repressed in N. benthamiana protoplasts expressing N-terminally truncated Rep
(T-Rep; Hong and Stanley, 1995; Brunetti et al., 2001), and T-Rep transgenic plants
showed a degree of resistance (Hong and Stanley, 1996; Noris et al., 1996). T-Rep
expression in tomato plants also conferred resistance to the homologous virus by
tightly repressing the viral Rep promoter, whereas it affected a heterologous
geminivirus by the formation of dysfunctional complexes with the Rep of the
heterologous virus (Lucioli et al., 2003). Similar observations have been reported for
the expression of the N-terminal region of ToLCNDV Rep, encompassing the DNA
binding and oligomerization domain, in N. benthamiana plants and protoplasts. This
led to a decrease of more than 70% in DNA accumulation of the homologous virus,
but also afforded a 20–50% decrease with heterologous ACMV, Pepper huasteco
39
yellow vein virus (PHYVV) and Potato yellow mosaic virus (PYMV) (Chatterji et al.,
2001). Resistance under field conditions was observed with tomatoes expressing parts
of the Rep gene with the intergenic region of TYLCV (Yang et al., 2004a). However,
in this case expression of the Rep protein was not necessary for resistance. It is
believed that the dsRNA hairpin loops transcribed from the inverted repeats of the
intergenic region trigger PTGS. TGMV MP had a deleterious effect on systemic
infection of ACMV DNA-A in N. benthamiana plants (von Arnim and Stanley,
1992a). Tobacco plants expressing a mutated version of ToMoV MP also showed
resistance to ToMoV and CaLCuV infection (Duan et al., 1997). Non-functional MPs
may compete for NSP interaction or oligomerization (Frischmuth et al., 2004), and
this could explain the resistance observed in plants expressing mutated MP.
Expression of full-length and truncated Rep of MYMV inhibited viral replication in
transgenic tobacco plants (Shivaprasad et al., 2006).
Cell death can contain the virus at the site of inoculation. To engineer virus-
inducible cell death mechanisms to confine ACMV to the primary infection site,
attempts have been made by expressing a ribosome-inactivating protein (dianthin)
controlled by the ACMV DNA-A virion strand promoter, which is transactivated by
ACMV TrAP on infection (Haley et al., 1992; Hong et al., 1997). Susceptibility of
transgenic N. benthamiana plant to infection by ACMV isolates originating from
widely separated locations was greatly reduced. As homologous and heterologous
TrAP proteins (TGMV, ACMV and SqLCV) are able to activate virion strand
expression of the TGMV promoter (Sunter et al., 1994), this strategy may confer
resistance to a broad spectrum of geminiviruses. In a similar approach barnase and
barstar proteins have been used to develop resistance to geminiviruses. Barnase is a
110-residue extraceullular protein found in Bacillus amyloliquefaciens. It is a
ribonuclease whose potentially lethal functions within the cell are inhibited by barstar,
a 90-residue polypeptide. The barnase and barstar coding sequences from Bacillus
amyloliquefaciens were cloned under the control of the virion-sense and
complementary-sense promoters from ACMV, respectively (Zhang et al., 2003).
Theoretically, in the absence of geminivirus infection, the barnase and barstar
transgenes should be expressed at similar levels and no active barnase is available.
During infection, the Rep and TrAP proteins increase the barnase/barstar ratio,
leading to the production of barnase with RNase activity, local cell death and, finally,
inhibition of virus spread.
40
Sera and Uranga (2002) have produced artificial zinc finger proteins (AZPs)
with a high affinity and selectivity for the Rep dsDNA binding site in the viral
replication origins of TGMV and Beet severe curly top virus (BSCTV). Expression of
a six finger AZP with a nuclear localization signal (NLS) under the control of a
Cestrum yellow leaf curling virus promoter in Arabidopsis thaliana also produced
transgenic lines with reduced or no replication of BSCTV (Sera, 2005). This approach
is likely to generate stable resistance as the virus needs to evade the AZP effect by
simultaneously mutating both the Rep sequence and the origin of replication.
1.9.2 DNA interference
In addition to genomic components, often subgenomic DNAs occur naturally
in geminivirus-infected plants (Frischmuth and Stanley, 1993). Because of their
ability to delay and attenuate infection symptoms they behave as defective interfering
(DI) DNA (Stanley et al., 1990). ACMV-infected plants contained small amounts of
DNA-B of approximately twice and half the genomic DNA length (Stanley and
Townsend, 1985) and their concentrations were negatively correlated with the ACMV
multiplication in N. benthamiana. Plants transformed with a tandem repeat of
subgenomic defective ACMV DNA-B showed reduced symptoms compared with
untransformed plants on ACMV infection (Stanley et al., 1990). This phenomenon
was virus specific because no resistance phenotype could be observed when the
transgenic plants were challenged with BCTV and TGMV. Subgenomic DNAs of
BCTV comprised a heterogeneous population, varying in size from 800 to 1800
nucleotides (Stenger et al., 1990; Frischmuth and Stanley, 1992). N. benthamiana
transformed with partial repeats of subgenomic DNAs remained susceptible to
infection but showed ameliorated symptoms when agroinoculated with BCTV.
Symptom amelioration was associated with the mobilization of subgenomic DNA
from the host genome (Frischmuth and Stanley, 1994; Stenger, 1994). BCTV DI
DNA-mediated resistance was linked to its size (Frischmuth et al., 1997) and it was
suggested that during the early stages of infection of control plants viral genomic
DNA is replicated to suitably high levels and subsequently spreads within the plant. In
transformed plants the DI DNA is mobilised from the host genome and competes
with, and reduces, the level of genomic DNA, thus, the level of viral DNA available
for spread decreases. Because the subgenomic DNA competes also for spread proteins
fewer cells will receive viral DNA.
41
1.9.3 RNA interference
RNA interference (RNAi) is involved in the inhibition of viruses and silencing
of transposable elements in plants, insects, fungi and nematodes by small interfering
(si)RNAs (21-nt dsRNA) that are processed from dsRNA viral replication
intermediates (Waterhouse et al., 2001; Voinnet, 2001; Wilkins et al., 2005; Segers
et al., 2007). These siRNAs are loaded into RISC and target the fully complementary
viral RNAs for destruction or translational repression (Haasnoot et al., 2003).
RNaseIII-type enzymes, termed Drosha and Dicer (DCR) in animals or DCR-LIKE
(DCL) in plants, catalyze processing of siRNA precursors to 21- to 24-nt duplexes
(Bartel, 2004; Baulcombe, 2004). Distinct pathways are involved in the synthesis of
siRNAs. Heterochromatin-associated siRNAs (predominantly 24-nt) form through the
activities of RDR2, RNA polymerase IV, and DCL3 and require AGO4 for activity to
direct or reinforce cytosine methylation of DNA and histone H3 methylation at Lys-9
(Herr et al., 2005; Onodera et al., 2005; Xie et al., 2004; Hamilton et al., 2002;
Zilberman et al., 2003). Formation of post-transcriptionally active siRNAs from
exogenous (viral and transgenic) sources may involve RDR1 or RDR6 and, for some
viruses, DCL2 (Baulcombe, 2004). Endogenous, trans-acting small interfering (ta-si)
RNAs arise from PolII genes and guide cleavage of target messenger RNAs (Allen et
al., 2005; Peragine et al., 2004; Vazquez et al., 2004). ta-siRNAs require RDR6 and
suppressor of gene silencing 3 (SGS3) for precursor formation (Peragine et al., 2004;
Vazquez et al., 2004). ta-siRNA formation also requires DCL1, although the specific
role of DCL1 may be indirect (Allen et al., 2005; Peragine et al., 2004; Vazquez et
al., 2004). All known classes of endogenous small RNAs in Arabidopsis require
HEN1, an RNA methyltransferase that modifies the 3′ end (Yu et al., 2005). A.
thaliana has three known families of ta-siRNA-encoding genes, designated TAS1,
TAS2, and TAS3 (Allen et al., 2005; Peragine et al., 2004; Vazquez et al., 2004). The
TAS1 family is composed of three genes that encode a closely related set of ta-
siRNAs (for example, siR255 and siR480) that target four messenger RNAs encoding
proteins of unknown function (Allen et al., 2005; Peragine et al., 2004; Vazquez et
al., 2004). TAS2-derived ta-siRNAs (for example, siR1511) targets a set of
messenger RNAs encoding pentatricopeptide repeat proteins (Allen et al., 2005;
Peragine et al., 2004). The TAS3 locus specifies two ta-siRNAs that target a set of
messenger RNAs for several Auxin response factors (ARFs), including ARF3
(ETTIN) and ARF4 (Allen et al., 2005; Williams et al., 2005). Arabidopsis mutants
42
with defects in RDR6 and SGS3 lack ta-siRNAs and exhibit accelerated transition
from juvenile to adult phase during vegetative development (Peragine et al., 2004;
Vazquez et al., 2004), suggesting that ta-siRNAs regulate developmental timing,
presumably through regulation of ta-siRNA target genes.
micro RNAs are small non-coding RNAs that are expressed as primary
microRNAs and processed first by the protein Drosha and then by Dicer into a ~70 nt
stem-loop precursor micro (pre-mi) RNA and the mature microRNA of 21–25 nt,
respectively. microRNA is loaded into the RNA-induced silencing complex (RISC).
The guide strand (microRNA) targets RISC to messenger RNAs with partially
complementary sequences, triggering messenger RNA cleavage or translational
inhibition. It has recently been suggested that under stress conditions, the mode of
microRNA regulation can change and, by association with other proteins, can turn
into an activator of gene expression (Leung and Sharp, 2007). The exact criteria for
target recognition are currently not clear. However, pairing of the 5′ 7–8 nucleotides
of the micro RNA (seed region) to multiple sites in the 3′ untranslated region of a
target messenger RNA is in many cases sufficient to trigger translational inhibition
(Krek, 2005; Brennecke et al., 2005; Grimson, et al., 2007; Lewis et al., 2003).
Several lines of research indicate that RNA silencing is a general antiviral
defense mechanism in plants. The first indication came from the studies of pathogen
derived resistance (PDR) in plants. In PDR, resistance to a particular virus is
engineered by stably transforming plants with a transgene derived from the virus.
Eventually it became clear, that one class of PDR was the result of RNA silencing of
the viral transgene. Once RNA silencing transgene had been established, all RNAs
with homology with the transgene were degraded, including those derived from an
infecting virus (Lindbo et al., 1993). Thus plant viruses could be the target of RNA
silencing induced by a transgene. The same work demonstrated that plant viruses
could also induce RNA silencing. VIGS can be targeted to either transgenes or
endogenous genes (Ruiz et al., 1998) and the technique has been used to screen for
gene function using libraries of endogenous sequences cloned into a viral vector
(Vance and Vaucheret, 2001). Transient expression of reporter genes encoding either
green fluorescence protein (GFP) or red fluorescent protein from Discosoma was
specifically reduced by 58% and 47%, respectively, at 24 h after codelivery of
cognate siRNAs in BY2 protoplasts. In contrast to mammalian systems, the siRNA-
induced silencing of GFP expression was transitive as indicated by the presence of
43
siRNAs representing parts of the target RNA outside the region homologous to the
triggering siRNA. Codelivery of a siRNA designed to target the messenger RNA
encoding the Rep of the geminivirus ACMV from Cameroon blocked Rep messenger
RNA accumulation by 91% and inhibited accumulation of the ACMV genomic DNA
by 66% at 36 and 48 h after transfection. As with siRNA-induced reporter gene
silencing, the siRNA targeting ACMV Rep was specific and did not affect the
replication of EACMCV.
1.9.4 Aims and objectives of the study
Across southern Asia, including Pakistan, YMD of legumes is a significant
constrain to the production of some legume crops. Although there are reports of
resistance to the viruses causing YMD in the literature, obtained by conventional
breeding, these appear not to have reached the field or not to hold up in the field –
fields of legumes continue to show symptoms of severe YMD infection in summer
crops. Despite the importance of legumes (and particularly grain legumes) to the diets
of the peoples of southern Asia, the begomoviruses affecting these crops have only
been poorly investigated. The objectives of the study reported here were to determine
the precise diversity of begomoviruses infecting legumes in Pakistan. This was to be
achieved by producing full-length clones and determining the sequence of all
begomovirus components, from as many samples and as many legume species
(including weeds) as was feasible in the time available. Furthermore, the clones would
be used to produce constructs for infectivity of both legumes and experimental
(model) plants to investigate virus gene function (gene requirements for infectivity).
Additionally, such an infectivity system will, it is anticipated, in the future be useful
for screening legumes varieties for resistance (so called “molecular breeding”).
Experiments conducted during the study would investigate the feasibility of this idea.
Finally, the availability of virus clones (thus virus sequences) and an infectivity
system would be used to investigate the possibility of using the RNAi approach to
develop resistance to legume-infecting begomoviruses. This Thesis details the results
of the aforementioned study. Although it was not anticipated prior to beginning the
investigation, the identification of betasatellites in some legume samples provided an
interesting aside, the investigation of which provided some highly novel and
interesting findings.
44
Chapter 2
Materials and methods
2.1 Sample collection
Symptomatic plants were located in fields and photographed with a high
resolution camera. Young leaves of symptomatic plants were collected, kept in plastic
bags labelled with permanent marker, transported on ice and stored at -80 ˚C until
utilized.
2.2 DNA extraction from plant tissue
2.2.1 DNA extraction from legumes
For legumes DNA was extracted from leaf samples using the method
described by Porebski (1997) with some modifications. 500 mg of leaf tissue was
ground to a fine powder in a pestle and mortar in the presence of liquid nitrogen and
transferred to a 15 mL centrifuge tube. 5 mL of extraction buffer [100 mM tris, 1.4 M
NaCl, 20 mM EDTA (pH 8.0), 2% CTAB, 0.3% β mercaptoethanol] and 50 mg of
PVP was mixed with powdered tissue and incubated at 65˚C with constant shaking for
30-45 minutes. The slurry was centrifuged at 1800×g in a tabletop centrifuge
(Eppendorf centrifuge 5810R) for 10 minutes to pellet tissue debris. The liquid phase
was collected in a new tube and mixed with 6 mL chloroform:isoamyl alcohol (24:1)
to form an emulsion and centrifuged at 1800×g for 20 minutes at room temperature.
The upper aqueous phase was transferred to a fresh tube by using a wide-bore pipette
tip and the chloroform:isoamyl alcohol extraction was repeated until the supernatant
was clear, without cloudiness. A half volume of 5 M NaCl was added to the final
aqueous solution recovered, mixed well and two volumes of cold 100% ethanol was
added, mixed well and placed in -20 ˚C freezer for 10 minutes. The precipitated DNA
was pelleted by centrifugation at 3220×g for 6 minutes. After removal of the
supernatant the pellet was washed with 70% ethanol, dried at 37 ˚C in an incubator
and resuspended in 300 µL TE buffer. Dissolved DNA was transferred to a new 1.5
mL microcentrifuge tube and 3 µL of RNase A (10 mg/mL) was added. After
incubation at 37 ˚C for 1 hour, 3 µL proteinase K (1 mg/mL) was added and incubated
at 37 ˚C for 15 minutes. 300 µL phenol:chloroform (1:1) mixture was added to the
45
tube, vortexed briefly and centrifuged (Eppendorf centrifuge 5415D) at 16000×g for
10 minutes. The upper aqueous phase containing DNA transferred to a new
microcentrifuge tube and mixed with 1/10 volume of 3 M sodium acetate and 2
volumes of absolute ethanol and centrifuged at 16000×g for 10 minutes. The DNA
pellet was washed with 70% ethanol and air dried. Finally the pellet was dissolved in
sterile distilled (SDW) water and stored at -20 ˚C freezer.
DNA of some legume samples was isolated using a Nucleon Phytopure
genomic DNA extraction kit (GE Healthcare) according to the instructions provided
by the manufacturer. 100 mg leaf tissue was ground to a fine powder in a pestle and
mortar in the presence of liquid nitrogen and transferred to a microcentrifuge tube
using a chilled spatula. For cell lysis, the powder was mixed with 600 µL Reagent 1
before adding 200 µL Reagent 2. The contents of the tube were mixed by inversion
and incubated at 65 ˚C for 10 minutes with regular manual agitation. The sample was
placed on ice for 20 minutes and then mixed with 500 µL chilled chloroform and 100
µL Nucleon PhytoPure DNA extraction resin suspension. The tube was agitated
manually for 10 minutes at room temperature and centrifuged at 11200×g for 10
minutes. The upper DNA containing phase was transferred to a fresh microcentrifuge
tube, mixed with an equal volume of cold isoropanol and centrifuged at 16000×g for 5
minutes to pellet the DNA. The DNA pellet was washed with 70% cold ethanol, air
dried and re-suspended in TE buffer.
2.2.2 DNA extraction from Nicotiana benthamiana and N. tabacum
From Nicotiana benthamiana and N. tabacum tissues DNA was isolated by the
CTAB method described by Doyle and Doyle (1990). 100 to 200 mg of leaf tissue
was ground to a fine powder in liquid nitrogen in a pestle and mortar. In a
microcentrifuge tube the powdered tissue was mixed with 700 µL pre-warmed CTAB
buffer [100 mM Tris-HCl (pH 8.0), 20 mM EDTA, 1.4 M NaCl, 2% (w/v) CTAB and
0.2% (v/v) β-mercaptethanol] and incubated at 65 ˚C for 30 minutes. After lowering
the temperature of the sample to room temperature, an equal volume of
chloroform:isoamyl alcohol (24:1) was added, mixed well and centrifuged at 11200×g
for 10 min at room temperature. The upper DNA containing phase was transferred
into a new microcentrifuge tube and mixed with 0.6 volume isopropanol to precipitate
the DNA. DNA was pelleted by centrifugation at 16000×g for 10 minutes, washed
with 70% ethanol and air dried. Finally the pellet was dissolved in SDW.
46
2.3 Quantification of DNA
The concentration of dsDNA was determined by spectrophotometer
(SmartSpec Plus, BIORAD). The sample was diluted 10/100 in SDW and the
absorbance measured at 260 nm after zeroing the machine against SDW. An O.D260 of
1 is equivalent to 50 µg/mL of DNA.
2.4 Amplification of DNA
2.4.1 PCR amplification of DNA
For amplification of DNA by PCR a reaction mixture of 50 µL containing 10
pg-1µg template DNA, 5 µL 10X Taq polymerase buffer (Fermentas), 5 µL 2 mM
dNTPs , 1.5 mM MgCl2, 0.5 µM each of primers (Table 2.1) and 1.25 units Taq DNA
polymerase (Fermentas) was prepared in a 0.25 mL or 0.5 mL thin walled PCR tube.
The reaction mixture was incubated in thermal cycler (Eppendorf). The machine was
programmed for a preheat treatment of 94 ˚C for 5 minutes followed by 35 cycles of
94 ˚C for 1 min, 48 ˚C to 52 ˚C for 1 min and 72 ˚C for varying times (dependent
upon the length of fragment to be amplified; typically 1 min per 1000 nucleotides to
be amplified), followed by a final incubation of 10 min at 72 ˚C. Specific as well as
universal primers were used for DNA amplification. For diagnostic PCR the volume
of reaction mixture was reduced to 25 µL per tube by reducing the ingredients
accordingly.
47
Table 2.1 Names, sequences and brief description of primers used in this study.
Primer name Sequence Used for
DNA-A Forward1
DNA-A Reverse1
GTAAAGCTTACATCCTCCACCAAGTGG
TGTAAGCTTTACGCATAATGCTCAATAC
Amplification of DNA-A of
MYMIV
DNA-A Forward2
DNA-A Reverse2
GTAAAGCTTACATCCTCCACC
TGTAAGCTTTACGCATAATGTTC
Amplification of
DNA-A of MYMIV
DNA-A Forward3
DNA-A Reverse3
TGTGGGATCCATTGTTGAACGACTTTC
CAATGGATCCCACATTGTTAGTGGGTTC
Amplification of
DNA-A of
MYMIV
DNA-B Forward DNA-B Reverse
CCAGGATCCAATGATGCCTCTGGCA ATTGGATCCTGGAGATTCAATATCTC
Amplification of
DNA-B of
MYMIV
PedLCV Forward
PedLCV Reverse
GATAGGACTTGACGTCGGAGCTTGAC
CATGTCATTGTCCGTTAGTGCTTTG
PCR detection of
PedLCV
AV2 Forward AV2 Reverse
CCACCCGGGATGTGGGATCCATTGTTG CAGGTCGACTATACAGTCGGTAAAAC
Cloning of
MYMIV AV2 in
PVX.
CP Forward
CP Reverse
TCCCCCGGGATGCCCAAGCGGACTTAC
CAAGTCGACTTAATTCAATATCGAATC
Cloning of
MYMIV CP in
PVX.
AC5 Forward
AC5 Reverse
GTTCCCGGGATGGTTCTCATACCTCGC
ATGGTCGACTTATGTCGTGACAGACG
Cloning of MYMIV AC5 in
PVX.
REn Forward
REn Reverse
GCCCCCGGGATGGATTTTCGCACAGG
GATGTCGACTTAATAAAGTTTGTATTG
Cloning of
MYMIV REn in PVX.
TrAP Forward
TrAP Reverse
CTTCCCGGGATGCGGAATTCTACAC
ATAGTCGACTACGGAAGATCGATAAGATC
Cloning of
MYMIV TrAP in PVX.
Rep Forward
Rep Reverse
ACTCCCGGGATGCCAAGGGAAGGTCG
CAGGTCGACTCAATTCGAGATCGTCG
Cloning of
MYMIV Rep in
PVX.
AC4 Forward
AC4 Reverse
GAGCCCGGGATGAAGATGGACAACCTC
CCTGTCGACTCAATATAAGGAGGGCCTCC
Cloning of
MYMIV AC4 in
PVX.
NSP Forward
NSP Reverse
AACATCGATATGTTTAACCGGAATTATC
TTAGTCGACTTATCCAACGTATTTCA
Cloning of MYMIV NSP in
PVX.
MP Forward
MP Reverse
TCTGATCGATGGAGAATTATTCAGGAGC
TTTCCCCGGGTTACAACTGTTTGTTCAC
Cloning of
MYMIV MP in PVX.
βC1-PVX Forward βC1-PVX Reverse
TCACCCGGGATGACATATGAACACTCAC
AATGTCGACTTATACGGATGAATGCG
Cloning of
MYMIV βC1 in
PVX.
AV2 Forward
AV2 Reverse
CCACCCGGGATGTGGGATCCATTGTTG
CAGGAATTCTATACAGTCGGTAAAAC
Cloning of
MYMIV AV2 in pJIT163.
48
Table 2.1 continued
Primer name Sequence Used for
CP Forward
CP Reverse
TCCCCCGGGATGCCCAAGCGGACTTAC
CAAGAATTCTTAATTCAATATCGAATC
Cloning of MYMIV CP in
pJIT163.
AC5 Forward
AC5 Reverse
GTTCCCGGGATGGTTCTCATACCTCGC
ATGGAATTCTTATGTCGTGACAGACG
Cloning of
MYMIV AC5 in pJIT163.
REn Forward REn Reverse
GCCCCCGGGATGGATTTTCGCACAGG GATGAATTCTTAATAAAGTTTGTATTG
Cloning of
MYMIV REn in
pJIT163.
TrAP Forward
TrAP Reverse
CTTAAGCTTATGCGGAATTCTACAC
AATGGATCCTTACGGAAGATCGATAAG
Cloning of
MYMIV TrAP in
pJIT163.
Rep Forward
Rep Reverse
ACTAAGCTTATGCCAAGGGAAGGTCG
CAGGGATCCTCAATTCGAGATCGTCG
Cloning of MYMIV Rep in
pJIT163.
AC4 Forward
AC4 Reverse
GAGCCCGGGATGAAGATGGACAACCTC
CTTTGAATTCAATATAAGGAGGGCCTCC
Cloning of
MYMIV AC4 in
pJIT163.
NSP Forward
NSP Reverse
AACAAGCTTATGTTTAACCGGAATTATC
TTAGGATCCTTATCCAACGTATTTCA
Cloning of MYMIV NSP in
pJIT163.
MP Forward
MP Reverse
TTTCAAGCTTATGGAGAATTATTCAGG
TTTCCCCGGGTTACAACTGTTTGTTCAC
Cloning of MYMIV MP in
pJIT163.
βC1-35S Forward
βC1-35S Reverse
TCAAAGCTTATGACATATGAACACTCAC
AATGGATCCTTATACGGATGAATGCG
Cloning of
MYMIV βC1 in pJIT163.
BΔNSP
Forward B
ΔNSP Reverse
AAGCTTGATGTCTCTGGTGTG * AAGCTTAAGTTACTTGATGTAATCCCTAC *
Mutation of NSP of MYMIV.
MIGFPF
MIGFPR
GTCGACATGAGTAAAGGAGAAGAAC
ACGCGTTTATTTGTATAGTTCATCCATG
Amplification of
GFP
A6GFPF A6GFPR
ACGCGTTATGCAACTCTTAAAATTCGGATC GTCGACGGATGCGCAATACCTGAATTAAC
Amplification of
MYMIV DNA-A
without CP
MIBETAF MIBETAR
CTTGAATTCCCCTATATTAGACTCCTTG GGGAATTCAAGCAAGAAGACATGGTG
Amplification of TbLCB
RhYAF
RhYAR
ATGCGAAAGCGGAGCTACGATACG
TTAATTTGATATCGAATCGTAAAAATAG
Diagnosis of DNA-
A of RhYMV
RhYBF
RhYBR
ATGTTTAATCGTAATTTTCGCTCC
TTATCCCAAATATTTTAATTCAAATTG
Diagnosis of DNA-
B of RhYMV
MYMVAF
MYMVAR
ATGCCAAAGCGGAATTACGATACCGC
CAAACTTTATTAATTTGAAATCGAATC
Diagnosis of DNA-
A of MYMV
MYMVBF
MYMVBR
ATGTACAACCGTAACATACGAACCCCAG
TTATCCAATGTATTGTAGTTCAAATTG
Diagnosis of DNA-
B of MYMV
RdR6F RdR6R
ATAGTCGACTCGTAGTGACTCAAATTAGTG CTGATCGATGATGCCTTTGTGCAAAACCGC
To produce
antisense construct
of RdR6.
* Bold letters in primer sequences are nucleotides used to add mutations.
49
2.4.2 Rolling-circle amplification
For amplification of circular DNA molecules rolling-circle amplification
(RCA; Fire and Xu 1995; Liu et al. 1996; Lizardi et al. 1998) was used. Reaction
mixtures of 20 µl containing 100 to 200 ng of genomic DNA extracted from infected
plant samples was used as a template, 50 µM random hexamer primers, 2 µl 10X φ29
DNA polymerase reaction buffer (330 mM Tris-acetate [pH 7.9 at 37 ˚C], 100 mM
magnesium acetate, 660 mM potassium acetate, 1% [v/v] Tween 20, 10 mM DTT)
was prepared and incubated at 94 ˚C for 3 minutes to denature double-stranded DNA.
The mixture was cooled to room temperature and mixed with 1 mM dNTPs, 5-7 units
of φ29 DNA polymerase and 0.02 units of pyrophosphatase (to eliminate inhibitory
accumulation of pyrophosphate) and incubated at 30 ˚C for 18 to 20 h. Finally the φ29
DNA polymerase was inactivated at 65 ˚C for 10 minutes.
2.5 Cloning of amplified DNA
2.5.1 Cloning of PCR product
PCR amplified DNA was cloned using an InsTAclone PCR Cloning Kit
(Fermentas) according to the instructions provided by the manufacturer. In brief, a
reaction mixture of 30 µL containing 18 to 540 ng PCR product (dependent upon the
length of DNA fragment), 3 µL vector (pTZ57R/T), 6 µL 5X ligation buffer and 5
units T4 DNA Ligase, was prepared in a 1.5 mL microcentrifuge tube and incubated
at 16 ˚C overnight. The following day the ligation mixture was transformed into
competent Escherichia coli cells by the heat-shock method. Transformed cells were
spread on solid LB medium (1% tryptone, 0.5% yeast extract and 1% NaCl) plates
containing 100 µg/mL ampicillin, spread with 20 µL X-Gal (50 mg/mL) and 100 µL
IPTG (24 mg/mL) and incubated at 37 ˚C for 16 hours. White colonies were picked
using sterile tooth picks, inoculated into 5 mL aliquots of LB liquid media in
autoclaved test tubes and grown at 37 ˚C in a shaker overnight. Plasmids were then
isolated from E. coli cultures and screened for desired inserts by restriction analysis.
For cloning in PVX vector, movement deficient PVX vector or pJIT163, PCR product
cloned in pTZ57R/T was digested at specific restriction sites introduced in primers
and ligated into the desired vector.
For cloning of RCA products the concatameric DNA was digested with
restriction endonucleases to yield monomeric copies. A cloning vector (usually
50
pBluescript II KS/SK [+]) was also restricted with the same enzyme. Restricted RCA
product and vector were extracted with phenol-chloroform to remove proteins and
quantified. Vector and insert were ligated in a reaction mixture of 20 µL containing
75-150 ng vector and 200-500 ng insert (approx. a 1:3 ratio), 4 µL 5X ligation buffer
and 1 µL T4 DNA ligase. The ligation mixture was kept at 16 ˚C overnight and the
following day transformed into competent E. coli cells.
2.6 Transformation of competent cells
2.6.1 Transformation of heat-shock competent E. coli cells
Transformation of competent E. coli cells was carried out by the methods
described by Sambrook et al. (1989). The ligation mixture was added to thawed
competent cells (200 µL), mixed gently and incubated on ice for 30 min. The cells
were heat shocked at 42˚C in a dry bath. After 1-2 minutes cells were transferred to
ice and incubated for two minutes. 1 mL of LB liquid medium was added to each tube
and the tubes were placed in a shaker at 37˚C for 1 hour. Transformed cells were
spread on solid LB media plates with appropriate antibiotics and kept at 37˚C in an
incubator for 16 hours.
2.6.2 Transformation of competent Agrobacterium tumefaciens cells
2 µL of the plasmid or ligation mixture was mixed with electro-competent A.
tumefaciens cells on ice and transferred to a chilled electroporation cuvette. The
electroporator (BTX Harvards) was set at 1.44 kV and the cuvette was inserted into
the electric shock chamber and the start button was pressed. After the electric shock, 1
mL of LB liquid medium was added to the cells and the tube was placed in a shaker at
28 ˚C for 2 hours. The cells were finally spread on Petri plates containing AB minimal
medium (K2HPO4 3 g, NaH2PO4 1 g, NH4Cl 1 g, MgSO4.7H2O 0.3 g, KCl 0.15 g,
CaCl2 0.005 g, FeSO4.7H2O 0.0025 g, and glucose 20% [w/v] [pH 7.2] in a 1 L
volume) with agar 14 g and appropriate antibiotics, wrapped with aluminium foil and
placed in a 28 ˚C incubator for 48 hours.
51
2.7 Preparation of competent cells
2.7.1 Preparation of heat shock competent Escherichia coli cells
A single colony from a freshly grown plate of E. coli was picked and
transferred into 20 mL LB medium in a 50 mL flask and incubated at 37 C overnight
with vigorous shaking. The next day 2 mL of the overnight culture was added to
250 mL LB in 1 L flask and shaken vigorously at 37oC until an OD600 of 0.5-1. The
culture was chilled on ice for 30 minutes, transferred aseptically to sterile disposable
50 mL propylene tubes and centrifuge at 3220×g at 4oC for 5 minutes to pellet the
cells. The cell pellet was resuspended in 20 mL of 0.1 M MgCl2 and centrifuged
again. The pellet was resuspended in 20 mL of 0.1 M CaCl2, incubated on ice for 30
minutes and centrifuged. Finally the pellet was resuspended in 3-4 mL of 0.1 M CaCl2
and filter-sterilised cold glycerol (in approx. 3:1 ratio). The cells were stored in
aliquots of 200 μL at -80oC.
2.7.2 Preparation of electro competent Agrobacterium tumefaciens cells
A single colony from a freshly grown plate of Agrobacterium tumefaciens
(strain EHA105 or GV3101) was picked using a sterile toothpick and inoculated into
20 mL LB liquid medium with 25 µg/mL rifampicin in a 50 mL autoclaved flask and
placed in a shaker (160 rotations per minute) at 28 C for 48 hours. 5 mL of the culture
was inoculated into a 1 L flask containing 250 mL of LB medium with 25 µg/mL
rifampicin and placed in a shaker at 28 C until the OD600 of cells was 0.5-1. The cells
were transferred aseptically to ice cold 50 mL propylene tubes, incubated on ice for
10 minutes and centrifuged at 3220×g for 10 minutes at 4 C. The pellet was
resuspended in 50 mL of sterile cold SDW and centrifuged. Cells were again
resuspended in cold SDW and the wash was repeated. Then the cells were
resuspended in 10 mL cold SDW containing filter sterilized cold 10% [v/v] glycerol
and centrifuged. This wash was also repeated. Finally the cells were re-suspended in
3-4 mL of filter sterilized cold 10% [v/v] glycerol, aliquoted in 1.5 mL
microcentrifuge tubes and stored at –80oC.
2.8 Plasmid isolation
Using a sterile tooth pick, a single bacterial colony from a plate was picked
and inoculated into 5 mL of LB broth with appropriate antibiotic selection in a sterile
52
culture tube. The tube was incubated overnight at 37oC with shaking. After about
sixteen hours the culture was decanted into a 1.5 mL microcentrifuge tube and
centrifuged at full speed for two minutes in a microfuge to harvest the cells. The
supernatant was discarded and the pellet was resuspended in 100 µL Resuspension
solution (50 mM Tris-HCl [pH 8.0], 10 mM EDTA, 100 ug/mL RNase A) by
vortexing. 200 µL Lysis solution (1% [w/v] SDS, 0.2 M NaOH) was added and mixed
gently. 200 µL Neutralization solution (3.0 M potassium acetate [pH 5.5]) was added,
mixed thoroughly and centrifuged at 16000×g for 10 minutes in a microfuge. The
supernatant was transferred to new microcentrifuge tube and two volumes chilled
absolute ethanol was added, mixed to precipitate the DNA and centrifuged for 10
minutes to pellet the DNA. The DNA pellet was washed with 70% ethanol, air dried
and dissolved in SDW.
For DNA sequencing, plasmids were isolated using a GeneJET Plasmid
Miniprep Kit (Fermentas). Overnight cultures of E. coli were transferred to 1.5 mL
microcentrifuge tubes, centrifuged for 2 minutes and the supernatant removed using a
pipette. This step was repeated 2-3 times to remove all the culture medium. The pellet
was resuspended in 250 µL Resuspension Solution. Cells were lysed with 250 µL
Lysis Solution, neutralized with 350 µL Neutralization Solution and the tube was
centrifuged at 16000×g for five minutes. A mini-column provided with the kit was
inserted into a collection tube and the supernatant was transferred to the column. The
column was centrifuged for one minute to bind the DNA to the matrix and the flow-
through in the collection tube was discarded. The matrix was washed twice with
500 µL Column Wash Solution and subsequently the column was centrifuged for one
minute in a dry tube to remove residual ethanol. Finally the column was inserted into
a fresh microcentrifuge tube and the DNA in the column was eluted in 50 µL SDW
and recovered by centrifugation.
2.9 Digestion of plasmid DNA
Digestion of plasmid preparations and PCR products was achieved using
enzymes and their corresponding buffers in accordance with the supplier’s
(Fermentas) guidelines. A total volume of 10 μL (containing 500 ng DNA, 3 units
restriction enzyme, buffer and SDW) was used when screening plasmid preparations
for insert size and 20 μL (2 µg DNA, 10 units restriction enzyme, buffer and SDW)
for digestions for cloning. Reaction mixtures were kept at optimum temperatures for
53
1-3 hour. Sizes of DNA fragments in digested product were determined on ethidium
bromide stained gel.
2.10 Agarose-gel electrophoresis
DNA was mixed with 5X loading dye and electrophoresed in 1% [w/v]
agarose gels containing ethidium bromide (0.5 μg/ mL). Gels were prepared in a
minigel apparatus (12 x 9 cm) or midigel apparatus (18 x 15 cm), containing either 1X
TBE (89 mM Tris, 89 mM boric acid, 2 mM EDTA) or 0.5X TAE (20 mM Tris-
acetate and 0.5 mM EDTA [pH 8.0]) buffer. TBE gels were electrophoresed at
approximately 40 volts and TAE gels at 100 volts. The ethidium-stained DNA was
viewed using a short wavelength ultraviolet (UV) transilluminator (Eagle Eye-
Stratagene) and fragment length estimated by comparison with a co-electrophoresed 1
kbp DNA ladder (Fermentas).
2.11 Preparation of glycerol stocks
To preserve bacterial cultures, glycerol stocks were prepared. In 1.5 mL
Eppendorf tubes 300 µL filter sterilised glycerol and 700 µL of cell culture was mixed
and stored at -80 ˚C freezer. To recover bacterial cultures from glycerol stocks, a
small amount of the culture was streaked using a sterile loop on culture plates with
solid growth media and suitable antibiotics and incubated at suitable temperatures.
2.12 Purification of DNA
2.12.1 Gel extraction and PCR product purification
The digested or PCR amplified DNA was run on a 1% agarose gel stained
with ethidium bromide and the desired fragments were excised from the gel using a
scalpel on a UV transilluminator. DNA from the gel was isolated using a Wizard SV
Gel and PCR Clean-Up System (Promega) as described by the manufacturer. The gel
slice was weighed and placed in a 1.5 mL microcentrifuge tube. 10 µL of Membrane
Binding Solution per 10 mg of gel slice was added, vortexed and incubated at 55-65
˚C until the gel slice was completely dissolved. For PCR product purification, an
equal volume of Membrane Binding Solution was mixed with the PCR reaction
mixture. Dissolved gel mixture/ PCR product mixture was transferred to a
Minicolumn assembly, incubated at room temperature for 1 minute and centrifuged at
54
16,000×g for 1 minute. The flowthrough was discarded and the Minicolumn was
reinserted into a Collection Tube. 700 µL of Membrane Wash Solution was added and
centrifuged at 16,000×g for 1 minute. The flowthrough was discarded and 500 µL
Membrane Wash Solution was added to the column. After 5 minutes of centrifugation
at 16,000×g the Collection Tube was emptied and the Minicolumn, with the empty
Collection Tube, was centrifuged for 1 minute with the microcentrifuge lid open to
allow evaporation of any residual ethanol. The Minicolumn was transferred to a clean
microcentrifuge tube, 50 µL SDW was added to the Minicolumn, incubated at room
temperature for 1 minute and centrifuged at 16,000×g for 1 minute. The Minicolumn
was discarded and the DNA solution was stored at -20 ˚C.
2.12.2 Phenol-chloroform extraction of DNA
To remove proteins from DNA solutions phenol:chloroform (1:1) extraction
was used. An equal volume of phenol:chloroform was mixed with the DNA solution
and vortexed until the mixture turned milky. The solution was centrifuged at
16,000×g for 10 minutes and the upper aqueous phase was transferred to a clean tube
without disturbing the interface between the two phases. 1/10 volume 3 M sodium
acetate (pH 5.4) and 2.5 volumes chilled absolute ethanol was mixed with the
supernatant and placed at -20 ˚C for one hour. To pellet the DNA, the tube was
centrifuged at maximum speed in a microfuge. DNA pellet was washed with 70%
ethanol, air dried and dissolved in SDW.
2.13 Agroinoculation
Clones in the binary vector pBin19 were electroporated into Agrobacterium
strain EHA105 whereas clones in pGreen0029 or PVX vector pGR107 were
electroporated to Agrobacterium strain GV3101. For agroinoculation to legumes
glycerol stocks of Agrobacterium strain EHA105 with required clones were streaked
on solid AB minimal medium plates containing 12.5 µg/mL rifampicin and 50 µg/mL
kanamycin and incubated at 28 ˚C for 48 hours. A single colony of bacteria was
picked with a sterile wire loop and inoculated into 50 mL AB minimal containing the
required antibiotics and placed in a shaker (160 rotations per minute) at 28 ˚C until
the O.D600 of the culture was 1. The cells were harvested by centrifugation at 3220×g
for 8 minutes and resuspended in AB minimal medium (pH 5.6) containing
acetosyringone (final concentration 100 µM). For surface sterilization, seeds of
55
legumes were first treated with 80% ethanol for 30 minutes, dipped in SDW for 30
minutes and finally treated with 10% bleaching agent for 2-3 minutes. Surface-
sterilized seeds of legumes were germinated on wet filter paper in Petri plates.
Hypocotyls of germinated seedlings were punctured three or four times with a G30
syringe needle, soaked in Agrobacterium inocula in a 50 mL flask and kept in the dark
at 25 ˚C overnight. Inoculated seedlings were washed twice with distilled water and
grown in pots containing silt and sand in equal amounts with a small amount of
compost. Plants were kept at 25 ˚C for ten days and later on moved to a growth
chamber at 30 to 35 ˚C with supplementary lighting to give a 16 hours photoperiod.
For agroinoculation to N. benthamiana and N. tabacum, plants at the 4 to 5
leaf stage were not watered for 24 hours before inoculation. The Agrobacterium
inoculum was infiltrated into fully expanded leaves using a 5 mL sterile syringe.
Plants were grown in a growth room at 25 ˚C with supplementary lighting to give a 16
hour photoperiod.
2.14 Plant growing conditions
All plants were grown in controlled conditions in growth rooms. Legumes
were grown at 30 ˚C with 16 hour dark period/8 hour light period and 65% humidity
in big earthen pots containing compost, silt and sand in 1:4:4 ratio. N. benthamiana
and N. tabacum were grown at 25 ˚C with 16 hours dark period/8 hours light period
and 65% humidity in small 5 inch diameter plastic pots containing clay, silt, sand and
compost in equal proportions. All plants were watered on daily basis and with
Hoagland solution (0.75 mM MgSO4.7H2O, 1.5 mM Ca(NO3)2.4H2O, 0.5 mM
KH2PO4, 1.25 mM KNO3, micronutrients [50 µM H3BO3, 15 µM MnCl2.4H2O, 2.0
µM ZnSO4.7H2O, 0.5 µM Na2MoO4.2H2O, 1.5 µM CuSO4.5H2O] and Fe-EDTA [30
µM FeSO4.7H2O, 1 mM KOH, 30 µM EDTA.2Na] once a week.
2.15 Southern blot analysis
A 1% agarose gel was loaded with DNA samples and run slowly, to
avoid smearing of DNA samples, until the bromophenol blue marker contained in the
loading buffer was near the bottom of the gel. The gel was treated with depurination
solution (0.25 M HCl) for 15 minutes, denaturation solution (1.5 M NaCl and 0.5 M
NaOH) for 30 minutes and neutralization solution (1 M Tris [pH7.4], 1.5 M NaCl) for
30 minutes. The gel was rinsed briefly with SDW in between treatments and agitated
56
gently on a platform shaker. DNA in the gel was transferred to a nylon membrane
(Hybond, Amersham) in 5X SSC (0.75 M NaCl and 75 mM sodium citrate) by
capillary action, using the apparatus illustrated in Fig. 2.1.
Fig. 2.1 Southern blot assembly for the capillary transfer of DNA from agarose gels to nylon
membranes. The gel is placed on a wick spread on a solid support. Both edges of wick are dipped in
transfer buffer (5X SSC) in a shallow dish. The nylon membrane (Hybond) is placed on the gel and
covered with Whatman 3MM paper. The transfer buffer is absorbed by paper towels.
DNA on the nylon membrane was crosslinked to the membrane in a UV
crosslinker (CL-1000 Ultraviolet Crosslinker-UVP) at 120 mJ/cm2 energy. The
membrane was then washed in a solution containing 0.1X SSC, 0.5% SDS at 65 ˚C
for 45 minutes to remove residual agarose. Before hybridization the membrane was
treated with 0.2 mL/cm2 pre-hybridization solution (6X SSC, 5X Denhardt’s solution
[0.1% {w/v} each of BSA, Ficol {mol. wt. 70,000} and PVP {mol. wt. 40,000}],
0.5% SDS, 50% [v/v] deionized formamide and 50 µg/mL denatured salmon sperm
DNA) at 42 ˚C for 2-4 hours in a hybridizer, to block non-specific binding sites. The
DNA probe was prepared using a Biotin DecaLabel DNA Labeling kit (Fermentas)
according to the manufacturer’s instructions. In a 1.5 mL microcentrifuge tube a
44 µL reaction mixture was prepared by adding 100 ng to 1 µg DNA template
57
(usually purified PCR product), 10 µL decanucleotide in 5X reaction buffer and
SDW. The reaction mixture was vortexed briefly, centrifuged 3-5 sec. and incubated
in a boiling water bath for 5-10 minutes. After heating, the tube was cooled on ice,
centrifuged and contents of the tube were mixed with 5 µL biotin labeling mixture
and 1 µL Klenow fragment exo- (5units). After shaking, the tube was centrifuged for
3-5 sec and incubated at 37 ˚C for 1 to 20 hours. The reaction was stopped by adding
1 µL 0.5 M EDTA (pH 8.0).
After 2-4 hours treatment of the membrane with pre-hybridization
solution in a hybridizer at 42 ˚C, the biotin-labeled probe was denatured at 100 ˚C for
5 minutes, chilled on ice and mixed with prehybridization solution (25-100 ng/mL).
The blot was then incubated overnight in the hybridizer at 42 ˚C. The following day
the membrane was washed two times with 2X SSC, 0.1% [w/v] SDS at room
temperature for 10 minutes and then two times with 0.1X SSC, 0.1% [w/v] SDS at 65
˚C for 20 minutes. To detect the biotin-labeled probe the membrane was washed in 30
mL Blocking/Washing Buffer (provided in Biotin Chromogenic Detection Kit by
Fermentas) at room temperature. After 5 minutes the membrane was treated with 30
mL Blocking Solution for 30 minutes to block non specific binding sites on the
membrane. Streptavidin-AP conjugate was diluted in 20 mL Blocking Solution (1:49
ratios) and the membrane was incubated in it for 30 minutes. The membrane was
washed twice in 60 mL Blocking/Washing buffer for 15 minutes and incubated with
20 mL Detection Buffer for 10 minutes. Finally the membrane was treated with 10
mL freshly prepared Substrate Solution at room temperature in the dark until a blue-
purple precipitate became visible. To stop the reaction the Substrate Solution was
discarded and the membrane was rinsed in SDW.
