Date post: | 05-Jan-2016 |
Category: |
Documents |
Upload: | aubrie-mabel-palmer |
View: | 215 times |
Download: | 1 times |
Linkage and Mapping
Linkage and Mapping
Figure 4-8For linked genes, recombinant frequencies are less than
50 percent
Map distances are generally additive
A map of the 12 tomato chromosomes• Genetic distance is measured by
recombination frequency• A relative map can be constructed based
on genetic distances
Genetic vs. Molecular Maps
• What is the relationship of genetic distance to molecular distance?
• How can genetic and molecular relationships be reconciled?
• How can one be used to locate the other?
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Genetic markers
• Genetic mapping between positions on chromosomes– Positions can be genes
• Responsible for phenotype– Examples: eye color or disease trait
– Positions can be physical markers• DNA sequence variation
Physical markers
• Physical markers are DNA sequences that vary between two related genomes
• Referred to as a DNA polymorphism
• Usually not in a gene
– Examples• SSLP (microsatellite)
• SNP– RFLP– Intergenic SNP– Silent intragenic SNP– Causative point mutation
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
SSLP
• Simple-sequence length polymorphism• Most genomes contain repeats of three or four nucleotides• Length of repeat varies• Use PCR with primers external to the repeat region• On gel, see difference in length of amplified fragment
ATCCTACGACGACGACGATTGATGCT
12
18
1 2
2
1
ATCCTACGACGACGACGACGACGATTGATGCT
RFLP
• Restriction-fragment length polymorphism– Cut genomic DNA from two individuals with
restriction enzyme– Run Southern blot– Probe with different pieces of DNA– Sequence difference creates different band
pattern
GGATCCCCTAGG
GGTACCCCATGG
GGATCCCCTAGG
200 400
GGATCCCCTAGG
GCTACCCGATGG
GGATCCCCTAGG
200 400*
*
200
400
600
1 2
**
2
1
KpnI
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
SNP
• Single-nucleotide polymorphism– One-nucleotide difference in sequence of two
organisms– Discovered by sequencing– Example: Between any two humans, on average
one SNP every 1,000 base pairs
ATCGATTGCCATGACATCGATGGCCATGAC2
1
SNP
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Physical mapping
• Determination of physical distance between two points on chromosome– Distance in base pairs
• Example: between physical marker and a gene
• Need overlapping fragments of DNA– Requires vectors that accommodate large
inserts• Examples: cosmids, YACs, and BACs
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Large insert vectors
• Lambda phage– Insert size: 20–30 kb
• Cosmids– Insert size: 35–45 kb
• BACs and PACs (bacterial and P1 artificial chromosomes respectively)– Insert size: 100–300 kb
• YACs (yeast artificial chromosomes)– Insert size: 200–1,000 kb
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Pros and cons of large-insert vectors
• Lambda phage and cosmids– Inserts stable
– But insert size too small for large-scale sequencing projects
• YACs– Largest insert size
– But difficult to work with
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
BACs and PACs
• BACs and PACs– Most commonly used
vectors for large-scale sequencing
– Good compromise between insert size and ease of use
– Growth and isolation similar to that for plasmids
© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458
Contigs
• Contigs are groups of overlapping pieces of chromosomal DNA– Make contiguous clones
• For sequencing one wants to create “minimum tiling path”– Contig of smallest number of inserts that covers a region of
the chromosome
genomic DNA
contig
minimumtiling path
Pros and cons whole genome shotgun sequencing
• Pros– Very rapid
– Becomes cheaper as sequencing technologies advance
• Cons– Alignment is more challenging, especially in repeats
– Requires more computing power
Figure 4-20Phenotypic and molecular markers mapped on human
chromosome 1
SNP genotyping methods
Single SNPs:– SSCP– TGCE– Differential PCR amplification
Many SNPs simultaneously:– SNP arrays– Direct sequencing (high-throughput)
Temperature gradient gel
electrophoresis
Alignment of physical and recombination maps
Phase I (2005)1M SNPs from 269 individuals
Phase II (2007)3M SNPs from 270 individuals
Phase III (2010)1.6M SNPs genotyped from 1184 individuals from 11 populationsSequenced 10x 100kb regions from 692
Figure 4-16Using haplotypes to deduce gene position