Linkage and Mapping

Linkage and Mapping

Figure 4-8For linked genes, recombinant frequencies are less than

50 percent

Map distances are generally additive

A map of the 12 tomato chromosomes• Genetic distance is measured by

recombination frequency• A relative map can be constructed based

on genetic distances

Genetic vs. Molecular Maps

• What is the relationship of genetic distance to molecular distance?

• How can genetic and molecular relationships be reconciled?

• How can one be used to locate the other?

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

Genetic markers

• Genetic mapping between positions on chromosomes– Positions can be genes

• Responsible for phenotype– Examples: eye color or disease trait

– Positions can be physical markers• DNA sequence variation

Physical markers

• Physical markers are DNA sequences that vary between two related genomes

• Referred to as a DNA polymorphism

• Usually not in a gene

– Examples• SSLP (microsatellite)

• SNP– RFLP– Intergenic SNP– Silent intragenic SNP– Causative point mutation

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

SSLP

• Simple-sequence length polymorphism• Most genomes contain repeats of three or four nucleotides• Length of repeat varies• Use PCR with primers external to the repeat region• On gel, see difference in length of amplified fragment

ATCCTACGACGACGACGATTGATGCT

12

18

1 2

2

1

ATCCTACGACGACGACGACGACGATTGATGCT

RFLP

• Restriction-fragment length polymorphism– Cut genomic DNA from two individuals with

restriction enzyme– Run Southern blot– Probe with different pieces of DNA– Sequence difference creates different band

pattern

GGATCCCCTAGG

GGTACCCCATGG

GGATCCCCTAGG

200 400

GGATCCCCTAGG

GCTACCCGATGG

GGATCCCCTAGG

200 400*

*

200

400

600

1 2

**

2

1

KpnI

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

SNP

• Single-nucleotide polymorphism– One-nucleotide difference in sequence of two

organisms– Discovered by sequencing– Example: Between any two humans, on average

one SNP every 1,000 base pairs

ATCGATTGCCATGACATCGATGGCCATGAC2

1

SNP

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

Physical mapping

• Determination of physical distance between two points on chromosome– Distance in base pairs

• Example: between physical marker and a gene

• Need overlapping fragments of DNA– Requires vectors that accommodate large

inserts• Examples: cosmids, YACs, and BACs

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

Large insert vectors

• Lambda phage– Insert size: 20–30 kb

• Cosmids– Insert size: 35–45 kb

• BACs and PACs (bacterial and P1 artificial chromosomes respectively)– Insert size: 100–300 kb

• YACs (yeast artificial chromosomes)– Insert size: 200–1,000 kb

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

Pros and cons of large-insert vectors

• Lambda phage and cosmids– Inserts stable

– But insert size too small for large-scale sequencing projects

• YACs– Largest insert size

– But difficult to work with

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

BACs and PACs

• BACs and PACs– Most commonly used

vectors for large-scale sequencing

– Good compromise between insert size and ease of use

– Growth and isolation similar to that for plasmids

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458

Contigs

• Contigs are groups of overlapping pieces of chromosomal DNA– Make contiguous clones

• For sequencing one wants to create “minimum tiling path”– Contig of smallest number of inserts that covers a region of

the chromosome

genomic DNA

contig

minimumtiling path

Pros and cons whole genome shotgun sequencing

• Pros– Very rapid

– Becomes cheaper as sequencing technologies advance

• Cons– Alignment is more challenging, especially in repeats

– Requires more computing power

Figure 4-20Phenotypic and molecular markers mapped on human

chromosome 1

SNP genotyping methods

Single SNPs:– SSCP– TGCE– Differential PCR amplification

Many SNPs simultaneously:– SNP arrays– Direct sequencing (high-throughput)

Temperature gradient gel

electrophoresis

Alignment of physical and recombination maps

Phase I (2005)1M SNPs from 269 individuals

Phase II (2007)3M SNPs from 270 individuals

Phase III (2010)1.6M SNPs genotyped from 1184 individuals from 11 populationsSequenced 10x 100kb regions from 692

Figure 4-16Using haplotypes to deduce gene position