2.16 Sequencing and sequence analysis
Selected plasmid clones were purified using a GeneJET Plasmid Miniprep Kit
(Fermentas) and sent to Macrogen (South Korea) for sequencing with universal
primers (M13F [-20] and M13R [-20]). To extend the sequence specific primers were
designed (primer walking). The sequence data were assembled and analysed with the
aid of the Lasergene package of sequence analysis software (DNAStar Inc., Madison,
WI, USA). Sequence similarity searches (Blast) were performed by comparing the
sequence to other begomovirus/betasatellite sequences in the database
(http://www.ncbi.nlm.nih.gov/BLAST/). Open reading frames (ORFs) were located
58
using ORF Finder (http://www.ncbi.nlm.nih.gov/gorf/gorf.html). Final sequences
were submitted to the EMBL database (http://www.ebi.ac.uk/embl). Multiple
sequence alignments were performed using Clustal X (Thompson et al., 1997) and the
MegAlign program of Lasergene. Phylogenetic trees were constructed using the
Neighbour Joining algorithm of Clustal X and displayed, manipulated and printed
using Treeview (Page 1996). The recombination analysis was performed using the
recombination detection programme (RDP) version 3.34 (Martin and Rybicki, 2000).
2.17 Photography and computer graphics
A digital camera (Sony, DSC W50) was used to photograph plants. The
photographs were edited with Adobe Photoshop CS. The figures were produced using
CorelDRAW 13 (Corel Corp.).
59
Chapter 3
Begomoviruses of legumes in Pakistan
3.1 Introduction
Based on nucleotide sequence data of the genomic components of yellow
mosaic viruses, two distinct begomoviruses, Mungbean yellow mosaic India virus
(MYMIV; Mandal et al. 1997) and Mungbean yellow mosaic virus (MYMV;
Morinaga et al. 1993), are the major cause of yellow mosaic disease in legumes in
southern Asia. Some other less well characterized begomoviruses from legumes are
Dolichos yellow mosaic virus (DoYMV; Maruthi et al., 2005) from India, Soybean
crinkle leaf virus (SbCLV; Samretwanich et al., 2001) from Thailand, Cowpea golden
mosaic virus (CPGMV) from Nigeria, Horsegram yellow mosaic virus (HgYMV;
Muniyappa et al., 1987) from India, and Kudzu mosaic virus (KuMV; Ha et al., 2008)
from Vietnam. Most of the work published on LYMVs from India is based on
MYMIV and MYMV and data shows that both these viruses have distinct
geographical distributions. MYMIV is prevalent in northern and central regions
whereas MYMV is infecting legumes in southern and western regions (Usharani et
al., 2004).
Legumes, especially mungbean and blackgram, are grown on a large area in
summer and winter seasons in Pakistan and they are prone to severe attack of yellow
mosaic disease. However, there are not many published reports of DNA viruses of
legumes from Pakistan. Yellow mosaic disease was first reported in cowpea from
vicinity of Lyallpur (now known as Faisalabad; Vasudeva, 1942). Hameed et al.
(2004) reported, on the basis of sequence analysis, that MYMIV is the pathogen
infecting mungbean in Pakistan. In the same year Hussain et al. (2004) reported,
based on PCR, partial sequencing of the DNA-B and Southern hybridization, that
MYMIV is the causative agent of yellow mosaic disease in mungbean in Pakistan. In
2004 a complete nucleotide sequence of MYMV DNA-A was submitted to NCBI
database (accession no.AY269991) which was isolated from soybean. In 2006 Qazi et
al. reported that yellow mosaic disease of mothbean in Pakistan is caused by MYMIV
based upon NSP gene sequence.
All of the viruses reported from legumes in southern Asia are bipartite
begomoviruses with narrow host ranges and are believed to be genetically isolated
60
(Qazi et al., 2007). These viruses have host ranges limited to plants of the family
Fabaceae. Although there is ample evidence for genetic interaction between these
begomoviruses within the legumes, in the form of both classical recombination and
component exchange, there is little evidence for interaction with viruses that infect
other plants. This is indicative of genetic isolation, the viruses in legumes evolving
independently of the begomoviruses in plant species of other families.
The emergence of new viral diseases can cause considerable damages and it is
difficult to pinpoint the attributes responsible for the establishment and spread of
viruses. Ecological studies can provide good information about factors that are
important for the invasion of pathogens (Kolar and Lodge, 2001; Schrag and Wiener,
1995). However, involvement of genetic approaches in these studies is very less, even
though genetic variation may determine the success of invaders. For successful
emergence, viruses need to evolve rapidly to circumvent loss of genetic variation
normally associated with founder effects, and adapt to the novel environmental
conditions. Gene flow provided by recombination is frequently exploited by viruses to
increase their evolutionary potential and to achieve local adaptation (García- Arenal et
al., 2001; Michalakis and Roze, 2004; Moya et al., 2004; Roossinck, 1997).
Begomoviruses constitute a group of plant viruses that exploit gene flow by
recombination and a distinct form of recombination unique to multipartite viruses
known as pseudo-recombination (Chatchawankanphanich and Maxwell, 2002; Monci
et al., 2002; Padidam et al., 1999; Pita et al., 2001; Preiss and Jeske, 2003; Sanz et al.,
2000; Zhou et al., 1997). Therefore a continued study of genetic diversity of viruses is
necessary to plan future strategies for their control.
To study genetic diversity, a fundamental requirement in molecular biology is
the isolation and amplification of specific DNA sequences. Target sequences are
typically inserted into circular vectors, propagated in a biological host, and isolated by
physical methods (Sambrook et al., 1989). However, such methods are laborious,
costly, and not amenable to high-density formats. PCR is also used to amplify defined
sequences, but can introduce sequence errors and is limited to amplification of
relatively short DNA segments (Innis et al., 1990). In nature, the replication of
circular DNA molecules such as plasmids or viruses frequently occurs via a rolling
circle mechanism (Kornberg and Baker, 1992). As a laboratory method, linear rolling
circle amplification (RCA) (Fire and Xu, 1995; Liu et al., 1996; Lizardi et al., 1998)
is the prolonged extension of an oligonucleotide primer annealed to a circular
61
template DNA. A continuous sequence of tandem concatameric copies of the circle is
synthesized. Previously, RCA had been used to amplify small DNA circles
approximately 100 nt. in length. However, the rate for plasmid-sized targets is only
about 20 copies per hour, limiting the usefulness with plasmids or other circles larger
than 0.2 kb. Dean et al., 2001 described a technique called multiply-primed RCA that
uses the unique properties of φ29 DNA polymerase and random primers to achieve a
10,000-fold amplification. RCA has the advantage of not requiring a thermal cycling
instrument. A cascade of strand displacement reactions results in an exponential
amplification. φ29 DNA polymerase of the Bacillus subtilis bacteriophage (Blanco et
al., 1989; Dean et al., 2001) copies DNA with high fidelity (Esteban et al., 1993), has
a proofreading activity (Garmendia et al., 1992), and high processivity (Blanco et al.,
1989). For analysis of circular DNA viruses, rolling-circle amplification with φ29
DNA polymerase has a tremendous potential. In 2004, RCA was first applied to viral
genomes. Rector et al. (2004) showed that the papillomavirus genome, which is
composed of circular dsDNA, could be efficiently amplified from tissue samples
using this technique. At the same time, Inoue-Nagata et al. (2004) used this method
for cloning of geminiviruses. As specific primer sequences are not required for this
technique, many novel viruses have been discovered using the technique. In addition,
components like DNA-B can be amplified more easily than with common methods
used so far (Inoue-Nagata et al., 2004). Reaction products can also be used directly
for DNA sequencing after phosphatase treatment to inactivate unincorporated
nucleotides. Infectious clones which allow functional studies of the viral genome
sequences have been produced directly from RCA products, which are concatameric
(Ferreira et al., 2007).
No studies have been conducted to determine the diversity of legume-infecting
begomoviruses in Pakistan. To date only one sequence of a DNA-A component of
MYMV and six sequences of DNA-A components of MYMIV isolates are available
in the databases originating from Pakistan (Fauquet et al., 2008). No cognate DNA-B
component for these viruses originating from Pakistan has been obtained. A study of
the diversity of legume-infecting begomoviruses will thus be helpful in better
understanding the epidemiology of legume yellow mosaic disease and in developing
effective management practices, including the possibility of developing transgenic,
pathogen-derived resistance.
62
3.2 Methodology
To study begomoviruses of legumes and their diversity in Pakistan, leaves of
leguminous crops and weeds showing yellow mosaics were collected from different
areas of Pakistan in the years 2005 to 2008 (Fig.3.1). As there were earlier reports that
MYMIV is the causative agent of yellow mosaic disease in legume crops in Pakistan,
specific primers (Table 2.1) were used to amplify DNA-A and DNA-B components of
MYMIV from total genomic DNA of infected samples by PCR. Subsequently RCA
using φ29 DNA polymerase was employed to amplify circular DNA viruses. RCA has
the advantage, over PCR, that it amplifies all circular DNA molecules without the
selection that invariably occurs due to the primers that are used in PCR. Amplified
products were cloned, sequenced and analysed.
3.3 Results
Mungbean (Vigna radiata), blackgram (Vigna mungo), cowpea (Vigna
unguiculata) and soybean (Glycine max) with yellow mosaic disease (YMD; Fig 3.2a-
d) were sampled from Faisalabad, Narowal, Hyderabad, Nawabshah, Muzafargar,
Islambad, Mianwali, Bhakar, Layah and Multan districts in Pakistan (Fig. 3.1) and
used for amplification of DNA viruses. Amplified products of about 2.8 kb and 1.4 kb
were cloned and on the basis of restriction analyses 37 clones of ~2.8 kb and 2 clones
of ~1.4 kb sizes were selected for sequencing. The origins, features and database
accession numbers of the sequences obtained are listed in Table 3.1. The sequences
obtained were compared with sequences available in the NCBI database using
BLAST. Closely related sequences were downloaded and used for sequence
comparison in MegAlign by Clustal V method.
Out of 37 clones 19 had high levels of nucleotide sequence identity (between
93.8% and 99.5%) to the DNA-A component of isolates of MYMIV (Table 3.2)
whereas 17 clones had between 90.7% and 98.9% identity to DNA-B of isolates of
MYMIV (Table 3.3).The sequence of clone MI1 showed between 88.9% and 92.6%
nucleotide sequence identity to Pedilanthus leaf curl virus (PedLCV; a virus
sometimes referred to as Tomato leaf curl Pakistan virus). Two clones of ~1.4 kb in
size had 94% identity to Tobacco leaf curl betasatellite (TbLCB). Since the species
demarcation threshold for begomoviruses is 89% (Fauquet et al., 2008) and for
betasatellites is 78% (Briddon et al., 2008) the results indicate that all legume crops
from eleven districts were infected with MYMIV. Additionally one soybean sample
63
from Nawabshah (Province of Sind) infected with MYMIV was co-infected with
PedLCV and TbLCB. A further ten soybean samples, from different fields in two
districts in the Province of Sind were also checked for the presence of PedLCV and
TbLCB by PCR. For PedLCV specific diagnostic primers (Table 2.1) were designed
while universal primers (Briddon et al., 2002) were used to detect betasatellites. All
soybean samples from Nawabshah and Hyderabad were found to be co-infected with
PedLCV. However no betasatellite was amplified from any sample other than that
originating from Nawabshah. None of the other legume crop samples originating from
Punjab province were found to contain PedLCV, TbLCB or any other non-
leguminous geminivirus.
Fig. 3.1 Map of Pakistan showing areas where virus infected legumes were collected.
64
Fig. 3.2 Symptoms exhibited by field-collected legumes. Mungbean (a), blackgram (b) and cowpea (c)
infected with MYMIV collected from Multan, Narowal and Faisalabad respectively. Soybean (d) with
a multiple infection of MYMIV, PedLCV and TbLCB collected from Nawabshah, Rhynchosia capitata
(e) infected with MYMV and PaLCuV collected from Mianwali and Rhynchosia minima infected with
RhYMV collected from Lahore (f).
65
To identify possible alternate hosts of legume yellow mosaic viruses
(LYMVs), two leguminous weeds, Rhynchosia capitata (Fig.3.2e) and Rhynchosia
minima (Fig.3.2f), with yellow mosaics were examined for the presence of
begomoviruses. RCA amplified viral components of about 2.8 kb were cloned and
nine clones were selected for sequencing. Sequence analyses showed that one clone
(MI65) from Rhynchosia capitata had between 91.9% and 97.8% nucleotide sequence
identity to the DNA-A components of isolates of MYMV, whereas the highest level
of identity to the DNA-A components of other legume infecting viruses was 81.7%.
Based on the presently applicable species demarcation threshold (89%) for
distinguishing species from isolates, this indicates that MI65 is an isolate of MYMV.
Two further clones isolated from the same plant (MI66 and MI67) showed 58.9% to
87.5% identity to the DNA-B component of MYMV, but less than 63.0% to the
DNA-B components of other legume-infecting begomoviruses.
Clones MI68 and MI69 isolated from the same plant as clones MI65-MI67 had
between 88.3% and 93.8% identity to isolates of Papaya leaf curl virus (PaLCuV;
Table 3.2). PCR with specific diagnostic primers was used to check for the presence
of MYMV and PaLCuV in seven other R. capitata samples from same area. All
samples were positive for the presence of MYMV but no other sample was found to
contain PaLCuV.
Two clones (MI32 and MI33) obtained from Rhynchosia minima showed
between 67.8% and 69.5% nucleotide sequence identity to the DNA-A components of
isolates of MYMV but less than 69.1% identity to the DNA-A components of the
other LYMVs (Table 3.2). Two further clones from same sample (MI34 and MI35)
showed 49% to 49.6% identity to the DNA-B component of HgYMV but less than
49.5% identity to the DNA-B components of the other LYMVs (Table 3.3). Based on
the presently applicable threshold level for species demarcation of 89% nucleotide
sequence identity, this indicates that these clones represent a new species in genus
begomovirus. On the basis of the symptoms exhibited by the field-infected plants, the
virus was tentatively named Rhynchosia yellow mosaic virus (RhYMV). Open
reading frames (ORF) of each clone were identified using the ORF finder program on
the NCBI website. All ~2.8 kb size clones had typical patterns of ORFs for the DNA-
A and DNA-B components of begomoviruses and the ~1.4kb clone had multiple
ORFs but one, in the complementary-sense, typical of betasatellites. Sequences were
66
submitted to the databases and are available under the accession numbers given in
Table 3.1. This table also lists all features of each clone.
The study of the diversity of legume-infecting begomoviruses in Pakistan
identified three bipartite begomoviruses (MYMIV, MYMV, RhYMV), two
monopartite begomoviruses (PedLCV, PaLCuV) and one betasatellite (TbLCB). A
more detailed analysis of each is conducted in the following sections.
67
Table 3.1 List of the begomovirus clones obtained in this study and a summary of their features.
Virus Host/year/
locality
Coding sequences of genomic components▲ (coordinates/coding capacity (no. of amino acids)/predicted molecular weight (kDa)
DNA A DNA B
Accession no./
Clone name/
Size (nt.)
(A)V2 CP (A)C5 REn TrAP Rep (A)C4
Accession no./
Clone name/
Size (nt.)
NSP MP
MYMIV Mungbean/2005
/ Islamabad
FM208836/
A4*/ 2746
156-497/
113/ 13.09
316-1089/
257/ 29.99
984-733/
83/ 9.06
1490-1086/
134/ 15.57
1680-1228/
150/ 16.98
2626-1538/
362/ 41.42
2475-2176/
99/ 11.36
FM202440/
B13*/ 2670
415-1185/
256/ 29.2
2113-1217/
298/ 33.7
MYMIV Mungbean/2006
/ Islamabad
AM950268/
MI15/ 2746
156-497/
113/ 13.09
316-1089/
257/ 29.99
984-733/
83/ 9.18
1490-1086/
134/ 15.81
1680-1228/
150/17.0
2626-1538/
362/41.31
2475-2176/
99/11.4
AM992617/
MI21/ 2672
417-1187/
256/ 29.1
2115-1219/
298/ 33.7
MYMIV Mungbean/2008
/Multan
FM955600/
MI76/ 2746
156-497/
113/ 13.07
316-1089/
257/ 30.1
984-733/
83/ 9.16
1490-1086/
134/ 15.77
1680-1228/
150/ 17.19
2626-1538/
362/ 41.38
2475-2176/
99/ 11.45
FM955603/
MI71/ 2662
405-1175/
256/29.21
2103-1207/
298/ 33.8
MYMIV Mungbean/2008
/Multan - - - - - - - -
FM955605/
MI77/ 2663
406-1176/
256/29.29
2023-1208/
271/30.74
MYMIV Mungbean/2008
/Mianwali
FM955598/
MI75/ 2746
156-497/
113/ 13.17
316-1089/
257/ 29.93
984-733/
83/ 9.11
1490-1086/
134/ 15.58
1680-1228/
150/ 16.99
2626-1538/
362/ 41.42
2475-2176/
99/ 11.3
FM955606/
MI74/ 2671
415-1185/
256/29.22
2113-1217/
298/33.73
MYMIV Mungbean/2008
/Layah
FM955599/
MI72/ 2746
156-497/
113/ 13.11
316-1089/
257/ 29.99
984-733/
83/ 9.06
1490-1086/
134/15.79
1680-1228/
150/ 17.14
2626-1538/
362/ 41.49
2475-2176/
99/ 11.4
FM955604/
MI73/ 2662
406-1176/
256/29.14
2104-1208/
298/33.78
MYMIV Mungbean/2005
/ Faisalabad
FM208838/
A6G*/ 2751
161-502/
113/ 13.09
321-1094/
257/ 29.92
989-738/
83/ 9.12
1495-1091/
134/ 15.6
1685-1233/
150/ 17.0
2631-1543/
362/ 41.30
2480-2181/
99/11.4 - - -
MYMIV Mungbean/2005
/ Faisalabad
FM208837/
A6*/ 2746
156-497/
113/13.1
316-1089/
257/ 29.9
984-733/
83/ 9.1
1490-1086/
134/ 15.6
1680-1228/
150/17.02
2626-1538/
362/41.44
2475-2176/
99/11.3
FM202439/
B4*/ 2670
415-1185/
256/ 29.2
2113-1217/
298/ 33.7
MYMIV Mungbean/2006
/Muzafargarh
FM208839/
A14*/ 2746
156-497/
113/13.1
316-1089/
257/ 29.90
984-733/
83/ 9.07
1490-1086/
134/ 15.6
1680-1226/
150/17.0
2626-1538/
362/41.31
2475-2176/
99/ 11.4
FM958506/
MI30/ 2660
404-1174/
256/29.2
2102-1206/
298/33.7
MYMIV Mungbean/2006
Narowal
FM208843/
MI7/2747
157-498/
113/13.08
317-1090/
257/30.0ǁ
985-734/
83/ 9.21
1491-1087/
134/ 15.8
1681-1229/
150/17.0
2627-1539/
362/41.27
2476-2177/
99/11.4
FM202442/
MI5/ 2672
417-1187/
256/ 29.2
2115-1219/
298/ 33.7
MYMIV Mungbean/2006
/ Narowal - - - - - - - -
FM202443/
MI6/ 2672
417-1187/
256/ 29.2
2115-1219/
298/ 33.7
MYMIV Mungbean/2006
/ Narowal - - - - - - -
FM955609/
MI10/ 2672
417-1187/
256/29.17
2115-1219/
298/33.7◊
MYMIV Mungbean/2006
/ Narowal
FM208846/
MI2/ 2746
156-497/
113/13.09
316-1089/
257/ 30.09
984-733/
83/ 9.2
1490-1086/
134/ 15.8
1680-1228/
150/17.0
2626-1538/
362/41.17
2475-2176/
99/11.4
FM202441/
MI3/ 2674
418-1140/
240/ 27.3
2117-1221/
298/ 33.8
MYMIV Mungbean/2006
/ Narowal
FM208842/
MI9/ 2749
156-497/
113/13.06
316-1089/
257/29.9¶
984-733/
83/9.1¶
1490-1086/
134/ 15.8
1681-1229/
150/17.0
2627-1539/
362/41.30
2476-2177/
99/11.4
FM202444/
MI8/ 2660
405-1175/
256/ 29.3
2103-1207/
298/ 33.7
MYMIV Soybean/2006/
Hyderabad
FM208833/
A1*/ 2746
156-497/
113/13.19
316-1089/
257/29.82
984-733/
83/ 9.1
1490-1086/
134/15.8
1680-1228/
150/17.07
2626-1538/
362/41.47
2475-2176/
99/11.34 - - -
MYMIV Soybean/2006/
Hyderabad
FM208834/
A1E*/ 2746
156-497/
113/13.19
316-1089/
257/29.83
984-733/
83/ 9.1
1490-1086/
134/ 15.8
1680-1228/
150/17.1
2626-1538/
362/41.47
2475-2176/
99/11.3 - - -
67
68
Virus Host /year/
locality
Coding sequences of genomic components▲ (coordinates/coding capacity (no. of amino acids)/predicted molecular weight (kDa)
DNA A DNA B
Accession no./
Clone name/
Size (nt.)
(A)V2 CP (A)C5 REn TrAP Rep (A)C4
Accession no./
Clone name/
Size (nt.)
NSP MP
MYMIV Soybean/2006/
Nawabshah
AM992618/
MI18/ 2746
156-497/
113/13.08
316-1089/
257/29.98
984-733/
83/ 9.07
1490-1086/
134/ 15.8
1680-1228/
150/17.1
2626-1538/
362/41.25
2475-2176/
99/11.5
FM161881/
MI17/ 2674
417-1187/
256/ 29.2
2115-1219/
298/ 33.8
MYMIV Soybean/2006/
Nawabshah - - - - - - - -
FM202445/
MI16/ 2674
417-1187/
256/ 29.2
2115-1219/
298/ 33.8
MYMIV Cowpea/2005/
Faisalabad
FM208840/
A17*/ 2746
156-497/
113/13.14
316-1089/
257/29.92
984-733/
83/ 9.12
1490-1086/
134/ 15.6
1680-1228/
150/ 17.0
2626-1538/
362/ 41.44
2475-2176/
99/ 11.3
FM202446/
B3*/ 2660
404-1174/
256/ 29.2
2102-1206/
298/ 33.7
MYMIV Blackgram/
2006/Islamabad
FM208844/
MI12/ 2746
156-497/
113/13.12
316-1089/
257/30.0
984-733/
83/9.15
1490-1086/
134/15.8§
1680-1228/
150/17.1
2626-1538/
362/41.24
2475-2176/
99/11.4
FM202447/
MI20/ 2672
417-1187/
256/ 29.1
2115-1219/
298/ 33.7
MYMIV Blackgram/
2006/Islamabad
FM208845/
MI13/ 2745
156-497/
113/ 13.12
316-1089/
257/ 30.05
984-733/
83/ 9.15
1490-1086/
134/ 15.8
1680-1228/
150/ 17.0
2626-1538/
362/41.2 ‡
2474-2175/
99/11.5 - - -
MYMIV Blackgram/
2005/Faisalabad
FM208835/
A2*/ 2751
161-502/
113/ 13.09
321-1094/
257/ 29.92
989-738/
83/ 9.12
1495-1091/
134/ 15.6
1685-1233/
150/ 17.0
2631-1543/
362/ 41.31
2480-2337/
47/5.3 - - -
MYMIV Blackgram/
2006/ Narowal
FM208841/
A20*/ 2746
156-497/
113/13.07
316-1089/
257/29.9Δ
984-544/
146/16.1
1490-1086/
134/ 15.6
1680-1228/
150/17.0
2626-1538/
362/ 41.47
2475-2314/
53/5.8 - - -
RhYMV
Rhynchosia
minima/2007/
Lahore
AM999981/
MI33/ 2740
145-513/
122/ 13.75
305-1078/
257/ 29.9
973-557/
138/ 15.76
1482-1075/
135/ 15.46
1636-1223/
137/ 15.73
2624-1530/
364/ 41.31
2467-2174/
97/ 11.18
AM999982/
MI35/ 2639
415-1182/
255/ 8.83
2121-1225/
298/33.73
RhYMV
Rhynchosia
minima/2007/
Lahore
FM208847/
MI32/ 2741
185-514/
109/ 12.14
306-1079/
257/ 29.9
974-558/
138/ 15.76
1483-1076/
135/ 15.47
1637-1224/
137/ 15.73
2625-1531/
364/ 41.32
2468-2175/
97/11.18
FM208848/
MI34/ 2643
415-1182/
255/28.83
2121-1225/
298/33.71
MYMV
Rhynchosia
capitata/2007/
Mianwali
FM242701/
MI65/ 2737
148-498/
116/ 13.58
308-1081/
257/ 29.78 -
1482-1078/
134/15.62
1630-1220/
136/15.42
2618-1530/
362/ 40.88
2467-2168/
99/11.45
FM242702/
MI66/ 2676
421-1191/
256/ 29.0
2113-1217/
298/ 33.7
MYMV
Rhynchosia
capitata/2007/
Mianwali
- - - - - - - - FM955607/
MI67/ 2676
421-1191/
256/28.97
2113-1217/
298/33.7
PedLCV Soybean/2006/
Nawabshah
AM948961/
MI1/ 2760
149-505/
118/ 13.74
309-1079/
256/ 29.7
974-723/
83/9.46
1480-1076/
134/15.68
1625-1221/
134/15.16
2613-1528/
361/40.57
2462-2166/
98/10.89 - - -
PaLCuV
Rhynchosia
capitata/2007
Mianwali
FM955602/
MI68/ 2756
148-504/
118/ 13.73
308-1078/
256/ 29.7
973-722/
83/ 9.46
1479-1075/
134/15.6†
1624-1220/
134/15.1†
2612-1527/
361/40.4†
2584-2198/
128/14.3†
- - -
PaLCuV
Rhynchosia
capitata/2007/
Mianwali
FM955601/
MI69/ 2754
148-504/
118/ 13.75
308-1078/
256/ 29.68
973-722/
83/ 9.46
1479-1075/
134/ 15.68
1624-1220/
134/ 15.16
2612-1527/
361/ 40.43
2584-2198/
128/ 14.31 - - -
68
Table 3.1 continued
69
Footnote to Table 1.
* These clones were obtained by PCR. All other clones were obtained by RCA.
▲For clones with mutations of genes, the data given in the table is for a corrected sequence.
† Insertion of a G at position 1272 and A at position 2395 leading to a truncation of the TrAP and
REn genes, as well as a frame-shift fusing the N-terminal sequences of C4 with Rep.
‡ Truncation of the Rep gene due to deletion of C at position 2052 leading to a frame-shift and
premature stop codon at position 2017.
§ Truncation of the REn gene due to a transition (T to C in the virion-strand) at position 1428 leading
to a premature stop codon.
ǁ Truncation of the CP gene due to a transition (G to A) at position 469 leading to a premature stop
codon.
¶ Truncation of the CP gene due to insertion of a T at position 927 leading to a frame-shift and
premature stop codon at position 934. This also introduces a premature stop codon in the AC5 gene.
Δ Truncation of the CP gene due to a transition (G to A) at position 450 leading to a premature stop
codon.
◊ Truncation of the MP gene due to a transition (G to A) at position 1857 leading to a premature stop
codon.
70
Table 3.2 Percent nucleotide sequence identity for pair wise sequence comparisons of the sequences of the genomes (or DNA-A components) of viruses isolated in this
study and selected sequences from the databases.
MI76 A1 A1E A2 A4 A6 A6G A14 A17 A20 MI2 MI7 MI9 MI12 MI13 MI15 MI18 MI72 MI75 MI65 MI32 MI33 MI1 MI68 MI69 MYMIV MYMV KuMV HgYMV DoYMV CPGMV SbLCV PaLCuV PedLCV PepLCBDV (20)
* (10)
* (2)
* (5)
* (2)
* (2)
* (2)
*
*** 96.8 96.8 95.4 96.3 96.4 95.4 96.1 96.3 96.0 95.8 95.6 95.3 95.7 95.5 95.8 96.3 98.7 96.4 78.6 68.4 68.5 56.2 53.8 54.3 94.0-96.5 76.5-78.6 63.6 77.5 54.9-55.3 52.3 57.2 53.6-53.8 56.4 52.0-52.7 MI76
*** 100 96.1 97.5 97.5 96.0 97.1 97.5 97.3 95.7 95.6 95.3 95.8 95.6 95.8 97.3 97.3 97.5 79.4 68.1 68.2 56.3 54.0 54.4 94.3-97.7 77.3-79.2 63.7 77.6 55.0-55.2 52.6 57.0 53.9-54.2 56.6 52.3-53.1 A1
*** 96.1 97.5 97.5 96.0 97.0 97.5 97.2 95.7 95.5 95.3 95.7 95.5 95.8 97.3 97.2 97.5 79.4 68.1 68.2 56.2 54.0 54.4 94.3-97.6 77.3-79.2 63.6 77.6 54.9-55.2 52.6 57.6 53.8-53.9 56.5 52.3-53.1 A1E
*** 97.7 97.4 99.8 98.1 97.8 97.4 96.5 96.3 96.0 96.5 96.2 96.0 96.9 95.8 97.4 78.6 67.9 68.5 55.9 54.2 54.3 94.2-99.1 76.8-78.4 63.9 77.6 55.4-55.4 52.9 57.0 53.6-53.9 56.2 52.3-52.7 A2
*** 99.2 97.6 98.9 99.1 98.8 96.0 95.9 95.6 96.0 95.8 96.1 96.7 96.8 98.9 79.0 68.2 68.2 56.3 54.0 54.5 94.4-99.5 76.8-78.8 63.7 77.7 55.8-56.3 53.0 57.0 53.8-53.9 56.6 52.3-52.9 A4
*** 97.3 98.6 99.1 98.7 95.9 95.7 95.6 95.9 95.7 96.1 96.6 96.7 98.9 78.9 68.2 68.4 56.2 54.1 54.2 94.2-99.2 76.7-78.7 63.6 77.6 55.2-55.9 53.0 56.9 54.0 56.4 52.6-53.1 A6
*** 98.0 97.7 97.3 96.4 96.2 95.9 96.4 96.2 95.9 96.9 95.7 97.3 78.4 67.9 68.5 55.8 54.1 54.3 93.9-99.0 76.7-78.6 63.9 77.6 55.0-55.4 53.0 57.1 53.6-53.9 56.1-56.2 52.3-52.6 A6G
*** 98.6 98.4 96.4 96.3 96.0 96.4 96.2 96.1 97.3 96.5 98.5 79.0 67.9 68.0 56.4 54.3 54.7 94.1-99.0 77.0-78.8 63.5 77.7 55.5-56.0 52.9 57.5 54.1-54.2 56.6-56.8 52.4-53.1 A14
*** 98.9 96.0 95.8 95.6 96.0 95.7 96.1 96.7 96.7 99.0 78.8 68.1 68.2 56.2 54.0 54.2 94.2-99.2 76.7-78.7 63.4 77.5 55.5-55.9 53.0 56.8 53.9-54.1 56.4-56.5 52.4-53.0 A17
*** 95.5 95.4 95.1 95.5 95.3 95.7 96.4 96.4 98.7 78.5 67.7 67.8 55.7 53.6 53.8 93.8-98.8 76.7-78.4 63.2 77.4 55.3-55.8 53.0 56.6 53.5-54.0 56.0-56.2 52.1-52.8 A20
*** 99.3 99.0 99.5 99.2 98.3 96.6 96.1 95.8 79.0 68.6 68.8 56.7 54.2 54.4 94.3-99.5 77.2-78.9 63.9 78.6 55.1-55.6 53.3 57.9 53.9-54.3 56.6-56.9 52.5-53.1 MI2
*** 98.8 99.2 99.0 98.1 96.5 95.9 95.7 78.9 68.8 69.0 56.8 54.4 54.6 94.0-99.3 77.4-79.1 64.0 78.6 55.1-55.5 53.3 58.0 54.2-54.5 57.0-57.2 52.6-53.2 MI7
*** 98.9 98.7 97.7 96.2 95.6 95.4 78.6 68.7 68.9 56.5 54.2 54.7 93.8-99.1 76.9-78.7 63.6 78.6 55.3-55.6 53.3 57.9 54.0-54.6 56.6-56.9 52.4-52.8 MI9
*** 99.5 98.4 96.6 96.0 95.8 78.8 68.8 68.9 56.6 54.2 54.4 94.2-99.4 77.0-78.9 63.8 78.6 54.9-55.4 53.2 58.1 53.8-54.3 56.7-56.9 52.3-53.0 MI12
*** 98.2 96.4 95.8 95.6 78.2 68.6 68.8 56.2 54.3 54.5 94.5-99.2 77.0-78.3 63.8 78.5 54.7-55.2 51.9 57.5 53.9-54.3 56.6-56.7 52.4-52.9 MI13
*** 96.2 96.0 95.9 78.8 69.1 69.2 56.6 54.1 54.6 94.4-99.3 77.2-79.2 63.5 78.7 55.1-55.4 52.9 57.4 53.7-54.0 56.8-57.0 52.4-53.2 MI15
*** 96.7 96.6 78.8 68.3 68.4 56.9 54.6 54.9 94.8-97.5 76.9-78.7 64.0 77.7 54.9-55.4 52.9 57.5 54.1-54.6 57.0-57.2 52.5-53.2 MI18
*** 96.7 78.8 68.4 68.6 56.9 54.4 54.7 94.3-96.9 76.6-78.6 63.5 77.8 54.7-55.1 52.5 56.9 54.3-54.4 56.8-57.0 52.7-53.4 MI72
*** 78.9 68.4 68.6 56.2 54.0 54.2 94.1-99.0 76.8-78.8 63.5 77.7 55.4-55.8 53.1 57.2 53.9-54.3 56.3-56.4 52.3-52.9 MI75
*** 68.8 69.2 56.3 54.3 54.6 76.9-79.1 91.9-97.8 64.5 81.7 55.5-56.3 52.3 58.1 53.6-54.5 56.4-57.1 53.1-54.2 MI65
*** 99.8 58.4 56.3 56.4 66.7-69.0 67.8-69.1 64.6 68.1 56.6-57.4 51.2 59.2 55.2-55.4 58.0-58.8 54.5-56.1 MI32
*** 58.4 56.5 56.5 66.9-69.1 68.0-69.5 64.8 68.7 56.8-57.6 52.8 59.3 55.3-55.5 58.7-58.8 54.6-56.3 MI33
*** 88.7 87.5 55.2-57.0 55.7-57.1 57.7 56.7 48.8-54.3 57.3 72.8 79.4-84.9 88.9-92.6 77.0-78.8 MI1
*** 99.5 52.9-54.5 53.8-54.9 55.3 54.1 51.2-56.1 54.9 67.7 88.3-92.8 82.0-84.7 83.8-85.7 MI68
*** 53.3-54.8 54.3-55.3 55.8 54.0 50.9-56.4 55.6 68.1 88.7-93.2 82.5-83.8 84.1-86.1 MI69
*** 76.0-76.9 62.1 76.3 53.2-53.7 51.0 56.2 52.7-53.0 55.6-57.2 51.2-53.8 MYMIV (20)*
*** 63.1 76.9 54.6-54.9 52.6 57.6 53.2-53.4 55.9-57.5 52.6-55.8 MYMV (10)*
*** 78.2 55.0-55.4 53.4 57.4 53.6-53.8 56.9 54-54.8 KuMV
*** 55.8-56.3 53.1 57.1 53.9-54.0 57.2-57.3 53.8-55.5 HgYMV (2)*
*** 52.9 57.7 53.9-54.2 53.2-54.4 53.0-55.5 DoYMV (5)*
*** 58.3 54.1-54.6 57.4-58.0 55.3-55.8 CPGMV
*** 53.5-53.8 72.5-72.8 67.4-67.8 SbLCV
*** 78.7-82.5 83.0-85.1 PaLCuV (2)*
*** 76.8-78.3 PedLCV (2)*
*** PepLCBDV (2)*
71
*Figures in brackets indicate the numbers of isolates that were compared. Species for which more than one sequence was available the highest and lowest percentage identity is shown.
Table 3.3 Percent nucleotide sequence identity for pair wise sequence comparisons of the sequences of DNA-B component of viruses isolated in this study and selected
sequences from the databases.
MI77 B3 B4 B13 MI3 MI5 MI6 MI8 MI10 MI16 MI17 MI20 MI21 MI30 MI71 MI73 MI74 MI66 MI67 MI34 MI35 MYMIV MYMV KuMV HgYMV
(9)* (11)* (2)*
*** 93.1 91.7 91.7 91.6 91.9 91.9 92.3 91.8 95.0 94.8 91.6 91.9 93.3 98.1 98.6 92.3 62.0 61.8 47.0 47.3 78.1-93.1 59.7-83.9 44.8 59.7 MI77
*** 96.2 96.4 91.5 92.0 92.1 92.4 91.9 94.1 93.8 91.8 92.3 97.9 93.2 93.8 96.5 63.3 63.2 48.4 48.0 87.4-96.4 59.6-86.3 45.6 57.1 B3
*** 98.2 92.2 92.8 92.8 91.7 92.6 94.3 94.2 92.5 92.8 96.3 91.8 92.4 97.6 62.2 62.1 48.2 48.3 84.6-98.2 58.8-86.8 44.5 57.9 B4
*** 92.7 93.3 93.2 92.2 93.1 94.5 94.2 93.0 93.3 96.6 91.9 92.4 97.6 62.5 62.4 48.2 48.4 84.6-98.9 59.3-87.3 45.8 58.4 B13
*** 97.8 97.7 95.2 97.6 93.2 93.0 97.4 97.9 91.8 91.7 92.1 91.8 59.6 59.6 47.3 48.6 87.6-94.6 58.8-86.6 43.6 55.6 MI3
*** 99.6 96.3 99.5 93.8 93.5 98.5 98.9 92.5 91.8 92.2 92.4 61.3 61.3 47.6 47.2 84.2-95.1 59.1-86.5 45.0 58.6 MI5
*** 96.4 99.4 93.8 93.6 98.5 98.8 92.5 91.8 92.2 92.4 61.4 61.4 47.6 47.2 84.1-95.1 59.1-86.6 45.5 58.6 MI6
*** 96.2 92.6 92.1 96.0 96.5 92.9 92.4 92.8 91.5 63.2 62.0 47.0 46.7 86.5-93.8 60.3-85.5 44.4 58.1 MI8
*** 93.6 93.3 98.3 98.8 92.4 91.7 92.1 92.2 61.2 61.2 47.7 47.3 84.2-95.1 58.9-86.4 45.3 58.6 MI10
*** 98.2 93.3 94.0 94.1 95.2 95.6 94.8 62.4 62.3 47.3 47.1 84.3-95.0 59.4-87.4 44.8 57.6 MI16
*** 93.0 93.6 94.0 94.9 95.5 94.4 62.1 62.0 47.7 48.0 84.3-94.7 59.4-87.2 45.2 57.7 MI17
*** 98.6 92.2 91.7 92.1 92.3 61.3 61.3 47.7 47.3 83.9-95.0 59.3-86.8 45.7 58.3 MI20
*** 92.5 92.0 92.4 92.4 61.4 61.4 47.9 47.2 84.3-95.5 59.3-86.8 45.0 58.6 MI21
*** 93.4 93.9 96.6 63.3 63.2 48.9 47.7 87.6-96.6 59.7-86.4 45.9 59.7 MI30
*** 98.8 92.4 62.0 62.0 46.7 46.8 78.2-93.2 58.4-83.7 45.0 59.8 MI71
*** 92.9 62.2 63.7 47.0 47.1 84.2-93.7 60.2-84.6 45.3 59.9 MI73
*** 62.6 62.5 49.0 48.3 84.6-97.5 59.0-86.8 46.1 59.4 MI74
*** 99.9 47.0 46.1 57.1-63.0 58.4-87.5 46.1 60.4 MI66
*** 47.1 46.2 57.0-63.0 58.5-87.5 46.1 60.4 MI67
*** 97.0 47.1-49.2 45.3-49.4 48.4 49.6 MI34
*** 47.1-49.5 46.3-48.7 48.6 49.0 MI35
*** 54.0-90.9 43.9-46.0 55.1-60.2 MYMIV (9)*
*** 44.3-46.3 56.7-94.2 MYMV (11)*
*** 45.0 KuMV
*** HgYMV (2)*
*Figures in brackets indicate the numbers of isolates that were compared. Species for which more than one sequence was available the highest and lowest percentage identity is shown.
72
3.3.1 Mungbean yellow mosaic India virus
The genomic components of the MYMIV isolates cloned in this study range in
size from 2745 to 2751 nucleotides and 2660 to 2674 nucleotides for the DNA-A and
DNA-B, respectively. Like all other legume-infecting begomoviruses, MYMIV encodes
seven genes from DNA-A and two genes from DNA-B. A comparison of the nucleotide
sequences and predicted amino acid sequences of all encoded genes/proteins of MYMIV
showed that isolates from Pakistan have more conserved gene/protein sequences than
those of isolates from rest of the world. The Rep of geminiviruses contains conserved
motifs (Motif 1, Motif 2 and Motif 3) in the cleavage/ligation domain, Helix 1 and Helix
2 essential for DNA binding and cleavage (Orozco and Hanley-Bowdoin, 1998), Helix 4
involved in binding of Rep with pRBR and an oligomerization domain (Arguello-Astorga
et al., 2004). Similarly Zinc finger domains of the TrAP (Ruiz-Medrano et al., 1999) and
CP (Kirthi and Savithri, 2003) are involved in binding of these proteins to DNA. These
features were identified in the MYMIV isolates characterised here (results not shown).
Alignments of the intergenic region (IR) sequences of the DNA-A and DNA-B
components of the MYMIV isolates obtained here showed that the CR, the sequence
conserved between the DNA-A and DNA-B components, is approx. 126 nucleotides in
length and shows between 81 and 84.1% nucleotide sequence identity. The CR contains
the origin of replication, which consists of a conserved hairpin structure with the
nonanucleotide (TAATATTAC), a binding site for Rep (Argüello-Astorga et al., 1999)
consisting of five imperfect repeats of the motif (iterons) GGTGTA/C (four on the virion-
strand and one on the complementary-strand) and a TATA box that forms part of the Rep
promoter (Fig. 3.3).
An alignment of the predicted N-terminal amino acid sequences of the Rep
proteins of MYMIV isolates characterised here is shown in Fig. 3.4. This shows the
predicted iteron related domain (IRD; Argüello-Astorga et al., 2004), in common with
isolates of this species from the databases to be MPREGRFAIN. It is noticeable that,
although the IRD is highly conserved, sequences immediately downstream of the IRD
show considerable variability, adding weight to the idea that these sequences are
important. For none of the LYMVs have the predicted IRD or iteron sequences been
confirmed experimentally. All DNA-A isolated in this study had between 95.1% and
73
100% sequence identity among themselves and between 93.8% and 99.5% sequence
identity to MYMIV DNA-A sequences available in database (Table 3.2) whereas all
MYMIV DNA-B component sequences from this study had between 91.5% and 99.6%
sequence identity among themselves and between 90.7% and 98.9% to MYMIV DNA-B
sequences available in database (Table 3.3). However one DNA-B associated with
MYMIV, MYMIV-[IN:Ana:CpMBKA25:05](AY937196), was quite distinct and showed
a relatively low level of nucleotide sequence identity (83.8%-87.6%) with the other
DNA-B components of this species. Analysis of the aligned sequences of all MYMIV
DNA-A components for the presence of recombination using RDP identified some
intraspecific recombination events in the Rep, AV2 and CP regions of some isolates.
Although some potentially recombinant sequences were recognized for which no donor
parent could be identified, this could not be conclusively attributed to interspecific
recombination (results not shown).
A phylogenetic analysis based on an alignment of the DNA-A components of
MYMIV (Table 3.1) isolated in this study with DNA-A component (or the genome)
sequences of all legume-infecting begomoviruses from the Old World available in the
databases showed that these grouped with MYMIV sequences from India, Nepal and
Pakistan. The MYMIV DNA-As segregated into three groups, one small group (group
III) with three sequences and two large groups (group I and II). Sequences from Pakistan
were distributed between groups I and II (Fig. 3.5) and their segregation was associated
with their geographical origin. Isolates in group I (MI2, MI7, MI9, MI12, MI13, MI15)
originated from the north and north-eastern parts of the country (Islamabad, Narowal)
whereas isolates in group II (A1, A1E, A2, A4, A6, A6G, A14, A17, A20, MI18, MI72,
MI75, MI76) were distributed throughout the country (Multan, Layah, Nawabshah,
Hyderabad, Muzafargar, Faisalabad, Mianwali, Islamabad, Narowal; Fig. 3.5). Group I
also included sequences from Nepal and India (Srinagar, Jabalpur and New Delhi) and
group II also included sequences from India (Kanpur, Varanasi, New Delhi, Punjab).
Group III included one sequence from Bangladesh and two sequences from India.
A phylogenetic analysis based upon an alignment of the complete nucleotide
sequences DNA-B (Fig 3.6) components of MYMIV isolates from Pakistan with DNA-B
sequences available in databases gave results similar to that obtained with DNA-A. All
74
available sequences of DNA-B were distributed into one small group (group III; with one
sequence only) and two large groups (groups I and II). Group I contained sequences from
Islamabad (MI20, MI21) and Narowal (MI3, MI5, MI6, MI8, MI10) along with
sequences from India (Jabalpur and Akola). In group II sequences from Multan (MI71,
MI77), Layah (MI73), Nawabshah (MI16, MI17), Faisalabad (B3, B4), Muzafargar
(MI30), Mianwali (MI74) and Islamabad (B13) were distributed with sequences from
India (New Delhi, Srinagar and Varanasi). Group III included only a single sequence and
that was from India. Just like DNA-A, DNA-B sequences from Pakistan also had distinct
geographical distributions. Sequences in group I originated from the north and north-east
of the country, whereas sequences in group II were distributed throughout the country.
Phylogenetic analyses based on alignments of nucleotide and protein sequences of all
genes produced trees with essentially the same topology as that produced by the full-
length DNA-A and DNA-B sequences (results not shown).
Comparisons of the MYMIV sequences showed that for the most part the DNA-A
components in group I associated with DNA-B components of group I whereas group II
DNA-A components associated with group II DNA-B components. However, in a few
cases, group I DNA-A sequences associated with group II DNA-B sequences. No
instances of group II DNA-A sequences associating with group I DNA-B sequences were
detected. The geographic origin and their component groupings are indicated in Figure
3.7. It is evident that the A2/B2 class predominates across Pakistan whereas A1/B1
occurs in the north of the country. Both cases of A1/B2 occur in India (the DNA-A
components of MYMIV-[IN:ND:Sb2:99](AY049772) and MYMIV-
[IN:Sri:Mg1:96](AF416742) belong to group I but associate with DNA-B components
belonging to group II).
75
76
Fig. 3.3 Alignment of the intergenic regions of the DNA-A and DNA-B components of the MYMIV
isolates characterised in the present study and an isolate from the database (MYMIV-[IN:ND:Bg3:91]
DNA-A accession no. AF126406, DNA-B accession no. AF142440). Gaps (-) were introduced into the
sequences to optimise the alignment. Sequences conserved between the majority are surrounded by a black
box. Part of the alignment that does not form part of the common region (CR) is shaded grey. The positions
of the stem-loop structure (the two legs of which are highlighted in light green), which contains the loop
that includes the nonanucleotide sequence (TAATATTAC; highlighted in dark green), the TATA box of
the Rep promoter (highlighted in red) and the predicted iterons (indicated as F1, F2, F3 and F4 for the
virion-sense and R1 for the complementary-sense; highlighted in blue) are indicated. The nucleotide
coordinates for each sequence are indicated on the right.
Fig. 3.4 Alignment of the N-terminal amino acid sequences of the Rep proteins of MYMIV isolates
obtained in this study. The position of the predicted iteron related domain is highlighted in blue. The
sequence of MYMIV-[IN:ND:Bg3:91] (AF126406) is shown for comparison. Sequences conserved
between the isolates are boxed.
77
78
Fig. 3.5 Phylogenetic dendrogram (left) based upon an alignment of the complete nucleotide sequences of
the DNA-A components of legume-infecting begomoviruses from the Old World. Vertical branches are
arbitrary, horizontal branches are proportional to calculated mutation distances. Values at nodes indicate
percentage bootstrap values (1000 replicates). Begomovirus species used for comparison were Mungbean
yellow mosaic virus (MYMV), Mungbean yellow mosaic India virus (MYMIV), Dolichos yellow mosaic
virus (DoYMV), Horsegram yellow mosaic virus (HgYMV), Kudzu mosaic virus (KuMV), Cowpea golden
mosaic virus (CPGMV) and Soybean leaf crinkle virus (SbCLV). This tree was arbitrarily rooted on the
sequence of the DNA-A component of Tomato leaf curl New Delhi virus (ToLCNDV). The virus acronyms
used are as described in Fauquet et al. (2008). The database accession numbers are indicated and the
sequences produced as part of this study are highlighted. The groups of sequences labelled I, II and III are
discussed in the text. The distribution of all MYMIV isolates is shown on a map of southern Asia (right).
MYMIV isolates in each of the three phylogenetic groups are indicated on the map by coloured circles.
79
80
Fig. 3.6 Phylogenetic dendrograms (left) based upon complete nucleotide sequences of DNA-B of legume-
infecting begomoviruses from Old World. Vertical branches are arbitrary, horizontal branches are
proportional to calculated mutation distances. Values at nodes indicate percentage bootstrap values (1000
replicates). Begomovirus sequences used for comparison were Mungbean yellow mosaic virus (MYMV),
Mungbean yellow mosaic India virus (MYMIV), Horsegram yellow mosaic virus (HgYMV) and Kudzu
mosaic virus (KuMV). The tree was arbitrarily rooted on the sequences of Tomato leaf curl New Delhi
virus (ToLCNDV) DNA-B. The database accession numbers are indicated, and the clone names of viruses
isolated from Pakistan are highlighted by black boxes. The distribution of all MYMIV isolates is shown on
a map of southern Asia (right). MYMIV isolates in each of the three phylogenetic groups are indicated on
the map by coloured circles.
Fig. 3.7 Distribution of MYMIV with DNA-A and DNA-B belong to group to group I (A1/B1; indicated by
brown colour), group II (A2/B2; indicated by orange colour) and MYMIV with DN-A belongs to group I
and DNA-B belongs to group II (A1/B2; indicated by green colour) in Indian sub-continent. The plant
species which each isolate was obtained from is indicated.
81
3.3.2 Mungbean yellow mosaic virus
DNA-A and DNA-B components of MYMV with genome size 2737 nt. and 2676
nt. respectively, like many of the other begomoviruses, encodes eight genes (six on DNA-
A and two on DNA-B). Detailed sequence analysis found the usual conserved sequence
motifs in proteins encoded by MYMV (as described in section 3.2.1). Multiple
alignments of the IR between DNA-A and DNA-B components of MYMV showed that
the CR is 134 nucleotides long with 78.4% identity and contains the conserved
geminivirus stem-loop structure, the TATA box forming part of the Rep promoter and
three predicted iterons (ATC/TGGTG) upstream of the TATA box. It is noticeable that
sequences between the aforementioned motifs shows a higher levels of variability (a
larger number of sequence changes) than there are in the motifs, suggesting that these
predicted features are important for virus function and thus conserved (Fig. 3.8). The
DNA-B sequence of the isolate characterised here shares a large sequence insertion (18
nt. between coordinates 2632 and 2651 of the alignment) with a MYMV from India
([IN:Vam:VigKA27](AF262064)) and three others forming a distinct cluster in the
phylogenetic tree (Fig. 3.6) , as discussed later. Comparison of the predicted N-terminal
amino acid sequences of the Rep of MYMV isolates shows the predicted IRD to be
MPRQGRFAIN (Fig. 3.9) based upon the work of Argüello-Astorga et al. (2004) .
Recombination analysis using RDP identified no evidence for recombination in any
isolate of this species.
Phylogenetic analysis based on an alignment of the DNA-A component sequence
of MYMV (MI65) with DNA-A sequences of other legume-infecting begomoviruses
from the Old World showed that the cluster containing sequences of MYMV segregate
into two groups (Fig 3.5). One large group consists of the sequences of viruses from
India, Thailand and Cambodia. However, the sequences of MYMV from Thailand and
Cambodia, which are geographically far removed from the other isolates, are distinct
from those originating from India and Pakistan. The smaller group consists of two
sequences from Pakistan (including MI65) and one from India (Fig. 3.5). It is important
to note that the one MYMV isolate segregating with Pakistani isolates (MYMIV-
[IN:Har:01] AY271896) originates from Haryana state (India) which is geographically
82
close to the border with Pakistan and may thus explain the close relationship between
these two isolates.
A phylogenetic analysis based on an alignment of the sequences of the DNA-B
components of MYMV obtained in this study (MI66 and MI67) with the DNA-B
component sequences of all legume-infecting begomoviruses from the Old World showed
that, with the exception of MYMV-[IN:Mad:Sb](AJ867554) (which instead segregated
with the DNA-B of HgYMV), they formed two distinct clusters. One cluster, containing
all sequences from India, was more closely related, and basal, to the DNA-B components
of MYMIV. These DNA-B components likely are the result of pseudo-recombination
(MYMV isolates that have captured MYMIV DNA-Bs). The second cluster, which likely
represents the cognate DNA-B of MYMV, consists of isolates from India and Thailand,
as well as the MYMV DNA-B components identified in this study (MI66 and MI67). The
CRs of all these “cognate” MYMV DNA-B isolates have the insertion (as mentioned
earlier), with respect to the isolates of MYMV DNA-B that are more similar to the DNA-
Bs of MYMIV (results not shown). These newly identified DNA-B components are
distinct from, and basal to, all other MYMV DNA-B components (Fig. 3.6). These two
sequences represent the most westerly examples so far identified and it is likely that they
have diverged from the other MYMV DNA-B components due to the large geographic
distances between them. Nevertheless, despite the geographic distances and the time
between isolation of these DNA-B components (the first LYMV identified was a MYMV
isolate from Thailand that was cloned prior to 1993; Morinaga, Ikegami and Miura, 1993)
their sequences remained clearly related.
83
Fig. 3.8 Alignment of the intergenic regions of DNA-A (MI65, MYMV-[TH:Mg2] AB017341 and MYMV-[IN:Mah:Sb:99] AF314530) and DNA-B (MI66, MYMV-[IN:Vam:VigKA27] AF262064 and MYMV-[IN:Vig] AJ132574) components of MYMV characterized in this study and obtained from the NCBI
database. Gaps (-) were introduced into the sequences to optimize the alignment. Conserved sequences in the alignment are surrounded by black box. Part of the
alignment that is not included in the CR is shaded grey. Position of stem (highlighted in light green) and loop with nonanucleotide (highlighted in dark green),
TATA box of the Rep promoter (highlighted in red) and iterons (F1, F2 and F3; highlighted in blue) are indicated. The nucleotide coordinates for each sequence
are given.
84
Fig. 3.9 The N-terminal amino acid sequence of the Rep protein of MYMV isolated from Rhynchosia
capitata (MI65) is aligned with that of selected MYMV isolates from the databases (MYMV-
[TH:Mg2](AB017341), MYMV-[IN:Mah:Sb:99](AF314530) and MYMV-[IN:Vig](AJ132575)) for
comparison. The position of the predicted iteron related domain is highlighted in blue.
3.3.3 Rhynchosia yellow mosaic virus
Four clones (MI32-MI35) were determined to be 2741, 2740, 2643 and 2639 nt.
in length and like other legume-infecting begomoviruses DNA-A encodes seven genes
whereas DNA-B encodes two genes. Detailed analysis of the nucleotide sequences of
DNA-A and DNA-B showed that the CR (57.1-59.0%), TrAP (65.9-70.2%) and NSP
(52.2-55.1%) of RhYMV have the highest sequences identities to those of MYMIV.
Whereas the Rep (73.2-75.6%), AV2 (53.7-66.4) and AC4 (82.7-84.0%) are more closely
related to those of MYMV and the CP (75.8%), AC5 (75.5) and MP (69.9%) have
highest sequence similarity with those of HgYMV. The REn of RhYMV is most closely
related to that of KuMV (70.6% nucleotide sequence identity). RhYMV encodes
relatively larger AC5 gene with the capacity to encode a predicted 138 amino acid protein
with a predicted molecular weight of and 15.8kDa (Table 3.1). Proteins encoded by
RhYMV contain all the conserved sequences usually found in geminiviruses (as
described in section 3.2.1). Alignments of IR of DNA-A and DNA-B showed that the CR
shared between the components is 125 nucleotides long with 80.8% to 87.2% identity.
Along with stem-loop structure and TATA box of the Rep promoter, there are three
iterated elements (ATC/TGG). Comparison of CR of RhYMV with that of other legume-
infecting begomoviruses showed arrangement and sequences of iterons is distinct from
the other LYMVs (Fig. 3.10). Comparison of N-terminal part of Rep mapped the IRD to
be MPRQGRFAIN which is distinct from the predicted IRDs of all other legume-
infecting begomoviruses (Fig. 3.11).
85
Phylogenetic analysis based on sequences of DNA-A (MI32 and MI33) and DNA-
B (MI34 and MI35) of RhYMV with other legume-infecting begomoviruses from the Old
World showed that this virus is very distinct, segregating between KuMV and (being
basal to) the southern Asian LYMVs (Fig. 3.5 and 3.6). RhYMV is thus the most distinct
of the southern Asian LYMVs. Comparison of sequences of DNA-A and DNA-B of
RhYMV with those of other legume-infecting begomoviruses showed that the most
closely related viruses, MYMV, MYMIV, HgYMV and KuMV have less than 70%
nucleotide sequence identity (Table 2.2 and 2.3), consistent with it being a distinct
begomovirus species.
86
Fig. 3.10 An alignment of the sequences of the common regions of the DNA-A and DNA-B component sequences that are representative of the LYMV species
DoYMV, HgYMV, KuMV, MYMIV and MYMV in comparison to RhYMV. No sequence of the DNA-B of DoYMV has yet been deposited in the databases. In
each case the predicted iterons (as indicated in the colour key), predicted stem-loop structure with nonanucleotide sequence (light green and dark green) and
TATA box (red) of the Rep promoter are highlighted. The nucleotide coordinates for each sequence are indicated on the right.
87
Fig. 3.11 Comparison of N-terminal amino acid sequence of the Rep proteins of RhYMV isolate obtained
in this study with that of MYMIV-[IN:ND:Bg3:91] AF126406, MYMV-[TH:Mg2] AB017341, KuMV-
[VN:Hoa:05] DQ641690, HgYMV-[IN:Coi] AJ627904 and DoYMV-[IN:Ban:04] AM157412. The
position of the predicted iteron related domains are highlighted for each virus.
3.3.4 Pseudo-recombination in legume-infecting begomoviruses
Comparison of phylogenetic trees of the DNA-A and DNA-B components of
LYMVs showed that there is extensive evidence of pseudo-recombination for these
legume-infecting begomoviruses. In Fig. 3.12 lines are used to join cognate DNA-A and
DNA-B sequences. Lines that cross are indicative of possible pseudo-recombination
events. Thus the association of the DNA-Bs of MYMV-[IN:Mad:Sb](AJ867545),
MYMIV-[IN:ND:Bg:91](AF142440), MYMIV-[IN:Sri:Mg1:96](AF416741), MYMIV-
[IN:ND:Sb2:99](AY049771) with their cognate DNA-As are likely examples of pseudo-
recombination. Similarly among MYMIV isolates from Pakistan characterised as part of
the present study, the association of the DNA-B components B3, B4, B13 and MI10 with
the DNA-A components A17, A6, A4 and MI9, respectively, are possible examples of
pseudo-recombinations.
88
Fig. 3.12 Comparison of the phylogenetic trees of the DNA-A (left) and DNA-B (right) of LYMVs. Cognate DNA-A and DNA-B components are joined by
lines and crossing over indicates likely pseudo-recombination. The trees were arbitrarily rooted on the sequences of the DNA-A and DNA-B components of Tomato leaf curl New Delhi virus, respectively. Numbers at nodes indicate bootstrap confidence scores (1000 replicates).
89
3.3.5 Non-legume viruses and betasatellite
The DNA sequence of PedLCV was shown to be 2760 nucleotides in size and in
common with other Old World begomoviruses, its genome encodes six genes (two on
virion-sense strand and four on complementary-sense strand). Comparison of the IR
sequence of PedLCV with that of other isolates of the species showed that it has a stem-
loop structure (with a nonanucleotide TAATATTAC) and TATA box like other
begomoviruses. There are four iterons (ATC/TGGT) which are different in sequence and
position from those of the reported PedLCV isolates (Fig. 3.13). Comparison of N-
terminal part of the Rep of PedLCV mapped IRD to be KRFQIY (Fig. 3.14), which is the
same as isolate PedLCV-[PK:RYK1:04](DQ116884) but differs from isolate PedLCV-
[PK:Mul:04](AM712436). In view of the strictly maintained interaction between a Rep
and its cognate binding sequence (Argüello-Astorga et al., 2004), these differences may
indicate that these PedLCV isolates have distinct origins or have at some point
recombined to gain distinct Rep/iteron motifs.
The PaLCuV isolate obtained here was shown to have a genome consisting of 2754
nucleotides which encodes six genes (two on virion-sense strand and four on
complementary-sense strand) like other Old World begomoviruses. An alignment of IR
of PaLCuV with that of other isolates of the species has shown a stem-loop structure with
a nonanucleotide (TAATATTAC), Rep promoter-associated TATA box in common with
the other isolates and four iterons (GGGGAC) identical in sequence and position to those
identified in the other isolates of this species (Fig. 3.13). An alignment of N-terminal part
of the Rep of PaLCuV mapped the predicted IRD to be NSFCIN (Fig. 3.14), having a
single amino acid change with respect to the other isolates.
The two clones of TbLCB obtained from a single soybean sample obtained in this
study are each 1344 nucleotides in length and, in common with all previously
characterised betasatellites, have a single ORF conserved in sequence and position (βC1),
an A-rich sequence, a stem-loop structure with similarity to the origin of replication of
geminiviruses and a sequence conserved between all betasatellites (the SCR). Both
sequences of TbLCB (MI22 and MI23) were submitted to the databases and are available
under accession numbers AM922485 and FM955608, respectively.
90
Fig. 3.13 Alignment of the intergenic regions in genome of Pedilanthus leaf curl virus (MI1, PedLCV-[PK:RYK1:04] DQ116884, PedLCV-[ PK:Mul:04]
AM712436) and Papaya leaf curl virus (MI69, PaLCuV-PK[PK:Cot:02] AJ436992, PaLCuV IN[IN:Luc] Y15934) characterized in this study and isolates from
the database. Gaps (-) were introduced into the sequences for optimization of the alignment. Conserved sequences in the alignment are black boxed. Position of
stem (highlighted in light green) and loop with nonanucleotide (highlighted in dark green), TATA box of the Rep promoter (highlighted in red) and iterons
(highlighted in brown for PedLCV and in blue for PaLCuV) are indicated. The nucleotide coordinates for each sequence are given.
91
Fig. 3.14 Alignment of the N-terminal amino acid sequences of the Rep proteins of PedLCV and PaLCuV
isolates obtained in this study. The position of the predicted iteron related domain is highlighted in brown
for PedLCV and in blue for PaLCuV. The sequences of PedLCV-[PK:RYK1:04] DQ116884, PedLCV-
[PK:Mul:04] AM712436, PaLCuV-IN[IN:Luc] Y15934 and PaLCuV-PK[PK:Cot:02] AJ436992 are shown
for comparison. Sequences conserved between the isolates are boxed.
Phylogenetic analysis based on an alignment of the complete nucleotide
sequences of PedLCV and PaLCuV with selected monopartite begomoviruses showed
that both viruses were grouped in same cluster along with Cotton leaf curl Multan virus
(CLCuMV), Chilli leaf curl virus (ChiLCV), Pepper leaf curl Bangladesh virus
(PepLCBDV) and Euphorbia leaf curl virus (EuLCV). PedLCV was most closely related
to EuLCV, whereas PaLCuV was more closely related to PepLCBDV (Fig. 3.15).
Phylogenetic analysis of TbLCB (MI22 and MI23) with other betasatellites showed
that this betasatellite species is most closely related to and clusters with Papaya leaf curl
betasatellite and Chilli leaf curl betasatellite, although it is basal to these (Fig. 3.16).
However, in all respects it is a typical betasatellite.
92
93
Fig. 3.15 Phylogenetic dendrogram based upon alignments of complete nucleotide sequences of
Pedilanthus leaf curl virus (PedLCV-MI1) and Papaya leaf curl virus (PaLCV-MI68 and MI69) from
Pakistan and selected monopartite viruses from NCBI database. Vertical distances are arbitrary. Horizontal
distances are proportional to genetic distances (see scale bar). The number at nodes refer to number of
times (in percentages) in which the branching was supported. Monopartite virus sequences used for
comparison were Ageratum yellow vein virus (AYVV), Chilli leaf curl virus (ChiLCV), Cotton leaf curl
Gezira virus (CLCuGV), Cotton leaf curl Kokhran virus (CLCuKV), Cotton leaf curl Multan virus
(CLCuMV), Euphorbia leaf curl virus (EuLCV), Papaya leaf curl virus (PaLCuV), Papaya leaf curl China
virus (PaLCuCNV), Papaya leaf curl Guangdong virus (PaLCuGuV), Pepper leaf curl Bangladesh virus
(PepLCBDV), Tomato leaf curl Bangladesh virus (ToLCBDV), Tomato leaf curl China virus (ToLCCNV),
Tomato leaf curl Gujrat virus (ToLCGV), Tomato leaf curl Bangalore virus (ToLCBV), Tomato leaf curl
Karnatka virus (ToLCKV), PedLCV and Tomato leaf curl Philippines virus (ToLCPV). The tree was
arbitrary rooted on the sequence of Maize streak virus. The database accession numbers are indicated and
the viruses isolated from Pakistan are highlighted.
94
95
Fig.3.16 Phylogenetic dendrograms based upon alignments of complete nucleotide sequences of TbLCB
from soybean and selected betasatellites from NCBI database. Vertical distances are arbitrary. Horizontal
distances are proportional to calculated mutation distances. The numbers at nodes refer to number of times
(in percentages) in which the branch was supported in bootstrapping (1000 replicates). Betasatellites
sequences used for comparison were Ageratum yellow vein betasatellite (AYVB), Ageratum yellow vein
Sri Lanka betasatellite (AYVSLB), Ageratum yellow leaf curl betasatellite (AYLCB), Alternanthera
yellow vein betasatellite (AIYVB), Bean leaf curl China betasatellite (BLCCNB), Chilli leaf curl
betasatellite (ChLCB), Croton yellow vein mosaic betasatellite (CroYVMB), Cotton leaf curl Gezira
betasatellite (CLCuGB), Cotton leaf curl Multan betasatellite (CLCuMB), Erectites yellow mosaic
betasatellite (ErYMB), Eupatorium yellow vein betasatellite (EpYVB), Honeysuckle yellow vein Kobe
betasatellite (HYVKB), Honeysuckle yellow vein betasatellite (HYVB), Honeysuckle yellow vein mosaic
betasatellite (HYVMB), Honeysuckle yellow vein Nara betasatellite (HYVNB), Honeysuckle yellow vein
Japan betasatellite (HYVJB), Kenaf leaf curl betasatellite (KLCuB), Ludwigia leaf distortion betasatellite
(LuLDB), Malvastrum leaf curl betasatellite (MaLCuB), Malvastrum yellow vein Yunnan betasatellite
(MaYVYnB), Mesta yellow mosaic betasatellite (MeYMB), Okra leaf curl betasatellite (OLCuB), Papaya
leaf curl betasatellite (PaLCuB), Sida leaf curl betasatellite (SiLCuB), Siegesbeckia yellow vein
betasatellite (SibYVB), Sida yellow vein mosaic China betasatellite (SiYMCNB), Tobacco curly shoot
betastellite (TbCSB), Tobacco leaf curl betasatellite (TbLCB), Tomato leaf curl China betasatellite
(ToLCCNB), Tomato leaf curl Bangladesh betasatellite (ToLCBDB) and Tomato leaf curl Bangalore
betasatellite (ToLCBB). The betasatellites tree was arbitrary rooted on the sequence of alphasatellite
(AJ132344). The database accession numbers are indicated and the betasatellites isolated from soybean
(MI22 and MI23) are highlighted.
96
3.4 Discussion
The study presented here shows that MYMIV is the most prevalent pathogen
responsible for yellow mosaic disease of legumes across Pakistan and is the only
pathogen of leguminous crops. Nevertheless, at least two other LYMVs were identified
as occurring in the country, MYMV and the newly identified RhYMV. The identification
of a new, previously unrecognised species indicates that the diversity of this unusual
group of pathogens may be greater than we presently realise. This virus is the first of the
LYMVs identified in and isolated from a weed. All previous LYMVs have been
identified in crop species and no effort has been made to systematically screen
leguminous weeds and ornamental for their presence. It would seem likely that previous
efforts at identifying such viruses have selected only for the most common viruses and
those that affect crops. In view of the importance of these viruses to agriculture in
southern Asia, a greater effort to establish the actual diversity within this interesting
group of viruses is desirable.
MYMV is an important pathogen of crops in India but does not seem to be a
significant pathogen in Pakistan, having only been identified in a weed in the present
study. The reason for this anomaly is unclear. A single sequence of only a DNA-A
component of MYMV originating from Pakistan has previously been deposited with the
databases (acc no. AY269991). This was isolated from an experimental plot of soybean
being grown at a research institute in Islamabad. Soybean is not native to this region and
is postulated to have its origins in northern Asia (China) (Wang, 1985). It is thus possible
that soybean does not have a long association with the LYMVs and has thus not evolved
any resistance against them. Certainly reports from India indicate that wherever soybean
is grown it suffers from infection by LYMVs and there has been the suggestion that
soybean cultivation exacerbates LYMV problems in other legume crops (Usharani et al.,
2005). If this is the case, it suggests that LYMVs are host adapted and that the MYMV
“strain” present in Pakistan is not well adapted to the legume crops being cultivated in
this country. However, the presence of MYMV in the country and its potential to be able
to infect soybean do not bode well for soybean cultivation in Pakistan. Although soybean
is not presently cultivated in Pakistan, there are pilot studies underway looking at the
possibility of doing so.
97
The phylogeographic analysis indicates that MYMIV in Pakistan segregates into
two types. A2/B2 type is occurring across the country and the A1/B1 type occurring only
in the north of the country. The reason for this is unclear. Pakistan is the western most
country in which LYMVs have been identified. It is likely that the desert and
mountainous regions between Pakistan and its neighbours to the west (Iran and
Afghanistan) and north (China) provide a barrier to the further dissemination of these
viruses, at least so far; these viruses are exclusively vector transmitted and the vector, B.
tabaci, does not survive well in either dry or high altitude (with cold nights and winters)
regions. Intensive agriculture is a relatively new phenomenon in southern Asia (within
the last 50 years) in response to ever increasing population density (Atapattu and
Kodituwakku, 2009). The problems associated with LYMVs are thus a relatively recent
phenomenon; certainly MYMV was first reported as recently as 1993 (Morinaga et al.,
1993). Whether LYMVs were present in Pakistan prior to this is unclear. However, the
distribution of MYMIV types is consistent with the virus spreading into Pakistan from
India. During the summer months, the period when LYMVs are a problem in crops, there
is a constant wind, known as Deccan, that blows from the south-west to the north east
across the country. Since these viruses are only vector transmitted, any virus introduced
into Pakistan would thus spread northwards very quickly but less quickly westwards. A
virus introduced in the north would move southwards only very slowly. With this in mind
it would thus seem likely that the A2/B2 type, which occurs across the country, may have
been introduced in the south and have spread across the country from there. The more
limited distribution of the A1/B1 type can possibly be explained by this having
immigrated into Pakistan from India further north, where the summer winds restrict its
southward spread. Unfortunately the limited number of sequences available from India,
and particularly from states adjoining Pakistan, means that the evidence supporting this
hypothesis is limited. Nevertheless, the available evidence supports this hypothesis for
the present distribution of MYMIV in Pakistan. One further factor that may play a part is
that the area surrounding the border between Pakistan and India is cotton country. In the
summer months the predominant crop is cotton. Thus really only in the far south and the
far north are any other crops, including legumes, grown in any abundance during the
period when the virus is mobile due to the vector being active and present in appreciable
98
numbers. This thus provides two corridors through which MYMIV could be introduced
from India into Pakistan. A southern and a northern corridor is consistent with the
hypothesis regarding the present distribution of MYMIV types.
The genetic basis for the MYMIV isolates forming three distinct groups in
phylogenetic analyses is unclear. A closer inspection of the DNA-A alignment used to
derive the dendrogram shows nucleotide changes to, for the most part, be randomly
distributed throughout the component. However, there were a slight higher number of
changes evident in the N-terminal end of the Rep gene and the IR, corresponding for
group II isolates to the region identified as possibly recombinant. To ascertain whether
the recombination might determine the groupings, separate trees were constructed from
the sequences that are apparently recombinant and the remainder of the sequences.
Although for most of the isolates the groupings remained the same, some isolates
changed groupings based on whether the recombinant region or the non-recombinant
region was used to derive the tree. This suggests that, although the recombinant sequence
may play a part in determining the three groups, other sequences also play a part. The
precise genetic basis for the three groups thus remains unclear. For the alignment based
on DNA-B sequences, sequence changes were randomly distributed throughout the
component and it was not possible to determine what the basis for the groupings are.
There was also no strong correlation between host and the three groupings of MYMIV
isolates. We can thus only speculate that, for the two groups of MYMIV isolates
identified in Pakistan, these likely represent “types” (they do not meet the criteria
necessary for description as strains as defined by Fauquet et al. [2008]) of MYMIV that
have diverged, possibly due to geographic isolation (southern and northern types).
Whether host adaptation had a part to play in this divergence is unclear. The group II type
was likely introduced into Pakistan from India in the south, from where it spread across
the country. In contrast, the group I type was introduced in the north and remain
geographically constrained due to environmental conditions. The isolation and
characterisation of more viruses, particularly on the Indian side of the border, will be
required to be able to determine whether this scenario is likely to be correct or not.
Pseudo-recombination is a form of “sexual” genetic exchange that is unique to
multipartite viruses. Recombination (including pseudo-recombination) is recognised as a
99
strong driving force in the evolution of geminiviruses (Rojas et al., 2005). It has likely
played a part in determining the taxonomic structure of the family Geminiviridae and is
leading to the appearance of new strains and species of geminiviruses (Fauquet et al.,
2003). Pseudo-recombination between and within species of LYMVs is well documented.
Probably the most prominent examples in this regard is MYMV-[IN:Mad:Sb](AJ421642)
which is associated with a HgYMV-like DNA-B (AJ867554) and a group of MYMV
isolates that associate with MYMIV-like DNA-B components (Figure 3.6). Of the
isolates characterised as part of the study presented here, there are further examples of
possible pseudo-recombination between MYMIV. IRDs study of these viruses shows that
MYMV and MYMIV are quite similar with each other and HgYMV is quite similar to
MYMV and MYMIV (Fig. 3.11) whereas study of CR revealed that iterons of these
viruses are poorly aligned (Fig 3.10) which shows flexibility is on the part of iterons.
Although putative recombination events between the DNA-A components of MYMIV
isolates was detected using software, no conclusive evidence of recombination between
MYMIV and non-leguminous begomoviruses was evident, although some putative
recombinant fragments were highlighted for which no donor parent could be identified.
These results are consistent with the earlier suggestion that these legume-infecting
begomoviruses are genetically isolated (Qazi et al., 2007).
There have been no previous reports of betasatellites that are adapted to legumes.
To date betasatellites have been shown (experimentally) only to associate with
monopartite viruses (Briddon et al., 2003; Chattopadhyay et al., 2008), although there is
one begomovirus which can be either bipartite or monopartite/betasatellite associated
(Blawid et al., 2008). Nevertheless, here TbLCB was identified in one soybean and an
earlier study identified CLCuMB in cowpea. The symptoms exhibited by the plants from
which the betasatellites were isolated, yellow mosaics, would seem to indicate that a
LYMV is the major symptom determinant in each case. However, in both cases the
symptoms suggested that the betasatellite was possibly responsible for enhancing
symptoms. In the case of cowpea the plant exhibited enations which are typical of
CLCuMB (Rouhibakhsh and Malathi, 2005). The plant identified in the present study
exhibited some leaf crumpling which is not typical of MYMIV infection and may thus be
due to the TbLCB. No previous work has addressed the interaction of betasatellites with
100
LYMVs and a study to address this lack of knowledge is presented in Chapter 5. Both the
betasatellites in question have been identified previously and are, as far has been
determined, adapted to species in the Malvaceae (CLCuMB is responsible, in
conjunction with several distinct monopartite begomoviruses, for cotton leaf curl disease
across Pakistan and northern India, the major biotic constraint to cotton production in
these areas; Mansoor et al., 2003) and to plants in the Solanaceae (TbLCB has previously
been identified only in tobacco originating from Pakistan; Briddon et al., 2003). In view
of the problems that begomovirus-betasatellite complexes cause in non-leguminous
crops, the identification of betasatellites in legumes is of grave concern.
As well as the LYMVs that were isolated in this study, two viruses, PedLCV and
PaLCuV, that would not be expected to be encountered in legumes (having not
previously been identified in legumes and having host ranges, as far as has been
determined, limited to plants in the family Solanacaea) were nevertheless isolated, There
have been previous reports of apparently non-legume infecting begomoviruses isolated
from legume crops (Raj et al., 2005; 2006a; 2006b; Reddy et al., 2005). In one case the
virus, Cotton leaf curl Kokhran virus, was actually reported as causing the disease (Raj et
al., 2006). However, in none of these cases was the aetiology of the disease investigated
using infectious clones and for each the symptoms were indicative of infection by
LYMVs. It is thus far more likely that these viruses are “passengers” that are maintained
in the respective legumes by one of the LYMVs (complementation). PedLCV was
identified in all eleven soybean samples tested whereas PaLCuV was present in one out
of eight Rhynchosia capitata samples which shows that both viruses are at different
levels of adaptations to legumes. Nevertheless, the presence of these viruses in legumes
means that there is scope for recombination and the possibility of more severe variants
arising. It would thus appear that the genetic isolation of the LYMVs is being breached.
Whether the lack of evidence for genetic interaction between leguminous and non-
leguminous begomoviruses indicates that these have not yet occurred, or have not yet
been identified (possibly due to the low number of isolates that have actually been
sequenced) or there are some constraints imposed by legumes that mean that recombinant
viruses are less fit, is unclear. Whatever is the case, the appearance of these viruses and
the betasatellites in legumes is a cause for concern and further studies should be initiated
101
to monitor the situation and give early warning of changes in virus populations. The
study presented here has set a base-line for identifying any possible future changes that
occur in Pakistan.
102
Chapter 4
Analysis of the infectivity of Legume yellow mosaic virus clones
4.1 Introduction
While working on infectious disorders in man and animals, Robert Koch
introduced the pure culture technique by using solid media. After having established
microscopically that the isolated bacteria were identical with those in the diseased
organs, he was able to reproduce the disease by introducing the isolated bacteria into a
healthy host. He then formulated the conditions a microorganism has to fulfil to be
regarded as a pathogen (now known as Koch’s Postulates; Bos, 1981). Geminiviridae
is the largest family of plant DNA viruses infecting a wide range of plant species. To
fulfil Koch’s Postulates for geminiviruses the pathogen is introduced into the host by
biolistic, Agrobacterium-mediated or mechanical methods.
The viruses that cause yellow mosaic disease of legumes are not sap
transmissible. For this reason the ability to identify their host ranges depends mainly
on the efficacy of transmission and the behaviour of whiteflies, which varies with host
genotypes, vector biotypes and growth conditions. In such cases, agroinoculation is
suggested as an alternative to introduce viral nucleic acids into plants. For
agroinoculation, the viral genome is subcloned into binary vectors in the form of
partial direct repeats in which the viral origin of replication is duplicated which is
believed to aid replicational release of unit length viral DNA upon inoculation
(Stenger et al., 1991). An advancement in the production of agroinfectious clones is
the amplification of viral DNA by RCA, partial digestion with a unique cutter enzyme
and cloning of dimers into binary vectors (Ferreira et al., 2008). Agrobacterium-
mediated inoculation of bipartite geminiviruses is normally done by mixing two
Agrobacterium cultures that independently harbour partial tandem repeats of the
DNA-A and DNA-B components. Jacob et al. (2001) reported that a method that
utilizes one strain of Agrobacterium that harbours DNA-A and DNA-B partial tandem
repeats on two compatible replicons can give infectivity up to 100%. There are some
reports of infectivity of legume-infecting begomoviruses, MYMV and MYMIV, to
legumes. An isolate of MYMV induced yellow mosaic disease of leaves in blackgram
by agroinoculation (Mandal et al., 1997). Similarly, a cowpea isolate of MYMIV with
a DNA-B more closely related to the components of MYMV, was readily infectious
103
to cowpea, mungbean, blackgram and Frenchbean by agroinoculation (John et al.,
2008).
The study of diversity of legume-infecting begomoviruses in Pakistan has
shown that MYMIV is the most prevalent pathogen causing yellow mosaic disease of
legume crops. MYMV and RhYMV, in contrast, appear only to be present in
leguminous weeds (Chapter 3). There are earlier reports of the isolation and
sequencing of MYMV (a single sequence submitted to NCBI databank) and MYMIV
(Hameed and Robinson, 2004) from Pakistan but so far no studies of the infectivity of
the cloned viruses have been conducted.
4.2 Methodology
A construct for the Agrobacterium-mediated inoculation of the DNA-A
component of MYMIV-[PK:Isl:Mg:07] (clone MI15) was produced by cloning an
approximately 1.8kb HindIII and BamHI fragment into the binary vector pBin19. This
pBin19 plasmid, with a fragment of the DNA-A clone containing the origin of
replication, was linearised with HindIII and treated with calf intestine alkaline
phosphatase (CIAP) to prevent self ligation and ligated with the full length DNA-A
component which was released from pBluescript II KS/SK (+) by restriction with
HindIII (Fig. 4.1a).
A partial direct repeat construct of the DNA-B of MYMIV-[PK:Isl:Mg:07]
(clone MI21) was produced by releasing an approximately 1.6 kb fragment with
BamHI and ClaI which was ligated into pBluescript II KS/SK (+). This fragment was
then released by digestion with BamHI and SalI and cloned in pBin19. This partial
clone of DNA-B in pBin19 was linearised with BamHI and the full-length DNA-B
insert, released with BamHI, ligated into this (Fig. 4.1b).
For the DNA-A component of MYMIV-[PK:Nsh:Sb:07] (clone MI18), a
partial direct repeat construct was produced by the same method described above for
the clone MI15. In this case the partial length fragment with the origin of replication
was approximately 1.1 kb in size and was released with EcoRI and BamHI and the
full-length DNA-A was inserted at the BamHI site (Fig. 4.2a). The construct for the
DNA-B component of MYMIV-[PK:Nsh:Sb:07] (clone MI17) was produced by
exactly the same procedure described above for the clone MI21 (Fig. 4.2b).
104
Fig. 4.1 Structures of the partial direct repeat constructs in pBin19 produced for the Agrobacterium-
mediated inoculation of MYMIV-[PK:Isl:Mg:07] DNA-A (clone MI15) (panel a) and DNA-B (clone
MI21) (panel b) . The positions of restriction endonuclease recognition sites used, the approximate
sizes of fragments, the origin of replication of each begomovirus component (hairpin structure) and the
left (LB) and right (RB) borders of the pBin19 T-DNA are indicated.
Fig. 4.2 Structures of the partial direct repeat constructs for the agroinoculation of MYMIV-
[PK:Nsh:Sb:07] DNA-A (clone MI18) (panel a) and DNA-B (clone MI17) (panel b) . The restriction
endonucleases used, the approximate sizes of fragments, the origin of replication of each begomovirus
component (hairpin structure) and the left (LB) and right (RB) borders of the pBin19 T-DNA are
shown.
105
A construct for the inoculation of DNA-A component of RhYMV-
[PK:Lah:Rh:07] (clone MI32) was produced by digesting this with XbaI and BamHI
to release an approximately 1.2 kb fragment with the origin of replication and ligating
into pBluescript II KS/SK (+). From pBluescript this fragment was moved into
pBin19 at SacI and HindIII restriction sites. This partial clone was then linearised
with BamHI, treated with CIAP, and ligated with the full-length DNA-A component
released with XbaI, recircularised by self ligation and digested with BamHI (Fig.
4.3a).
The construct for the DNA-B component of RhYMV-[PK:Lah:Rh:07] (clone
MI34) was produced by digestion with XbaI and HindIII, releasing an approximately
1.1 kb DNA fragment which was cloned in pBluescript II KS/SK (+). This was
digested with SacI and HindIII and the fragment was transferred into pBin19. The
pBin19 clone was then digested with HindIII and the full-length component of DNA-
B, released with XbaI, recircularised by self ligation and digested with HindIII, was
inserted (Fig. 4.3b).
Fig. 4.3 Structures of clones produced in the binary vector pBin19 for agroinoculation of RhYMV-
[PK:Lah:Rh:07] DNA-A (clone MI32) (panel a) and DNA-B (clone MI34) (panel b). Restriction
endonuclease sites used to produce the constructs, approximate sizes of fragments, the position of the
hairpin structure and the left (LB) and right borders (RB) of the T-DNA in the binary vector are
indicated.
106
Partial direct repeat constructs of MYMV-[PK:Kun:Rh:06] DNA-A (clone
MI65) and DNA-B (MI66) were produced essentially as described above for the clone
MI15. For clone MI65 the fragment was approx. 2.0 kb in size and was released with
EcoRI and HindIII and full length DNA-A was inserted at HindIII site (Fig. 4.4a) and
for MI66 the fragment was 1.2 kb in size and was released with SmaI and HindIII and
full length DNA-B was inserted at HindIII (Fig. 4.4b).
Fig. 4.4 Structures of the partial direct repeat constructs of the DNA-A (panel a) and DNA-B (panel b)
components of MYMV-[PK:Kun:Rh:06] which were produced in the binary vector pBin19 for
agroinoculation. The approximate sizes of fragments, restriction sites used for their cloning, the origin
of replication (hairpin structure) and the left (LB) and right (RB) borders of the T-DNA in the binary
vector are shown.
A partial direct repeat construct of PedLCV-[PK:Nsh:Sb:07] (clone MI1) was
produced by the same procedure described above for clone MI18 (Fig. 4.5a).
Similarly a construct of PaLCuV-[PK:Kun:Rh:06] (clone MI69) was produced by the
method describe above for the clone MI18, except that the fragment used was 1.2 kb
in length (Fig. 4.5b). For TbLCB-[PK:Nsh:Sb:07] (clone MI22) a construct for
agroinoculation was produced by digesting the full-length clone with XbaI and EcoRI
107
to release a fragment of ~1.28kb which was cloned in pBluescript II KS/SK (+). This
partial length fragment was moved into pBin19 at restriction sites SacI and EcoRI.
The partial length clone of TbLCB in pBin19 was restricted with EcoRI, treated with
CIAP and ligated with full length insert of MI22 released with EcoRI (Fig. 4.5c).
Fig. 4.5 Structures of the partial direct repeat constructs of PedLCV-[PK:Nsh:Sb:07] (clone MI1)
(panel a), PaLCuV-[PK:Kun:Rh:06] (clone MI69) (panel b) and TbLCB-[PK:Nsh:Sb:07] (clone MI22)
(panel c) in binary vector pBin19 for Agrobacterium-mediated inoculation. The approximate sizes of
fragments, restriction sites used for their cloning, hairpin structures and left (LB) and right (RB)
borders of T-DNA in the binary vector are indicated.
108
4.3 Results
4.3.1 Infectivity of Mungbean yellow mosaic India virus isolated from
mungbean
The DNA-A (MI15) and DNA-B (MI21) components of the mungbean isolate
of MYMIV-[ PK:Isl:Mg:07] were agroinoculated to mungbean (Vigna radiata
Wilczek) var. 96006, blackgram (Vigna mungo) var. Qandhari mash, soybean
(Glycine max Merr) var. Ig6, N. benthamiana and N. tabacum. Symptoms resembling
those observed in field-infected mungbean (Chapter 3, Fig. 3.2) were induced in
mungbean. The symptoms were evenly distributed, diffuse yellow mosaics on leaves
that appeared after three weeks which subsequently increased in size and fused with
each other giving a typical yellow mosaic appearance (Fig. 4.6a). In blackgram the
yellowing initially appeared along the midrib and veins (which was not observed in
the field-infected blackgram; Chapter 3, Fig. 3.2) after four weeks and subsequently
(50 days post-inoculation) leaves became completely yellow (Fig. 4.6b). In soybean
symptoms were like that of field-infected plants (Chapter 3, Fig. 3.2) which were
yellow spots that appeared on leaves approximately eight weeks after inoculation and
gradually became more intense (Fig. 4.6c). In mungbean, blackgram and soybean the
infectivity rate was 55%, 77% and 63% respectively (Tabel 4.1) and all symptomatic
plants tested were positive for the presence of both components of MYMIV by PCR
and Southern blot analysis (results not shown). No virus was detected in inoculated,
non-symptomatic plants or healthy, non-inoculated control plants by Southern blot
analysis or PCR.
In contrast to the legumes, inoculation of N. benthamiana resulted in
symptomless infections in 20% of plants (Table 4.1). Both the DNA-A and DNA-B
components of MYMIV could be detected by PCR but not by Southern hybridization
approx. 25 days after inoculation. In N. tabacum the virus was not infectious; neither
component could be detected in this species at 25 days post inoculation using
diagnostic PCR (Table 4.1).
4.3.2 Infectivity of Mungbean yellow mosaic India virus isolated from soybean
The partial repeat constructs of DNA-A (MI18) and DNA-B (MI17)
components of MYMIV-[ PK:Nsh:Sb:07] isolated from soybean were agroinoculated
to mungbean (var. 96006), blackgram (var. Qandhari mash), soybean (var. Ig6) and N.
benthamiana. All three legume species were susceptible to this virus isolate and
109
developed typical yellow mosaics on leaves similar to the symptoms produced in
legumes infected with MYMIV-Mg (Fig. 4.7a-c). However, the virus was less
infectious to blackgram (40% of plants infected) than to soybean (80% of plants
infected). This isolate of MYMIV was also less infectious to blackgram than the
MYMIV-Mg (which infected approx. 77% of plants) (Table 4.1). In blackgram
yellowing appeared along the midrib and veins on leaves after five weeks and
symptoms did increase in intensity, remaining relatively mild in comparison to those
induced by MYMIV-Mg. In soybean yellow spots appeared on leaves eight weeks
after inoculation which intensified gradually and, at ten weeks after inoculation,
leaves were completely yellow. In N. benthamiana the behaviour of the virus was
similar to the MYMIV-Mg. There were symptomless infections in 20% of plants
(Table 4.1) and both the DNA-A and DNA-B components of MYMIV could be
detected by PCR (results not shown).
4.3.3 Infectivity of Mungbean yellow mosaic virus
Agroinoculation of partial tandem repeat constructs of the DNA-A and DNA-
B components of MYMV-[PK:Kun:Rh:06] to blackgram (var. Qandhari mash)
produced mild infection with yellow mosaic symptoms on leaves (Fig. 4.7d) in 43%
of inoculated plants (Table 4.1). Symptoms appeared after three weeks and persisted
without further enhancement until senescence of the plants. In symptomatic plants the
presence of both viral components was confirmed by PCR diagnostics, whereas the
virus could not be detected in inoculated non-symptomatic plants. In N. benthamiana
the behaviour of this virus was similar to that of MYMIV; all inoculated plants were
non-symptomatic and both components of the virus were detected by PCR in
systemic, non-inoculated leaves in 17% of inoculated plants (Table 4.1).
4.3.4 Infectivity of Rhynchosia yellow mosaic virus
Partial dimeric clones of RhYMV-[PK:Lah:Rh:07] were agroinoculated to
mungbean (var. 96006), blackgram (var. Qandhari mash), soybean (var. Ig6 and FS-
85), mothbean and N. benthamiana. In soybean var. Ig6 the virus induced small
yellow spots on leaves (Fig. 4.7e) in 20% of plants (Table 4.1) three months after
inoculation and DNA-A and DNA-B components of the virus was detectable by PCR
whereas mock inoculated plants were negative for both components. Approximately
fifteen days after the appearance of symptoms, the plants recovered, newly emerging
110
leaves showed no symptoms and no virus could be detected by PCR. In a second
soybean var. FS-85 severe infection resulted which caused yellow mosaics with
necrosis on leaves (Fig. 4.7f) in 36% of inoculated plants after two months.
Interveinal necrotic spots appeared along with yellow mosaics on young, newly
emerging leaves and gradually increased in severity. The presence of the virus in
symptomatic plants was confirmed by PCR but no virus was detected in inoculated,
non-symptomatic plants. RhYMV was not infectious to N. benthamiana and, in
contrast to MYMIV and MYMV, this virus did not produce symptomless infection;
PCR-mediated detection was unable to show the presence of either component in
young, emerging leaves of inoculated plants. Similarly the clones of RhYMV were
not infectious to blackgram, mungbean, mothbean and N. tabacum.
111
Fig. 4.6 Symptoms exhibited by plants infected with Mungbean yellow mosaic India virus isolated from mungbean (MYMIV-[PK:Isl:Mg:07]).
Symptoms of MYMIV infection to mungbean (a) and soybean (c) were a foliar yellow mosaic whereas in blackgram yellowing appeared along
the veins (b) which subsequently spread to interveinal tissues. Mock inoculated mungbean (d), blackgram (e) and soybean (f) plants were
symptomless. The photographs of mungbean and blackgram were taken approx. 25 days post inoculation and the photographs of soybean were
taken approx. 60 days post inoculation.
112
Fig. 4.7 Symptoms exhibited by plants infected with Mungbean yellow mosaic India virus isolated
from soybean (MYMIV-[PK:Nsh:Sb:07]), Mungbean yellow mosaic virus isolated from Rhynchosia
capitata (MYMV-[PK:Kun:Rh:06]) and Rhynchosia yellow mosaic virus isolated form Rhynchosia
minima (RhYMV-[PK:Lah:Rh:07]). Infection of mungbean (a), blackgram (b) and soybean (c) with
MYMIV induced typical yellow mosaics of leaves. Infection of blackgram with MYMV induced mild
yellow mosaics and leaf puckering (d). RhYMV induced faint yellow spots on leaves of soybean line
Ig6 (e) and severe symptoms with cell death on leaves of soybean line FS-85 (f). The photographs of
mungbean and blackgram were taken approx. 30 days post inoculation and the photographs of soybean
were taken approx. 60 days post inoculation.
113
4.3.5 Infectivity of Pedilanthus leaf curl virus, Papaya leaf curl virus and
Tobacco leaf curl betasatellite
The PedLCV construct was agroinoculated to tomato (var. Nagina), N.
benthamiana, N. tabacum, blackgram (var. Qandhari mash) and soybean (var. Ig6). In
tomato the virus induced mild leaf curl (Fig. 4.8b) in 15 out of 17 plants (88%)
inoculated (Table 4.1), 30 days after inoculation. In N. benthamiana it induced cell
death at the inoculation site and severe upward leaf curling in emerging leaves (Fig.
4.8d) of all 18 inoculated plants (Table 4.1), approx. 20 days after inculcation. The
virus was not infectious to N. tabacum or any of the legumes that were inoculated. In
tomato and N. benthamiana the presence of the virus was confirmed by PCR and
Southern hybridization.
Co-inoculation of PedLCV with TbLCB to N. benthamiana induced severe
downward leaf curling, vein yellowing and vein thickening but no enations (Fig. 4.8e)
in infected plants after eighteen days. After 25 days infected plants were severely
deformed and stunted. 18 plants were agroinoculated in three independent
experiments and all plants were infected in each experiment (Table 4.1). PedLCV
with TbLCB was not infectious to N. tabacum (Table 4.1).
The partial direct repeat construct of Papaya leaf curl virus (PaLCuV) was
agroinoculated to nineteen N. benthamiana plants in three independent experiments.
After 25 days 17 out of 19 plants inoculated (89%) (Table 4.1) showed symptoms of
infection consisting of a mild leaf crumpling (Fig. 4.8f) which did not increase in
severity with time. All symptomatic plants were positive for the virus by PCR
detection whereas the presence of the virus could not be demonstrated in non-
symptomatic control plants.
114
Fig.4.8 Leaf of a mock inoculated tomato plant (a) and a tomato plant infected with PedLCV exhibiting
leaf curling, a severe reduction in leaf size and vein thickening (b). A mock inoculated N. benthamiana
plant (c) and N. benthamiana plants infected with PedLCV (showing upward leaf curling and vein
thickening; d), PedLCV and TbLCB (exhibiting severe downward leaf curling; e) and PaLCuV (with
very mild leaf crumpling; f). The photographs were taken approx. 25 days post inoculation.
115
Table 4.1 Infectivity of the cloned viruses and betasatellite obtained in this study.
Inoculum Plant species
Infectivity
(plants infected/plants inoculated)
Symptoms Experiment
Total I II III
MYMIV-Mg
mungbean 6/10 5/10 11/20 22/40 Yellow mosaics on
leaves
blackgram 7/10 8/10 8/10 23/30 Yellow mosaics on
leaves
soybean 6/10 7/10 6/10 19/30 Yellow mosaics on
leaves
N. benthamiana 2/10 3/10 1/10 6/30 No symptom
N. tabacum 0/10 0/10 0/10 0/30 No symptom
MYMIV-Sb
mungbean 10/20 11/20 12/20 33/60 Yellow mosaics on
leaves
blackgram 4/10 3/10 5/10 12/30 Yellow mosaics on
leaves
soybean 8/10 9/10 7/10 24/30 Yellow mosaics on
leaves
N. benthamiana 1/6 2/7 1/7 4/20 No symptom
RhYMV
mungbean 0/10 0/10 0/10 0/30 No symptom
blackgram 0/10 0/10 0/10 0/30 No symptom
N. benthamiana 0/6 0/6 0/5 0/17 No symptom
soybean (var.Ig6) 2/10 3/10 1/10 6/30 Very mild yellow
mosaics on leaves
soybean (var.FS-85) 4/10 2/10 5/10 11/30 Yellow mosaics with
cell death on leaves
mothbean 0/10 0/10 0/10 0/30 No symptom
MYMV blackgram 4/10 4/10 5/10 13/30
Yellow mosaics on
leaves
N. benthamiana 1/6 2/10 1/7 4/23 No symptom
PedLCV
N. benthamiana 6/6 6/6 6/6 18/18 Severe upward leaf
curling
N. tabacum 0/6 0/6 0/6 0/18 No symptom
tomato 5/6 6/7 4/4 15/17 Mild leaf curling
soybean 0/20 0/20 0/20 0/60 No symptom
blackgram 0/30 0/30 0/30 0/90 No symptom
PedLCV + TbLCB
N. benthamiana 6/6 6/6 6/6 18/18 Severe downward
leaf curling
N. tabacum 0/6 0/6 0/6 0/18 No symptom
PaLCuV N. benthamiana 4/5 6/6 7/8 17/19 Mild leaf crumpling
116
4.4 Discussion
Although MYMIV is reported to infect many legume crops, the results
obtained here show that isolates of this virus have different levels of adaptation to
different legume species. Out of the three plant species (mungbean, blackgram and
soybean) studied, MYMIV-Mg was highly infectious to blackgram but less infectious
to mungbean. In contrast, MYMIV-Sb was highly infectious to soybean and less
infectious to blackgram. There is no published data available in direct support of these
results but, in a related study, a blackgram isolate of MYMIV has been shown to
produce a mild leaf curl symptoms in cowpea plants whereas a cowpea isolate and a
soybean isolate of the same virus species produced typical golden mosaic symptoms
and greenish yellow mosaic along with mottling symptoms respectively in cowpea
(Surendranath et al., 2005). In another report MYMIV isolate from soybean was
shown to be similar to a cowpea isolate of MYMIV (MYMIV-[IN:ND:Cp7:98]) in its
ability to infect cowpea but differed from blackgram and mungbean isolates which do
not infect cowpea (Usharani et al., 2005).
LYMV isolates show distinct differences in host ranges and this has in most
cases been attributed to differences in the DNA-B components. Balaji et al. (2004)
studied the infectivity of a related virus, a blackgram isolate of MYMV (MYMV-
[IN:Vig]) with two different DNA-B components, MYMV-[IN:Vig](AJ132574) with
a CR 95% identical and MYMV-[IN:Vam:VigKA27](AF262064) with a CR 85.6%
identical to that of the DNA-A (MYMV-[IN:Vig](AJ132575)) component, in
mungbean and blackgram. Using the MYMV-[IN:Vig] DNA-B, the virus was highly
infectious to blackgram whereas in the presence of MYMV-[IN:Vam:VigKA27]
DNA-B it was highly infectious to mungbean. A similar situation may be the case for
the MYMIV isolates used in the study here. The DNA-B components of the
mungbean and soybean isolates have 93.6% identity and in the phylogenetic analysis
these DNA-Bs segregate in different clusters, cluster I for the mungbean isolate and
cluster II for the soybean isolate (Chapter 3, Fig. 3.7). This may suggest that the
distinct host adaptation of these isolates is determined by the DNA-B components.
However, to rule out any possible involvement of the DNA-A in host range
determination of MYMIV, the infectivity of both DNA-B components with either of
the DNA-A components (pseudo-recombination) should be tested.
MYMV is the major causal agent of yellow mosaic disease of legumes in
southern and western India (Usharani et al., 2004). From northern and central India as
117
well as from Pakistan there has been no report of the occurrence of this virus with the
exception of an early submission of a sequence of DNA-A of MYMV isolated from a
soybean sample collected from Islamabad (Pakistan). In the study conducted here,
MYMV was not identified in crops, only in the leguminous weed R. capitata.
Sequence analysis showed that DNA-B associated with MYMV isolated from R.
capitata was distinct (Chapter 3, Section 3.3.2) and infectivity analysis showed that
this isolate is not well adapted to blackgram; it induced mild infections with light
yellow mosaics on leaves by agroinoculation. This finding, together with the fact that
MYMV was not detected in crops, even though it was found in a weed associated
with crops, indicate that possibly the “strain” of MYMV present in Pakistan is not
adapted to the legume crops grown in the country. However, the fact that MYMV
causes losses to cultivated legumes elsewhere in southern Asia indicates that this virus
species has the capacity to adapt. The presence of well adapted MYMIV in the
country means that there is the possibility of interaction between the two species (by
recombination or pseudo-recombination) to yield a MYMV that is adapted to
cultivated crops. The identification of a MYMV in soybean in Pakistan in the past is
possibly an indication of such future problems. However, it would seem more likely
that this earlier identification of MYMV in a leguminous crop was due to the
cultivation of a susceptible species (soybean) rather than due to genetic changes in the
virus. Nevertheless, this possibility of MYMV becoming a problem in the future
should be examined in more detail experimentally.
In common with MYMV, RhYMV was not identified in legume crops in the
study presented here. Infectivity analyses showed that RhYMV was not infectious to
mungbean, blackgram and mothbean, suggesting that its host range is very limited.
However, in soybean line Ig6, very mild symptoms appear initially and the plants then
recovered from the infection, suggesting that this variety has a level of resistance to
this virus. In recovered plants, the virus could not be detected by PCR diagnostics. In
another soybean line (FS-85) the infection was severe with yellow mosaic and
necrosis on leaves and plants did not recover.
Although RhYMV has a host range that extends to soybean, this crop is not
grown by farmers in Pakistan, rather it is limited to small fields in research stations.
This may explain why RhYMV has not been identified previously and is not found in
crops. However, were soybeans to be grown on a large scale, the results show that this
virus could become a problem. Since both MYMV and MYMIV occurring in Pakistan
118
have the capacity to infect soybean, this would open the door to interaction between
these three viruses (during co-infection), possibly leading to (pseudo)recombination
and the possibility of better adapted virus evolving.
RhYMV was not able to infect N. benthamiana at all, whereas both MYMIV
and MYMV produced asymptomatic infection in a few plants. This lack of infectivity
or poor infectivity of LYMVs to N. benthamiana is unusual since virtually all dicot-
infecting geminiviruses are infectious to this host; it is the model host of choice for
infectivity studies with these, and many other, viruses (Goodin et al., 2008). For
begomoviruses originating from the Old World, no legume-infecting begomovirus has
been reported from non-leguminous species and no clones have been shown to
experimentally infect species other than legumes. This suggests that these viruses
have very narrow host ranges which likely have resulted in genetic isolation (Qazi et
al., 2007). This lack of infectivity of LYMVs is further investigated in Chapter 5.
PedLCV (previously also known as Tomato leaf curl Pakistan virus) has
previously been identified in tomato (acc. no. DQ116884) and the ornamental shrub
Pedilanthus tithymaloides, after which the virus is named (Tahir et al., 2009).
Although the presence of a betasatellite was not investigated for the tomato isolate,
TbLCB (the same betasatellite species as identified with PedLCV here; Chapter 3)
was identified in association with the isolate from P. tithymaloides. However, for
neither isolate was infectivity of the obtained clones investigated. This is thus the first
demonstration of infectivity of clones of this species. Although PedLCV was isolated
from soybean it was not infectious to this species, even though it was shown to be
highly infectious, in both the presence and absence of TbLCB, to N. benthamiana.
The natural host range of PedLCV thus does not extend to soybean or any of the other
legumes tested and suggests that its presence in soybean in the field is dependent upon
the presence of MYMIV; possibly a synergistic extension of host range. The
interaction of the LYMVs with PedLCV is further investigated in Chapter 5.
The situation with PaLCuV is likely to be the same as with PedLCV. PaLCuV
was first identified in papaya originating from India (Saxena et al., 1998) and
subsequently in cotton in association with the CLCuD-associated betasatellite,
CLCuMB (Mansoor et al., 2003). The isolate from cotton was additionally shown, by
biolistic inoculation, to be infectious to cotton in the presence of CLCuMB and to
induce typical CLCuD symptoms. The presence of PaLCuV in the leguminous weed
R. capitata is thus likely due to the additional presence of MYMV. A number of
119
begomoviruses, which would not usually be expected to infect legumes, have been
reported from legumes; these include Tomato leaf curl Karnataka virus (Raj et al.,
2006a) and Cotton leaf curl Kokhran virus from soybean (Raj et al., 2006b), Tomato
leaf curl New Delhi virus from pigeonpea (Raj et al., 2005) and cowpea (Reddy et al.,
2005). Since the infectivity of none of the clones of these viruses was investigated in
the relevant legume hosts, and all legumes from which they were isolated showed
symptoms typical of infection by LYMVs, it would seem more than likely that the
presence of these viruses in legumes, as is the case with PedLCV reported here, is
supported by another begomovirus, one of the LYMVs.
The behaviour of PedLCV and TbLCB in N. benthamiana is identical to that
of AYVV and AYVB, the first betasatellite complex identified (Saunders et al.,
2000). In the absence of the betasatellite PedLCV causes a severe upward leaf curl in
N. benthamiana associated with vein swelling. In the presence of TbLCB, these
symptoms become a downward leaf curling with some leaf deformation and vein
swelling. This shows that this betasatellite and PedLCV have a “productive”
interaction; the virus is able to trans-replicate the betasatellite and moves it
systemically and that the expression of the βC1 protein encoded by the satellite leads
to the change in the symptom phenotype (Saunders et al., 2001). This thus shows that
PedLCV and TbLCB form a viable complex.
To identify resistant lines, breeders usually rely on field screening. This has
distinct limitations in that, in the case of begomoviruses, environmental conditions are
variable and whitefly transmission efficiency may consequently vary. Similarly, the
genetic make-up of the virus in the field may vary and the screening can only be
conducted once a year. The agroinoculation technique used here provides a means of
overcoming many of these limitations. The screening can be done, in glasshouses, at
any time of the year. This technique overcomes the variability due to the whitefly and
a defined (cloned) virus is inoculated every time. The brief study here, using two
soybean varieties with differing levels of resistance to MYMIV, demonstrates the
potential usefulness of this technique for the rapid screening of resistance in legume
varieties. Although it can not entirely replace field screening, there will always be a
need to assess the performance of new varieties in field conditions, it will be useful
for rapidly identifying promising resistant lines and should speed-up the introduction
of these.
120
Chapter 5
Interaction of LYMVs with other begomoviruses and betasatellites
5.1 Introduction
Component exchange, commonly referred to as pseudo-recombination for
geminiviruses, is common in legume-infecting begomoviruses (Qazi et al., 2007). For
example, an isolate of MYMV obtained from blackgram was shown to be associated
with two distinct types of DNA-B. The first (MYMV-[IN:Vam:VigKA27]
AF262064) showed 97% sequence identity to the DNA-B of the MYMV isolate from
Thailand. The other (represented by four clones, MYMV-[IN:Vam:VigKA21]
AJ439059, MYMV-[IN:Vam:VigKA22] AJ132574, MYMV-[IN:Vam:VigKA28]
AJ439058 and MYMV-[IN:Vam:VigKA34] AJ439057), had only 71-72% identity to
the Thai isolate (Karthikeyan et al., 2004). Infectivity analysis showed the DNA-A
component of this virus to be able to support both DNA-B components at the same
time and to induce only mild symptoms in blackgram in the presence of MYMV-
[IN:Vam:VigKA27] AF262064 but typical disease symptoms in this host in the
presence of the other DNA-B components. For an isolate of MYMIV from cowpea,
the presence of a distinct DNA-B was shown to extend the host range of this virus to
cowpea. These clones were not well adapted to blackgram, inducing severe symptoms
but accumulating to only low levels in this species (Malathi et al., 2005).
Furthermore, an isolate of MYMV isolated from soybean has been shown to be
associated with a DNA-B with high sequence identity to the DNA-B of HgYMV
(96%). The DNA-B of HgYMV is the most distinct amongst the LYMV DNA-Bs,
showing only 70-73% identity to the DNA-B components of MYMV and MYMIV.
Surendranath et al. (2005) showed that pseudo-recombinants between distinct
MYMIV isolates were highly infectious and produced typical symptoms in all
legumes hosts tested except cowpea. Extremely low viral DNA accumulation and
atypical leaf curl symptoms produced by reassortants in cowpea suggest barriers both
for replication and systemic movement despite genetic similarity.
Recently some begomoviruses have been shown to require the presence of
single-stranded DNA satellites to induce characteristic symptoms in some hosts
(Briddon et al., 2001a; Jose and Usha, 2003; Saunders et al., 2000). The satellites
have been identified, thus far, only in association with monopartite begomoviruses
from the Old World (Briddon et al., 2003; Bull et al., 2004; Zhou et al., 2003b). Full-
121
length clones of monopartite begomoviruses Ageratum yellow vein virus (AYVV)
from Singapore and Cotton leaf curl Multan virus (CLCuMV) from Pakistan,
although infectious in N. benthamiana (Briddon et al., 2001a; Saunders et al., 2000),
were unable to induce typical symptoms of yellow vein in Ageratum conyzoides and
leaf curl in cotton, respectively, and novel molecules, named DNA β (now
collectively known as betasatellites; Briddon et al., 2008), were shown to be
associated with both viruses, and to be essential for induction of characteristic
symptoms in Ageratum and cotton (Saunders et al., 2000; Briddon et al., 2001a). The
monopartite begomoviruses that associate with betasatellite can be divided into two
types according to whether or not their betasatellites are indispensable for induction of
symptoms in the hosts from which they were isolated. In most cases the
begomoviruses have an obligate interaction with their betasatellites; the viruses never
being identified infecting hosts in the field in the absence of the betasatellite (Zhou et
al., 2003a). For a minority, the associated betasatellite molecules do not appear to
play a key role in symptom induction and their relationship with the helper virus is
facultative and less well understood. These classes of monopartite begomoviruses
may represent evolutionary intermediates between the obligate betasatellite
interacting and true monopartite begomoviruses that have genomes consisting of only
a single genomic component homologous to the DNA-A component of bipartite
begomoviruses (Li et al., 2005).
Analysis of betasatellites has revealed that they are approximately half the size
of the genomes of their helper begomoviruses and, with the exception of the
TAATATTAC motif (the nonanucleotide sequence) contained within a conserved
stem-loops structure, have little sequence similarity to either the DNA-A or DNA-B
components of begomoviruses. Betasatellites require helper begomoviruses for
replication, encapsidation, insect transmission and movement in plants (Briddon and
Stanley 2006) and they contribute to the production of symptoms and enhance helper
virus accumulation in certain hosts. They might affect the replication of their helper
virus by either facilitating its spread in host plants or by suppressing host gene
silencing (Saunders et al., 2000; Saeed et al., 2007). The βC1 encoded by
betasatellites is the determinant of both pathogenicity and suppression of gene
silencing (reviewed by Briddon and Stanley, 2006).
Legume-infecting begomoviruses have host ranges limited to plants of the
family Fabaceae and there is ample evidence for genetic interaction between these
122
begomoviruses within the legumes, in the form of both classical recombination and
component exchange. However, there is little evidence for interaction of these viruses
with non-legume viruses. This is indicative of genetic isolation, the viruses in legumes
evolving independently of the begomoviruses in plant species of other families and
this may be the reason that these viruses are evolutionary distinct (Qazi et al., 2007).
There are reports of the isolation of non-legume begomoviruses from legumes with
yellow mosaic disease such as Tomato leaf curl Karnataka virus and Cotton leaf curl
Kokhran virus were isolated from soybean (Raj et al., 2006a; 2006b), Tomato leaf
curl New Delhi virus was isolated from pigeonpea (Raj et al., 2005) and cowpea
(Reddy et al., 2005). In this study PedLCV and TbLCB were isolated from soybean
and PaLCuV was isolated from Rhynchosia capitata (Chapter 3, Section 3.3). The
interaction of these non-legume viruses with LYMVs is investigated in this chapter.
5.2 Methodology
To mutate the MP gene encoded on DNA-B of MYMIV-[PK:Isl:Mg:07]
(clone MI21), NcoI was used. This is a single cutter enzyme at nucleotide position
1768 that cuts the MP gene in the centre. The DNA-B component was digested with
NcoI and the cohesive ends were in-filled by using Klenow fragment. In this way a
frame shift mutation was introduced by adding four nucleotides in the DNA and the
NcoI restriction site was lost. The mutation was confirmed by loss of the NcoI site
from the clone. This MP mutated DNA-B component (DNA-BΔMP
) was used to
produce a construct for Agrobacterium-mediated inoculation. DNA-BΔMP
was
digested with BamHI and ClaI and an approximately 1.6 kb DNA fragment was
cloned into the pBluescript II KS/SK (+) vector. This partial length fragment was
released with BamHI and SalI from pBluescript II KS/SK (+) vector and cloned into
pBin19. The pBin19 clone was then digested with BamHI and the full-length insert of
DNA-BΔMP
was cloned into this as a BamHI fragment, yielding a partial direct repeat
construct.
To mutate the NSP gene of DNA-B of MYMIV, mutagenic abutting primers
(BΔNSP
Forward and BΔNSP
Reverse; Table 2.1) were designed in such a way that
nucleotide A was replaced with G at position 710 to add a HindIII restriction site and
nucleotide T was replaced with A at position 703 to add a stop codon in the coding
sequence. These primers were used to amplify DNA-B by PCR and the amplified
product was cloned by InsTAclone PCR Cloning Kit (Fermentas) into pTZ57R/T. The
123
mutation was confirmed by digestion of the introduced HindIII restriction site. To
produce a partial direct repeat clone of DNA-B with mutated NSP (DNA-BΔNSP
). The
mutated clone was digested with BamHI and HindIII and the approx. 2.2 kb DNA
fragment was cloned in the binary vector pBin19. This partial clone of DNA-B was
digested with HindIII, treated with CIAP, and ligated with full length component of
DNA-BΔNSP
released as a HindIII fragment. A further mutant DNA-B was produced
in which both the MP and NSP genes were mutated (DNA-BΔMPΔNSP
) by the same
procedure described above for mutation of NSP; however for PCR amplification the
DNA-B clone with mutated MP was used as a template. A construct for
Agrobacterium-mediated inoculation of this mutant was made as described above for
DNA-BΔNSP
.
The βC1 gene of TbLCB was cloned in the binary vector pBin19 under the
control of the Cauliflower mosaic virus 35S promoter. To produce this construct, the
gene was amplified with specific primers (βC1-35S Forward and βC1-35S Reverse;
Table 2.1) and cloned in the expression vector pJIT163 (Guerineau et al., 1992) at
restriction sites HindIII and BamHI. The βC1-containing expression cassette with 35S
promoter and nos terminator was excised by digesting with restriction enzymes SacI
and EcoRV and ligated into pBin19 which was first digested with SacI and SmaI.
5.3 Results
To study the interactions of MYMIV with PedLCV and TbLCB, infectious
clones of MYMIV-[PK:Nsh:Sb:07] (clones MI18, MI17), PedLCV-[PK:Nsh:Sb:07]
(clone MI1) and TbLCB-[PK:Nsh:Sb:07] (clone MI22) were produced and infectivity
experiments were carried out in controlled conditions.
5.3.1 Interaction of MYMIV with betasatellites
Infectious clones of MYMIV (DNA A and B) and TbLCB were
agroinoculated to soybean. Typical symptoms of MYMIV infection of this host
appeared after 60 days (a yellow mosaic on newly emerging leaves; as described in
Chapter 4, Section 4.3.2). Analysis of the plants by PCR with primers specific for
each component showed the presence of both MYMIV components but not TbLCB
(Table 5.1). In control inoculations of TbLCB with PedLCV, to N. benthamiana,
typical symptoms (Fig. 5.6d) of infection appeared after 16 days and diagnostic PCR
showed the presence of TbLCB, confirming the viability of the betasatellite inoculum.
This showed that, at least under the experimental conditions used here, TbLCB is not
124
infectious to soybean in the presence of MYMIV. This is surprising, considering that
the TbLCB clone was isolated from a soybean plant infected with MYMIV. Whether
this indicates that the TbLCB clone is defective, or the inability of TbLCB to infect
soybean in the presence of MYMIV is a consequence of the, relatively, low efficiency
of the inoculation system (typically only 57% of inoculated soybean plants become
infected [Table 5.1]) is unclear. Further investigation will be required to answer this
question.
MYMIV was poorly infectious to N. benthamiana, all inoculated plants were
symptomless although in approx. 20% of inoculated plants the virus could be detected
in newly emerged leaves by PCR but not by Southern blot (Chapter 4, Section 4.3.1 ),
suggesting that virus levels in plants are low. Inoculation of DNA-A of MYMIV to N.
benthamiana also gave a similar result; symptomless plants and 3 out of 22 plants
positive for DNA-A (Table 5.1). When MYMIV DNA-A, DNA-B and TbLCB were
coinoculated to N. benthamiana, all plants were symptomatically infected after twelve
days with severe downward leaf curling, vein yellowing and thickening (Fig. 5.1c).
Co-inoculation of MYMIV DNA-A and TbLCB produced infected plants with the
same phenotype (Fig. 5.1b) but the infectivity was only 60% of inoculated plants
(Table 5.1) and symptoms started after eighteen days. The remaining 40% of plants
were symptomless and PCR-mediated diagnostics was unable to detect the presence
of either TbLCB or MYMIV DNA-A. The presence of MYMIV DNA-A, DNA-B and
TbLCB in systemically infected tissues was assessed by Southern hybridization (Fig.
5.2). There were very bright bands for DNA-A and TbLCB on the blot but for DNA-
B faint bands were produced even though equal amounts of DNA (10µg per well)
were load. All these experiments were repeated three times and produced reproducible
results. These results showed that the poor infectivity of MYMIV to N. benthamiana
is not due to a problem with virus replication since, in the presence of TbLCB, the
virus is highly infectious to this host. Rather the results suggest that this is either due
to restricted movement of the virus or because of a strong host defence response
against the virus by this host. TbLCB can complement the movement functions
encoded on DNA-B. Although the DNA-B of MYMIV appeared not to be well
adapted to N. benthamiana the results suggested it still had some role to play in
infection since, in its presence, infectivity increased from 60% to 100% in co-
infections with TbLCB. To determine the contribution of each of the genes encoded
by DNA-B in these TbLCB assisted infections, the MYMIV genes encoding NSP and
125
MP were cloned in the binary vector pGreen0029 under the control of the 35S
promoter. In the presence of 35S-NSP, MYMIV DNA-A and TbLCB infected 60% of
plants inducing typical betasatellite symptoms. However, in the presence of 35S-MP
all inoculated plants were infected (Table 5.1). This indicates that, in N. benthamiana,
it is likely the function of MYMIV NSP that is compromised.
To further investigate the specificity of interaction of MYMIV with
betasatellites, two further betasatellite clones, Cotton leaf curl Multan betasatellite
(CLCuMB) and Chilli leaf curl betasatellite (ChLCB) were assessed for their ability
to assist MYMIV in infecting N. benthamiana. Both betasatellite clones were
infectious to N. benthamiana with the helper virus CLCuMV (Table 5.1). However,
when coinoculated with the components of MYMIV, they did not facilitate the
infectivity of this virus (Table 5.1). This indicates that not all betasatellites are
capable of interacting with MYMIV. The lack of detection of either betasatellite in
systemic tissues in which the virus was detected, suggests that MYMIV is unable to
transreplicate these satellites.
Previous studies have indicated that all betasatellite functions are mediated by
the βC1 protein, the only product encoded by betasatellites (reviewed by Briddon and
Stanley, 2006). To study the role of the βC1 gene of TbLCB in the interaction with
MYMIV, a PVX vector expressing the TbLCB βC1 gene (βC1-PVX) was
coinoculated with MYMIV DNA-A and DNA-B to N. benthamiana. Symptoms of
infection, consisting of severe leaf curling, vein thickening, stem and petiole
deformation, enations on underside of the leaves along the veins, and dense hairs on
leaves and stems, appeared within 12 days of inoculation (Fig. 5.1f). βC1-PVX
infection alone also produced the same phenotype (Fig. 5.1d), indicating that MYMIV
made no contribution to the phenotype. MYMIV DNA-A and DNA-B components
moved systemically and accumulated to high levels in systemic leaves when
compared to control N. benthamiana plants inoculated with MYMIV alone (Fig. 5.2).
Similarly plants inoculated with MYMIV DNA-A and βC1-PVX also produced the
same phenotype as was obtained with βC1-PVX alone (Fig. 5.1e) and the DNA-A
was detected in systemically infected leaves. To study transient effect of βC1 protein
expression, a construct with the βC1 gene under the control of the 35S promoter (35S-
βC1) was co-infiltrated with MYMIV DNA-A and DNA-B to N. benthamiana leaves.
All inoculated plants remained symptomless and MYMIV was not detected by
Southern hybridization. However, by PCR diagnostics, all plants were shown to have
126
both components of MYMIV in systemic leaves. Similarly plants inoculated with
MYMIV DNA-A and βC1-35S were also symptomless but by PCR were shown to
contain MYMIV DNA-A in systemic leaves (Table 5.1).
N. benthamiana infected with MYMIV DNA-A, DNA-B and TbLCB
contained very low amounts of DNA-B in systemically infected leaves. To investigate
the involvement of proteins encoded by DNA-B in its low accumulation, the genes on
DNA-B were individually mutated. Agroinoculation of MYMIV DNA-A and DNA-
BΔMP
to N. benthamiana gave results similar to those obtained by inoculation with
MYMIV DNA-A and DNA-B which were very low levels of both components of the
virus in 20% of inoculated plants. Inoculation of MYMIV DNA-A, DNA-BΔMP
and
TbLCB produced symptomatic infection in 60% of plants (Table 5.1) with typical
betasatellite symptoms (Fig. 5.4b) and the accumulation of DNA-BΔMP
was slightly
increased, as it was detectable in infected tissues by Southern hybridization (Fig. 5.3).
Agroinoculation of MYMIV DNA-A and DNA-BΔNSP
to N. benthamiana produced
results similar to those obtained by inoculation of N. benthamiana with MYMIV
DNA-A and DNA-B; non-symptomatic plants in which only very few contained
detectable level of DNA-A and DNA-B. When MYMIV DNA-A, DNA-BΔNSP
and
TbLCB were co-inoculated to N. benthamiana, 60% plants were infected (Table 5.1)
and exhibited typical betasatellite symptoms (Fig. 5.4a). In infected tissues DNA-
BΔNSP
was detectable in small amounts by Southern hybridization (Fig. 5.3). All N.
benthamiana inoculated with MYMIV DNA-A, DNA-BΔMPΔNSP
and TbLCB were
symptomless and none of the plants was positive in newly emerging tissues, for any
of the inoculated components by PCR analysis (Table 5.1).
127
Fig. 5.1 Symptoms induced following the inoculation of Nicotiana benthamiana with Mungbean
yellow mosaic India virus (MYMIV) and Tobacco leaf curl betasatellite (TbLCB) and its derivatives.
Shown are a non-inoculated N. benthamiana plant for comparisons (a) and N. benthamiana plants
inoculated with MYMIV DNA-A and TbLCB (b), MYMIV DNA-A, DNA-B and TbLCB (c), βC1-
PVX (d), MYMIV DNA-A, βC1-PVX (e) and MYMIV DNA-A, DNA-B and βC1-PVX (f). Plants
were photographed approximately 20 dpi.
128
Fig. 5.2 Southern hybridization of blots probed with MYMIV DNA-A (a), DNA-B (b) and TbLCB (c).
DNA samples run on the gels were extracted from a mature, field-infected mungbean plant showing
clear yellow mosaic symptoms of infection by MYMIV (lane 1), healthy non-inoculated N.
benthamiana (lane 2). The samples run in lanes 3 to 8 were extracted from N. benthamiana plants
inoculated with MYMIV DNA-A and TbLCB (lane 3), MYMIV DNA-A, DNA-B and TbLCB (lane
4), MYMIV DNA-A and βC1-PVX (lane 5) MYMIV DNA-A, DNA-B and βC1-PVX (lane 6),
MYMIV DNA-A and 35S- βC1 (lane 7), MYMIV DNA-A, DNA-B and 35S- βC1(lane 8). Samples
were extracted approx. 25 dpi and approximately 10µg of DNA was loaded in each lane.
129
Fig. 5.3 Southern hybridization of a blot probed with MYMIV DNA-B. The DNA sample in lane 1 was
extracted from a mature, field-collected soybean plant with clear mosaic symptoms typical of infection
by MYMIV. Lanes 2 to 8 contained DNA extracted from a non-inoculated N. benthamiana plant (lane
2) or N. benthamiana plants inoculated with MYMIV DNA-A, DNA-B and TbLCB (lanes 3 and 4)
MYMIV DNA-A, DNA-BΔMP and TbLCB (lanes 5 and 6) and MYMIV DNA-A, DNA-BΔNSP and
TbLCB (lanes 7 and 8). Samples were extracted approx. 25 dpi and approximately 10µg of DNA was
loaded in each case.
5.3.2 Interaction of TbLCB with RhYMV and MYMV
To investigate whether the interaction of TbLCB is specific for MYMIV and
this betasatellite has the capacity to interact with other legume-infecting
begomoviruses, RhYMV and MYMV were similarly analysed for their ability to
interact with this betasatellite. Earlier infectivity analyses showed that, in common
with the other LYMVs, RhYMV was not infectious to N. benthamiana (Chapter 4,
Section 4.3.4). All plants inoculated with RhYMV DNA-A and DNA-B were
symptomless and the virus was not detectable in newly emerging tissues by PCR. To
study the potential for interaction between RhYMV and TbLCB they were
agroinoculated to N. benthamiana and after twelve days 60% of plants (Table 5.1)
developed symptoms of infection, consisting of leaf curling, vein yellowing and
thickening (Fig. 5.4d). RhYMV DNA-A was also co-inoculated with TbLCB to N.
130
benthamiana and 40% plants (Table 5.1) were symptomatic within 16 days of
inoculation with symptoms consisting of mild leaf curling, vein yellowing and
thickening (Fig. 5.4c). Southern blot analyses showed that the levels of DNA-A and
TbLCB replication were similar in plants with DNA-B and without DNA-B (Fig.
5.5a), whereas the level of DNA-B was very low; detectable by PCR but not by
Southern hybridization.
Infectivity analyses showed that MYMV is poorly infectious to N.
benthamiana (Chapter 4, Section 4.3.3), as all inoculated plants were symptomless
although in 10% to 20% plants the virus was detectable by PCR. MYMV was also
assessed for its ability to interaction with TbLCB in N. benthamiana. Inoculation of
plants with MYMV DNA-A, DNA-B and TbLCB induced leaf curling in 60%
inoculated plants approx. ten days after inoculation. (Table 5.1) and after sixteen days
plants were fully infected with severe leaf curling (Fig. 5.4f), symptoms
indistinguishable from the inoculation of this betasatellite with the other LYMVs.
DNA-A alone was also able to interact with TbLCB and 40% of inoculated plants
became symptomatic (Table 5.1), with leaf curl symptoms appearing after ten days
(Fig. 5.4e). By PCR diagnostics all three components were detected in
symptomatically infected tissues and by Southern blot analysis the levels of DNA-A
and TbLCB were similar in plants with or without DNA-B (Fig. 5.5b and c). However
DNA-B could not be detected by Southern blotting in symptomatic plants inoculated
with MYMV DNA-A, DNA-B and TbLCB.
131
Fig. 5.4 Phenotypic behaviour of N. benthamiana plants inoculated with MYMIV DNA-A, TbLCB and
DNA-BΔNSP (a) DNA-A, TbLCB and DNA-BΔMP (b) RhYMV DNA-A and TbLCB (c) RhYMV DNA-
A, DNA-B and TbLCB (d) MYMV DNA-A and TbLCB (e) and MYMV DNA-A, DNA-B and TbLCB
(f). Plants were photographed approximately 20 dpi.
132
Fig. 5.5 Southern hybridization of blots probed with RhYMV DNA-A (a) MYMV DNA-A (b) and
TbLCB (c). DNA samples immobilized on blot (a) were extracted from a mature, field-infected
Rhynchosia minima plant showing clear yellow mosaic symptoms of infection by RhYMV (lane 1),
healthy non-inoculated N. benthamiana (lane 2) and N. benthamiana inoculated with RhYMV (lane 3).
The samples run in lanes 4 to 8 were extracted from N. benthamiana plants inoculated with RhYMV
DNA-A and TbLCB (lanes 4 and 5) and RhYMV DNA-A, DNA-B and TbLCB (lanes 6-8). DNA
samples on blot (b) were extracted from field-infected Rhynchosia capitata plant showing yellow
mosaic symptoms of infection by MYMV (lane 1), healthy non-inoculated N. benthamiana (lane 2) and
N. benthamiana inoculated with MYMV (lane 3). The samples run in lanes 4 to 8 were extracted from
N. benthamiana plants inoculated with MYMV DNA-A and TbLCB (lanes 4 and 5) and MYMV DNA-
A, DNA-B and TbLCB (lanes 6 and 7). DNA samples on blot (c) were extracted from N. benthamiana
infected with MYMIV DNA-A, DNA-B and TbLCB (lane 1), healthy non-inoculated N. benthamiana
(lane 2) and N. benthamiana inoculated with RhYMV DNA-A, TbLCB (lanes 3 and 4), RhYMV
DNA-A, DNA-B and TbLCB (lanes 5 and 6), MYMV DNA-A and TbLCB (lane 7) and MYMV DNA-
A, DNA-B and TbLCB (lanes 8 and 9). Samples were extracted approx. 25 dpi and approximately
10µg of DNA was loaded in each lane.
133
Table 5.1 Study of interaction of legume-infecting begomoviruses with betasatellites.
Inoculum Plant species
Infectivity (plants infected/inoculated)
Symptoms Experiment Total
I II III
MYMIV DNA-A+ DNA-B+TbLCB
soybean
Positive for
MYMIV
(6/10),
Positive for
TbLCB (0/10)
Positive for
MYMIV
(5/10),
Positive for
TbLCB (0/10)
Positive for
MYMIV
(6/10),
Positive for
TbLCB (0/10)
Positive for
MYMIV
(17/30),
Positive for
TbLCB (0/30)
Yellow mosaics on leaves
MYMIV DNA-A N. benthamiana 2/10 1/8 0/4 3/22 None
MYMIV DNA-A+B N. benthamiana
Positive for DNA-A and
DNA-B, (2/10)
Positive for DNA-A and
DNA-B (3/10)
Positive for DNA-A and
DNA-B (1/10)
Positive for DNA-A and
DNA-B (6/30)
None
MYMIV DNA-A+ TbLCB
N. benthamiana
Positive for DNA-A and
TbLCB, (6/10)
Positive for DNA-A and
TbLCB, (5/10)
Positive for DNA-A and
TbLCB, (5/10)
Positive for DNA-A and
TbLCB, (16/30)
Severe leaf curling
MYMIV DNA-A+ DNA-B+TbLCB
N. benthamiana
Positive for DNA-A,
DNA-B and TbLCB, (10/10)
Positive for DNA-A,
DNA-B and TbLCB, (10/10)
Positive for DNA-A,
DNA-B and TbLCB, (9/10)
Positive for DNA-A,
DNA-B and TbLCB, (29/30)
Severe leaf curling
MYMIV DNA-A+ TbLCB+35S-MP
N. benthamiana
Positive for DNA-A and
TbLCB,
(10/10)
Positive for DNA-A and
TbLCB,
(6/6)
Positive for DNA-A and
TbLCB,
(5/5)
Positive for DNA-A and
TbLCB,
(21/21)
Severe leaf curling
MYMIV DNA-A+ TbLCB+35S-NSP
N. benthamiana
Positive for DNA-A and
TbLCB, (5/10)
Positive for DNA-A and
TbLCB, (3/6)
Positive for DNA-A and
TbLCB, (3/5)
Positive for DNA-A and
TbLCB, (11/21)
Severe leaf curling
MYMIV DNA-A+ TbLCB+35S-MP+
35S-NSP
N. benthamiana
Positive for DNA-A and
TbLCB, (10/10)
Positive for DNA-A and
TbLCB, (6/6)
Positive for DNA-A and
TbLCB, (5/5)
Positive for DNA-A and
TbLCB, (21/21)
Severe leaf curling
MYMIV DNA-A+βC1-PVX
N. benthamiana 8/8 7/7 7/7 22/22 Severe leaf curling and enations
MYMIV DNA-A+DNA-B+ βC1-PVX
N. benthamiana
Positive for DNA-A and
DNA-B,
(10/10)
Positive for DNA-A and
DNA-B
(9/9)
Positive for DNA-A and
DNA-B
(10/10)
Positive for DNA-A and
DNA-B
(29/29)
Severe leaf curling and enations
MYMIV DNA-A+ 35S-βC1
N. benthamiana 6/6 9/10 5/6 20/22 None
MYMIV DNA-A+ DNA-B+35S-βC1
N. benthamiana
Positive for DNA-A and
DNA-B
(6/7)
Positive for DNA-A and
DNA-B
(10/10)
Positive for DNA-A and
DNA-B
(9/10)
Positive for DNA-A and
DNA-B
(25/27)
None
MYMIV DNA-A+ DNA-BΔNSP
N. benthamiana
Positive for DNA-A and
DNA-B,
(1/10)
Positive for DNA-A and
DNA-B
(0/8)
Positive for DNA-A and
DNA-B
(2/10)
Positive for DNA-A and
DNA-B
(3/28)
None
MYMIV DNA A+ DNA BΔNSP+TbLCB
N. benthamiana
Positive for DNA-A,
DNA-B and TbLCB, (6/10)
Positive for DNA-A,
DNA-B and TbLCB,
(4/8)
Positive for DNA-A,
DNA-B and TbLCB, (5/10)
Positive for DNA-A,
DNA-B and TbLCB, (15/28)
Severe downward leaf curling
134
Table 5.1 continued
Inoculum Plant species
Infectivity (plants infected/inoculated)
Symptoms Experiment Total
I II III
MYMIV DNA-A+
DNA-BΔMP N. benthamiana
Positive for DNA-A and
DNA-B, (1/10)
Positive for DNA-A and
DNA-B (0/7)
Positive for DNA-A and
DNA-B (1/8)
Positive for DNA-A and
DNA-B (2/25)
None
MYMIV DNA-A+ DNA-BΔMP+TbLCB
N. benthamiana
Positive for DNA-A,
DNA-B and TbLCB,
(6/8)
Positive for DNA-A,
DNA-B and TbLCB, (6/10)
Positive for DNA-A,
DNA-B and TbLCB, (5/10)
Positive for DNA-A,
DNA-B and TbLCB, (17/28)
Severe downward leaf curling
MYMIV DNA-A+ DNA-BΔNSPΔMP+ TbLCB
N. benthamiana 0/6 - - 0/6 None
MYMIV DNA-A+ CLCuMB
N. benthamiana
Positive for DNA-A (1/5),
Positive for CLCuMB
(0/5)
Positive for DNA-A and CLCuMB
(0/5)
Positive for DNA-A and CLCuMB
(0/5)
Positive for DNA-A (1/15)
Positive for CLCuMB
(0/5)
None
MYMIV DNA-A+
DNA-B+CLCuMB N. benthamiana
Positive for MYMIV DNA-A, DNA-B
(1/4)
Positive for MYMIV DNA-A, DNA-B
(0/5)
Positive for MYMIV DNA-A, DNA-B
(1/5)
Positive for MYMIV DNA-A, DNA-B (2/14)
None
CLCuMV+CLCuMB N. benthamiana
Positive for CLCuMV, CLCuMB
(6/6)
- -
Positive for CLCuMV, CLCuMB
(6/6)
Severe leaf
curl of
emerging
leaves
MYMIV DNA-A+ ChLCB
N. benthamiana
Positive for MYMIV DNA-A
(1/5)
Positive for MYMIV DNA-A
(0/5)
Positive for MYMIV DNA-A
(2/5)
Positive for MYMIV DNA-A
(3/15)
None
MYMIV DNA-A+
DNA-B+ChLCB N. benthamiana
Positive for MYMIV DNA-A, DNA-B
(1/5)
Positive for MYMIV DNA-A, DNA-B
(1/5)
Positive for MYMIV DNA-A, DNA-B
(0/5)
Positive for MYMIV DNA-A, DNA-B (2/15)
None
CLCuMV+ChLCB N. benthamiana
Positive for CLCuMV,
ChLCB (6/6)
- -
Positive for CLCuMV,
ChLCB (6/6)
Severe leaf
curl of
emerging
leaves
RhYMV DNA-A N. benthamiana 0/6 0/6 0/5 0/17 None
RhYMV DNA-A+ DNA-B
N. benthamiana 0/5 0/5 0/5 0/15 None
RhYMV DNA-A+ TbLCB
N. benthamiana
Positive for RhYMV DNA-A,
TbLCB (3/8)
Positive for RhYMV DNA-A, TbLCB (5/10)
Positive for RhYMV DNA-A, TbLCB (4/10)
Positive for RhYMV DNA-A, TbLCB (12/28)
Mild leaf curling
RhYMV DNA-
A+DNA-B+TbLCB N. benthamiana
Positive for RhYMV DNA-A, DNA-B,
TbLCB (4/6)
Positive for RhYMV DNA-A, DNA-B,
TbLCB (5/7)
Positive for RhYMV DNA-A, DNA-B,
TbLCB (3/7)
Positive for RhYMV DNA-A,
DNA-B, TbLCB (12/20)
Downward
leaf curling
MYMV DNA-A N. benthamiana 1/6 0/6 1/6 2/18 None
135
Table 5.1 continued
Inoculum Plant species
Infectivity (plants infected/inoculated)
Symptoms Experiment Total
I II III
MYMV DNA-A+ DNA-B
N. benthamiana
Positive for MYMV
DNA-A, DNA-B
(1/6)
Positive for MYMV
DNA-A, DNA-B
(1/6)
Positive for MYMV
DNA-A, DNA-B
(0/6)
Positive for MYMV
DNA-A, DNA-B (2/18)
None
MYMV DNA-A+TbLCB
N. benthamiana
Positive for MYMV DNA-A,
TbLCB (3/7)
Positive for MYMV DNA-A,
TbLCB (3/8)
Positive for MYMV DNA-A, TbLCB (4/10)
Positive for MYMV DNA-A, TbLCB (10/25)
Severe leaf curling
MYMV DNA-A+ DNA-B+TbLCB
N. benthamiana
Positive for MYMV DNA-A,
DNA-B, TbLCB (5/8)
Positive for MYMV DNA-A,
DNA-B, TbLCB (4/8)
Positive for MYMV DNA-A, DNA-B, TbLCB (6/10)
Positive for MYMV DNA-A, DNA-B, TbLCB (15/26)
Sever leaf curling
5.3.3 Interaction of MYMIV with Pedilanthus leaf curl virus
Analyses showed that the soybean sample from Sind province, infected with
MYMIV and PedLCV, had relatively low amounts of PedLCV DNA, although it was
at levels detectable by Southern hybridisation in some samples (Fig.5.7a). To study
the interaction of MYMIV with PedLCV, infectious clones of both viruses were
agroinoculated to soybean. Plants developing yellow mosaic disease were assessed for
the presence of MYMIV and PedLCV. PedLCV could not be detected in any plant;
however MYMIV was shown to be present in all symptomatic samples. The inoculum
of PedLCV was viable, as it was infectious to N. benthamiana in control inoculations
(Table 5.2).
MYMIV and PedLCV were also inoculated to N. benthamiana and all plants
showed typical symptoms of PedLCV which were severe upward leaf curling typical
of PedLCV in this host (Fig. 5.6a). Total genomic DNA of all inoculated plants was
extracted and assessed for the presence of MYMIV DNA-A, DNA-B and PedLCV by
PCR. All symptomatic plants were positive for MYMIV DNA-A and PedLCV,
whereas MYMIV DNA-B could not be detected. The presence of MYMIV DNA-A
and PedLCV was also confirmed by Southern hybridization (Fig. 5.7 b and d). N.
benthamiana plants inoculated with MYMIV DNA-A, DNA-B, PedLCV and TbLCB
showed downward leaf curling (Fig. 5.6b) and all four components were found in
systemically infected tissues by PCR. However by Southern hybridization MYMIV
136
DNA-B could not be detected, indicating that it was accumulating at levels below the
detection threshold of Southern hybridisation (Fig. 5.7b, c and d).
To see whether MYMIV has the capacity to interact with any other
monopartite begomoviruses, Cotton leaf curl Multan virus (CLCuMV; AJ496461)
and MYMIV were co-inoculated to N. benthamiana. All inoculated plants showed
typical symptoms of CLCuMV; downward leaf curling of emerging leaves (Fig. 5.6c).
All plants were found positive for MYMIV DNA-A, DNA-B and CLCuMV by PCR.
Southern blot analysis showed that the amount of MYMIV DNA-A and CLCuMV
was very high in infected tissues whereas the amount of DNA-B was very low, hardly
detectable on Southern blot hybridization (Fig. 5.7c).
Fig. 5.6 Symptoms induced following agroinoculation of N. benthamiana plants with MYMIV and
PedLCV (a), MYMIV, PedLCV and TbLCB (b), MYMIV and CLCuMV (c) and PedLCV and TbLCB
(d). Plants were photographed approximately 20 dpi.
137
Fig. 5.7 Southern blot analyses with a probe of PedLCV (a) to show presence of PedLCV in soybean
sampled from Sind province (lanes 3-6). Healthy soybean was used as a negative control (lane 2) and
N. benthamiana infected with PedLCV was used as a positive control (lane 1). Southern blot analysis
with a probe of MYMIV DNA-A (b) to show its presence in N. benthamiana inoculated with MYMIV
and PedLCV (lanes 3-5) MYMIV and CLCuMV (lanes 6-8). Soybean infected with MYMIV was used
as a positive control (lane 1) and healthy N. benthamiana was used as a negative control (lane 2).
Southern blot analysis with a probe of MYMIV DNA-B (c) to show its presence in N. benthamiana
inoculated with MYMIV and PedLCV (lanes 3 and 4), MYMIV, PedLCV and TbLCB (lanes 5 and 6),
MYMIV and CLCuMV (lanes 7 and 8). Soybean infected with MYMIV was used a positive control
(lane 1) and DNA extracted from a healthy N. benthamiana was used a negative control (lane 2).
Southern blot analysis with a probe of PedLCV (d) to show its presence in N. benthamiana inoculated
with MYMIV and PedLCV (lane 2-4) MYMIV, TbLCB and PedLCV (lanes 5-7). DNA extracted from
a healthy N. benthamiana was used a negative control (lane 1). Southern blot probed with CLCuMV
(e) to show presence of the virus in N. benthamiana inoculated with MYMIV and CLCuMV (lanes 2-
5). DNA extracted from a healthy N. benthamiana was used as a negative control (lane 1).
138
Table 5.2 Results of the co-inoculation of the components of MYMIV with PedLCV
and CLCuMV.
Inoculum Host species
Infectivity (plants infected/inoculated)
Symptoms Experiments Total
I II III
PedLCV N. benthamiana 6/6 5/5 6/6 17/17
Severe
upward leaf
curl
MYMIV+
PedLCV soybean
Positive for
MYMIV
(5/10),
Positive for
PedLCV (0/10)
Positive for
MYMIV
(5/10),
Positive for
PedLCV (0/10)
Positive for
MYMIV
(6/10),
Positive for
PedLCV (0/10)
Positive for
MYMIV
(16/30),
Positive for
PedLCV (0/30)
Yellow
mosaics on
leaves
MYMIV+
PedLCV
N. benthamiana
Symptomatic
(3/3), positive
for MYMIV-
A (3/3),
positive for
MYMIV-B
(0/3)
Symptomatic
(5/5), positive
for MYMIV-
A (5/5),
positive for
MYMIV-B
(0/5)
Symptomatic
(5/5), positive
for MYMIV-
A (5/5),
positive for
MYMIV-B
(0/5)
Symptomatic
(13/13),
positive for
MYMIV-A
(13/13),
positive for
MYMIV-B
(0/13)
Severe
upward leaf
curl
MYMIV+
PedLCV+ TbLCB
N. benthamiana
Symptomatic
(3/3), positive
for MYMIV-
A (3/3), positive for
MYMIV-B
(3/3)
Symptomatic
(3/3), positive
for MYMIV-
A (3/3), positive for
MYMIV-B
(3/3)
Symptomatic
(5/5), positive
for MYMIV-
A (5/5), positive for
MYMIV-B
(5/5)
Symptomatic
(11/11),
positive for
MYMIV-A
(11/11), positive for
MYMIV-B
(11/11)
Severe
downward leaf curl
MYMIV+
CLCuMV
N. benthamiana
Symptomatic
(10/10),
positive for
MYMIV-A
(10/10),
positive for
MYMIV-B
(9/10)
Symptomatic
(5/5), positive
for MYMIV-
A (5/5),
positive for
MYMIV-B
(5/5)
Symptomatic
(8/8), positive
for MYMIV-
A (8/8),
positive for
MYMIV-B
(8/8)
Symptomatic
(23/23),
positive for
MYMIV-A
(23/23),
positive for
MYMIV-B
(22/23)
Mild leaf
curl of
emerging
leaves
PedLCV+
TbLCB
N. benthamiana
6/6 3/3 3/3 12/12
Severe
downward leaf curl
5.3.4 Pseudo-recombination among legume-infecting begomoviruses
The ability of the components of MYMV, MYMIV and RhYMV to produce
viable reassortants (pseudo-recombinants) was examined by making reciprocal
exchanges (Table 5.3) in legumes. This study could not be carried out in the
experimental plant N. benthamiana since all three viruses were either non-infectious
139
or poorly infectious to this host. The results show that no combination of DNA-A and
DNA-B component, other than the cognate combinations, were viable and produced
systemic infections of legumes. The earlier analysis of iteron/IRD sequences of the
viruses showed that all three are different from each other (Chapter 3, Section 3.3.1 to
3.3.3) and the lack of interaction is most likely due to this Rep-iteron incompatibility.
Table 5.3 Study of infectivity of MYMIV, MYMV and RhYMV to legumes by
exchanging their components.
Inoculum Plant species
Infectivity (plants infected/inoculated)
Symptoms Experiments Total
I II III
MYMIV blackgram 7/10 8/10 8/10 23/30
Yellow
mosaics on
leaves
MYMV blackgram 4/10 4/10 5/10 13/30
Yellow
mosaics on
leaves
RhYMV soybean 4/10 2/10 5/10 11/30
Yellow mosaics with
cell death on
leaves
MYMIV DNA-A
and MYMV
DNA-B
blackgram 0/10 0/10 0/10 0/30 None
MYMIV DNA-A
and RhYMV
DNA-B
blackgram 0/10 0/10 0/10 0/30 None
MYMV DNA-A
and MYMIV
DNA-B
blackgram 0/10 0/10 0/10 0/30 None
MYMV DNA-A
and RhYMV
DNA-B
soybean 0/10 0/10 0/10 0/30 None
RhYMV DNA-A and MYMIV
DNA-B
soybean 0/10 0/10 0/10 0/30 None
RhYMV DNA-A
and MYMV
DNA-B
soybean 0/10 0/10 0/10 0/30 None
140
5.4 Discussion
At first glance the legume-infecting begomoviruses appear to be typical Old
World, bipartite begomoviruses. However, evidence is accumulating which suggests
that they are not typical of the rest of the bipartite begomoviruses. The LYMVs have
been shown to be genetically distinct from all other begomoviruses and are thought to
represent an evolutionarily ancient lineage. The lack of evidence for recombination
between the LYMVs and the other begomoviruses has been taken to indicate that they
are genetically isolated; possibly legumes not being hosts to the other viruses and
LYMVs not having a host range that extends to non-leguminous species (Qazi et al.,
2007). However, extensive evidence has been published showing the genetic
interaction between distinct LYMVs in the form of component exchange (also known
as pseudo-recombination). The LYMVs are thus interesting for study not only due to
the losses they cause to crops, but also due to their unusual biological characteristics.
Although component exchange is well documented for the LYMVs (reviewed
by Qazi et al., 2007) the experiments conducted here were unable to demonstrate
pseudo-recombination for the three viruses used in this analysis. For viruses with
multipartite genomes it is important for there to be a strong mechanism of maintaining
genome integrity, despite the long term evolutionary advantages of component
exchange (Jeske, 2009). For bipartite begomoviruses this is mediated by the highly
specific interaction between the Rep (specifically the iteron related domain at the N-
terminus of Rep; Argüello-Astorga and Ruiz-Medrano, 2001) and the Rep binding
sequences (the iterons; Argüello-Astorga et al., 1994) which are contained within the
CR shared by the two components. Analysis (Chapter 3, Section 3.3) showed that the
three viruses included in the analysis have very distinct predicted iterons and IRDs. It
is likely the lack of compatibility between the distinct iterons and IRDs, preventing
initiation of replication of heterologous components, is responsible for the lack of
pseudo-recombination, although the relatively low infectivity of the viruses to
legumes by Agrobacterium-mediated inoculation could also play a part in this.
Analysis of cases where pseudo-recombination has been shown to occur (in the
literature) indicates that in each case this is due to exchange of the CR from a DNA-A
component to an heterologous DNA-B component (known as “origin donation” [Qazi
et al., 2007] or “regulon grafting” [Saunders et al., 2002]). In these cases the DNA-B
has been made compatible by introducing suitable iterons into the DNA-B component
(from the DNA-A component) by recombination. Similar origin exchanges have also
141
been noted for the begomovirus-associated betasatellites (Saunders et al., 2001;
Briddon et al., 2001; Tao and Zhou, 2008) indicating that it is a general evolutionary
adaptation. Although, judging from the literature, one might conclude that for
LYMVs origin exchange occurs frequently, the results presented here suggest this
might not be the case. Certainly in one round of inoculation, no pseudo-recombination
was detected (no plants became infected). Possibly by using a more susceptible and
longer living host (such as a perennial leguminous weed), by inoculating a much
larger number of plants or by using a forced recombination system (as reported by
Schnippenkoetter et al., 2001) it may be possible to achieve a pseudo-recombination
event experimentally and thus gain some idea of the frequency of this occurring.
N. benthamiana is the model host of choice for the investigation of the
infectivity of many viruses, including the dicot-infecting geminiviruses. At least for
RNA viruses the highly susceptible nature of N. benthamiana has been attributed to it
encoding a mutant (possibly defective) variant of the RNA-dependant RNA
polymerase 1; a gene involved in anti-viral defense (Yang et al., 2004) All dicot-
geminiviruses investigated have been shown to be infectious to this host with the
exception of the LYMVs. Although relatively little work on the infectivity of LYMVs
to plants has been published, of the work that has been published, none reports
infectivity to N. benthamiana and only one report trying N. benthamiana as a host
(Maruthi et al., 2006 ). The reason for this now becomes clear, N. benthamiana is not
a host for the LYMVs. At very low efficiency, the viruses are able to move
systemically in this host but do not induce any noticeable symptoms. It has previously
been shown for a number of bipartite begomoviruses that, at low efficiency, the DNA-
A is capable of systemic infection in N. benthamiana in the absence of DNA-B
(Klinkenberg et al., 1989; Evans and Jeske, 1993; Briddon and Markham, 2001).
DNA-A is capable of autonomous replication in host cells (Evans and Jeske, 1993;
Regers et al., 1986; Townsend et al., 1986) whereas the DNA-B provides movement
functions (Noueiry et al., 1994; Frischmuth et al., 2007; Sanderfoot and Lazarowitz,
1995). The phenomenon of independent infection by DNA-A was attributed to the
method of inoculation (using Agrobacterium) since it did not occur following
inoculation by the biolistic method. Klinkenberg et al. (1989) suggested that
Agrobacterium-mediated inoculation induced cell division leading to shedding of
encapsidated DNA-A into the phloem. This was then able to spread in the phloem and
re-infect cells, at low efficiency, distal to the inoculation site. Due to the absence of
142
DNA-B, however, the infection was unable to spread further and induce symptoms.
The situation with the LYMVs is very similar, with the exception that, even in the
presence of DNA-B, a symptomatic infection does not ensue. This thus suggests that
the defect in LYMVs, with respect to lack of symptomatic infection of N.
benthamiana, rests with their DNA-B components. It is likely their DNA-B encoded
movement proteins (MP and NSP) are not well adapted to function in a non-
leguminous host and are unable to mediate movement of the viruses.
Inoculation of any of the LYMV DNA-A components with TbLCB led to a
full, symptomatic systemic infection, indicating that this betasatellite can complement
movement in N. benthamiana. This finding is in agreement with the results of Saeed
et al. (2007) who showed that CLCuMB can complement the movement functions of
ToLCNDV DNA-B by mediating the movement of the DNA-A in N. benthamiana.
This was the first evidence showing a possible virus movement function encoded by
betasatellites. The details of the mechanism of movement mediated by betasatellites
remain unclear. However, thus far, all functions encoded by betasatellites have been
shown to be mediated by βC1, the only gene product encoded by these satellites; this
includes suppression of post-transcriptional gene silencing (Gopal et al., 2007) and
symptom determination/pathogenicity (Saunders et al., 2004). The ability of TbLCB
βC1 expressed from a PVX vector to similarly mediate the movement of MYMIV
DNA-A (in both the presence and absence of DNA-B) confirmed this was due to βC1.
Further evidence for βC1 possessing a virus movement function was
provided by transient expression of this gene. Expressed under the control of the 35S
promoter, βC1 increased the numbers of plants in which DNA-A (or DNA-A and
DNA-B) was detectable in systemic leaves in comparison to experiments where DNA
A (or DNA-A and DNA-B) was/were inoculated in the absence of βC1. However, the
amount of DNA in infected tissue of plants was less than when βC1 was expressed
from the PVX vector, indicating that PVX itself has some part to play in this
phenomenon. Interestingly, when expressed transiently in the presence or absence of
MYMIV components, the plants remained symptomless, suggesting that the βC1
protein does not have the capacity to move systemically. This finding differs from the
results of a similar study involving CLCuMB βC1 and ToLCNDV DNA-A, which
induced mild systemic symptoms (Saeed et al., 2007). Since βC1 is a strong symptom
determinant, and the symptoms induced in their experiment were not typical of this
protein, it is possible that the differences in their results in comparison to our findings
143
are due to the different viruses used. ToLCNDV is well adapted to plants of the
Solanaceae and it is thus possible that the DNA-A of this virus has some ability to
move out of the phloem and replicate in additional tissues distal to the inoculation site
and thus induce symptoms.
Lack of infectivity of MYMIV to N. benthamiana is probably due to lack of
adaptation of the products encoded by DNA-B which have limited ability to mediate
virus movement in this host. However DNA-B appears to have some role to play
since its presence increases the infectivity of DNA-A and TbLCB from 60% to 100%
of inoculated plants. Based on the hypothesis put forward by Klinkenberg, Ellwood
and Stanley (1989), as described earlier, it would appear that despite its lack of
adaptation to N. benthamiana, the DNA-B may be able to provide some movement
function in this host, possibly pushing more virus into the phloem. This is supported
by the fact that inoculation with the MP gene under the control of the 35S promoter
increased infectivity of DNA-A and TbLCB from 60% to 100% of inoculated plants.
Since expression of NSP had no effect on proportion of plants infected, it also shows
that the effect is mediated by MP. For bipartite begomoviruses, MP is the major
symptom determinant, and the expression of this protein induces disease-like
symptoms (Brough et al., 1988; Duan et al., 1997; Etessami, et al., 1988; Hou et al.,
2000; Ingham et al., 1995; Pascal 1993). Here we have shown that expression of the
MP of MYMIV from a PVX vector in N. benthamiana induces cell death at the site of
inoculation and severe leaf curling (as will be presented in Chapter 6, Section 6.3.1)
in systemic leaves which is an indication of its importance in pathogenicity.
To further investigate the reason for the restricted movement of DNA-B of
LYMVs in N. benthamiana, the genes encoded by MYMIV DNA-B were individually
mutated and inoculated with DNA-A. No significant effect of these mutations was
observed on infectivity of MYMIV to N. benthamiana. However, DNA-B with a
double mutation produced somewhat unexpected results. All N. benthamiana
inoculated with DNA-A, DNA-BΔNSPΔMP
and TbLCB were symptomless and no viral
DNA was detected in systemic leaves by PCR. This was surprising since inoculation
of DNA-A with TbLCB typically gave an infectivity of 60% in plants. Since in this
case neither of the DNA-B gene products is expressed, it is likely that this lack of
spread of MYMIV DNA-A is due to interference in replication. Nevertheless the lack
of any detectable viral DNA in systemic leaves is surprising and difficult to explain
without further investigation. A possibly similar situation, of replicational interference
144
has been encountered with betasatellites. Saunders et al. (2001) showed that in
infections of Ageratum conyzoides involving AYVV and a recombinant betasatellite,
containing the origin of replication of AYVV, symptoms were less severe and virus
DNA levels were less than in infections involving the cognate betasatellite, Ageratum
yellow vein betasatellite. For a similar recombinant betasatellite of Tomato yellow
leaf curl China betasatellite (TYLCCNB) and Tomato yellow leaf curl China virus
(TYLCCNV), Tao and Zhou (2008) showed that infections involving the recombinant
betasatellite, TYLCCNV and TYLCCNB led to reduced accumulation of viral DNA,
presumably due to replicational interference. It is thus possible that in the case
described here, involving MYMIV DNA-A, TbLCB and a DNA-B with both genes
mutated, that maintenance of two molecules (DNA-B and the betasatellite) with
distinct but compatible origins of replication reduce virus replication to such an extent
that insufficient betasatellite is produced and hence insufficient βC1 is expressed to
allow systemic spread. However, care needs to be taken in interpreting all these
results with mutants of DNA-B of MYMIV since the differences in numbers of plants
infected systemically are small and a far greater number of plants would need to be
analysed to obtain statistically significant results.
Complementation of movement for bipartite begomoviruses has been
investigated in some depth. For example, Frischmuth et al. (1993) investigated the
ability of Old and New World bipartite begomoviruses to trans-complement the
movement of heterologous DNA-A components in the absence of the cognate DNA-B
component. They concluded that there was an evolutionary divergence between Old
and New World begomoviruses, based on the demonstration that an Old World virus
could complement the movement of New World DNA-A components but that the
reciprocal was not successful. Also, Briddon et al. (2001) demonstrated that a
curtovirus and a topocuvirus could complement the movement of the DNA-A
components of both a New World and an Old World bipartite begomovirus in the
absence of their cognate DNA-B components. Here we have extended these earlier
findings to show that monopartite begomoviruses can facilitate the movement of a
bipartite begomovirus. PedLCV and CLCuMV can complement movement of
MYMIV in N. benthamiana. Since the host range of MYMIV does not extend to N.
benthamiana (as discussed earlier), the findings also show that the complementation
by monopartite begomoviruses (and possibly bipartite begomoviruses, although that
possibility was not investigated here) also has the capacity to increase the host range
145
of LYMVs. Thus in this case the components of MYMIV were able to systemically
infect N. benthamiana at high efficiency in the presence of either PedLCV or
CLCuMV. This has important epidemiological implications. It suggests that, in spite
of their strict host range limitation (to legumes), LYMVs can use non-leguminous
plant species as intermediate hosts, and possibly also as “overwintering” hosts, by
associating with begomoviruses that infect non-leguminous hosts. Of course this
requires that a polyphagous B. tabaci biotype (one that feeds on leguminous as well as
non-leguminous plants) be present for transmission of the viruses. The presence of
PedLCV (Chapter 3), Tomato leaf curl Karnatka virus (Raj et al., 2006a) and Cotton
leaf curl Kokhran virus (Raj et al., 2006b) in soybean, Tomato leaf curl New Delhi
virus in pigeonpea (Raj et al., 2005) and cowpea (Reddy et al., 2005) may be
evidence supporting this theory. These viruses possibly being the “helper viruses” that
were used by the LYMVs to overwinter in a non-leguminous host prior to infection of
the legume crop in which they were identified.
146
Chapter 6
Plant responses to transient expression of MYMIV genes and a study
of RNAi-mediated resistance
6.1 Introduction
A gene is the basic unit of heredity in a living organism. It expresses itself in
the form of protein and plays its role. While whole genome sequences are the basis of
further characterization, the identification of gene functions is needed for further
functional genomics based on genome sequences. In addition to comprehensive
expression analysis with a DNA microarray to characterize gene expression, the
ectopic expression of a target gene in heterologous host cells is useful for
understanding gene functions. RNA virus based vectors such as Potato virus X (PVX)
have been proved a very useful tool for this purpose. The PVX vector (pGR107; Lu et
al., 2003) itself gives very mild symptoms in solanaceous plants such as N.
benthamiana and N. tabacum. However, when a gene is inserted in the vector under
the control of the duplicated coat protein promoter it is expressed along with the other
PVX proteins during infection. The PVX vector has been used to express numerous
foreign genes in many host plants (Roggero et al., 2001). For example, PVX-mediated
expression of the CP gene of Turnip crinkle virus mediates suppression of RNA
silencing (Thomas et al., 2003). Similarly a chimaeric virus PVX-p22 containing p22
of Tomato bushy stunt virus (TBSV) trans complement TBSV cell-to-cell movement
mutant and PVX-p19 containing p19 of same virus induced systemic necrosis in N.
benthamiana (Scholtof et al., 1995).
Gene silencing techniques are also good for characterizing gene functions in
target cells since the disruption of gene expression often shows a more critical
phenotype. In geminiviruses, Tomato golden mosaic virus (Peele et al., 2001;
Kjemtrup et al., 1998 ), Cabbage leaf curl virus (Muangsan et al., 2004, Turnage et
al., 2002), African cassava mosaic virus (Fofana et al., 2004) and Tomato yellow leaf
curl China betasatellite (Tao X and Zhou, 2004) have been used as silencing vectors.
The PVX vector is also used as Virus-Induced Gene Silencing (VIGS) vector
(Lacomme and Chapman, 2008; Faivre et al., 2004) in which plant endogenous genes
are silenced using viruses. One example of the use of the PVX as a VIGS vector was
in the down regulation of RdR6 in N. benthamiana. This silencing made N.
147
benthamiana susceptible to many RNA viruses (Qu et al., 2005). RDR6 is a putative
RNA dependent RNA polymerase (RdRP) originally identified as required for RNA
silencing of transgenes (Dalmay et al., 2000; Mourrain et al., 2000). RDR6 has been
shown to be necessary for the continued silencing of a transgene after the complete
elimination of inducer RNA, the cell-to-cell movement of the RNA silencing signal,
and the spread of silencing along the target RNA to sequences beyond the region that
is homologous to the trigger molecule (Dalmay et al., 2001; Himber et al., 2003;
Klahre et al., 2002; Vaistij et al., 2002). VIGS differs from transgene-mediated
silencing at the initiation stage because the primary dsRNA inducer is generally
thought to be the viral double-stranded replication intermediates, hence circumventing
the requirement of a host RdRP. However, virus-induced silencing is similar to
transgene-mediated silencing at the maintenance stage in that both require siRNA
amplification and an intercellular silencing signalling. Indeed, several studies have
shown that plant viral silencing suppressors function primarily by preventing the
movement of silencing signals out of the initially infected cells (Havelda et al., 2003;
Qu and Morris, 2002; Qu and Morris, 2003; Voinnet et al., 2000). Therefore, plants
encoding defective RDR6 would be expected to become more susceptible to virus
infections.
Gene silencing through RNA interference (RNAi) is also used for the
development of resistance in plants against viruses. In RNAi double-stranded RNA
(dsRNA) molecules are generated. The resulting dsRNA molecules are digested into
21-25 nucleotide-long small interfering RNA (siRNA) by Dicer (an RNaseIII like
enzyme). This siRNA acts as a template for the targeted degradation of messenger
RNA (mRNA) by RISC (RNA-induced silencing complex). In general RNAi has two
potential mechanisms for down-regulating gene expression; post transcriptional gene
silencing (PTGS) through either mRNA degradation or translational arrest, and
transcriptional gene silencing (TGS) via the methylation of DNA (Baulcombe, 2004).
The suppression of gene expression by RNAi was used before the discovery of the
mechanisms of gene silencing. Plants carrying a transgene derived from the replicase
genes of PVX (Mueller et al., 1995), Cowpea mosaic virus (Sijen et al., 1995) and
Pepper mild mottle tobamovirus (Tenllado et al., 1995, 1996) were resistant to related
viruses. Tobacco plants expressing a transgene encoding the CP of subgroup II strain
of Cucumber mosaic virus were resistant to the strain of same subgroup (Jacquemond
et al., 2001). PTGS of the p23 silencing suppressor of Citrus tristeza virus confers
148
resistance to the virus in transgenic Mexican lime (Fagoaga et al., 2006). RNAi has
also been used for resistance against geminiviruses.
In their response to pathogens, plants sometimes respond with programmed
cell death, known as hypersensitive response (HR), at the site of contact. HR occurs in
race-specific disease resistance mediated by a host disease R (resistance) gene and the
corresponding pathogen avr (avirulence) gene in an allele-specific manner (Flor,
1971). It is characterized by rapid calcium and other ion fluxes, an extracellular
oxidative burst, and transcriptional reprogramming (Scheel, 1998). HR and disease
resistance are intricately linked in plants, exemplified by the simultaneous induction
of disease resistance and activation of cell death upon pathogen recognition by R
proteins. A number of signalling molecules are involved in disease resistance
including reactive oxygen species (ROS), salicylic acid (SA), and nitric oxide
(Shirasu and Schulze-Lefert, 2000). ROS accumulate preceding cell death during HR,
with biphasic oxidative bursts (Lamb and Dixon, 1997).
6.2 Methodology
MYMIV potentially encodes nine genes on its two genomic components. All
these genes were individually amplified by PCR with specific primers (Table 2.1)
from cloned DNA-A (MI15) and DNA-B (MI21) components; clones which were
previously shown to be infectious to legumes (Chapter 4). Each gene was cloned in
pTZ57R/T using an InsTAclone PCR Cloning Kit (Fermentas) and then transferred to
the PVX vector pGR107 and a movement deficient version of this PVX vector. The
movement deficient PVX was kindly provided by Ms. Javaria Qazi who mutated the
25K movement protein essentially as described by Morozov et al. (1997). AV2, CP,
AC5, REn, TrAP, Rep and AC4 were cloned in the PVX and the movement deficient
PVX vector at SmaI and SalI using restriction sites introduced in the primers.
Similarly NSP was cloned at ClaI and SalI and MP was cloned at ClaI and SmaI
restriction sites. For cloning of the βC1 gene from TbLCB in the PVX vector, it was
amplified with specific primers (βC1-PVX Forward and βC1-PVX Reverse; Table
2.1) and cloned in pTZ57R/T by using an InsTAclone PCR Cloning Kit (Fermentas)
and then transferred to the PVX vector at SmaI and SalI restriction sites. All PVX
constructs were transferred to Agrobacterium strain GV3101 and agroinoculated to
Nicotiana benthamiana and Nicotiana tabacum.
149
To replace the CP gene of MYMIV DNA-A (MI15) with GFP, specific
primers (A6GFPF and A6GFPR; Table 2.1) were used to amplify DNA-A without the
CP gene. Restriction sites MluI and SalI were included in the forward and reverse
primers respectively. The amplified product was cloned in pTZ57R/T in such a way
that the SacI restriction site in the MCS of pTZ57R/T was adjacent to the MluI site of
amplified fragment. The GFP gene (Kindly provided by Dr. Saeed) was amplified
with primers (MIGFPF and MIGFPR; Table 2.1) with a SalI site included in the
forward primer and an MluI site in the reverse primer. The product of about 0.7 kb
was cloned in pTZ57R/T in such a way that the SacI restriction site in the MCS of
pTZ57R/T and the MluI site in the amplified product were on opposite ends. The GFP
gene was excised from pTZ57R/T with MluI and SacI, gel purified and ligated with
linearized (digested with MluI and SacI) DNA-A without CP in pTZ57R/T. In this
way a 2.7 kb DNA-A component was produced in which CP had been replaced with
GFP and the AV2 gene was truncated (DNA-A-GFPΔAV2
). To produce a partial dimeric
clone of DNA-A-GFPΔAV2
, it was digested with SalI and EcoRI and an approx. 1.25 kb
DNA fragment was cloned in the binary vector pBin19 (Bevan, 1984). This partial
fragment of DNA-A in pBin19 was digested with SalI and the full length insert of
DNA-A-GFPΔAV2
was ligated into it to produce a partial direct repeat construct of the
component. DNA-A-GFPΔAV2
along with DNA-B of MYMIV was agroinoculated to
blackgram and soybean and both components along with TbLCB were agroinoculated
to N. benthamiana.
The AV2 gene encoded by the DNA-A component of MYMIV from
mungbean (MI15) was mutated using a unique BamHI restriction site (nucleotide
position 161). The full-length insert of clone MI15 was cloned in a pBluesript vector
lacking a BamHI site in the MCS. The unique BamHI site was digested and the 3′
recessed ends of the DNA were in-filled by using Klenow fragment in a reaction
mixture of 20 µl containing 0.1-4 µg digested DNA, 2 µl of 10X Klenow reaction
buffer (500 mM Tris-HCl [pH8.0 at 25 ˚C], 50 mM MgCl2, 10 mM DTT) 0.05 mM
dNTPs and 1-5u Klenow fragment. The reaction mixture was incubated at 37 ˚C for
10 minutes and the reaction was stopped by heating to 75˚C for 10 minutes. In this
way a frame shift mutation was introduced by adding four nucleotides in the DNA
and the BamHI restriction site was lost. This AV2 mutated DNA-A component
(DNA-AΔAV2
) was used to produce a partial direct repeat construct for
agroinoculation. DNA-AΔAV2
was digested with HindIII and BamHI and an approx.
150
1.8 kb DNA fragment was cloned in pBin19. This partial clone of DNA-AΔAV2
in
pBin19 and full length clone of DNA-AΔAV2
in pBluescript II KS/SK (+) vector were
digested with HindIII and full length insert of DNA-AΔAV2
was ligated into the
linearised pBin19 clone.
To silence the RNA-dependent RNA polymerase 6 (RdR6) in N. benthamiana,
specific primers (RdR6F and RdR6R; Table 2.1) were designed on the basis of the
sequence of RdR6 from N. benthamiana (accession no.AY722008; Qu et al., 2005).
A 1003 nucleotides long N-terminal fragment of RdR6 was PCR amplified and cloned
in the PVX vector (pGR107) in antisense orientation at SalI and ClaI sites. This clone
was transferred to Agrobacterium strain GV3101.
An antisense construct of the Rep gene encoded by the DNA-A component of
MYMIV (MI15), was produced by digesting the clone with ClaI and XhoI to yield a
409 nt. fragment. This was cloned in the PVX vector pGR107 in an antisense
orientation (asRep-PVX) at ClaI and SalI sites and transferred to Agrobacterium
strain GV3101.
6.3 Results
6.3.1 Transient expression of MYMIV genes from the PVX vector
The AV2 gene (also known as the pre-coat protein gene) when expressed from
the PVX vector in N. benthamiana induced a hypersensitive response (HR),
characterised by cell death, at the site of inoculation one week after inoculation (Fig.
6.2a). The first symptoms of infection (mild leaf curling) appeared ten days after
inoculation. After two weeks there was severe downward leaf curl of emerging leaves
(Fig. 6.2b) and plants exhibited stunted growth and flower setting started early. This
contrasted with plants inoculated with the PVX vector (with no insert) which showed
a very mild vein yellowing on leaves (Fig. 6.1b) appearing ten days after inoculation.
There was no effect of AV2 expression on N. tabacum. Plants exhibited only
symptoms typical of PVX (mild vein yellowing) in this host (Fig. 6.1d).
Expression of the MYMIV coat protein (CP) in N. benthamiana from PVX
induced mild leaf crumpling approx. thirteen days after inoculation which gradually
increased in severity. Emerging leaves were severely deformed and showed a
pronounced vein yellowing (Fig. 6.2d). Growing points of the plants were severely
affected and growth ceased (Fig. 6.2c). There was no effect of CP expression on N.
tabacum, with Plants only expressing the symptoms typical of PVX.
151
In N. benthamiana PVX-mediated expression of AC5 gave a mild leaf curl
and light green mosaics across the leaf lamina approx. twelve days after inoculation.
Mosaics continued to increase in size with time and fused with each other leaving just
a few dark green islands (Fig. 6.2e and f). However, in N. tabacum no obvious
phenotype resulted from AC5 expression with only symptoms typical of PVX evident.
PVX-mediated expression in N. benthamiana of the MYMIV TrAP gave HR
at inoculation site after one week (Fig.6.3a). Leaf curling appeared in emerging leaves
and after approximately thirteen days necrosis was evidenced along the veins in
mature leaves (Fig. 6.3b). After three weeks leaves were severely necrotic and
bleached (Fig. 6.3c). In N. tabacum expression of TrAP induced only an HR at the
site of inoculation (Fig. 6.3d).
Expression of Rep of MYMIV from the PVX vector in N. benthamiana
induced cell death at inoculation site on leaves after one week. No other symptoms
appeared until approx. fifteen days after incoulation when a mild necrosis became
evident along the veins of emerging leaves. Mild leaf curling was also seen in some
leaves (Fig. 6.3e and f). Necrosis persisted for 4 to 5 days without further increase in
severity and after this symptoms on affected leaves gradually faded and newly
emerging leaves were symptomless. Expression of Rep in N. tabacum induced no
discernable phenotype beyond the typical symptoms of PVX.
In N. benthamiana infected with PVX expressing the AC4 gene the first
symptoms (mild leaf curling and vein yellowing) appeared after ten days. At fifteen
days post-inoculation there was a pronounced downward leaf curling, vein yellowing
and thickening and necrosis along the veins, particularly at the base of the leaves
(Fig.6.4a and b).
Expression of the MP induced an HR at the site of inoculation on leaves in N.
benthamiana (Fig.6.4c). This was followed by a severe downward leaf curling and
necrosis along the veins on leaves (Fig. 6.4d) after eleven days. Expression of MP in
N. tabacum induced no phenotype except the typical symptoms of PVX.
MYMIV REn and NSP expressing from the PVX vector did not result in a
phenotype in N. benthamiana and N. tabacum beyond that induced by the vector
alone. The results of the expression of the genes of MYMIV from the PVX in N.
benthamiana are summarised in Table 6.1. Additionally the MYMIV genes were
cloned in a version of the PVX vector with the triple gene block 25K gene mutated.
When inoculated to N. benthamiana none of the MYMIV gene products were able to
152
complement the 25K mutation; none of the genes allowed PVX to spread systemically
as judged by the production of symptoms on newly emerging leaves.
Fig. 6.1 Photographs of healthy plants of N. benthamiana (a), N. tabacum (c) and plants of each species
(N. benthamiana [b], N. tabacum [d]) infected with PVX. Photographs were taken approx. 20 days
after inoculation.
153
Fig. 6.2 Photographs of N. benthamiana plants infected with PVX expressing the MYMIV AV2 (a and
b), PVX expressing the MYMIV coat protein (c and d) and PVX expressing the MYMIV AC5 (e and
f). Photographs were taken approx. 20 days after inoculation.
154
Fig. 6.3 Symptoms induced by PVX expressing the TrAP of MYMIV in N. benthamiana (a-c) and in
N. tabacum (d) or the Rep of MYMIV in N. benthamiana (e and f). Photographs were taken approx. 20
days after inoculation.
155
Fig. 6.4 Symptoms induced by expression of AC4 (a and b) and MP (c and d) of MYMIV and βC1 (e
and f) of TbLCB from the PVX vector in N. benthamiana. Photographs were taken approx. 20 days
after inoculation.
156
Table 6.1 Summary of the results of the expression of MYMIV genes from the PVX
vector in N. benthamiana.
Gene Latent period *(days) Symptoms
PVX (no insert) 10 Mild veins yellowing and thickening and very light
mosaics on lamina.
AV2 10
Cell death at inoculation site, severe downward
curling of top leaves, stunted growth, early
flowering.
CP 13 Mild leaf crumpling, emerging leaves were
deformed and vein yellowing.
AC5 12 Mild leaf curling, appearance of light green angular
mosaics across the leaf .
REn 10 Only PVX symptoms
TrAP 13
Cell death at the site of inoculation, leaf crumpling
and necrosis along the veins, after three weeks
leaves exhibited a severe chlorotic mosaic.
AC4 10
Downward leaf curling, vein yellowing and
thickening. Necrosis along the veins, particularly at
the base of the leaves.
Rep 15 Cell death at the site of inoculation, mild necrosis
along the veins, symptoms recovered after 25 days.
NSP 10 Only PVX symptoms
MP 11 Cell death at the site of inoculation, severe
downward leaf curling and necrosis along the veins.
*Time between inoculation and appearance of first symptoms.
6.3.2 Expression of TbLCB βC1 gene from the PVX vector
The βC1 gene of TbLCB when expressed from the PVX vector induced very
severe leaf curling, stem deformation and enations on underside of leaves in N.
benthamiana (Fig. 6.4e and f). There was no response to expression of this gene in N.
tabacum with only symptoms typical of PVX evident.
157
6.3.3 Mutation of MYMIV AV2 and replacement of CP gene with the GFP gene
To study the importance in infectivity of MYMIV to legumes and as a
potential candidate for replacement with reporter genes, the CP gene was replaced
with the GFP gene. However in this replacement the AV2 coding sequence was also
truncated. A partial tandem repeat construct of MYMIV DNA-A-GFPΔAV2
along with
the DNA-B was agroinoculated to mungbean, blackgram and soybean but no infection
resulted and no GFP expression could be seen in inoculated plants under UV
illumination. The construct was also inoculated to N. benthamiana along with TbLCB
but again no infectivity was evident and no GFP expression was detected.
Bull et al. (2007) showed that for EACMZV CP and AV2 expressions were
closely linked and mutation of AV2 down regulated CP expression. Plants infected
with the mutant had low levels of viral DNA accumulation. To study the importance
of AV2 in the infectivity of MYMIV to legumes the AV2 gene was mutated. The
mutant virus, DNA-AΔAV2
, and DNA-B of MYMIV were agroinoculated to
blackgram. All inoculated plants remained symptomless and no virus could be
detected in newly emerging leaves of inoculated plants by PCR. However control
plants inoculated with wild type MYMIV were infected (Table 6.2).
Table 6.2 Study of the effect of the mutation of the CP and AV2 on infectivity of
MYMIV to plants.
Inoculum Plant species
Infectivity (plants infected/plants
inoculated)
Symptoms Experiment Total
I II III
MYMIV DNA-A
+ DNA-B
blackgram 7/10 8/10 8/10 23/30
Yellow mosaics
on leaves
MYMIV DNA-A-GFPΔAV2
+ DNA-B
blackgram 0/20 0/20 0/20 0/60 None
MYMIV DNA-A
+ DNA-B
soybean 6/10 7/10 6/10 19/30
Yellow mosaics
on leaves
MYMIV DNA-A-GFPΔAV2
+ DNA-B
soybean 0/20 0/20 0/20 0/60 None
MYMIV DNA-A
+ DNA-B + TbLCB
N. benthamiana 6/6 6/6 6/6 18/18 Leaf curling
MYMIV DNA-A-GFPΔAV2
+ DNA-B + TbLCB N. benthamiana
0/6 0/6 0/6 0/18 None
MYMIV DNA-A-ΔAV2
+ DNA-B
blackgram 0/20 0/20 0/20 0/60 None
158
6.3.4 Silencing of RdR6 in Nicotiana benthamiana
In contrast to all other dicot-infecting geminiviruses, MYMIV does not
systemically infect N. benthamiana. The analyses conducted in Chapter 5 have shown
that this lack of infectivity is likely due to poor adaptation of the gene products
encoded by MYMIV DNA-B. Thus, although the virus can replicate in N.
benthamiana, it appears unable to spread from the site of inoculation. This is despite
the fact that N. benthamiana has a mutant (possibly non-functional) RDR1, which is
believed responsible for the highly susceptible nature of this plant species to a range
of phytopathogenic viruses (Yang et al., 2004b). Qu et al. (2005) showed that down-
regulation of RDR6 in N. benthamiana led to an enhanced susceptibility of this
species to a range of RNA viruses. To investigate the possible involvement of this
gene in the lack of infectivity to N. benthamiana of MYMIV, RdR6 was silenced by
VIGS using the PVX vector. RdR6 silenced plants were agroinoculated with MYMIV
infectious clones and after three weeks tested for the presence of the virus. All
inoculated plants were showing the typical symptoms of PVX infection and 9 out of
20 (45%) plants were positive (by PCR diagnostics) for both components of MYMIV
in systemic tissues. Control plants, which were inoculated with the components of
MYMIV and just the PVX vector (with no additional gene) also showed the presence
of the virus in 6 out of 20 (30%) plants. Plants which were inoculated only with
MYMIV were symptomless and 3 out 20 plants (15%) were positive for the virus.
This indicates that RDR6 has an effect on the ability of MYMIV to infect N.
benthamiana. Down-regulation of the expression of this gene leads to an increase in
the numbers of plants that ultimately contain MYMIV in systemic tissues.
6.3.5 Investigation of the use of RNAi to provide resistance against MYMIV in
plants
Due to the problem of stable transformation, RNAi studies are difficult in
legumes. The lack of infectivity of MYMIV to N. benthamiana (Chapter 4) precludes
using this model host for investigating the use of RNAi to obtain resistance to
MYMIV. A novel strategy was thus adopted to investigate the potential use of RNAi
to provide resistance against this virus in N. benthamiana. TbLCB, which was shown
to mediate full symptomatic systemic infection of MYMIV (or even only the DNA-A
component of this virus; Chapter 5), was used to assist the virus in N. benthamiana,
159
allowing RNAi constructs which target the DNA-A component to be tested transiently
for their ability to provide resistance against the virus.
An antisense construct of the central region of the Rep gene of MYMIV was
produced in the PVX vector (asRep-PVX). Plants were agroinoculated with asRep-
PVX, the DNA-A and DNA-B components of MYMIV and TbLCB. Twenty days
after inoculation 2 out of 20 (10%) plants showed the symptoms typical of infection
of MYMIV supported by TbLCB, exhibiting severe leaf curling (as discussed in
Chapter 5). The remainder of the plants showed only enhanced PVX-like symptoms
(vein yellowing, thickening and mosaics on lamina), symptoms also exhibited by
plants inoculated with only asRep-PVX. In contrast, all plants (twenty in number)
inoculated with the components of MYMIV and TbLCB showed the severe symptom
phenotype. Southern blot analysis showed that in the plants co-inoculated with
MYMIV, TbLCB and the asRep-PVX construct, MYMV DNA-A could be detected
at low levels in a small number but was no detectable in others. However, in plants
inoculated with only the components of MYMIV and TbLCB viral DNA levels were
high (Fig 6.5).
This brief study thus shows that firstly the use of TbLCB to overcome the lack
of infectivity of MYMIV to N. benthamiana can be useful for assessing the efficacy
of resistance in this model host plant species and secondly that RNAi-mediated
resistance has the potential to yield resistance to MYMIV. Further experiments are
now required to demonstrate the reproducibility of these results.
160
Fig. 6.5 Southern blot probed for the presence of MYMIV DNA-A. Samples run on the gel were total
nucleic acids extracted from N. benthamiana plants co-agroinoculated with the DNA-A and DNA-B
components of MYMIV, TbLCB and asRep-PVX (lanes 3-6) or MYMIV DNA-A, DNA-B and
TbLCB (lanes 7-10). Nucleic acids in lanes 1 and 2 were extracted from a soybean plant
experimentally infected with MYMIV and a healthy N. benthamiana, respectively. Approximately 10
µg of total DNA was loaded in each case. The position of ssDNA is indicated by an arrow.
6.4 Discussion
The work described here represents the first study of the phenotypes induced
by the transient expression of each of the genes of MYMIV in N. benthamiana in the
absence of other geminiviral proteins. N. benthamiana is not a host for MYMIV
(Chapter 4, Section 4.3.1) and therefore this study may provide an insight into virus-
non-host interactions, possibly providing information on the lack of adaptation of this
virus to N. benthamiana.
Of the MYMIV genes only two, REn and NSP, did not induce a phenotype in
N. benthamiana, when expressed from PVX, above and beyond the mild vein
yellowing symptoms induced by the vector itself. REn is a protein required by the
majority of dicot-infecting geminiviruses for optimal genome replication (Settlage et
al., 2005), although it is not essential for replication. It is a homo-oligomer that
interacts with Rep and at least three host encoded proteins, PCNA, pRBR and a
transcription factor in the NAC family (Settlage et al., 2005; Selth et al., 2005).
161
Evidence suggests that REn acts by protein-protein interactions since no catalytic
activity has been demonstrated for this protein. TGMV mutants with the REn gene
mutated replicated far less efficiently than their wild-type counterparts (giving lower
viral DNA levels) with delayed and attenuated symptoms (Sunter et al., 1990).
Expression of the ToLCV REn gene from a TMV vector caused stunting in N.
benthamiana (Selth et al., 2004) which may be due to the protein interfering with cell-
cycle, possibly by interactions with pRBR. The lack of apparent effect due to similar
expression of the MYMIV REn protein from a PVX vector may thus indicate that this
is unable to interact with one or more host factors and hence could be the reason for
poor replication of the virus in N. benthamiana. However experiments have shown
that MYMIV DNA-A can replicate to normal level in the presence of TbLCB in this
host (Chapter 5), suggesting that this is not the case. The lack of a phenotype induced
may thus indicate either that REn does not contribute significantly in replication of
MYMIV in N. benthamiana or that it can interact with host factor without affecting
the normal phenotype of the plant. It is possible that the effects of REn expression are
minor, not evident at the whole plant level, requiring microscopy to detect. Future
studies should investigate this possibility.
Although PVX-mediated expression of MYMIV NSP in N. benthamiana did
not elicit a phenotype, expression of the MP induced downward leaf curling, necrosis
at the site of inoculation and a systemic veinal necrosis. This is consistent with a
number of previous studies of (bipartite) New World begomoviruses (Duan et al.,
1997; Hou et al., 2000; von Arnim and Stanley, 1992b; Smith and Maxwell, 1994)
and indicates that MP is a symptom determinant. However, these results differ from a
similar study of the bipartite Old World begomovirus Tomato leaf curl New Delhi
virus (ToLCNDV; Hussain et al., 2005), using both PVX expression and stable
transformation, that showed the NSP to be the pathogenicity determinant and the MP
to induce no noticeable effects. This may thus suggest that MYMIV is more similar to
New World begomoviruses, in its behaviour with respect to the DNA-B encoded
genes, than to the Old World viruses. However, there are few bipartite begomoviruses
identified in the Old World and no others have yet been studied and it is thus
premature to draw any definite conclusions from this.
In common with the NSP of ToLCNDV and the MP of Bean dwarf mosaic
virus (the pathogenicity determinants of each of these viruses), expression of the MP
of MYMIV induces necrosis. This indicates that in N. benthamiana the MYMIV MP
162
is an avirulence determinant that induces a hypersensitive response (HR). The HR is
associated with specific recognition (of the pathogen-encoded avirulence gene) and
resistance (determined by a host-encoded resistance [R] gene) to infection by a range
of plant pathogens. This gene-for-gene interaction is often accompanied by the
collapse of challenged host cells (Morel and Dangl, 1997; Dangl et al., 1996)
resulting in a necrotic lesion that is believed to contribute to containment of the
pathogen. However, there are examples in which the HR and resistance have been
uncoupled (Kim and Palukaitis, 1997; Morel and Dangl, 1997). This thus suggests
that N. benthamiana encodes an R gene that recognises the MP (the avirulence
determinant) of MYMIV. However, inoculation of MYMIV to N. benthamiana does
not induce an HR. Possibly this is due to the low level of replication of MYMIV
DNA-B in this species (as discussed in Chapter 4) or that MP is expressed at such low
levels that the HR is not visible. The expression of geminivirus genes is strictly
controlled during virus infection and it is thus possible that insufficient MP is
expressed to induce a prominent HR. Alternatively it is possible that the virus encodes
a second factor which is able to overcome (prevent) the HR, as has been documented
for ToLCNDV (Hussain et al., 2005). It is noticeable that the HR is unable to contain
the PVX expressing MYMIV MP, leading to systemic veinal necrosis. Nevertheless,
it is possible that the host response of N. benthamiana to MYMIV MP plays some
role in the lack of infectivity of this virus to this plant species.
The AV2 gene sequence is well conserved among begomoviruses from the
Old World (Padidam et al., 1996) but its phenotypic behaviour in plants is variable.
Expression of AV2 of MYMIV from PVX induces HR at the inoculation site but this
recognition does not prevent PVX spreading systemically and the virus can move on
and induce severe downward curling of new leaves and stunted growth. AV2 of
EACMCV induces a mild mottling (Reddy et al., 2008), V2 of CLCuKV exhibits
downward leaf curling, yellowing of leaves and systemic necrosis and V2 of ToLCV
caused stunting of N. benthamiana (Selth et al., 2004). Although the V2 of different
viruses appear to interact with host factors in different ways they seem to provide
similar function to monopartite and bipartite viruses such as overcoming host
defences mediated by post transcriptional gene silencing as well as movement
(Zrachya et al., 2006; Rojas et al., 2001; Rothenstein et al., 2007). Earlier results, that
MYMIV with the AV2 gene disrupted was not infectious to legumes (as mentioned
above in section 6.3.3) and these results that transient expression of AV2 of MYMIV
163
induce host response are consistent with the involvement of this protein in virus
movement.
Expression of the CP of ToLCV from a Tobacco mosaic virus based vector in
Nicotiana spp. induced no discernable phenotype (Selth et al., 2004). This is the only
report of the transient expression of a CP of a geminivirus in plants that is available in
the literature. However, much earlier studies, using the CPs of ACMV and TYLCV,
produced transgenic N. benthamiana and tomato, respectively, constitutively
expressing these genes (Frischmuth and Stanley, 1998; Kunik et al., 1994). Neither
paper specifically refers to any phenotype due to the transgenic expression of the CP.
Similarly Shivaprasad et al. (2006) produced transgenic N. tabacum lines
constitutively expressing the CP of MYMV which were phenotypically normal. The
demonstration here that PVX-mediated expression of the MYMIV CP induces leaf
crumpling and vein yellowing in N. benthamiana, is thus somewhat unusual. The
effects on the plant were very severe with severely deformed young leaves that were
greatly reduced in size, and plants ceased growth. The CP is the only structural
protein of geminiviruses; it forms the typical geminate particles from which the
family derives its name. It is vector determining and thus has to interact with both
plant hosts and arthropod vectors (Briddon et al, 1990). It plays a part in virus
movement. For monopartite begomoviruses it is essential and mutation of this gene
abolishes infectivity (Boulton et al., 1989; Briddon et al., 1989; Hormuzdi and Bisaro,
1993; Rigden et al., 1993). Although it is not essential for the movement of bipartite
begomoviruses in some cases, viruses with mutations in the CP gene show extended
latent periods, indicating that even for these viruses CP plays a part in movement
(Pooma et al., 1996). The CP has sequence non-specific DNA binding properties (Liu,
Boulton and Davies, 1997; Priyadarshini and Savithri, 2009; Kirthi and Savithri,
2003; Palanichelvam et al., 1998) and it is likely that CP-ssDNA interactions are
required for particle formation. Studies with TYLCV have shown that the CP acts as a
functional homolog of the bipartite begomovirus NSP, having both NLS (Kunik et al.,
1998) and nuclear export signals (Rhee et al., 2000) and interacts in planta with a
karyopherin α that likely is involved in transport into the nucleus (Kunik et al., 1999).
Of direct relevance to the study presented here, Guerra-Peraza et al. (2005), using
GFP tagging and N. plumbaginifolia protoplasts, showed that the CP of MYMV
contains two NLSs and interacts with karyopherin α. However, none of these earlier
studies provides us with any concrete indication as to why MYMIV CP affects plant
164
development or why the CP of this virus is different from all others so far examined.
By deletion mutations in CP, the domain(s) of the protein involved in affecting plant
development should be located for further study.
The common feature of the TrAP of begomoviruses studied so far is their
transient expression induces cell death resembling an HR and this recognition by the
host does not contain the virus-vector at the inoculation site (Selth et al., 2004). In this
study the TrAP of MYMIV was found to induce HR at inoculation site, curling of
emerging leaves and necrosis and bleaching of mature leaves. The TrAP of TYLCV
induced necrotic lesions and some veinal necrosis on inoculated leaves of N.
benthamiana. New leaves exhibited severe veinal necrosis extending into vascular
regions (Selth et al., 2004). Similar symptoms have been observed when TrAP from
ACMV was transiently expressed in N. benthamiana using a PVX-based vector
(Hong et al., 1997). TrAP of TYLCCNV induces necrotic ringspots on inoculated
leaves and necrotic vein banding on systemically infected leaves (Van Wezel et al.,
2001). TrAP has a key role in infection of begomoviruses as it is a transcriptional
activator, a silencing suppressor and suppressor of basal defense and it can suppress
local silencing by interacting with a host factor ADK and can suppress basal defense
by interacting with another host factor SNF1 kinase (Yang et al., 2007). The results
obtained here with the TrAP of MYMIV are thus entirely consistent with earlier
reports.
The geminivirus-encoded Rep protein plays a pivotal role in the viral infection
cycle probably the most important of which are its multiple functions in RCR and its
interference in the host cell-cycle (reviewed by Hanley-Bowdoin et al., 2004; 1999).
Generally overexpression of Rep leads to cell death (van Wezel et al., 2002b; Selth et
al., 2004), likely due to the interaction of this protein with pRBR which is required to
repress cell cycle progression. Downregulation of pRBR expression by VIGS has
been shown to induce developmental abnormalities and cell death (Jordan et al.,
2007). Despite this there are several reports of the production of transgenic plants
expressing the Rep proteins of various begomoviruses without any phenotypic effects
(Hanley Bowdoin et al., 1990; Hong and Stanley, 1996; Shivaprasad et al., 2006) but
few reports of an inability to regenerate transgenic plants expressing Rep (Selth et al.,
2004). This apparent anomaly may possibly be explained by a finding reported by Jin
et al. (2008) that a single amino acid change in Rep can abolish the cell-death
response. None of the reports of the successful production of Rep-expressing
165
transgenic plants mention having sequenced the transgene following insertion,
meaning that it is possible that the transformation protocols followed selected for Rep
mutations that did not elicit the cell-death response. The results of the PVX-mediated
expression of MYMIV Rep are thus wholly consistent with earlier reports that this
protein elicits cell-death. However, a TMV vector expressing ToLCV Rep was
localised to the site of inoculation and did not spread systemically, whereas the PVX
vector expressing MYMIV Rep was not restricted and spread systemically inducing
mild necrosis and leaf curling. There are two possible explanations for this anomaly.
First there may be different host responses due to the two distinct vectors used.
Alternatively it is possible that the PVX vector that spread systemically from the site
of inoculation was no longer expressing Rep or, more likely, was expressing a
mutated Rep. Chung et al. (2007) demonstrated that virus vectors carrying foreign
sequences are subject to a high frequency of deletions of the inserted sequences. It is
interesting to note that for ACMV and TYLCCNV Rep genes expressed from a PVX
vector, although this induces necrosis at the site of inoculation, the product
overlapping (A)C4 gene is required for systemic necrosis, indicating that a strong host
defense mechanism operates to counter Rep-induced necrosis (van Wezel et al.,
2002b). The construct used for expression of MYMIV Rep here also contains an
intact AC4 and would thus be expected to induce systemic necrosis, suggesting either
that the host response to ToLCV Rep by N. benthamiana is very strong or possibly
that ToLCV AC4 is not efficient at inhibiting the host defense response in the
systemic phase. Further investigation will need to be conducted to answer these
questions.
The precise function of the product of the AC4 (known as C4 in monopartite
viruses) gene of dicot-infecting geminiviruses (with the exception of the dicot-
infecting mastreviruses, which do not encode a homolog of this gene) remains unclear
and may differ between viruses. Disruption of the C4 gene of monopartite
begomoviruses results in attenuated symptoms and low infectivity, suggesting that it
is involved in either symptom development, virus movement, or both (Jupin et al.
1994; Rigden et al. 1994). The C4 of cutoviruses is an important symptom
determinant and induces hyperplasia although it is not essential for infectivity
(Latham et al., 1997), interacts with the brassinosteroid signalling pathway (Piroux et
al., 2007) and up-regulates host RKP, a protein that may interact with cell-cycle
inhibitor ICK/KRP proteins, thereby interfering in the cell-cycle (Lai et al., 2009). In
166
contrast, early studies of the AC4 of bipartite viruses by mutagenesis concluded that
this gene is either non-functional, or functionally redundant; mutants were infectious
and produced wild-type symptoms (Elmer et al., 1988; Etessami et al., 1991;
Hoogstraten et al., 1996; Pooma and Petty, 1996). However, van Wezel et al. (2002b)
showed that for both a monopartite and a bipartite begomovirus the (A)C4 may
overcome a host defense mechanism that confines Rep induced HR and the gene
product for some viruses acts as a suppressor of PTGS (Vanitharani et al., 2004).
Expression of the AC4 gene of MYMIV from the PVX vector induces virus-like
symptoms (vein yellowing and leaf curl) which contrasts with the results for the
expression of AC4 of ACMV and C4 of TYLCCNV from PVX which resulted in no
symptoms above those induced by PVX (van Wezel et al., 2002b). The MYMIV
results are more similar to the TMV-mediated expression of ToLCV C4 in N.
tabacum, which resulted in virus-like symptoms, which the authors attributed to a
possible interference by this protein in cell-cycle. Whether this is the case also for the
MYMIV will require further investigation.
The AC5 ORF is not well conserved between begomoviruses and is only
consistently seen in LYMVs. For this reason little attention has been paid to this
potential gene and only a single study has investigated its potential role in virus
infection. Studies in a yeast model have shown that the AC5 of MYMIV has a
possible function in viral DNA replication, although it provided no indication of what
that function might be (Raghavan et al., 2004). It is interesting to note that, although
no study has mapped the transcripts of MYMIV, a study of the closely related
MYMV did not identify transcripts spanning the AC5 ORF (Shivaprasad et al., 2005).
However, this was not an exhaustive study, aiming to identify only the major
transcripts, and it is thus possible that minor transcripts suitable for translation of the
AC5 were not characterised. In the present study expression of the AC5 gene of
MYMIV from the PVX vector in N. benthamiana induced mild leaf curl and light
green mosaics on systemically infected leaves. This indicates that the product of the
AC5 gene has an effect on cellular metabolism but gives no indication of what the
basis for that effect might be. Nevertheless, the identification of an effect indicates
that further studies are warranted to investigate the potential contribution this gene
product has on the viral infection cycle. The affect of mutagenesis of this gene on
virus infectivity now needs to be investigated to determine whether it has any function
in the virus infection cycle.
167
All functions thus far ascribed to betasatellites have been shown to be
mediated by the single, complementary-sense gene, βC1, they encode. βC1 is a
pathogenicity determinant (Saunders et al., 2004), a suppressor of PTGS (Gopal et al.,
2007), binds DNA without size or sequence specificity (Cui et al., 2005b) and may be
involved in virus movement (Saeed et al., 2007). Constitutive expression of βC1 in
transgenic plants, in the absence of helper virus, induces “virus-like” symptoms but
these do not resemble the typical symptoms of the intact betasatellite in association
with its helper begomovirus (Cui et al., 2004b; Gopal et al., 2007; Saunders et al.,
2004). For example, expression of the βC1 gene of Ageratum yellow vein betasatellite
(AYVB) yielded N. benthamiana plants with severe developmental abnormalities
(severely twisted stems and petioles) and vein greening (Saunders et al., 2004),
whereas infection of AYVB in the presence of its cognate helper begomovirus,
AYVV, results in N. benthamiana plants with a severe downward leaf curling
phenotype. These symptoms are very similar to the symptoms induced in this host by
PedLCV and TbLCB, although they are slightly less severe and show a slight upward
curling of the edges of the deeply downwardly cupped (curled) leaves (Chapter 4,
Section 4.3.5). The symptoms induced by expression of the TbLCB βC1 from the
PVX vector in N. benthamiana, leaf-like enations, are thus unusual. Qazi et al. (2007)
showed that near identical symptoms to those produced by TbLCB βC1 here, result
from the expression of the Cotton leaf curl Multan betasatellite (CLCuMB) βC1 from
the PVX vector in N. tabacum; the same symptoms were also produced by the
CLCuMB βC1 PVX construct in N. benthamiana (J. Qazi, personal communication).
These symptoms closely resemble the “Cotton leaf curl disease” symptoms induced
by CLCuMB with its cognate helper begomovirus (Cotton leaf curl Multan virus) in
cotton. This indicated that, although the βC1 is the major symptom determinant, the
bona fide disease symptoms are only produced when this is expressed in the correct
tissues, with the implication that PVX and CLCuMV have similar tissue specificities.
Since a PedLCV/TbLCB infection of N. benthamiana does not induce leaf-like
eantions, this suggests that the tissue specificities of PedLCV and CLCuMV (and
PVX) differ. The results also suggest that possibly all βC1 genes have the capacity to
induce these unusual leaf-like enation symptoms, if expressed in the correct tissues,
something that has previously only been shown for the “Malvaceae” betasatellites (a
phylogenetic grouping proposed by Briddon et al. [2003]) such as CLCuMB. A study
by Yang et al. (2008) has suggested that it is the interaction of βC1 Asymmetric
168
Levels 1 (AS1), a factor known to regulate leaf development that may be responsible
for the pathogenicity of this gene product.
Mutagenesis studies have shown that for monopartite geminiviruses the coat
protein is essential for systemic movement in infected plants Boulton et al., 1989;
Briddon et al., 1989; Rigden et al., 1993). In contrast, bipartite begomovirus coat
protein gene mutants are systemically infectious, although typically the infections are
attenuated and the latent period extended. These results were obtained whether viruses
were assayed in the host plant from which they were originally isolated (Azzam et al.,
1994; Padidam et al., 1995, Ingham et al., 1995), or in the experimental host N.
benthamiana (Padidam et al., 1995; Ingham et al., 1995; Stanley et al., 1986b;
Brough et al., 1988; Gardiner et al., 1988). Replacement of the CP of MYMIV with
GFP, which interrupts the AV2 coding sequence as well as deleting the CP gene,
renders the virus clones non-infectious to legumes. This indicates that one or both of
the genes are important for infectivity of MYMIV in legumes. To further extend the
study a mutation was introduced into only the AV2 coding sequence. This mutant also
was not infectious to legumes indicating that the product of this gene is indispensible
for the infectivity of MYMIV to legumes. Earlier studies with bipartite
begomoviruses originating from the New World (thus viruses lacking the AV2 gene)
have shown that the dispensability of the CP is correlated with the degree of virus–
host adaptation. TGMV is well adapted to N. benthamiana and does not require CP to
infect this host systemically, whereas BGMV is poorly adapted to N. benthamiana
and requires the CP (Pooma et al., 1996). However, we must assume that MYMIV is
well adapted to legumes, since this is the major host and the species from which this
clone of the virus was isolated. Mutation of the AV2 of EACMZV (a bipartite Old
World begomovirus) resulted in attenuated symptoms in cassava (the natural host of
this virus) and affected the expression of CP and accumulation of viral DNA in plants
suggesting a close structural and/or functional relationship between these coding
regions or their protein products (Bull et al., 2007). It is thus possible that, in legumes,
MYMIV has a more strict requirement for the CP as well as the AV2 gene product
than other bipartite begomoviruses do in their natural host. Unfortunately time
constraints prevented extending the study to N. benthamiana, using TbLCB to
overcome host constraints, which may shed more light on the requirement of MYMIV
for the CP and AV2 gene products. Nevertheless, the results indicate that using
MYMIV as a CP replacement vector for gene expression (or as a VIGS vector) will
169
not be as straight forward as for some other begomoviruuses. The intention was to use
a MYMIV CP replacement vector expressing GFP to study the movement of the virus
in legumes; following the example of Sudarshana et al. (1998) who used a GFP
expressing Bean dwarf mosaic virus CP replacement vector to non-invasively follow
the infection of this virus in common bean. This clearly will not be possible, although
the results here do not rule out the possibility that a CP replacement that leaves the
AV2 coding sequence intact (thus a CP translation fusion rather than the CP
transcription fusion approach use here) might work.
The RNA-dependant RNA polymerases RdR1 and RdR6 are important
constituents of the plant gene silencing pathway. RdR1 is salicylic acid inducible and
is required for basal defense against viruses (Yang et al., 2004b) whereas RDR6 has
been shown to be necessary for the continued silencing of a transgene after the
complete elimination of inducer RNA, the cell-to-cell movement of the RNA
silencing signal, and the spread of silencing along the target RNA to sequences
beyond the region that is homologous to the trigger molecule (a phenomenon known
as transitivity; Dalmay et al., 2001; Himber et al., 2003; Klahre et al., 2002; Vaistij et
al., 2002). N. benthamiana encodes an aberrant, possibly non-functional, RdR1 which
may explain its susceptibility to many viruses (Yang et al., 2004b). Despite this
“hole” in N. benthamiana defences, MYMIV is not infectious to this species and
raised the question as to what role RdR6 might play in this. The role of RDR6 in
antiviral defenses of plants has been less firmly established than for RdR1, with only
a few viruses having been shown to be more infectious in its absence (Dalmay et al.,
2000; Mourrain et al., 2000). VIGS-mediated down-regulation of RdR6 in N.
benthamiana resulted in a higher proportion of plants ultimately showing systemic
movement of MYMIV, although not the hoped for symptoms of infection, indicating
that although RdR6 has a part to play, the lack of infectivity of this virus to N.
benthamiana is not greatly affected by this gene product; implying that it is not the
silencing pathway that is the major contributor. However, due to technical constraints
it was not possible to actually demonstrate, by for example showing the production of
siRNA against the RDR6 gene, that the VIGS silencing of the gene was actually
occurring. Further studies will thus need to be conducted before definite conclusions
can be drawn. Nevertheless the effect on MYMIV infectivity levels in PVX-RdR6
inoculated plants is good circumstantial evidence that silencing of this genes was
170
occurring. However this is the first evidence of the involvement of RdR6 of N.
benthamiana in resistance against a DNA virus.
RNAi has become the technology of choice for developing transgenic
resistance in plants against viruses. There are many reports of use of RNAi, by the
expression of either sense, antisense or hairpin constructs, to deliver transgenic
resistance against begomoviruses infecting hosts such as cotton, tomato and cassava
but not, for the most part, in legumes. Legumes, and particularly the grain legumes
mungbean and blackgram, are recalcitrant to Agrobacterium-mediated transformation.
It is for this reason that all previous investigations of the use of RNAi to provide
resistance to the LYMVs have used transient expression methodologies. Pooggin et
al., (2003) produced a hairpin construct against the promoter region of MYMV and
showed that in blackgram bombardment of this on gold particles into MYMV infected
blackgram gave a 68%-77% recovery of seedlings from the virus infection. Making
use of the discovery that TbLCB can make MYMIV infectious to N. benthamiana
(Chapter 5) it was possible to show that an antisense Rep construct, expressed from
PVX, provides resistance. Although it was not specifically demonstrated, this
mechanism is likely RNAi. Although further experiments are required to fully
validate this procedure, this will provide a much simpler system for rapidly screening
constructs for resistance to LYMVs than have previously been available, particularly
those infecting the grain legumes. This will then allow only the most promising
constructs to be carried forward into transformation procedures once they become
available for these hosts.
171
Chapter 7
General discussion
Grain legumes are referred as “gold from the fields” as they are the cheapest
source of high-quality protein that can help the poor in combating malnutrition. They
are also vital in restoring and building soil health due to their nitrogen fixing
properties, particularly in rice-wheat areas where productivity is declining. One of the
major threats to legume production in southern Asia is YMD which was first reported
from India and Pakistan in 1940s. YMD can cause a significant reduction in crop
production, particularly if plants are infected soon after germination. Despite its high
economic value and the large numbers of people that rely on them for their dietary
protein intake, very little attention has been given to this biotic stresses that hamper
the production of grain legume crops across southern Asia. Increasing number of
legume-infecting begomoviruses, more chances for their pseudo-recombination and
relentless damage to crop yields, demand more interest in understanding different
aspects of this group of plant viruses and requires planning of strategies for long
lasting disease management practices. Other reasons to carry out this study were to
explore the natural resistance mechanisms of many legume species against
begomoviruses and exploration of diversity of these genetically isolated and
evolutionarily distinct viruses.
The small scale phylogeographic analysis conducted as part of the study has
shown that in Pakistan the problematic legume-infecting begomovirus is MYMIV.
This contrasts with India where both MYMIV and MYMV cause problems to
leguminous crops. Although the reasons for this disparity are unclear, there is strong
circumstantial evidence to suggest that the cultivation of soybean could have a part to
play. Although MYMV occurs in Pakistan, the only time it was identified in a crop
was in an experimental plot of soybean. In many cases where non-leguminous
begomoviruses have been identified in legumes across the sub-continent, this has been
in soybean. Soybean is cultivated widely across India but, at this time, soybean is only
being considered as a crop in Pakistan and is thus grown only in small experimental
plots. The reasons for this unusual behaviour of soybean with respect to the LYMVs
172
are unclear. Although it is native to Asia, and is believed to have originated from
northern Asia, it is possible that it was not, during its evolution, exposed to
begomoviruses and thus has not evolved resistance to them. Alternatively it is
possible that the varieties being grown have been selected for yield characteristics and
not resistance and have thus lost their natural resistance to begomoviruses. Whatever
the reason, it is clear that, should the decision be taken to introduce soybean as a crop
in Pakistan, that problems with LYMVs can be expected and that this is likely to lead
to greater problems with viruses in the other legumes also.
The LYMVs, since their first identification, have posed something of a
conundrum. Although during the 1990s they appeared to be entirely normal bipartite
begomoviruses, at a time when only few sequences were available, they always were
basal to all other OW begomoviruses in phylogenetic analyses (Howarth and
Vandemark, 1989; Rybicki, 1994; Padidam et al., 1995). A more recent analysis has
highlighted the unusual behaviour of the legume-infecting begomoviruses from the
OW (for which the collective name Legumovirus is being suggested) and has shown
that there are other groups of begomoviruses with unusual behaviour (Briddon et al.,
2009). The Corchorus-infecting viruses (bipartite begomoviruses – for which the
collective name Corchovirus) and the Ipomea-infecting viruses (apparently
monopartite begomoviruses – for which the collective name Sweepovirus is being
proposed) are basal to all begomoviruses in phylogenetic analyses. The “Study Group
on the Taxonomy of Geminiviruses” of the ICTV is at this time considering defining
these three groups as distinct sub-genera within the genus Begomovirus. Although it is
apparent that these viruses are unusual, the reason for this unusual behaviour is far
less clear. For the LYMVs it has been proposed that their unusual behaviour is due to
genetic isolation – the LYMVs (and likely also the other legume-infecting OW
begomoviruses) having co-evolved with their legume hosts and having been shielded
from interaction with the other OW begomoviruses (Qazi et al., 2007). A similar
“genetic isolation” hypothesis can possibly also be invoked to explain the unusual
nature of the corchoviruses and the sweepoviruses. However, this provides us with no
indication of what the mechanism for this unusual interaction between legumes and
OW legume-infecting begomoviruses is.
Certainly the behaviour of all LYMV isolates obtained as part of this study,
including the new species RhYMV, is consistent with the unusual behaviour of all the
other Legumoviruses in phylogenetic analyses (segregating basal to all OW
173
begomoviruses, results not shown). However, the results provide no indication of why
these viruses have these unusual characteristics. Although it is not possible to rule out
the possibility that the “genetic isolation” of LYMVs is due to host range limitations
of the vector (a possible “legume specific” race of B. tabaci that does not feed on non-
leguminous species transmitting these viruses and the vector race(es) that transmit all
other begomoviruses not being able to transmit begomoviruses to/from legumes), this
would seem unlikely in view of the fact that Agrobacterium-mediated inoculation
overcomes this limitation, the LYMVs are not infectious to non-legumes and the other
begomoviruses appear not to infect legumes even when this method is used (Chapter
4). One would thus have to assume that either there is something unusual about
legumes or that there is something unusual about the OW begomoviruses (with
respect to the infection of legumes) in comparison to the NW begomoviruses (many
of which do seem to readily infect legumes).
Although the OW legume-infecting begomoviruses are unusual, segregating
basal to all OW begomoviruses in phylogenetic analyses and having a bipartite
genome arrangement (whereas the majority of OW begomoviruses are monopartite
and associate with betasatellites) this is not the case for NW legume-infecting
begomoviruses. The legume-infecting viruses originating from the NW do not
segregate, but rather are polyphyletic for both their DNA-A and DNA-B components.
This indicates that distinct viruses have adapted to infect legumes, a major contrast to
the situation with the OW legume-infecting viruses. It is difficult to see how this
situation might have arisen. Possibly, during the explosive speciation following the
introduction of begomoviruses to the NW, a lineage evolved that was equally able to
infect both legumes and non-leguminous plant species. Alternatively, did the
“inoculum” of begomovirus(es) that was introduced into the NW, from which all
extant NW begomoviruses are postulated to have evolved, contain some legume
infecting virus(es)? The constituents of this “inoculum” and the method of its
introduction we can only speculate upon. The best, and only, available evidence are
the corchoviruses; NW-like bipartite begomoviruses occurring in the OW. These
viruses were isolated from species in the genus Corchorus. This genus includes
species which provide jute (for rope and cloth making) and species which are (were)
used across North Africa and Asia as a leaf vegetable. Thus two good reasons for
early travellers to the Americas to carry both seed and live plants of Corchorus spp.
(remembering that geminiviruses are not seed transmitted). Unfortunately the host
174
ranges of the corchoviruses and whether they are able to infect legumes have not been
investigated (Ha et al., 2006). It is interesting to note that Corchorus is a genus in the
family Malvaceae and that there is a difference between OW and NW begomoviruses
infecting species in this family. With the exception of the corchoviruses, all
malvaceous begomoviruses identified in the OW require a betasatellite, whereas there
are numerous bipartite begomoviruses that infect plants of the family Malvaceae in
the NW.
Could there be a fundamental biochemical difference between NW and OW
originating legumes? This would seem unlikely since some of the NW begomoviruses
appear to readily infect OW legumes such as soybean (Méndez-Lozano et al., 2006).
Overall the evidence appears to point to this phenomenon (the unusual behaviour of
OW begomoviruses with respect to legumes) being due to a deficiency in the OW
begomoviruses (that do not infect legumes) and that only one lineage, the
legumoviruses, retained the ability to infect species in the family Fabaceae
(Leguminoseae) but with a loss of the ability to infect species in the other families.
The answer to this question will only come from a more detailed analysis of the host
range determinants of the Legumoviruses and a comparison of these with the other
OW begomoviruses and legume-infecting NW begomoviruses.
Although it was not the intention of the project to investigate the host range
limitations of LYMVs, the results obtained have shed some light on the factors
involved. No previous reports have mentioned the lack of infectivity of cloned
LYMVs to non-leguminous hosts and, in particular, the “universal” experimental host
for dicot-infecting viruses N. benthamiana. Likely this is due to the fact that negative
results are not usually reported. Nevertheless, Maruthi et al. (2006) were unable to
infect this host (and numerous other non-leguminous hosts) with DoYMV by whitefly
transmission. However, this is not very informative since, even amongst LYMVs,
DoYMV is known to have a very limited host range (Maruthi et al., 2006). The results
obtained in Chapter 5 indicate that the major blockage to LYMVs infecting N.
benthamiana lies with the DNA-B components of these viruses. The DNA-A
component is well able to mediate a systemic infection when provided with a suitable
“helper” component – in this case a betasatellite. The TbLCB thus extend the host
range of three viruses examined to N. benthamiana. Similar results were previously
obtained with Sri Lankan cassava mosaic virus, the DNA-A of which became
infectious to Ageratum conyzoides in the presence of Ageratum yellow vein
175
betasatellite (Saunders et al., 2002). The mutation studies did not show significant
differences between mutation in the NSP and MP genes suggesting that both may lack
full functionality in N. benthamiana. The induction of an HR by MP when expressed
from the PVX vector is not unusual; the MPs of other begomoviruses induce a similar
response. Nevertheless, such a strong defence response could play a part in limiting
the spread of an already disabled virus. Similarly VIGS of RDR6 showed that this
gene appears to play a part in limiting the infectivity of these viruses. RDR6 is part of
the gene silencing pathway and gene silencing has a well established role in
countering virus infection (Qu et al., 2005). However, even when RDR6 is down-
regulated, MYMIV remains unable to induce a symptomatic infection, suggesting that
it is the lack of adaptation of the DNA-B genes to this host that is the main factor
preventing infectivity. To further investigate the host range limiting determinants of
these viruses it would be interesting to produce chimeric DNA-B components with
NSP and MP genes derived from non-legume infecting begomoviruses. Alternatively
these genes from a non-legume-infecting begomovirus could be, at least initially,
expressed transiently to try and complement the defect(s) in the LYMVs’ DNA-B.
Determination of the molecular basis for the lack of infectivity of LYMVs to non-
leguminous species, as well as the lack of infectivity of non-leguminous
begomoviruses to legumes, would be of interest as it may allow us to devise novel
resistance mechanisms.
The term “genetic isolation”, as it is applied to the LYMVs, means that there
has been no genetic exchange, at least as far as I have been able to detect using
relevant software, between the viruses that infect legumes and the viruses that infect
other plants. This contrasts with the multitude of unequivocal examples of
recombination between begomoviruses that infect species in other plant families, the
prime example here being the viruses that are associated with cotton leaf curl disease
on the sub-Continent (Sanz et al., 2000). The LYMVs were not recognised (or at least
not reported) until the 1940s (Vasudeva, 1942), from which point on they have
increased in geographic spread and severity of losses caused. It would seem likely that
prior to this these viruses were sporadic (minor) problems in cultivated legumes,
possibly having originated from local leguminous weeds, and that not until the early
part of the 20th Century did agriculture become intensive enough for the viruses to
become a major problem. Possibly before this agriculture in southern Asia was still
too small scale and cultivated land too fragmented for the viruses to become
176
established as major problems across a wide area. Whatever the reason for their
sudden appearance it would be naive to assume that agricultural intensification did not
have some part to play.
The identification of several non-leguminous begomoviruses in legumes,
including the two viruses reported here for the first time, is an indication that the
genetic isolation is under threat; in other words that the prerequisite for genetic
interaction (recombination), that is co-infection, is occurring. However, despite this
there still remain no reports of recombination, possibly indicating that recombination
between legume-infecting and non-legume infecting begomoviruses does not lead to
hybrid viruses with a selective advantage in legumes. However, the real evidence of
the breakdown of genetic isolation is with the identification of a productive
interaction between LYMVs and betasatellites. The work of Rouhibakhsh and Malathi
(2004) showed the production of enations on cowpea plants that contained a
betasatellite (CLCuMB) and MYMIV. Enations are typical of CLCuMB and indicate
a productive interaction (expression of βC1). Similarly the work here has shown that
LYMVs can transreplicate TbLCB and that the interaction enhances symptoms and
alters host range (although it was unfortunately not possible to repeat these
experiments in legumes). The relatively small numbers of plants that contained
betasatellite in this study, and its apparent limitation to soybean, indicates that the
new begomovirus-betasatellite complex has not yet become fully established.
Nevertheless, this is a grave threat to legume cultivation across southern Asia and
possibly also to all other areas around the World where legumes are grown and B.
tabaci is endemic.
The project presented here has, at least in a small way, examined the diversity
of LYMVs occurring across Pakistan. The project identified one new begomovirus
species affecting legumes and it is likely that further diversity is present. There is thus
a good reason for conduction of further studies of this nature in the country, since
these viruses pose a threat to legume production; the potential of the newly identified
virus to infect legumes, specifically soybean, was demonstrated. The phylogeographic
data detailed here provides a baseline from which changes in the virus populations,
both in terms of their make-up and geographic spread, can be monitored. Early
identification of changes, either the appearance of new species/strains or epidemics
(spatial changes), will allow suitable control measures to be introduced. Having
established the diversity of the LYMVs in the country, monitoring of the viruses can
177
possibly be conducted using a PCR-restriction fragment length polymorphism
diagnostic procedure (PCR-RFLP; or a derivation of this based upon RCA), which
would overcome the need for sequencing; a technique that in Pakistan remains too
expensive (and technically demanding) for use on a large scale. PCR-RFLP has been
used extensively to investigate the distribution and diversity of cassava mosaic
begomoviruses in Africa (Bull et al., 2006; Sserubombwe et al., 2008).
At this time, natural resistance and insecticides (countering the vector) remain
the main weapons in preventing losses. Although the very brief investigation of the
possibility of using RNA silencing-based resistance against these viruses showed
promise, at this time the lack of efficient transformation protocols for the main
leguminous crops species grown in the region and possible public opposition to
transgenic food crops means that this is possibly not the path to follow (although this
does not mean that we should not investigate this further once transformation
protocols become available). In light of this, it is probable that the most useful
outcome of the work presented here will be the use of the infectious clones in
screening new legume varieties for conventional virus resistance. A glasshouse-based
screening system, complementing the conventional field-based virus resistance
screening, would greatly speed up the identification and introduction of new resistant
varieties.
178
Chapter 8
References
Ahmad, M. and Harwood, R. F. 1973. Studies on a whitefly-transmitted yellow
mosaic of urdbean (Phaseolus mungo). Plant Disease Reporter 57: 800–802.
Allen, E., Xie, Z., Gustafson, A. M. and Carrington, J. C. 2005. microRNA-directed
phasing during trans-acting siRNA biogenesis in plants. Cell 121: 207–21.
Amin, I., Mansoor, S., Iram, S., Khan, M. A., Hussain, M., Zafar, Y., Bull, S. E.,
Briddon, R. W. and Markham, P. G. 2002. Association of a monopartite
begomovirus producing subgenomic DNA and a distinct DNA β on Croton
bonplandianus showing yellow vein symptoms in Pakistan. Plant Disease 86:
444.
Argüello-Astorga, G. R., Guevara-González, L. R., Herrera-Estrella, L. R. and
Rivera-Bustamante, R. F. 1994. Geminivirus replication origins have a group-
specific organization of iterative elements: a model for replication. Virology
203: 90–100.
Argüello-Astorga, G. R. and Ruiz-Medrano, R. 2001. An iteron-related domain is
associated to motif 1 in the replication proteins of geminiviruses: identification
of potential interacting amino acid-base pairs by a comparartive approach.
Archives of Virology 146: 1465–1485.
Argüello-Astorga, G., Lopez-Ochoa, L., Kong, L. J., Orozco, B. M., Settlage, S. B.
and Hanley-Bowdoin, L. 2004. A novel motif in geminivirus replication
proteins interacts with the plant retinoblastoma-related protein. Journal of
Virology 78: 4817–4826.
Atapattu, S. S. and Kodituwakku, D. C. 2009. Agriculture in South Asia and its
implications on downstream health and sustainability: A review. Agricultural
Water Management 96: 361–373.
Atzmon, G., van Oss, H. and Czosnek, H. 1998. PCR-amplification of Tomato yellow
leaf curl virus (TYLCV) DNA from squashes of plants and whitefly vectors:
application to the study of TYLCV acquisition and transmission. European
Journal of Plant Pathology 104: 189–194.
Azzam, O., Frazer, J., de la Rosa, D., Beaver, J. S., Ahlquist, P. and Maxwell, D. P.
1994. Whitefly transmission and efficient ssDNA accumulation of bean
179
golden mosaic geminivirus requires functional coat protein. Virology 204:
289–296.
Bailey, L. H. 1970. Manual of cultivated plants. (Rev.) MacMillan, New York. pp.
1116.
Balaji, V., Vanitharani, R., Karthikeyan, A. S., Anbalagan, S. and Veluthambi, K.
2004. Infectivity analysis of two variable DNA B components of Mungbean
yellow mosaic virus-Vigna in Vigna mungo and Vigna radiata. Journal of
Biosciences 29: 297–308.
Baliji, S., Black, M. C., French, R., Stenger, D. C. and Sunter, G. 2004. Spinach curly
top virus: a newly described Curtovirus species from southwest Texas with
incongruent gene phylogenies. Phytopathology 94: 772–779.
Bartel, D. P. 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell
116: 281–297.
Baulcombe, D. 2004. RNA silencing in Plants. Nature 431: 356–363.
Behjatnia, S. A. A., Dry, I. B. and Rezaian, M. A. 1998. Identification of the
replication-associated protein binding domain within the intergenic region of
tomato leaf curl geminivirus. Nucleic Acids Research. 26: 925–931.
Bevan, M. 1984. Binary Agrobacterium vectors for plant transformation. Nucleic
Acids Research 12: 8711–8721.
Bisaro, D. M., Hamilton, W. D. O., Coutts, R. H. A. and Buck, K. W. 1982.
Molecular cloning and characterisation of the two components of tomato
golden mosaic virus. Nucleic Acids Research 10: 4913–4922.
Bisaro, D. 1996. Geminivirus DNA replication. In "DNA replication in eukaryotic
cells", pp. 833–854. Cold Spring Harbor Laboratory press.
Bisaro, D. M. 2006. Silencing suppression by geminivirus proteins. Virology 344:
158–168.
Blanco, L., Bernard, A., Lazaro, J. M., Martin, G., Garmendia, C. and Salas, M. 1989.
Highly efficient DNA synthesis by the phage phi29 DNA polymerase.
Symmetrical mode of DNA replication. Journal of Biological Chemistry 264:
8935–8940.
Blawid, R., Van, D. T. and Maiss, E. 2008. Transreplication of a Tomato yellow leaf
curl Thailand virus DNA-B and replication of a DNAß component by Tomato
180
leaf curl Vietnam virus and Tomato yellow leaf curl Vietnam virus. Virus
Research 136: 107–117.
Bock, K. R., Guthrie, E. J. and Woods, R. D. 1974. Purification of Maize streak virus
and its relationship to viruses associated with streak diseases of sugarcane and
Panicum maximum. Annals of Applied Biology 77: 289–296.
Bos, L. 1981. Hundred years of Koch's Postulates and the history of etiology in plant
virus research. European Journal of Plant Pathology 87: 91–110.
Böttcher, B., Unseld, S., Ceulemans, H., Russell, R. B. and Jeske, H. 2004. Geminate
structures of African cassava mosaic virus. Journal of Virology 78: 6758–765.
Boulton, M. I., Steinkellner, H., Donson, J., Markham, P. G., King, D. I. and Davies,
J. W. 1989. Mutational analysis of the virion-sense genes of Maize streak
virus. Journal of General Virology 70: 2309–2323.
Boulton, M. I. and Markham, P. G. 1986. The use of squash-blotting to detect plant
pathogens in insect vectors. In "Developments and applications in virus
testing" (R. A. C. Jones, and L. Torrance, Eds.), pp. 55–69. Association of
Applied Biologists.
Boulton, M. I., King, D. I., Donson, J. and Davies, J. W. 1991. Point substitutions in a
promotor-like region and the V1 gene affect the host range and symptoms of
maize streak virus. Virology 183: 114–121.
Boulton, M. I. 2002. Functions and interactions of mastrevirus gene products.
Physiological and Molecular Plant Pathology 60: 243–255.
Brennecke, J., Stark, A., Russell, R. B. and Cohen, S. M. 2005. Principles of
microRNA-target recognition. PLoS Biology 3: E85.
Brewer, B. 1988. When polymerases collide: replication and transcriptional
organization of the E. coli chromosome. Cell 53: 679–686.
Briddon, R. W., Watts, J., Markham, P. G. and Stanley, J. 1989. The coat protein of
beet curly top virus is essential for infectivity. Virology 172: 628–633.
Briddon, R. W., Pinner, M. S., Stanley, J. and Markham, P. G. 1990. Geminivirus coat
protein replacement alters insect specificity. Virology 177: 85–94.
Briddon, R. W., Bedford, I. D., Tsai, J. H. and Markham, P. G. 1996. Analysis of the
nucleotide sequence of the treehopper-transmitted geminivirus, tomato
psueudo-curly top virus, suggests a recombinant origin. Virology 219: 387–
394.
181
Briddon, R. W., Stenger, D. C., Bedford, I. D., Stanley, J., Izadpanah, K. and
Markham, P. G. 1998. Comparison of a Beet curly top virus isolate originating
from the Old World with those from the New World. European Journal of
Plant Pathology 104: 77–84.
Briddon, R. W., Mansoor, S., Bedford, I. D., Pinner, M. S., Saunders, K., Stanley, J.,
Zafar, Y., Malik, K. A. and Markham, P. G. 2001a. Identification of DNA
components required for induction of cotton leaf curl disease. Virology 285:
234–243.
Briddon, R. W. and Markham, P. G. 2001b. Complementation of bipartite
begomovirus movement functions by topocuviruses and curtoviruses. Archives
of Virology 146: 1811–1819.
Briddon, R. W., Bull, S. E., Mansoor, S., Amin, I. and Markham, P. G. 2002.
Universal primers for the PCR-mediated amplification of DNA-β; a molecule
associated with some monopartite begomoviruses. Molecular Biotechnology.
18: 1–4.
Briddon, R. W., Bull, S. E., Amin, I., Idris, A. M., Mansoor, S., Bedford, I. D.,
Dhawan, P., Rishi, N., Siwatch, S. S., Abdel-Salam, A. M., Brown, J. K.,
Zafar, Y. and Markham, P. G. 2003. Diversity of DNA β: a satellite molecule
associated with some monopartite begomoviruses. Virology 312: 106–121.
Briddon, R. W., Bull, S. E., Amin, I., Mansoor, S., Bedford, I. D., Rishi, N., Siwatch,
S. S., Zafar, M. Y., Abdel-Salam, A. M. and Markham, P. G. 2004. Diversity
of DNA 1; a satellite-like molecule associated with monopartite begomovirus-
DNA β complexes. Virology 324: 462–474.
Briddon, R.W. and Stanley, J. 2006. Sub-viral agents associated with plant single-
stranded DNA viruses. Virology 344: 198–210.
Briddon, R., Brown, J., Moriones, E., Stanley, J., Zerbini, M., Zhou, X. and Fauquet,
C. 2008. Recommendations for the classification and nomenclature of the
DNA-β satellites of begomoviruses. Archives of Virology 153: 763–781.
Briddon, R. W., Basavaprabhu, P., Basavaraj, B., Nawaz-ul-Rehman, M. S. and
Fauquet, C. M. 2009. Distinct evolutionary histories of the DNA-A and DNA-
B components of bipartite begomoviruses. Manuscript in preparation.
Brough, C. L., Hayes, R. J., Morgan, A. J., Coutts, R. H. A. and Buck, K. W. 1988.
Effects of mutagenesis in vitro on the ability of cloned Tomato golden mosaic
182
virus DNA to infect Nicotiana benthamiana plants. Journal of General
Virology 69: 503–514.
Brough, C. L., Gardiner, W. E., Inamdar, N., Zhang, X. Y., Ehrlich, M. and Bisaro, D.
M. 1992. DNA methylation inhibits propagation of Tomato golden mosaic
virus DNA in transfected protoplasts. Plant Molecular Biology 18: 703–712.
Brown, J. K., Idris, A. M., Torres-Jerez, I., Banks, G. K. and Wyatt, S. D. 2001. The
core region of the coat protein gene is highly useful for establishing the
provisional identification and classification of begomoviruses. Archives of
Virology 146: 1581–1598.
Brown, J. K. and Czosnek, H. 2002. Whitefly transmission of plant virues. In R. T.
Plumb and J. A. Callow (Eds), Advances in Botanical Research. New York:
Academic Press, pp. 65–100.
Brunetti, A., Tavazza, R., Noris, E., Lucioli, A., Accotto, G. P. and Tavazza, M. 2001.
Transgenically expressed T-Rep of Tomato yellow leaf curl Sardinia virus acts
as a trans-dominant-negative mutant, inhibiting viral transcrition and
replication. Journal of Virology 75: 10573–10581.
Buchmann, R. C., Asad, S., Wolf, J. N., Mohannath, G. and Bisaro, D. M. 2009.
Geminivirus AL2 and L2 proteins suppress transcriptional gene silencing and
cause genome-wide reductions in cytosine methylation. The Journal of
Virology 83: 5005–5013.
Bull, S. E., Tsai, W. S., Briddon, R. W., Markham, P. G., Stanley, J. and Green, S. K.
2004. Diversity of begomovirus DNA β satellites of non-malvaceous plants in
east and south-east Asia. Archives of Virology 149: 1193–1200.
Bull, S. E., Briddon, R. W., Sserubombwe, W. S., Ngugi, K., Markham, P. G. and
Stanley, J. 2007. Infectivity, pseudorecombination and mutagenesis of Kenyan
cassava mosaic begomoviruses. Journal of General Virology 88: 1624–1633.
Campos-Olivas, R., Louis, J. M., Clerot, D., Gronenborn, B. and Gronenborn, A. M.
2002. The structure of a replication initiation protein unites diverse aspects of
nucleic acid metabolism Proceedings of National Academy of Science, USA.
99: 10310–10315.
Capoor, S. P. and Varma, P. M. 1948. Yellow mosaic of Phaseolus lunatus. Current
Science 17: 152–153.
183
Capoor, S. P. and Varma, P. M. 1950. New virus disease of Dolichos lablab. Current
Science 19: 242–249.
Castillo, A. G., Collinet, D., Deret, S., Kashoggi, A. and Bejarano, E. R. 2003. Dual
interaction of plant PCNA with geminivirus replication accessory protein
(REn) and viral replication protein (Rep). Virology 312: 381–394.
Castillo, A. G., Kong L. J., Hanley-Bowdoin, L. and Bejarano, E. R. 2004. Interaction
between a geminivirus replication protein and the plant sumoylation system.
Journal of Virology 78: 2758–2769.
Chakraborty, S., Pandel, P. K., Banerjee, M. K., Kalloo, G. and Fauquet, C. M. 2003.
Tomato leaf curl Gujarat virus, a new begomovirus species causing a severe
leaf curl disease of tomato in Varanasi, India. Virology 93: 1485–1495.
Chatchawankanphanich, O. and Maxwell, D. P. 2002. Tomato leaf curl Karnataka
virus from Bangalore, India, appears to be a recombinant begomovirus.
Phytopathology 92: 637–645.
Chatterji, A., Chatterji, U., Beachy, R. N. and Fauquet, C. M. 2000. Sequence
parameters that determine specificity of binding of the replication associated
protein to its cognate site in two strains of Tomato leaf curl virus-New Delhi.
Virology 273: 341–350.
Chatterji, A., Beachy, R. N. and Fauquet, C. M. 2001. Expression of the
oligomerization domain of the replication-associated protein (Rep) of Tomato
leaf curl New Delhi virus interferes with DNA accumulation of heterologous
geminiviruses. Journal of Biological Chemistry 276: 25631–25638.
Chattopadhyay, B., Singh, A., Yadav, T., Fauquet, C., Sarin, N. and Chakraborty, S.
2008. Infectivity of the cloned components of a begomovirus: DNA beta
complex causing chilli leaf curl disease in India. Archives of Virology 153:
533–539.
Choudhury, N. R., Malik, P. S., Singh, D. K., Islam, M. N., Kaliappan, K. and
Mukherjee, S. K. 2006. The oligomeric Rep protein of Mungbean yellow
mosaic India virus (MYMIV) is a likely replicative helicase. Nucleic Acids
Research 34: 6362–6377.
Chung, B. N., Canto, T. and Palukaitis, P. 2007. Stability of recombinant plant viruses
containing genes of unrelated plant viruses. Journal of General Virology 88:
1347–1355.
184
Cohen, S. and Nitzany, F. E. 1966. Transmission and host range of the Tomato yellow
leaf curl virus. Phytopathology 56: 1127–1131.
Cohen, S., Duffus, J. E., Larsen, R. C., Liu, H. Y. and Flock, R. A. 1983. Purification,
serology, and vector relationships of squash leaf curl virus, a whitefly-
transmitted geminivirus. Phytopathology 73: 1669–1673.
Collin, S., Fernandezlobato, M., Gooding, P. S., Mullineaux, P. M. and Fenoll, C.
1996. The two non-structural proteins from Wheat dwarf virus involved in
viral gene expression and replication are retinoblastoma-binding proteins.
Virology 219: 324–329.
Cui, X. F., Xie, Y. and Zhou, X. P. 2004a. Molecular characterization of DNA β
molecules associated with Tobacco leaf curl Yunnan virus. Journal of
Phytopathology. 152: 647–650.
Cui, X., Tao, X., Xie, Y., Fauquet, C. M. and Zhou, X. 2004b. A DNA β associated
with Tomato yellow leaf curl China virus is required for symptom induction.
Journal of Virology 78: 13966–13974.
Cui, X., Li, G., Wang, D., Hu, D. and Zhou, X. 2005. A begomovirus DNA β-
encoded protein binds DNA, functions as a suppressor of RNA silencing, and
targets the cell nucleus. Journal of Virology 79: 10764–10775.
Czosnek, H. and Laterrot, H. 1997. A world wide survey of Tomato yellow leaf curl
viruses. Archive of Virology 142: 1391–1406.
Czosnek, H., Ghanim, M., Morin, S., Rubinstein, G., Fridman, V. and Zeidan, M.
2001. Whiteflies; vectors, and victims of geminiviruses. Advances in Virus
Research 57: 291–322.
Czosnek, H., Ghanim, M. and Ghanim, M. 2002. The circulative pathway of
begomoviruses in the whitefly vector Bemisia tabaci — insights from studies
with Tomato yellow leaf curl virus. Annals Applied Biology 140: 215–231.
Dalmay, T., Hamilton, A. Rudd, S. Angell, S. and Baulcombe. D. C. 2000. An RNA-
dependent RNA polymerase gene in Arabidopsis is required for
posttranscriptional gene silencing mediated by a transgene but not by a virus.
Cell 101: 543–553.
Dalmay, T., Horsefield, R. Braunstein, T. H. and Baulcombe, D. C. 2001. SDE3
encodes an RNA helicase required for post-transcriptional gene silencing in
Arabidopsis. EMBO Journal 20: 2069–2077.
185
Dangl, J. L., Dietrich, R. A. and Richberg, M. H. 1996. Death don’t have no mercy:
Cell death programs in plant–microbe interactions. Plant Cell 8: 1793–1807.
Dean, F. B., Nelson, J. R., Giesler, T. L. and Lasken, R. S. 2001. Rapid amplification
of plasmid and phage DNA using phi29 DNA polymerase and multiply-
primed rolling circle amplification. Genome Research 11: 1095–1099.
De Candolle, A. 1886. Origin of cultivated plants. Hafner Publishing Company., New
York, N. Y. (Reprint of 2nd ed. 1959).
Desbiez, C., David, C., Mettouchi, A., Laufs, J. and Gronenborn, B. 1995. Rep
protein of tomato yellow leaf curl geminivirus has an ATPase activity required
for viral DNA replication. Proceedings of National Academy of Science, USA
92: 5640–5644.
Dickinson, V. J., Halder, J. and Woolston, C. J. 1996. The product of Maize streak
virus ORF V1 is associated with secondary plasmodesmata and is first
detected with the onset of viral lesions. Virology 220: 51–59.
Ding, S. W., Li, H., Lu, R., Li, F. and Li, W. X. 2004. RNA silencing: a conserved
antiviral immunity of plants and animals. Virus Research 102: 109–115.
Dixon, R. and Kahn, D. 2004. Genetic regulation of biological nitrogen fixation.
Nature Reviews Microbiology 2: 621–631.
Dong, X., van Wezel, R., Stanley, J. and Hong, Y. 2003. Functional characterization
of the nuclear localization signal for a suppressor of posttranscriptional gene
silencing. Journal of Virology 77: 7026–7033.
Donson, J., Morris-Krsinich, B. A. M., Mullineaux, P. M., Boulton, M. I. and Davies,
J. W. 1984. A putative primer for second-strand synthesis of Maize streak
virus is virion-associated. EMBO Journal 3: 3069–3073.
Doyle, J. J. and Doyle, J. L. 1990. Isolation of plant DNA from fresh tissue. Focus 12:
13–15.
Dry, I., Krake, L. R., Rigden, J. E. and Rezaian, M. A. 1997. A novel subviral agent
associated with a geminivirus: the first report of a DNA satellite. Proceeding
of National Academy of Science USA 94: 7088–7093.
Duan, Y. P., Powell, C. A. Purcifull, D. E. Broglio, P. and Hiebert, E. 1997.
Phenotypic variation in transgenic tobacco expressing mutated geminivirus
movement/pathogenicity (BC1) proteins. Molecular Plant-Microbe
Interactions. 10: 1065–1074.
186
Eagle, P. A., Orozco, B. M. and Hanley-Bowdoin, L. 1994. A DNA sequence
required for geminivirus replication also mediates transcriptional regulation.
Plant Cell 6: 1157–1170.
Egelkrout, E. M., Mariconti, L., Settlage, S. B., Cella, R., Robertson, D and Hanley-
Bowdoin, S. 2002. Two E2F elements regulate the proliferating cell nuclear
antigen promoter differently during leaf development. Plant Cell 14: 3225–
3236.
Elmer, J. S., Brand, L., Sunter, G., Gardiner, W. E., Bisaro, D. M. and Rogers, S. G.
1988. Genetic analysis of the tomato golden mosaic virus. The product of the
AL1 coding sequence is required for replication. Nucleic Acids Research 16:
7043–7060.
Esteban, J. A., Salas, M. and Blanco, L. 1993. Fidelity of phi 29 DNA polymerase.
Comparison between protein-primed initiation and DNA polymerization.
Journal of Biological Chemistry 268: 2719–2726.
Etessami, P., Callis, R., Ellwood, S. and Stanley, J. 1988. Delimitation of essential
genes of Cassava latent virus DNA 2. Nucleic Acids Research. 16: 4811–
4829.
Etessami, P., Saunders, K., Watts, J. and Stanley, J. 1991. Mutational analysis of
complementary-sense genes of African cassava mosaic virus DNA A. Journal
of General Virology 72: 1005–1012.
Evans, D and Jeske, H. 1993. DNA-B facilitates, but is not essential for, the spread of
Abutilon mosaic virus in agroinoculated Nicotiana benthamiana. Virology
194: 752–757.
Fagoaga, C., Lόpez, C., de Mendoza, A., Moreno, P., Navarro, L., Flores, R. and
Peńa, L. 2006. Post-Transcriptional Gene Silencing of the p23 Silencing
Suppressor of Citrus tristeza virus Confers Resistance to the Virus in
Transgenic Mexican Lime. Plant Molecular Biology 60: 153.
Faivre-Rampant, O., Gilroy, E. M., Hrubikova, K., Hein, I., Millam, S., Loake, G. J.,
Birch, P., Taylor, M. and Lacomme, C. 2004. Potato Virus X-induced gene
silencing in leaves and tubers of potato. Plant Physiology 134: 1308–1316.
Fauquet, C. M., Bisaro, D. M., Briddon, R. W., Brown, J. K., Harrison, B. D.,
Rybicki, E. P., Stenger, D. C. and Stanley, J. 2003. Revision of taxonomic
187
criteria for species demarcation in the family Geminiviridae, and an updated
list of begomovirus species. Archives of Virology 148: 405–421.
Fauquet, C., Briddon, R., Brown, J., Moriones, E., Stanley, J., Zerbini, M. and Zhou,
X. 2008. Geminivirus strain demarcation and nomenclature. Archives of
Virology 153: 783–821.
Ferreira, P. T. O., Lemos, T. O., Nagata, T. and Inoue-Nagata, A. K. 2008. One-step
cloning approach for construction of agroinfectious begomovirus clones.
Journal of Virological Methods 147: 351–354.
Fire, A. and Xu, S. Q. 1995. Rolling replication of short DNA circles. Proceeding of
National Academy of Science USA 92: 4641–4645.
Flor, H. H. 1971. Current status of the gene-for-gene concept. Annual Review of
Phytopathology 9: 275–296.
Fofana, I. B., Sangare, A., Collier, R., Taylor, C. and Fauquet, C. M. 2004. A
geminivirus-induced gene silencing system for gene function validation in
cassava. Plant Molecular Biology 56: 613–624.
Fontes, E. P. B., Luckow, V. A. and Hanley-Bowdoin, L. 1992. A geminivirus
replication protein is a sequence-specific DNA binding protein. Plant Cell 4:
597–608.
Fontes, E. P. B., Eagle, P. A., Sipe, P. S., Luckow, V. A. and Hanley Bowdoin, L.
1994. Interaction between a geminivirus replication protein and origin DNA is
essential for viral replication. Journal of Biological Chemistry 269: 8459–465.
Fox, J. E., Gulledge, J., Engelhaupt, E., Burow, M. E. and McLachlan, J. A. 2007.
Pesticides reduce symbiotic efficiency of nitrogen-fixing rhizobia and host
plants. Proceeding of National Academy of Science USA 104: 10282–10287.
Frischmuth, T., Roberts, S., von Arnim, A. and Stanley, J. 1993. Specificity of
bipartite geminivirus movement proteins. Virology 196: 666–673.
Frischmuth, T. and Stanley, J. 1993. Strategies for the control of geminivirus diseases.
Virology 4: 329–337.
Frischmuth, T. and Stanley, J. 1994. Beet curly top virus symptom amelioration in
Nicotiana benthamiana transformed with a naturally occurring viral
subgenomic DNA. Virology 200: 826–830.
Frischmuth, T., Engel, M., Lauster, S. and Jeske, H. 1997. Nucleotide sequence
evidence for the occurrence of three distinct whitefly-transmitted, Sida-
188
infecting bipartite geminiviruses in Central America. Journal of General
Virology 78: 2675–2682.
Frischmuth, T. and Stanley, J. 1998. Recombination between viral DNA and the
transgenic coat protein gene of African cassava mosaic geminivirus. Journal
of General Virology 79: 1265–1271.
Frischmuth, S., Kleinow, T., Aberle, H. J., Wege, C., Hülser, D. and Jeske, H. 2004.
Yeast two-hybrid systems confirm the membrane-association and
oligomerization of BC1 but do not detect an interaction of the movement
proteins BC1 and BV1 of Abutilon mosaic geminivirus. Archives of Virology
149: 2349–2364.
Frischmuth, S., Wege, C., Hülser, D. and Jeske, H. 2007. The movement protein BC1
promotes redirection of the nuclear shuttle protein BV1 of Abutilon mosaic
geminivirus to the plasma membrane in fission yeast. Protoplasma 230: 117–
23.
García-Arenal, F., Fraile, A. and Malpica, J. M. 2001. Variability and genetic
structure of plant virus populations. Annual Reviews of Phytopathology 39:
157–186.
Gardiner, W. E., Sunter, G., Brand, L., Elmer, J. S., Rogers, S. G. and Bisaro, D. M.
1988. Genetic analysis of tomato golden mosaic virus: the coat protein is not
required for systemic spread or symptom development. EMBO Journal 7:
899–904.
Garmendia, C., Bernad, A., Esteban, J. A., Blanco, L. and Salas, M. 1992. The
bacteriophage phi29 DNA polymerase, a proofreading enzyme. Journal of
Biological Chemistry 267: 2594–2599.
Garrido-Ramirez, E. R., Sudarshana, M. R., Lucas, W. J. and Gilbertson, R. L. 2000.
Bean dwarf mosaic virus BV1 protein is a determinant of the hypersensitive
response and avirulence in Phaseolus vulgaris. Molecular Plant-Microbe
Interactions 13: 1184–1194.
Gennadius, P. 1889. Disease of tobacco plantations in the Trikonia. The aleurodid of
tobacco. Ellenike Georgia 5:1–3.
Ghanim, M., Morin, S. and Czosnek, H. 2001. Rate of Tomato yellow leaf curl virus
translocation in the circulative transmission pathway of its vector, the whitefly
Bemisia tabaci. Phytopathology 91: 188–196.
189
Gibbs, M. J. and Weiller, G. F. 1999. Evidence that a plant virus switched hosts to
infect a vertebrate and then recombined with a vertebrate-infecting virus.
Proceeding of National Academy of Science USA 96: 8022–8027.
Gilbertson, R. L., Sudarshana, M., Jiang, H., Rojas, M. R. and Lucas, W. J. 2003.
Limitations on geminivirus genome size imposed by plasmodesmata and
virus-encoded movement protein: Insights into DNA Trafficking. Plant Cell
15: 2578–2591.
Girish, K. R. and Usha, R. 2005. Molecular characterization of two soybean-infecting
begomoviruses from India and evidence for recombination among legume-
infecting begomoviruses from South-East Asia. Virus Research 108: 167–
176.
Goodman, R. M. 1977a. Single-stranded DNA genome in a whitefly-transmitted plant
virus. Virology 83: 171–179.
Goodman, R. M., 1977b. Infectious DNA from a whitefly-transmitted virus of
Phaseolus vulgaris. Nature 266: 54–55.
Goodman, R. N. and Novacky, A. J. 1994. The hypersensitive reaction in plants to
pathogens. A resistance phenomenon. St Paul, MN, USA: APS Press.
Gopal, P., Pravin Kumar, P., Sinilal, B., Jose, J., Kasin Yadunandam, A. and Usha, R.
2007. Differential roles of C4 and βC1 in mediating suppression of post-
transcriptional gene silencing: evidence for transactivation by the C2 of
Bhendi yellow vein mosaic virus, a monopartite begomovirus. Virus Research
123: 9–18.
Greathead, A. H. 1986. Host plants. In: Bemisia tabaci – A Literature Survey. Ed. by
Cock, M. J. W. Ascot: FAO and CAB International Institute of Biological
Control. p 17–25.
Grimsley, N., Hohn, T., Davies, J. W., Hohn, B. 1987. Agrobacterium-mediated
delivery of infectious Maize streak virus into maize plants. Nature 325: 177–
179.
Grimson, A., Farh, K. K., Johnston, W. K., Garrett-Engele, P., Lim, L. P. and Bartel,
D. P. 2007. MicroRNA targeting specificity in mammals: determinants beyond
seed pairing. Molecular Cell 27: 91–105.
190
Gröning, B. R., Abouzid, A. and Jeske, H. 1987. Single-stranded DNA from Abutilon
mosaic virus is present in the plastids of infected Abutilon sellovianum.
Proceeding of National Academy of Science USA 84: 8996–9000.
Guerineau, F., Lucy, A. and Mullineaux, P. 1992. Effect of two consensus sequences
preceding the translation initiator codon on gene expression in plant
protoplasts. Plant Molecular Biology 18: 815–818.
Guerra-Peraza, O., Kirk, D., Seltzer, V., Veluthambi, K., Schmit, A. C., Hohn, T. and
Herzog, E. 2005. Coat proteins of Rice tungro bacilliform virus and Mungbean
yellow mosaic virus contain multiple nuclear-localization signals and interact
with importin alpha. Journal of General Virology 86: 1815–1826.
Ha, C., Coombs, S., Revill, P., Harding, R., Vu, M. and Dale, J. 2006. Corchorus
yellow vein virus, a New World geminivirus from the Old World. Journal of
General Virology 87: 997–1003.
Ha, C., Coombs, S., Revill, P., Harding, R., Vu, M. and Dale, J. A. 2008. Molecular
characterization of begomoviruses and DNA satellites from Vietnam:
additional evidence that the New World geminiviruses were present in the Old
World prior to continental separation. Journal of General Virology 89: 312–
326.
Haasnoot, P. C. J., Cupac, D. and Berkhout, B. 2003. Inhibition of virus replication by
RNA interference. Journal of Biomedical Science 10: 607–616.
Haber, S., Ikegami, M., Bajet, N. B. and Goodman, R. M. 1981. Evidence for a
divided genome in bean golden mosaic virus, a geminivirus. Nature 289: 324–
326.
Haley, A., Zhan, X. C., Richardson, K., Head, K. and Morris, B. 1992. Regulation of
the activities of African cassava mosaic virus promoters by the AC1, AC2 and
AC3 gene products. Virology 188: 905–909.
Hameed, S. and Robinson, D. J. 2004. Begomoviruses from mungbeans in Pakistan:
epitope profiles, DNA A sequences and phylogenetic relationships. Archives
of Virology 149: 809–819.
Hamilton, W. D. O., Bisaro, D. M. and Buck, K. W. 1982. Identification of novel
DNA forms in Tomato golden mosaic virus infected tissue. Evidence for a two
component viral genome. Nucleic Acids Research 10: 4901–4912.
191
Hamilton, A., Voinnet, O., Chappell, L. and Baulcombe, D. 2002. Two classes of
short interfering RNA in RNA silencing. EMBO Journal 21: 4671–4679.
Hanley-Bowdoin, L., Elmer, J. S. and Rogers, S. G. 1990. Expression of functional
replication protein from Tomato golden mosaic virus in transgenic tobacco
plants. Proceedings of the National Academy of Sciences USA 87: 1446–1450.
Hanley-Bowdoin, L., Settlage, S. B., Orozco, B. M., Nagar, S. and Robertson, D.
1999. Geminiviruses: models for plant DNA replication, transcription, and cell
cycle regulation. Critical Reviews in Plant Sciences 18: 71–106.
Hanley-Bowdoin, L., Settlage, S. B. and Robertson, D. 2004. Reprogramming plant
gene expression: a prerequisite to geminivirus DNA replication. Molecular
Plant Pathology 5: 149–156.
Hao, L., Wang, H., Sunter, G. and Bisaro, D. M. 2003. Geminivirus AL2 and L2
proteins interact with and inactivate SNF1 kinase. Plant Cell 15: 1034–1048.
Harrison, B. D., Barker, H., Bock, K. R., Guthrie, E. J., Meredith, G. and Atkinson,
M. 1977. Plant viruses with circular single-stranded DNA. Nature 270: 760–
762.
Harrison, B. D. and Robinson, D. J. 1999. Natural genomic and antigenic variation in
whitefly-transmitted geminiviruses (begomoviruses). Annual Review of
Phytopathology 37: 369–398.
Harrison, B. D., Swanson, M. M. and Fargette, D. 2002. Begomovirus coat protein:
serology, variation and functions. Physiol Mol Plant Pathol 60: 257–271.
Hartitz, M. D., Sunter G. and Bisaro, D. M. 1999. The geminivirus transactivator
(TrAP) is a single-stranded DNA and zinc-binding phosphoprotein with an
acidic activation domain. Virology 263: 1–14.
Havelda, Z., Hornyik, C., Crescenzi, A. and Burgyàn, J. 2003. In situ characterization
of Cymbidium ringspot tombusvirus infection-induced posttranscriptional gene
silencing in Nicotiana benthamiana. Journal of Virology 77: 6082–6086.
Hefferon, K. L., Kipp, P. and Moon, Y. S. 2004. Expression and purification of
heterologous proteins in plant tissue using a geminivirus vector system.
Journal of Molecular Microbiology and Biotechnology 7: 109–114.
Hehnle, S., Wege, C. and Jeske, H. 2004. Interaction of DNA with the movement
proteins of geminiviruses revisited. Journal of Virology 78: 7698–7706.
192
Herr, A. J., Jensen, M. B., Dalmay, T. and Baulcombe, D. C. 2005. RNA polymerase
IV directs silencing of endogenous DNA. Science 308:118–120.
Heyraud-Nitschke, F., Shumacher, S., Laufs, J., Schaefer, S., Schell, J. and
Gronenborn, B. 1995. Determination of the origin cleavage and joining
domain of geminivirus Rep proteins. Nucleic Acids Research 23: 910–916.
Himber, C., Dunoyer, P., Moissiard, G., Ritzenthaler, C. and Voinnet, O. 2003.
Transitivity-dependent and -independent cell-to-cell movement of RNA
silencing. EMBO Journal 22: 4523–4533.
Höhnle, M., Höfer, P., Bedford, I. D., Briddon, R. W., Markham, P. G. and
Frischmuth, T. 2001. Exchange of three amino acids in the coat protein results
in efficient whitefly transmission of a nontransmissible Abutilon mosaic virus
isolate. Virology 290: 164–171.
Honda, Y., Iwaki, M., Saito, Y., Thonmeearkom, P., Kittisak, K. and Deema, N. 1983.
Mechanical transmission, purification and some properties of whitefly borne
Mung bean yellow mosaic virus in Thailand. Plant Disease 67: 801–804.
Hong, Y. and Stanley, J. 1995. Regulation of African cassava mosaic virus
complementary-sense gene expression by N-terminal sequences of the
replication-associated protein AC1. Journal of General Virology 76: 2415–
2422.
Hong, J. and Stanley, J. 1996. Virus resistance in Nicotiana benthamiana conferred
by African cassava mosaic virus replication-associated protein (AC1)
transgene. Molecular Plant-Microbe Interactions 4: 219–225.
Hong, Y., Saunders, K. and Stanley, J. 1997. Transactivation of dianthin transgene
expression by African cassava mosaic virus AC2. Virology 228: 383–37.
Hoogstraten, R. A., Hanson, S. F. and Maxwell, D. P. 1996. Mutational analysis of
the putative nicking motif in the replication-associated protein (AC1) of bean
golden mosaic geminivirus. Molecular Plant-Microbe Interactions 9: 594–
599.
Hormuzdi, S. G. and Bisaro, D. M. 1993. Genetic analysis of beet curly top virus:
evidence for three virion sense genes involved in movement and regulation of
single- and double-stranded DNA levels. Virology 193: 900–909.
Hou, Y. M., Sanders, R., Ursin, V. M. and Gilbertson, R. L. 2000. Transgenic plants
expressing geminivirus movement proteins: abnormal phenotypes and delayed
193
infection by Tomato mottle virus in transgenic tomatoes expressing the Bean
dwarf mosaic virus BV1 or BC1 proteins. Molecular Plant-Microbe
Interactions 13: 297–308.
Howarth, A. J. and Vandemark, G. J. 1989. Phylogeny of geminiviruses. Journal of
General Virology 70: 2717–2727.
Howell, S. H. 1984. Physical structure and genetic organisation of the genome of
Maize streak virus (Kenyan isolate). Nucleic Acids Research 12: 7359–7375.
Hur, J., Kenneth, J. B., Lee, S. and Keith, R. D. 2007. Transcriptional activator
elements for Curtovirus C1 expression reside in the 3′ coding region of ORF
C1. Molecules and Cells 23: 80–87.
Husain, M. A. and Trehan, K. N. 1933. Observations on the life-history, bionomics
and control of white-fly of cotton (Bemisia gossypiperda M. and L.). Indian
Journal of Agricultural Science 3: 701–753.
Hussain, M., Qazi, J., Mansoor, S., Iram, S., Bashir, M. and Zafar, Y. 2004. First
report of Mungbean yellow mosaic India virus on mungbean in Pakistan. New
Disease Reports [http://www.bspp.org.uk/ndr/] Volume 9.
Hussain, M., Mansoor, S., Iram, S., Fatima, A. N. and Zafar, Y. 2005. The nuclear
shuttle protein of Tomato leaf curl New Delhi virus is a pathogenicity
determinant. Journal of Virology 79: 4434–4439.
Hussain, M., Mansoor, S., Iram, S., Zafar, Y and Briddon, R. W. 2007. The
hypersensitive response to Tomato leaf curl New Delhi virus nuclear shuttle
protein is inhibited by transcriptional activator protein. Molecular Plant-
Microbe Interactions 20: 1581–1588.
Idris, A. M. and Brown, J. K. 2004. Cotton leaf crumple virus is a distinct Western
Hemisphere begomovirus species with complex evolutionary relationships
indicative of recombination and reassortment. Phytopathology 94: 1068–1074.
Ingham, D. J., Pascal. E. and Lazarowitz, S. G. 1995. Both bipartite geminivirus
movement proteins define viral host range, but only BL1 determines viral
pathogenicity. Virology 207: 191–204.
Innis, M. A., Gelfand, D. H. and Sninsky, J. J. 1990. PCR protocols. Academic Press,
San Diego.
Inoue-Nagata, A. K., Albuquerque, L. C., Rocha, W. B. and Nagata, T .2004. A
simple method for cloning the complete begomovirus genome using the
194
bacteriophage φ29 DNA polymerase. Journal of Virologcal Methods 116:
209–211.
Inouye, T. and Osaki, T. 1980. The first record in the literature of the possible plant
virus disease that appeared in Manyoshu, a Japanese classic anthology, as far
back as the time of the 8th century. Annual report of Phtopathological Society
of Japan 46: 49–50.
Jacob, S. S., Vanitharani, R., Karthikeyan, A. S., Chinchore, Y., Thillaichidambaram,
P. and Veluthambi, K. 2003. Mungbean yellow mosaic virus-Vi agroinfection
by codelivery of DNA A and DNA B from one Agrobacterium strain. Plant
Disease 87: 247–251.
Jacquemond, M., Teycheney, P. Y., Carrĕre, I., Navas-Castillo, J. and Tepfer, M.
2001. Resistance phenotypes of transgenic tobacco plants expressing different
cucumber mosaic virus (CMV) coat protein genes. Molecular Breeding 8: 85.
Jeske, H., Lutgemeier, M. and Preiss, W. 2001. DNA forms indicate rolling circle and
recombination-dependent replication of Abutilon mosaic virus. EMBO Journal
20: 6158–6167.
Jeske, H. 2009. Geminiviruses. In "The Still Elusive Human Pathogens" (E.-M. de
Villiers, and H. Zur Hausen, Eds.). Springer Verlag, Berlin Heidelberg.
Jiang, T. and Zhou, X. P. 2004. First report of Malvastrum yellow vein virus infecting
Ageratum conyzoides. Plant Pathology 53: 799.
Jiang, T. and Zhou, X. 2005. Molecular characterization of a distinct begomovirus
species and its associated satellite DNA isolated from Malvastrum
coromandelianum in China. Virus Genes 31: 43– 48.
Jin, M., Li, C., Shi, Y., Ryabov, E., Huang, J., Wu, Z., Fan, Z. and Hong, Y. 2008. A
single amino acid change in a geminiviral Rep protein differentiates between
triggering a plant defence response and initiating viral DNA replication.
Journal of General Virology 89: 2636–2641.
John, P., Sivalingam, P., Haq, Q., Kumar, N., Mishra, A., Briddon, R. and Malathi, V.
2008. Cowpea golden mosaic disease in Gujarat is caused by a Mungbean
yellow mosaic India virus isolate with a DNA B variant. Archives of Virology
153: 1359–1365.
195
Jordan, C., Shen, W., Hanley-Bowdoin, L. and Robertson, D. 2007. Geminivirus-
induced gene silencing of the tobacco retinoblastoma-related gene results in
cell death and altered development. Plant Molecular Biology 65: 163–175.
Jose, J. and Usha, R., 2003. Bhendi yellow vein mosaic disease in India is caused by
association of a DNA β satellite with a begomovirus. Virology 305: 310–317.
Jupin, I., De Kouchkovsky, F., Jouanneau, F. and Gronenborn, B. 1994. Movement of
tomato yellow leaf curl geminivirus (TYLCV): Involvement of the protein
encoded by ORF C4. Virology 204: 82–90.
Kapitonov, V. V. and Jurka, J. 2001. Rolling-circle transposons in eukaryotes.
Proceedings of the National Academy of Sciences USA 98: 8714–8719.
Karthikeyan, A. S., Vanitharani, R., Balaji, V., Anuradha, S., Thillaichidambaram, P.,
Shivaprasad, P. V., Parameswari, C., Balamani, V., Saminathan, M. and
Veluthambi, K. 2004. Analysis of an isolate of Mungbean yellow mosaic virus
(MYMV) with a highly variable DNA B component. Archive of Virology 149:
1643–1652.
Khan, A., Idris, A., Al-Saady, N., Al-Mahruki, M., Al-Subhi, A. and Brown, J. 2008.
A divergent isolate of Tomato yellow leaf curl virus from Oman with an
associated DNAβ satellite: an evolutionary link between Asian and the Middle
Eastern virus–satellite complexes. Virus Genes 36: 169–176.
Kikuno, R., Toh, H., Hayashida, H. and Miyata, T. 1984. Sequence similarity between
putative gene products of geminiviral DNAs. Nature 308: 562–562.
Kim, C. H. and Palukaitis, P. 1997. The plant defense response to Cucumber mosaic
virus in cowpea is elicited by the viral polymerase gene and affects virus
accumulation in single cells. EMBO Journal 16: 4060–4068
Kirthi, N. and Savithri, H. S. 2003. A conserved zinc finger motif in the coat protein
of Tomato leaf curl Bangalore virus is responsible for binding to ssDNA.
Archives of Virology 148: 2369–2380.
Kittelmann, K., Rau, P., Gronenborn, B. and Jeske, H. 2009. Plant geminivirus Rep
protein induces re-replication in fission yeast. Journal of Virology (in press).
Kjemtrup, S., Sampson, K. S., Peele C. G., Nguyen, L. V., Conkling, M. A.,
Thompson, W. F. and Robertson, D. 1998. Gene silencing from plant DNA
carried by a geminivirus. Plant Journal 14: 91–100.
196
Klahre, U., Crete, P., Leuenberger, S. A., Iglesias, V. A. and Meins, F. 2002. High
molecular weight RNAs and small interfering RNAs induce systemic
posttranscriptional gene silencing in plants. Proceedings of the National
Academy of Sciences USA 99: 11981–11986.
Klinkenberg, A., Ellwood, S. and Stanley, J. 1989. Fate of African cassava mosaic
virus coat protein deletion mutants after agroinoculation. Journal of General
Virology 70: 1837–1844.
Klute, K. A., Nadler, S. A. and Stenger, D. C. 1996. Horseradish curly top is a distinct
subgroup II geminivirus species with Rep and C4 genes derived from a
subgroup III ancestor. Journal of General Virology 77: 1369–1378.
Kolar, S. and Lodge, D. M. 2001. Progress in invasion biology: predicting invaders.
Trends in Ecology and Evolution 16: 199–204.
Kong, L. J., Orozco, B. M., Roe, J. L., Nagar, S., Ou, S., Feiler, H. S., Durfee, T.,
Miller, A. B., Gruissem, W., Robertson, D. and Hanley-Bowdoin, L. 2000. A
geminivirus replication protein interacts with the retinoblastoma protein
through a novel domain to determine symptoms and tissue specificity of
infection in plants. EMBO Journal 19: 3485–3495.
Kong, L. and Hanley-Bowdoin, L. 2002. A geminivirus replication protein interacts
with a protein kinase and a motor protein that display different expression
patterns during plant development and infection. Plant Cell 14: 1817–1832.
Koonin, E. V. and Ilyina, T. V. 1992. Geminivirus replication proteins are related to
prokaryotic plasmid rolling circle DNA replication initiator proteins. Journal
of General Virology 73: 2763–2766.
Kornberg, A. and Baker, T. A. 1992. DNA replication. W.H. Freeman and Company,
San Francisco.
Krek, A., Grün, D., Poy, M. N., Wolf, R., Rosenberg, L., Epstein, E. J.,
MacMenamin, P., da Piedade, I., Gunsalus, K. C., Stoffel, M. and Rajewsky,
N. 2005. Combinatorial microRNA target predictions. Nature Genetics 37:
495–500.
Kunik, T., Salomon, R., Zamir, D., Navot, N., Zeidan, M., Michelson, I., Gafni, Y.
and Czosnek, H. 1994. Transgenic tomato plants expressing the Tomato
yellow leaf curl virus capsid protein are resistant to the virus. Biotechnology
12: 500–504.
197
Kunik, T., Palanichelvam, K., Czosnek, H., Citovsky, V. and Gafni, Y. 1998. Nuclear
import of the capsid protein of Tomato yellow leaf curl virus (TYLCV) in
plant and insect cells. Plant Journal 13: 393–399.
Kunik, T., Mizrachy, L., Citovsky, V. and Gafni, Y. 1999. Characterization of a
tomato karyopherin α that interacts with the Tomato yellow leaf curl virus
(TYLCV) capsid protein. Journal of Experimental Biology 50: 731–732.
Lacomme, C. and Chapman, S. 2008. Use of Potato virus X (PVX) -based vector for
gene expression and virus-induced gene silencing (VIGS). Current Protocols
in Microbiology 8: 161.1.1–161.1.13.
Lai, J., Chen, H., Teng, K., Zhao, Q., Zhang, Z., Li, Y., Liang, L., Xia, R., Wu, Y.,
Guo, H. and Xie, Q. 2009. RKP, a RING finger E3 ligase induced by BSCTV
C4 protein, affects geminivirus infection by regulation of plant cell cycle.
Plant Journal 57: 905–917.
Lamb, C. and Dixon, R. A. 1997. The oxidative burst in plant disease resistance.
Annual Review of Plant Physiology and Plant Molecular Biology 48: 251–275
Latham, J. R., Saunders, K., Pinner, M. S. and Stanley, J. 1997. Induction of plant cell
division by Beet curly top virus gene C4. Plant Journal 11: 1273–1283.
Laufs, J., Traut, W., Heyraud, F., Matzeit, V., Rogers, S. G., Schell, J., and
Gronenborn, B. 1995a. In vitro cleavage and joining at the viral origin of
replication by the replication initiator protein of Tomato yellow leaf curl virus.
Proceedings of the National Academy of Sciences USA 92: 3879–3883.
Laufs, J., Schumacher, S., Geisler, N., Jupin, I., Gronenborn, B., 1995b. Identification
of the nicking tyrosine of geminivirus Rep protein. FEBS Letters. 377: 258–
262.
Laufs, J., Jupin, I., David, C., Schumacher, S., Heyraud-Nitschke, F. and Gronenborn,
B. 1995c. Geminivirus replication: genetic and biochemical characterization of
Rep protein function, a review. Biochimie 77: 765–773.
Lazarowitz, S. G., Wu, L. C., Rogers, S. G. and Elmer, J. S. 1992. Sequence-specific
interaction with the viral AL1 protein identifies a geminivirus DNA
replication origin. Plant Cell 4: 799–809.
Lefeuvre, P., Lett, J. M., Reynaud, B., Martin, D. P. 2007a. Avoidance of protein fold
disruption in natural virus recombinants. PLoS Pathogens 3: e181.
198
Lefeuvre, P., Martin, D. P., Hoareau, M., Naze, F., Delatte, H., Thierry, M., Varsani,
A., Becker, N., Reynaud, B., Lett, J. M. 2007b. Begomovirus 'melting pot' in
the south-west Indian Ocean islands: molecular diversity and evolution
through recombination. Journal of General Virology 88: 3458–68.
Leung, A. K. and Sharp, P. A. 2007. microRNAs: a safeguard against turmoil? Cell
130: 581–585.
Lewis, B. P., Shih, I. H., Jones-Rhoades, M. W., Bartel, D. P. and Burge, C. B. 2003.
Prediction of mammalian microRNA targets. Cell 115: 787–798.
Li, Z. H., Xie, Y. and Zhou, X. P. 2005. Tobacco curly shoot virus DNAβ is not
necessary for infection but intensifies symptoms in a host-dependent manner.
Phytopathology 95: 902–908.
Lindbo, J. A., Silva-Rosales, L., Proebsting, W. M. and Dougherty, W. G. 1993.
lnduction of a highly specific antiviral state in transgenic plants: implications
for regulation of gene expression and virus resistance. Plant Cell 5: 1749–
1759.
Liu, D., Daubendiek, S. L., Zillman, M. A., Ryan, K. and Kool, E. T. 1996. Rolling
circle DNA synthesis: Small circular oligonucleotides as efficient templates
for DNA polymerases. Journal of the American Chemical Society 118: 1587–
1594.
Liu, H., Boulton, M. I. and Davies, J. W. 1997. Maize streak virus coat protein binds
single- and double-stranded DNA in vitro. Journal of General Virology 78:
1265–1270.
Liu, H., Boulton, M. I., Thomas, C. L., Prior, D. A., Oparka, K. J. and Davies, J. W.
1999. Maize streak virus coat protein is karyophyllic and facilitates nuclear
transport of viral DNA. Molecular Plant-Microbe Interactions 12: 894–900.
Lizardi, P. M., Huang, X., Zhu, Z., Bray-Ward, P., Thomas, D. C. and Ward, D. C.
1998. Mutation detection and single-molecule counting using isothermal
rolling-circle amplification. Nature Genetics 19: 225–232.
Lotrakul, P., Valverde, R. A., Clark, C. A. and Hurtt, S. 2002. Sweet potato leaf curl
virus and related geminiviruses in sweetpotato. Acta Horticultrae 583: 135–
141.
Lu, R., Malcuit, I., Moffett, P., Ruiz, M. T., Peart, J., Wu, A. J., Rathjen, J. P.,
Bendahmane, A., Day, L. and Baulcombe, D. C. 2003. High throughput virus-
199
induced gene silencing implicates heat shock protein 90 in plant disease
resistance. EMBO Journal 22: 5690–5699.
Lucioli, A., Noris, E., Brunetti, A., Tavazza, R., Ruzza, V., Castillo, A. G., Bejarano,
E. R., Accotto, G. P. and Tavazza, M. 2003. Tomato yellow leaf curl Sardinia
virus Rep-derived resistance to homologous and heterologous geminiviruses
occurs by different mechanisms and is overcome if virus-mediated transgene
silencing is activated. Journal of Virology 77: 6785–6798.
Luque, A., Sanz-Burgos, A. P., Ramirez-Parra, E., Castellano, M. M. and Gutiérrez,
C. 2002. Interaction of geminivirus Rep protein with replication factor C and
its potential role during geminivirus DNA replication. Virology 302: 83–94.
Luria, S. E., Darnell, J. E. J., Baltimore, D. and Cambell, A. 1978. In general
virology, pp. 1–7 John Willey and sons.
Lyttle, D. J. and Guy, P. L. 2004. First record of geminiviruses in New Zealand:
Abutilon mosaic virus and Honeysuckle yellow vein virus. Australian Plant
Pathology 33: 321–322.
Malathi, V. G., Surendranath, B., Naghma, A. and Roy, A. 2005. Adaptation to new
hosts shown by the cloned components of Mungbean yellow mosaic India
virus causing cowpea golden mosaic in northern India. Canadian Journal of
Plant Pathology 27: 439–447.
Mandal, B., Varma, A. and Malathi, V. G. 1997. Systemic infection of Vigna mungo
using the cloned DNAs of the blackgram isolate of Mungbean yellow mosaic
geminivirus through agroinoculation and transmission of the progeny virus by
whiteflies. Journal of Phytopathology 145: 505–510.
Mansour, A. and Al-Musa, A. 1992. Tomato yellow leaf curl virus: host range and
virus vector relationships. Plant Pathology 42: 122–125.
Mansoor, S., Khan, S. H., Bashir, A., Saeed, M., Zafar, Y., Malik, K. A., Briddon, R.
W., Stanley, J. and Markham, P. G. 1999. Identification of a novel circular
single-stranded DNA associated with cotton leaf curl disease in Pakistan.
Virology 259: 190–199.
Mansoor, S., Amin, I., Hussain, M., Zafar, Y., Bull, S., Briddon, R. W. and Markham,
P. G. 2001. Association of a disease complex involving a begomovirus, DNA
1 and a distinct DNA beta with leaf curl disease of okra in Pakistan. Plant
Disease 85: 922.
200
Mansoor, S., Briddon, R. W., Bull, S. E., Bedford, I. D., Bashir, A., Hussain, M.,
Zafar, M.Y., Malik, K. A., Fauquet, C. and Markham, P. G. 2003. Cotton leaf
curl disease is associated with multiple monopartite begomoviruses supported
by single DNA β. Archives of Virology 148: 1969–1986.
Mariano, A. C., Andrade, M. O., Santos, A. A., Carolino, S. M. B., Oliveira, M. L.,
Baracat-Pereira, M. C., Brommonshenkel, S. H. and Fontes, E. P. B. 2004.
Identification of a novel receptor-like protein kinase that interacts with a
geminivirus nuclear shuttle protein. Virology 318: 24–31.
Martin, D. P. and Rybicki, E. P. 2000. RDP: detection of recombination amongst
aligned sequences. Bioinformatics 16: 562–563.
Maruthi, M. N., Rekha, A. R., Govindappa, M. R., Colvin, J. and Muniyappa, V.
2005. A distinct begomovirus causes Indian dolichos yellow mosaic disease.
New Diseas Report. [http://www.bspp.org.uk/ndr/] Volume 11.
Maruthi, M. N., Manjunatha, B., Rekha, A. R., Govindappa, M. R., Colvin, J. and
Muniyappa, V. 2006. Dolichos yellow mosaic virus belongs to a distinct
lineage of Old World begomoviruses; its biological and molecular properties.
Annals of Applied Biology 149: 187–195.
Matthews, R. E. F. 1979. Classification and nomenclature of viruses. Third Report of
the International Committee on Taxonomy of Viruses. Intervirology 12:132–
296.
Mayo, M. A., Leibowitz, M. J., Palukaitis, P., Scholthof, K. B. G., Simon, A. E.,
Stanley, J. and Taliansky, M. 2005. Satellites. In: Fauquet, C. M., Mayo, M.
A., Maniloff, J., Desselberger, U., Ball, L.A. (Eds.), VIIIth Report of the
International Committee on Taxonomy of Viruses. Virus Taxonomy,
Elsevier/Academic Press, London, pp. 1163–1169.
McGarry, R. C., Barron, Y. D., Carvalho, M. F., Hill, J. E., Gold, D., Cheung, E.,
Kraus, W. L. and Lazarowitz, S. G. 2003. A novel Arabidopsis
acetyltransferase interacts with the geminivirus movement protein NSP. Plant
Cell 15: 1605–1618.
Mehta, P., Wyman, J. A., Nakhla, M. K. and Maxwell, D. P. 1994. Polymerase chain
reaction detection of viruliferous Bemisia tabaci (Homoptera:Aleyrodidae)
with two tomato-infecting geminiviruses. Journal of Economic Entomology
87: 1285–1290.
201
Méndez-Lozano, J., Quintero-Zamora, E., Barbosa-Jasso, M. P., Leyva-López, N. E.,
Garzón-Tiznado, A. and Argüello-Astorga, G. R. 2006. A begomovirus
associated with leaf curling and chlorosis of soybean in Sinaloa, Mexico is
related to Pepper golden mosaic virus. Plant Disease 90: 109.
Michalakis, Y., Roze, D. 2004. Epistasis in RNA viruses. Science 306: 1492–1493.
Modernell, M. G., Granito, M., Paolini, M. and Olaizola, C. 2008. Use of cowpea
(Vigna sinensis) as a chicken complement in an infant formula. Archive of
Latinoam Nutrition 58:292–298.
Moffatt, B. A., Stevens, Y. Y., Allen, M. S., Snider, J. D., Periera, L. A., Todorova,
M. I., Summers, P. S., Weretilnyk, E. A., Martin-Caffrey, L. and Wagner C.
2002. Adenosine kinase deficiency is associated with developmental
abnormalities and reduced transmethylation. Plant Physiology 128: 812–821.
Mohr, J. J., Clark, R., Sun, S., Androphy, E. J., MacPherson, P. and Botchan, M. R.
1990. Targeting the E1 replication protein to the papillomavirus origin of
replication by complex formation with E2 transactivation. Science 250:1694–
1699.
Monci, F., Sanchez-Campos, S., Navas-Castillo, J. and Moriones, E. 2002. A natural
recombinant between the geminiviruses Tomato yellow leaf curl Sardinia
virus and Tomato yellow leaf curl virus exhibits a novel pathogenic phenotype
and is becoming prevalent in Spanish populations. Virology 303: 317–326.
Monsalve-Fonnegra, Z., Argüello-Astorga, G. and Rivera-Bustamante, R. 2001.
Geminivirus replication and gene expression. In "Plant viruses as molecular
pathogens" (J. A. Khan, and J. Dijstra, Eds.), pp. 257-277. The Haworth Press,
New York.
Mor, T. S., Moon, Y. S., Palmer, K. E. and Mason, H. S. 2003. Geminivirus vectors
for high-level expression of foreign proteins in plant cells. Biotechnology and
Bioengineering 81: 430–437.
Morel, J. B. and J. L. Dangl. 1997. The hypersensitive response and the induction of
cell death in plants. Cell Death and Differentiation 4: 1318–1328.
Morinaga, T., Ikegami, M. and Miura, K. I. 1993. The nucleotide sequence and
genome structure of mungbean yellow mosaic geminivirus. Microbiology and
Immunology 37: 471–476.
202
Morozov, S., Fedorkin, O., Juttner, G., Schiemann, J., Baulcombe, D. and Atabekov,
J. 1997. Complementation of a Potato virus X mutant mediated by
bombardment of plant tissues with cloned viral movement protein genes.
Journal General Virology 78: 2077–2083.
Mourrain, P., Beclin, C., Elmayan, T., Feuerbach, F., Godon, C., Morel, J. B., Jouette,
D., Lacombe, A. M., Nikic, S., Picault, N., Remoue, K., Sanial, M., Vo, T. A.
and Vaucheret, H. 2000. Arabidopsis SGS2 and SGS3 genes are required for
post-transcriptional gene silencing and natural virus resistance. Cell 101: 533–
542.
Moya, A., Holmes, E. C., González-Candelas, F. 2004. The population genetics and
evolutionary epidemiology of RNA viruses. Nature Revies Microbiology 2:
279–288.
Muangsan, N., Beclin, C., Vaucheret, H., Robertson, D. 2004. Geminivirus VIGS of
endogenous genes requires SGS2/SDE1 and SGS3 and defines a new branch
in the genetic pathway for silencing in plants. Plant Journal 38: 1004–1014.
Mueller, E., Gilbert, J. E., Davenport, G., Brigneti, G. and Baulcombe, D. C. 1995.
Homology-dependent resistance: Transgenic virus resistance in plants related
to homology-dependent gene silencing. Plant Journal 7: 1001–1013.
Mullineaux, P. M., Donson, J., Morris-Krsinich, B. A. M., Boulton, M. I. and Davies,
J. W. 1984. The nucleotide sequence of Maize streak virus DNA. EMBO
Journal. 3: 3063–3068.
Mumford, D. L. 1974. Purification of curly top virus. Phytopathology 64: 136–139.
Muniyappa, V., Rajeshwari, R., Bharathan, N., Reddy, D. V. R. and Nolt, B. L. 1987.
Isolation and characterization of a geminivirus causing yellow mosaic disease
of horsegram (Macrotyloma uniflorum [Lam.] Verdc.). Journal of
Phytopathogy 119: 81–87.
Murphy, F. A., Fauquet, C. M., Bishop, D. H. L., Ghabrial, S. A., Jarvis, A. W.,
Martelli, G. P., Mayo, M. A. and Summers, M. D. 1995. Virus Taxonomy:
Sixth Report of the International Committee on Taxonomy of Viruses.
Wien, New York: Springer-Verlag. pp 585.
Nagar, S., Pedersen, T. J., Carrick, K. M., Hanley-Bowdoin, L. and Robertson, D.
1995. A geminivirus induces expression of a host DNA synthesis protein in
terminally differentiated plant cells. Plant Cell 7: 705–719.
203
Nair, N. G., Nene, Y. L. and Naresh, J. S. 1974. Reaction of certain urdbean varieties
to yellow mosaic virus of mungbean. Indian Phytopathology 27: 256–257.
Nariani, T. K. 1960. Yellow mosaic of mung (Phaseolus aureus L.). Indian
Phytopatholgy 13: 24–29.
Navot, N., Zeidan, M., Pichersky, E., Zamir, D. and Czosnek, H. 1992. Use of
polymerase chain reaction to amplify tomato yellow leaf curl virus DNA from
infected plants and viruliferous whiteflies. Phytopathology 82: 1199–1202.
Nene, Y. L. 1973. Viral disease of some warm weather pulse crops in India. Plant
Disease Reporter 57: 463–467.
Noris, E., Jupin, I., Accotto, G. P. and Gronenborn, B. 1996. DNA-binding activity of
the C2 protein of tomato yellow leaf curl geminivirus. Virology 217: 607–612.
Noueiry, A. O., Lucas, W. J. and Gilbertson, R. L. 1994. Two proteins of a plant
DNA virus coordinate nuclear and plasmodesmal transport. Cell 76: 925–932.
Onodera, Y., Haag, J. R., Ream, T., Nunes, P. C., Pontes, O. and Pikaard, C. S. 2005.
Plant nuclear RNA polymerase IV mediates siRNA and DNA-methylation
dependent heterochromtin formation. Cell 120: 613–622.
Orozco, B. M. and Hanley-Bowdoin, L. 1996. A DNA structure is required for
geminivirus replication origin function. Journal of Virology 70: 148–158.
Orozco B. M., Miller, A. B., Settlage, S. B. and Hanley-Bowdoin, L. 1997. Functional
domains of a geminivirus replication protein. Journal of Biological Chemistry
272: 9840–9846.
Orozco, B. M. and Hanley-Bowdoin, L. 1998. Conserved sequence and structural
motifs contribute to the DNA binding and cleavage activities of a geminivirus
replication protein. Journal of Biological Chemistry 273: 24448–24456.
Orozco, B. M., Gladfelter, H. J., Settlage, S. B., Eagle, P. A., Gentry, R. N. and
Hanley-Bowdoin, L. 1998. Multiple cis elements contribute to geminivirus
origin function. Virology, 242: 346–356.
Padidam, M., Beachy, R. N. and Fauquet, C. M. 1995. Classification and
identification of geminiviruses using sequence comparisons. Journal of
General Virology 76: 249–263.
Padidam, M., Beachy, R. N. and Fauquet C. M. 1996. The role of AV2 ("precoat")
and coat protein in viral replication and movement in tomato leaf curl
geminivirus. Virology 224: 390–404.
204
Padidam, M., Sawyer, S. and Fauquet, C. M. 1999. Possible emergence of new
geminiviruses by frequent recombination. Virology 265: 218–225.
Page, R. D. M. 1996. TREEVIEW: An application to display phylogenetic trees on
personal computers. Computer Applications in the Biosciences 12: 357–358.
Palanichelvam, K., Kunik, T., Citovsky, V. and Gafni, Y. 1998. The capsid protein of
Tomato yellow leaf curl virus binds cooperatively to single-stranded DNA.
Journal of General Virology 79: 2829–2833.
Pascal, E., Goodlove, P. E., Wu, L. C. and Lazarowitz, S. G. 1993. Transgenic
tobacco plants expressing the geminivirus BL1 protein exhibit symptoms of
viral disease. Plant Cell 5: 795–807.
Pascal, E., Sanderfoot, A. A., Ward, B. M., Medville, R., Turgeon, R., Lazarowitz, S.
G. 1994. The geminivirus BR1 movement protein binds single-stranded DNA
and localizes to the cell nucleus. Plant Cell 6: 995–1006.
Paximadis, M., Idris, A. M., Torres-Jerez, I., Villarreal, A., Rey, M. E. and Brown, J.
K. 1999. Characterization of tobacco geminiviruses in the Old and New
World. Archive of Virology 144: 703–717.
Peele, C., Jordan, C. V., Muangsan, N., Turnage, M., Egelkrout, E., Eagle, P., Hanley-
Bowdoin, L. and Robertson, D. 2001. Silencing of a meristematic gene using
geminivirus-derived vectors. Plant Journal 27: 357–366.
Peragine, A., Yoshikawa, M., Wu, G., Albrecht, H. L. and Poethig, R. S. 2004. SGS3
and SGS2/SDE1/RDR6 are required for juvenile development and the
production of trans-acting siRNAs in Arabidopsis. Genes and Development
18: 2368–2379.
Piroux, N., Saunders, K., Page, A. and Stanley, J. 2007. Geminivirus pathogenicity
protein C4 interacts with Arabidopsis thaliana shaggy-related protein kinase
AtSKη, a component of the brassinosteroid signalling pathway. Virology 362:
428–440.
Pita, J. S., Fondong, V. N., Sangre, A., Otim-Nape, G. W., Ogwal, S. and Fauquet, C.
M. 2001. Recombination, pseudorecombination and synergism of
geminiviruses are determinant keys to the epidemic of severe cassava mosaic
disease in Uganda. Journal General Virology 82: 655–665.
Pollard, D. G. 1955. Feeding habits of the cotton whitefly, Bemisia tabaci Genn.
(Homoptera:Aleyrodidae). Annals of Applied Biology 43: 664–671.
205
Polston, J. E., Al-Musa, A., Perring, T. M. and Dodds, J. A. 1990. Association of the
nucleic acid of squash leaf curl geminivirus with the whitefly Bemisia tabaci.
Phytopathology 80: 850–856.
Polston, J. E., McGovern, R. J. and Brown, L. G. 1999. Introduction of Tomato yellow
leaf curl virus in Florida and implications for the spread of this and other
geminiviruses of tomato. Plant Disease 83: 984–988.
Pooggin, M., Shivaprasad, P. V., Veluthambi, K. and Hohn, T. 2003. RNAi targeting
of DNA virus in plants. Nature Biotechnology 21: 131–132.
Pooma, W. and Petty, I. T. D. 1996. Tomato golden mosaic virus open reading frame
AL4 is genetically distinct from its C4 analogue in monopartite geminiviruses.
Journal of General Virology 77: 1947–1951.
Pooma, W., Gillette, W. K., Jeffrey, J. L. and Petty, I. T. D. 1996. Host and viral
factors determine the disspensability of coat protein for bipartite geminivirus
systemic movement. Virology 218: 264–268.
Porebski S. and Bailey L. G. 1997. Modification of a CTAB DNA extraction protocol
for plants containing high polysaccharide and polyphenol components. Plant
Molecular Biology Reporter 15: 8–15.
Poulter, R. T, Goodwin, T. J and Butler, M. I. 2003. Vertebrate helentrons and other
novel Helitrons. Gene 313: 201–212.
Preiss, W. and Jeske, H. 2003. Multitasking in replication is common among
geminiviruses. Journal of Virology 77: 2972–2980.
Priyadarshini, P. C. and Savithri, H. S. 2009. Kinetics of interaction of Cotton Leaf
Curl Kokhran Virus-Dabawali (CLCuKV-Dab) coat protein and its mutants
with ssDNA. Virology 386: 427–437.
Qazi, J., Mansoor, S., Amin, I., Awan, M. Y., Briddon, R. W. and Zafar, Y. 2006.
First report of Mungbean yellow mosaic India virus on mothbean in Pakistan.
New Disease Reports [http://www.bspp.org.uk/ndr/] Volume 13.
Qazi, J., Ilyas, M., Mansoor, S. and Briddon, .R. W. 2007a. Legume yellow mosaic
viruses genetically isolated begomoviruses. Pathogen Profile, Molecular Plant
Pathology 8: 343–348.
Qazi, J., Amin, I., Mansoor, S., Iqbal, M. J. and Briddon, R. W. 2007b. Contribution
of the satellite encoded gene βC1 to cotton leaf curl disease symptoms. Virus
Research 128: 135.
206
Qu, F. and Morris, T. J. 2002. Efficient infection of Nicotiana benthamiana by
Tomato bushy stunt virus is facilitated by the coat protein and maintained by
p19 through suppression of gene silencing. Molecular Plant-Microbe
Interaction 15: 193–202.
Qu, F., Ren, T. and Morris, T. J. 2003. The coat protein of Turnip crinkle virus
suppresses posttranscriptional gene silencing at an early initiation step.
Journal of Virology 77: 511–522.
Qu, F., Ye, X., Hou, G., Sato, S., Clemente, T. E. and Morris, T. J. 2005. RDR6 has a
broad-spectrum but temperature-dependent antiviral defense role in Nicotiana
benthamiana. Journal of Virology 79: 15209–15217.
Raghavan, V., Malik, P. S., Choudhury, N. R. and Mukherjee, S. K. 2004. The DNA-
A component of a plant geminivirus (Indian mung bean yellow mosaic virus)
replicates in budding yeast cells. Journal of Virology 78: 2405–2413.
Raj, S. K., Khan, M. S. and Singh, R. 2005. Natural occurrence of a begomovirus on
pigeonpea in India. New Disease Reports [http://www.bspp.org.uk/ndr/]
Volume 11.
Raj, S. K., Khan, M. S., Snehi, S. K., Srivastava, S. and Singh, H. B. 2006a. First
report of Tomato leaf curl Karnatka virus infecting soybean in India. New
Disease Reports [http://www.bspp.org.uk/ndr/] Volume 13.
Raj, S. K., Khan, M. S., Snehi, S. K., Srivastava, S. and Singh, H. B. 2006b. A
Yellow Mosaic Disease of Soybean in Northern India is caused by Cotton leaf
curl Kokhran virus. Plant Disease 90: 975.
Rector, A., Tachezy, R. and van Ranst, M. 2004. A sequence-independent strategy for
detection and cloning of circular DNA virus genomes by using multiply
primed rolling-circle amplification. Journal of Virology 78: 4993–
4998.Reddy, R. V., Colvin, J., Muniyappa, V. and Seal, S. 2005. Diversity and
distribution of begomoviruses infecting tomato in India. Archives of Virology
150: 845–867.
Reddy, R. V., Achenjangb, F., Feltona, C., Etarocka, M. T., Anangfaca, M., Nugenta,
P. and Fondong, V. N. 2008. Role of a geminivirus AV2 protein putative
protein kinase C motif on subcellular localization and pathogenicity. Virus
Research 135: 115–124.
207
Rhee, Y., Gurel, F., Gafni, Y., Dingwall, C. and Citovsky, V. 2000. A genetic system
for detection of protein nuclear import and export. Nature Biotechnology 18:
433–437.
Rigden, J. E., Dry, I. B., Mullineaux, P. M. and Rezaian, M. A. 1993. Mutagenesis of
the virion-sense open reading frames of Tomato leaf curl virus. Virology 193:
1001–1005.
Rigden, J. E., Krake, L. R., Rezaian, M. A. and Dry, I. B. 1994. ORF C4 of tomato
leaf curl geminivirus is a determinant of symptom severity. Virology, 204:
847–850.
Rigden, J. E., Dry, I. B., Krake, L. R. and Rezaian, M. A. 1996. Plant virus DNA
replication processes in Agrobacterium: insight into the origins of
geminiviruses? Proceedings of National Academy of Sciences USA 93: 10280–
10284.
Roberts, S. and Stanley, J. 1994. Lethal mutations within the conserved stem-loop of
African cassava mosaic virus DNA are rapidly corrected by genomic
recombination. Journal of General Virology 75: 3203–3209.
Roggero, P., Ciuffo, M., Benvenuto, E. and Franconi, R. 2001. The expression of a
single-chain Fv antibody fragment in different plant hosts and tissues by using
Potato virus X as a vector. Protein Expression and Purification 22: 70–74.
Rojas, M. R., Noueiry, A. O., Lucas, W. J. and Gilbertson, R. L. 1998. Bean dwarf
mosaic geminivirus movement proteins recognize DNA in a form- and
sizespecific manner. Cell 95: 105–113.
Rojas, M. R., Jiang, H., Salati, R., Xoconostle-Cazares, B., Sudarshana, M. R., Lucas,
W. J. and Gilbertson, R. L. 2001. Functional analysis of proteins involved in
movement of the monopartite begomovirus, Tomato yellow leaf curl virus.
Virology 291: 110–125.
Rojas, M. R., Hagen, C., Lucas, W. J. and Gilbertson, R. L. 2005. Exploiting chinks
in the plant's armor: Evolution and emergence of geminiviruses. Annual
Review of Phytopathology 43: 361–394.
Roossinck, M. J. 1997. Mechanisms of plant virus evolution. Annual Review of
Phytopathology 35: 191–209.
Roth, B. M., Pruss, G. J. and Vance V. B. 2004. Plant viral suppressors of RNA
silencing. Virus Research 102: 97–108.
208
Rothenstein, D., Krenz, B., Selchow, O. and Jeske, H. 2007. Tissue and cell tropism
of Indian cassava mosaic virus (ICMV) and its AV2 (precoat) gene product.
Virology 359: 137–145.
Rouhibakhsh, A. and Malathi, V.G. 2005. Severe leaf curl disease of cowpea–A new
disease of cowpea in northern India caused by Mungbean yellow mosaic India
virus and a satellite DNA β. Plant Pathology 54: 259.
Ruiz-Medrano, R., Guevara-González, R. G., Argüello-Astorga, G. R., Monsalve-
Fonnegra, Z., Herrera-Estrella, L. R. and Rivera-Bustamante, R. F. 1999.
Identification of a sequence element involved in AC2-mediated transactivation
of the pepper huasteco virus coat protein gene. Virology 253: 162–169.
Rybicki, E. P. 1994. A phylogenetic and evolutionary justification for three genera of
Geminiviridae. Archives of Virology 139: 49–77.
Saeed, M, Behjatnia, S. A. A., Mansoor, S., Zafar, Y., Hasnain, S. and Rezaian, M. A.
2005. A single complementary-sense transcript of a geminiviral DNA β
satellite is determinant of pathogenicity. Mol Plant Microbe Interact 18: 7–14.
Saeed, M., Zafar, Y., Randles, J. W. and Rezaian, M. A. 2007. A monopartite
begomovirus-associated DNA betasatellite substitutes for the DNA B of a
bipartite begomovirus to permit systemic infection. Journal of General
Virology 88: 2881–2889.
Sambrook, J., Fritsch, E. F. and Maniatis, T. 1989. Molecular cloning: A laboratory
manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
Samretwanich, K., Kittipakorn, K., Chiemsombat, P. and Ikegami, M. 2001.
Complete nucleotide sequence and genome organization of Soybean crinkle
leaf virus. Journal of Phytopathology 149: 333–336.
Sanderfoot, A. A. and Lazarowitz, S. G. 1995. Cooperation in viral movement: the
geminivirus BL1 movement protein interacts with BR1 and redirects it from
the nucleus to the periphery. Plant Cell 7: 1185–1194.
Sanderfoot, A. A., Ingham, D. J. and Lazarowitz, S. C. 1996. A viral movement
protein as a nuclear shuttle. Plant Physiology 11: 22–33.
Sanz, A. I., Fraile, A., García-Arenal, F., Zhou, X., Robinson, D. J., Khalid, S., Butt,
T. and Harrison, B. D. 2000. Multiple infection, recombination and genome
relationships among begomovirus isolates found in cotton and other plants in
Pakistan. Journal of General Virology 81: 1839–1849.
209
Saunders, K., Lucy, A. and Stanley, J. 1991. DNA forms of the geminivirus African
cassava mosaic virus consistent with a rolling circle mechanism of replication.
Nucleic Acids Research 19: 2325–2330.
Saunders, K., Lucy, A. and Stanley, J. 1992. RNA-primed complementary-sense
DNA synthesis of the geminivirus African cassava mosaic virus. Nucleic
Acids Research 20: 6311– 6315.
Saunders, K. and Stanley, J. 1999. A nanovirus-like DNA component associated with
yellow vein disease of Ageratum conyzoides: evidence for interfamilial
recombination between plant DNA viruses. Virology 264: 142–152.
Saunders, K., Bedford, I. D., Briddon, R. W, Markham, P. G, Wong, S. M., Stanley, J.
2000. A novel virus complex causes Ageratum yellow vein disease.
Proceedings of the National Academy of Sciences USA 97: 6890–6895.
Saunders, K., Bedford, I. D. and Stanley, J. 2001. Pathogenicity of a natural
recombinant associated with Ageratum yellow vein disease: implications for
geminivirus evolution and disease aetiology. Virology 282: 38–47.
Saunders, K., Salim, N., Mali, V. R., Malathi, V. G., Briddon, R. W., Markham, P. G.,
Stanley, J. 2002. Characterisation of Sri Lankan cassava mosaic virus and
Indian cassava mosaic virus: evidence for acquisition of a DNA B component
by a monopartite begomovirus. Virology 293: 63–74.
Saunders, K., Bedford, I. D., Yahara, T. and Stanley, J. 2003. The earliest recorded
plant virus disease. Nature 422: 831.
Saunders, K., Norman, A., Gucciardo, S. and Stanley, J. 2004. The DNA β satellite
component associated with Ageratum yellow vein disease encodes an essential
pathogenicity protein (βC1). Virology 324: 37–47.
Saxena, S., Hallan, V., Singh, B. P. and Sane, P. V. 1998. Nucleotide sequence and
intergeminiviral homologies of the DNA-A of papaya leaf curl geminivirus
from India. Biochemistry and Molecular Biology International 45: 101–113.
Scheel, D. 1998. Resistance response physiology and signal transduction. Current
Opinion in Plant Biology 1: 305–310.
Schnippenkoetter, W. H., Martin, D. P., Willment, J. A. and Rybicki, E. P. 2001.
Forced recombination between distinct strains of Maize streak virus. Journal
of General Virology 82: 3081–3090.
210
Scholthof, H. B., Scholthof, K. B. G. and Jackson, A. O. 1995. Identification of
Tomato Bushy Stunt Virus host-specific symptom determinants by expression
of individual genes from a Potato virus X vector. The Plant Cell 7: 1157–
1172.
Schrag, S. J. and Wiener, P. 1995. Emerging infectious disease: what are the relative
roles of ecology and evolution? Trends in Ecology and Evolution 10: 319–324.
Seemanpillai, M., Dry, I., Randles J. and Rezaian A. 2003. Transcriptional silencing
of geminiviral promoter-driven transgenes following homologous virus
infection. Molecular Plant-Microbe Interaction 16: 429–438.
Segers, G. C., Zhang, X., Deng, F., Sun, Q. and Nuss, D. L. 2007. Evidence that RNA
silencing functions as an antiviral defense mechanism in fungi. Proceedings of
the National Academy of Sciences USA 104: 12902–12906.
Selth, L. A., Randles, J. W. and Rezaian, M. A. 2004. Host responses to transient
expression of individual genes encoded by Tomato leaf curl virus. Molecular
Plant-Microbe Interactions 17: 27–33.
Selth, L. A., Dogra, S. C., Rasheed, M. S., Healy, H., Randles, J. W. and Rezaian, M.
A. 2005. A NAC domain protein interacts with Tomato leaf curl virus
replication accessory protein and enhances viral replication. Plant Cell 17:
311–325.
Sera, T. and Uranga, C. 2002. Rational design of artificial zinc-finger proteins using a
nondegenerate recognition code table. Biochemistry 41: 7074–7081.
Sera, T. 2005. Inhibition of virus DNA replication by artificial zinc finger proteins.
Journal of Virology 79: 2614–2619.
Settlage, S. B., Miller, B. and Hanley-Bowdoin, L. 1996. Interactions between
geminivirus replication proteins. Journal of Virology 70: 6790–6795.
Settlage, S. B., See, R. G. and Hanley-Bowdoin, L. 2005. Geminivirus C3 protein:
replication enhancement and protein interactions. Journal of Virology 79:
9885–9895.
Shih, S. L., Tsai, W. S., Green, S. K., Khalid, S., Ahmad, I., Rezaian, M. A. and
Smith, J. 2003. Molecular characterization of tomato and chilli leaf curl
begomoviruses from Pakistan. Plant Disease 87: 200.
Shirasu, K. and Schulze-Lefert, P. 2000. Regulators of cell death in disease resistance.
Plant Molecular Biology 44: 371–385.
211
Shivaprasad, P. V., Akbergenov, R., Trinks, D., Rajeswaran, R., Veluthambi, K.,
Hohn, T. and Pooggin, M. 2005. Promoters, transcripts, and regulatory
proteins of Mungbean yellow mosaic geminivirus. Journal of Virology 79:
8149–8163.
Shivaprasad, P., Thillaichidambaram, P., Balaji, V. and Veluthambi, K. 2006.
Expression of full-length and truncated Rep genes from Mungbean yellow
mosaic virus-Vigna inhibits viral replication in transgenic tobacco. Virus
Genes 33: 365–374.
Sijen, T., Wellink, J., Hendriks, J., Verver, J. and Van Kammen, A. 1995. Replication
of cowpea mosaic virus RNAl or RNA2 is specifically blocked in transgenic
Nicotiana benthamiana plants expressing the full-length replicase or
movement protein genes. Molecular Plant-Microbe Interactions 8: 340–347.
Singh, H. B., Joshi, B. S. and Thomas, T. A. 1970. The Phaseolus group. P.
Kachroo and M. Arif (eds.). Pulse crops of India. Indian Council of
Agricultural Research, New Delhi pp. 136–164.
Smartt, J. 1990. Pulses of the classical world, p. 190-198. In: R.J. Summerfield and
E.H. Ellis (eds.). Grain legumes: evaluation and genetic resources. Cambridge
University Press, Cambridge.
Smith, D. R. and Maxwell, D. P. 1994. Requirement of the common region of DNA-B
and the BL1 open reading frame of bean golden mosaic geminivirus for
infection of Phaseolus vulgaris. Phytopathology 84: 133–138.
Soto, M. J., Chen, L. F., Seo, Y. S., and Gilbertson, R. L. 2005. Identification of
regions of the Beet mild curly top virus (family Geminiviridae) capsid protein
involved in systemic infection, virion formation and leafhopper transmission.
Virology 341: 257–270.
Sserubombwe, W. S., Briddon, R. W., Baguma, Y. K., Ssemakula, G. N., Bull, S. E.,
Bua, A., Alicai, T., Omongo, C., Otim-Nape, G. W. and Stanley, J. 2008.
Diversity of begomoviruses associated with mosaic disease of cultivated
cassava (Manihot esculenta, Crantz) and its wild relative (Manihot glaziovii,
Müll. Arg.) in Uganda. Journal of General Virology 89: 1759–1769.
Stanley, J. 1983. Infectivity of the cloned geminivirus genome requires sequences
from both DNAs. Nature 305: 643– 645.
212
Stanley, J. and Gay, M. R. 1983. Nucleotide sequence of Cassava latent virus DNA.
Nature 301: 260–262.
Stanley, J. and Townsend, R. 1985. Characterization of DNA forms associated with
Cassava latent virus infection. Nucleic Acids Research 13: 2189–2205.
Stanley, J., Markham, P. G., Callis, R. J. and Pinner, M. S. 1986a. The nucleotide
sequence of an infectious clone of the geminivirus Beet curly top virus. EMBO
Journal 5:1761–1767.
Stanley, J. and Townsend, R. 1986b. Infectious mutants of Cassava latent virus
generated in vivo from intact recombinant DNA clones containing single
copies of the genome. Nucleic Acids Research 14: 5981–5998.
Stanley, J., Frischmuth, T. and Ellwood, S. 1990. Defective viral DNA ameliorates
symptoms of geminiviruses infection in transgenic plants. Proceedings of
National Academy of Sciences USA 87: 6291–6295.
Stanley, J. and Latham, J. R. 1992. A symptom variant of beet curly top geminivirus
produced by mutation of open reading frame C4. Virology 190: 506–509.
Stanley, J., Latham, J. R., Pinner, M. S., Bedford, I. and Markham, P. G. 1992.
Mutational analysis of the monopartite geminivirus Beet curly top virus.
Virology 191: 396–405.
Stanley, J., Bisaro, D. M., Briddon, R. W., Brown, J. K., Fauquet, C. M., Harrison, B.
D., Rybicki, E. P. and Stenger, D. C. 2005. Geminiviridae. Virus Taxonomy.
VIIIth Report of the International Committee on Taxonomy of Viruses, pp.
301–326. Edited by C. M. Fauquet, M. A. Mayo, J. Maniloff, U. Desselberger
and L. A. Ball. London: Elsevier/ Academic Press.
Stenger, D. C., Duffus, J. E. and Villalon, B. 1990. Biological properties of a
geminivirus isolated from peppers. Phytopathology 80: 704–709.
Stenger, D. C., Revington, G. N., Stevenson, M. C. and Bisaro, D. M. 1991.
Replication release of geminivirus genomes from tandemly repeated copies:
evidence for rolling-circle replication of a plant viral DNA. Proceedings of
National Academy of Sciences USA 88: 8029–8033.
Stenger, D. C. 1994a. Complete nucleotide sequence of the hypervirulent CFH strain
of Beet curly top virus. Molecular Plant-Microbe Interaction 7: 154–157.
213
Stenger, D. C. 1994b. Strain-specific mobilisation and amplification of a transgenic
defective-interfering DNA of the geminivirus Beet curly top virus. Virology
203: 397–402.
Stenger, D. C. and Ostrow, K. M. 1996. Genetic complexity of a Beet curly top virus
population used to assess sugar beet cultivar response to infection.
Phytopathology 86: 929–933.
Sudarshana, M. R., Wang, H. L., Lucas, W. J. and Gilbertson, R. L. 1998. Dynamics
of bean dwarf mosaic geminivirus cell-to-cell and long-distance movement in
Phaseolus vulgaris revealed, using the green fluorescent protein. Molecular
Plant-Microbe Interactions 11: 277–291.
Sunter, G., Hartitz, M. D., Hormuzdi, S. G., Brough, C. L. and Bisaro, D. M. 1990.
Genetic analysis of Tomato golden mosaic virus: ORF AL2 is required for
coat protein accumulation while ORF AL3 is necessary for efficient DNA
replication. Virology 179: 69–77.
Sunter, G. and Bisaro, D. M. 1992. Transactivation of geminivirus AR1 and BR1
gene expression by the viral AL2 gene product occurs at the level of
transcription. Plant Cell 4: 1321–1331.
Sunter, G., Hartitz, M. D. and Bisaro, D. M. 1993. Tomato golden mosaic virus
leftward gene expression: Autoregulation of geminivirus replication protein.
Virology 195: 275–280.
Sunter, G., Stenger, D. C. and Bisaro, D. M. 1994. Heterologous complementation by
geminivirus AL2 and AL3 genes. Virology 203: 203–210.
Sunter, G. and Bisaro, D. M. 1997. Regulation of a geminivirus coat protein promoter
by AL2 protein (TrAP): evidence for activation and derepression mechanisms.
Virology 232: 269–280.
Sunter, G., Sunter, J. L. and. Bisaro, D. M. 2001. Plants expressing Tomato golden
mosaic virus AL2 or Beet curly top virus L2 transgenes show enhanced
susceptibility to infection by DNA and RNA viruses. Virology 285: 59–70.
Sunter, G. and Bisaro, D. M. 2003. Identification of a minimal sequence required for
activation of the Tomato golden mosaic virus coat protein promoter in
protoplasts. Virology 305: 452–462.
Surendranath, B., Usharani, K. S., Nagma, A., Victoria, A. K. and Malathi, V. G.
2005. Absence of interaction of genomic components and complementation
214
between Mungbean yellow mosaic India virus isolates in cowpea. Archives of
Virology 150: 1833-1844.
Tahir, M., Haider, M. S., Iqbal, J. and Briddon, R. W.
2009. Association of a distinct
begomovirus and a betasatellite with leaf curl symptoms in Pedilanthus
tithymaloides. Journal of Phytopathology 157: 188–193.
Tan, P. H. N., Wong, S. M., Wu, M., Bedford, I. D., Saunders, K. and Stanley, J.
1995. Genome organization of Ageratum yellow vein virus, a monopartite
whitefly-transmitted geminivirus isolated from a common weed. Journal of
General Virology 76: 2915–2922.
Tao, X. and Zhou, X. 2004. A modified viral satellite DNA that suppresses gene
expression in plants. Plant Journal 38: 850–860.
Tao, X. and Zhou, X. 2008. Pathogenicity of a naturally occurring recombinant DNA
satellite associated with Tomato yellow leaf curl China virus. Journal of
General Virology 89: 306–311.
Tenllado, F., Gania-Luque, I., Serra, M. T., and Diaz-Ruir, J. R. 1995. Nicotiana
bentbamiana plants transformed with the 54-kDa region of the Pepper mild
mottle tobamovirus replicase gene exhibit two types of resistance responses
against viral infection. Virology 211: 170–183.
Tenllado, F., Gemia-Luque, I., Serra, M. T. and Dia-Ruir, J. R. 1996. Resistance to
Pepper mild mottle tobamovirus conferred by the 54-kDa gene sequence in
transgenic plants does not require expression of the wild-type 54-kDa protein.
Virology 219: 330–335.
Thomas, C. L., Leh, V., Lederer, C. and Maule, A. J. 2003. Turnip crinkle virus coat
protein mediates suppression of RNA silencing in Nicotiana benthamiana.
Virology 306: 33–41.
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and Higgins, D. G.
1997. The Clustal_X windows interface; flexible strategies for multiple
sequence alignment aided by quality analysis tools. Nucleic Acids Research
25: 4876–4882.
Thongmeearkom, P., Honda, Y., Saito, Y. and Syamananda, R. 1981. Nuclear
ultrastructural changes and aggregates of virus-particles in mungbean cells
infected with mungbean yellow mosaic disease. Phytopathology 71: 41–44.
215
Timmermans, M. C. P., Das, O. P. and Messing, J. 1994. Geminiviruses and their uses
as extrachromosomal replicons. Annual Review of Plant Physiology and Plant
Molecular Biology 45: 79–112.
Townsend, R., Watts, J. and Stanley, J. 1986. Synthesis of viral DNA forms in
Nicotiana plumbaginifolia protoplasts inoculated with Cassava latent virus
(CLV); evidence for the independent replication of one component of the CLV
genome. Nucleic Acids Research 14: 1253–1265.
Trinks, D., Rajeswaran, R., Shivaprasad, P. V., Akbergenov, R., Oakeley, E. J.,
Veluthambi, K., Hohn, T. and Pooggin, M. 2005. Suppression of RNA
silencing by a geminivirus nuclear protein, AC2, correlates with
transactivation of host genes. Journal of Virology 79: 2517–2527.
Turnage, M. A., Muangsan, N., Peele, C. G. and Robertson, D. 2002. Geminivirus
based vectors for gene silencing in Arabidopsis. Plant Journal 30: 107–114.
Unseld, S., Höhnle, M., Ringel, M. and Frischmuth, T. 2001. Subcellular targeting of
the coat protein of African cassava mosaic geminivirus. Virology 286: 373–
383.
Usharani, K. S., Surendranath, B., Haq, Q. M. R. and Malathi, V. G. 2004. Yellow
mosaic virus infecting soybean in northern India is distinct from the species
infecting soybean in southern and western India. Current Science 86: 845–
850.
Usharani, K. S., Surendranath, B., Haq, Q. M. R. and Malathi, V. G. 2005. Infectivity
analysis of a soybean isolate of Mungbean yellow mosaic India virus by
agroinoculation. Journal of General Plant Pathology 71: 230.
Vaistij, F. E., Jones, L. and Baulcombe, D. C. 2002. Spreading of RNA targeting and
DNA methylation in RNA silencing requires transcription of the target gene
and a putative RNA-dependent RNA polymerase. Plant Cell 14: 857–867.
Vance, V. B., and Vaucheret, H. 2001. RNA silencing in plants: defense and counter
defense. Science 292: 2277–2280.
Vanitharani, R., Chellappan, P., Pita, J. S. and Fauquet, C. 2004. Differential roles of
AC2 and AC4 of cassava geminiviruses in mediating synergism and
suppression of posttranscriptional gene silencing. Journal of Virology 78:
9487–9498.
216
Vanitharani, R., Chellappan, P. and Fauquet, C. M. 2005. Geminiviruses and RNA
silencing. Trends in Plant Science 10: 144–151.
van Regenmortel, H. V., Bishop, D. H. L., Fauquet, C. M., Mayo, M. A., Maniloff, J.
and Calisher, C. H. 1997. Guidelines to the demarcation of virus species.
Archives of virology 142: 1505–15018.
van Wezel, R., Liu, H., Tien, P., Stanely, J. and Hong, Y. 2001. Gene C2 of the
monopartite geminivirus tomato yellow leaf curl virus-China encodes a
pathogenicity determinant that is localized in the nucleus. Molecular Plant-
Microbe Interactions 14: 1125–1128.
van Wezel, R., Dong, X., Liu, H., Tien, P., Stanley, J. and Hong, Y. 2002a. Mutation
of three cysteine residues in Tomato yellow leaf curl virus-China C2 protein
causes dysfunction in pathogenesis and posttranscriptional genesilencing
suppression. Molecular Plant-Microbe Interactions 15: 203–208.
van Wezel, R., Dong, X., Blake, P., Stanley, J. and Hong, Y. 2002b. Differential roles
of geminivirus Rep and AC4 (C4) in the induction of necrosis in Nicotiana
benthamiana. Molecular Plant Pathology 3: 461–471.
van Wezel, R., Liu, H., Wu, Z., Stanley, J. and Hong, Y. 2003. Contribution of the
zinc finger to zinc and DNA binding by a suppressor of posttranscriptional
gene silencing. Journal of Virology 77: 696–700.
Vasudeva, R. S. 1942. A mosaic disease of cowpea in India. Indian Journal of
Science 12: 281–283.
Vaucheret, H., Vazquez, F., Crete, P. and Bartel, D. P. 2004. The action of
ARGONAUTE1 in the miRNA pathway and its regulation by the miRNA
pathway are crucial for plant development. Genes and Development 18: 1187–
1197.
Vavilov, N. I. 1951. The origin, variation, immunity, and breeding of cultivated
plants. (translation by K. S. Chester). Chronicle Botany 13: 1–364.
Vazquez, F., Vaucheret, H., Rajagopalan, R., Lepers, C., Gasciolli, V., Mallory, A.
C., Hilbert, J. L., Bartel, D. P. and Crete, P. 2004. Endogenous trans-acting
siRNAs regulate the accumulation of Arabidopsis mRNAs. Molecular Cell 16:
69–79.
217
Voinnet, O., Pinto, Y. M. and Baulcombe, D. C. 1999. Suppression of gene silencing:
a general strategy used by diverse DNA and RNA viruses of plants.
Proceedings of National Academy of Science USA. 96: 14147–14152.
Voinnet, O., Lederer, C. and Baulcombe, D. 2000. A viral movement protein prevents
spread of the gene silencing signal in Nicotiana benthamiana. Cell 103:157–
167.
Voinnet, O. 2001. RNA silencing as a plant immune system against viruses. Trends in
Genetics 17: 449–459.
Voinnet, O. 2005. Induction and suppression of RNA silencing: insights from viral
infections. Nature Reviwes Genetics 6: 206–220.
von Arnim, A. and Stanley, J. 1992a. Determinants of Tomato golden mosaic virus
symptom development located on DNA B. Virology 186: 286–293.
von Arnim, A. and Stanley, J. 1992b. Inhibition of African cassava mosaic virus
systemic infection by a movement protein from the related geminivirus
Tomato golden mosaic virus. Virology 187: 555–564.
Wang, H., Hao, L., Shung, C. Y., Sunter, G. and Bisaro, D. M. 2003. Adenosine
kinase is inactivated by geminivirus AL2 and L2 proteins. Plant Cell 15:
3020–3032.
Wang, H., Buckley, K. J., Yang, X., Buchmann, R. C. and Bisaro, D. M. 2005.
Adenosine kinase inhibition and suppression of RNA silencing by geminivirus
AL2 and L2 proteins. Journal of Virology 79: 7410–7418.
Wang, L. Z. 1985. Origin and diffusion of soybean. Soybean Science 4: 1–7
Wartig, L., Kheyr-Pour, A., Noris, E., De Kouchkovsky, F., Jouanneau, F.,
Gronenborn, B. and Jupin, I. 1997. Genetic analysis of the monopartite tomato
yellow leaf curl geminivirus: roles of V1, V2, and C2 ORFs in viral
pathogenesis. Virology 228: 132–140.
Waterhouse, P. M., Wang, M. B. and Lough, T. 2001. Gene silencing as an adaptive
defence against viruses. Nature 411: 834–842.
Were, H. K., Takeshita, M., Furuya, N. and Takanami, Y. 2005a. Molecular
characterization of a new begomovirus infecting honeysuckle in Kobe, Japan.
Journal of Faculty of Agriculture, Kyushu University 50: 61–71.
218
Were, H. K., Takeshita, M., Furuya, N. and Takanami, Y. 2005b. Molecular
characterization of a new begomovirus infecting honeysuckle in Sapporo,
Japan. Journal of Faculty of Agriculture, Kyushu University 50: 73–81.
Williams, L., Carles, C. C., Osmont, K. S. and Fletcher, J. C. 2005. A novel approach
identifies an endogenous trans-acting siRNA that targets the Arabidopsis
ARF2, ARF3/ETT and ARF4 genes. Proceedings of the National Academy of
Sciences USA 102: 9703–9708.
Wright, E. A., Heckel, T., Groenendijk, J., Davies, J. W. and Boulton, M. I. 1997.
Splicing features in maize streak virus virion- and complementary-sense gene
expression. Plant Journal 12: 1285–1297.
Wu, P. J. and Zhou, X. P. 2005. Interaction between a nanovirus-like component and
the tobacco curly shoot virus/satellite complex. Acta Biochimica Biophysica
Sinica 37: 25–31.
Xie, Z., Johansen, L. K., Gustafson, A. M., Kasschau, K. D., Lellis, A. D., Zilberman,
D., Jacobsen, S. E. and Carrington, J. C. 2004. Genetic and functional
diversification of small RNA pathways in plants. PLoS Biology 2: E104.
Xiong, Q., Guo, X. J., Che, H. Y. and Zhou, X. P. 2005. Molecular characterization of
a distinct Begomovirus and its associated satellite DNA molecule infecting
Sida acuta in China. Journal of Phytopathology 153: 264–268.
Yadav, R. K., Shukla, R. K., Chattopadhyay, D. 2009. Soybean cultivar resistant to
Mungbean yellow mosaic India virus infection induces viral RNA degradation
earlier than the susceptible cultivar. Virus Research (in press).
Yang, Y., Sherwood, T. A., Patte, C. P., Hiebert, E. and Polston, J. E. 2004a. Use of
Tomato yellow leaf curl virus (TYLCV) Rep gene sequences to engineer
TYLCV resistance in tomato. Phytopathology, 94: 490–496.
Yang, S. J., Carter, S. A., Cole, A. B., Cheng, N. H. and Nelson, R. S. 2004b. A
natural variant of a host RNA-dependent RNA polymerase is associated with
increased susceptibility to viruses by Nicotiana benthamiana. Proceedings of
the National Academy of Sciences USA 101: 6297–6302.
Yang, X., Baliji, S., Buchmann, R. C., Wang, H., Lindbo, J. A., Sunter, G. and Bisaro,
D. M. 2007. Functional modulation of the geminivirus AL2 transcription
factor and silencing suppressor by self-interaction. Journal of Virology 81:
11972–11981.
219
Yu, B., Yang, Z., Li, J., Minakhina, S., Yang, M., Padgett, R. W., Steward, R. and
Chen, X. 2005. Methylation as a crucial step in plant microRNA biogenesis.
Science 307: 932–935.
Zhang, H. S. and Dean, D. C. 2001. Rb-mediated chromatin structure regulation and
transcriptional repression. Oncogene 20: 3134–3138.
Zhang, W., Olson, N. H., Baker, T. S., Faulkner, L., Agbandje-McKenna, M.,
Boulton, M. I., Davies, J. W. and McKenna, R. 2001. Structure of the Maize
streak virus geminate particle. Virology 279: 471– 477.
Zhang, S. C., Ghosh, R. and Jeske, H. 2002. Subcellular targeting domains of
Abutilon mosaic geminivirus movement protein BC1. Archives of Virology
147: 2349–2363.
Zhang, P., Fütterer, J., Frey, P., Potrykus, I., Puonti-Kaerlas, J. and Gruissem, W.
2003. Engineering virus-induced ACMV resistance by mimicking a
hypersensitive reaction in transgenic cassava plants. In: I.K. Vasil (Ed.) Plant
Biotechnology 2002 and Beyond, Kluwer Academic Publishers, Dordrecht,
Netherlands, pp. 143–146.
Zhou, X., Liu, Y., Calvert, L., Munoz, C., Otim-Nape, G. W., Robinson, D. J. and
Harrison, B. D. 1997. Evidence that DNA A of a geminivirus associated with
severe cassava mosaic disease in Uganda has arisen by interspecific
recombination. Journal of General Virology 78: 2101–2111.
Zhou, X., Xie, Y., Tao, X., Zhang, Z., Li, Z. and Fauquet, C. M. 2003a.
Characterization of DNA β associated with begomoviruses in China and
evidence for co-evolution with their cognate viral DNA-A. Journal of General
Virology 84: 237–247.
Zhou, X., Xie, Y., Peng, Y. and Zhang, Z. 2003b. Malvastrum yellow vein virus, a
new Begomovirus species associated with satellite DNA molecule. Chinese
Science Bulletin 48: 2205–2209.
Zhukovsky, P. M. 1950. Cultivated plants and their wild relatives (translation by P. S.
Hudson, 1962). Commonwealth Agricultural Bureau, Farnham Royal,
England pp. 107.
Zilberman, D., Cao, X. and Jacobsen, S. E. 2003. ARGONAUTE4 control of locus-
specific siRNA accumulation and DNA and histone methylation. Science 299:
716–719.
220
Zrachya, A., Glick, E., Levy, Y., Arazi, T., Citovsky, V. and Gafni, Y. 2006.
Suppressor of RNA silencing encoded by Tomato yellow leaf curl virus -
Israel. Virology 358: 159–165.