Watson and CrickThe structure of DNA was described by

British Scientists Watson and Crick as long double helix shaped with its sugar phosphate backbone on the outside and its bases on inside; the two strand of helix run in opposite direction and are anti-parallel to each other. The DNA double helix is stabilized by hydrogen bonds between the bases.

Watson and Crick discovers DNA Feb 28th 1953

DNAA purine always links

with a pyrimidine base to maintain the structure of DNA.

Adenine ( A ) binds to Thymine ( T ), with two hydrogen bonds between them.

Guanine ( G ) binds to Cytosine ( C ), with three hydrogen bonds between them.

Nucleic acid probe Nucleic acid fragment, labelled by a

radioisotope, biotin, etc., that is complementary to a sequence in another nucleic acid (fragment) and that will, by hydrogen binding to the latter, locate or identify it and be detected; a diagnostic technique based on the fact that every species of microbe possesses some unique nucleic acid sequences which differentiate it from all others, and can be used as identifying markers or "fingerprints."

Nucleic acid probe Nucleic acid fragment, labelled by a

radioisotope, biotin, etc., that is complementary to a sequence in another nucleic acid (fragment) and that will, by hydrogen binding to the latter, locate or identify it and be detected; a diagnostic technique based on the fact that every species of microbe possesses some unique nucleic acid sequences which differentiate it from all others, and can be used as identifying markers or "fingerprints."

Hybridization probeHybridization probe is a fragment of DNA or

RNA of variable length (usually 100-1000 bases long), which is used to detect in DNA or RNA samples the presence of nucleotide sequences (the DNA target) that are complementary to the sequence in the probe. The probe thereby hybridizes to single-stranded nucleic acid (DNA or RNA) whose base sequence allows probe-target base pairing due to complementarily between the probe and target.

Dr.T.V.Rao MD 7

Nucleic Acid Probes Accu probes from

Gene probe, which contains a chemiluminescent label and target the rRNA of the microorganisms of interest.

It reads events in vivo or during the multiplication of organism.

DNA is Endless structureThe rungs of the

ladder can occur in any order (as long as the base-pair rule is followed)

Those 4 bases have endless combinations just like the letters of the alphabet can combine to make different words.

DNA ReplicationDNA replication is

semi-conservative. That means that when it makes a copy, one half of the old strand is always kept in the new strand. This helps reduce the number of copy errors.

So we remained what we were ?

So we remained what we wereBecause of Our Genetic Materials

DNA to RNA DNA remains in the

nucleus, but in order for it to get its instructions translated into proteins, it must send its message to the ribosome's, where proteins are made. The chemical used to carry this message is Messenger RNA

Blotting technique

Southern Blot

It is used to detect DNA.

Northern Blot

It is used to detect RNA.

Western blot

It is used to detect protein.

TYPES OF BLOTTING TECHNIQUES

Nucleic Acid Hybridizations

The hybridization of a radioactive probe to filter bound DNA or RNA is one of the most informative experiments that is performed in molecular genetics. Two basic types of hybridizations are possible.

Southern hybridization - hybridization of a probe to filter bound DNA; the DNA is typically transferred to the filter from a gel

Northern hybridization - hybridization of a probe to filter bound RNA; the RNA is typically transferred to the filter from a gel

Western blottingWestern blotting is an Immunoblotting technique

which rely on the specificity of binding between a molecule of interest and a probe to allow detection of the molecule of interest in a mixture of many other similar molecules.

In Western blotting, the molecule of interest is a protein and the probe is typically an antibody raised against that particular protein.

The SDS PAGE technique is a prerequisite for Western blotting .

Western Blotting

Restriction fragment length polymorphism

Sir Alec Jeffreys developed restriction fragment length polymorphism (RFLP), which quickly became the standard technique for DNA testing throughout the 1980s. RFLP provided the world with the first form of genetic testing based on DNA, the body's genetic material

Restriction Fragment Length Polymorphism (RFLP)

Restriction Fragment Length Polymorphism (RFLP) is a technique in which organisms may be differentiated by analysis of patterns derived from cleavage of their DNA.

RFLP The resulting DNA

fragments are then separated by length through a process known as agarose gel electrophoresis, and transferred to a membrane via the Southern blot procedure.

SpoligotypingSpoligotyping, a new method for simultaneous detection and typing of M. tuberculosis complex bacteria, has been recently developed. This method is based on polymerase chain reaction (PCR) amplification of a highly polymorphic direct repeat locus in the M. tuberculosis genome.

Spoligotyping in TuberculosisThe well-conserved

36-bp direct repeats are interspersed with unique spacer sequences varying from 35 to 41 bp in size. Clinical isolates of MTC bacteria can be differentiated by the presence or absence of one or more spacers.

Results analyzed by Computer

DNA finger printingEvery one of our DNA is equal except for only

about 0.10 %.DNA finger printing lies in uniqueness of those

regions of DNA that do differ from person to person.

Only 5 % of our DNA code rest do not code called in past as Junk DNA and contain repeated sequences of base pairs

Called as Variable number of tandem repeats contain 20 to 100 base pairs and the same sequence is repeated one to 3 times in a row

Documentation of Finger printing for Records

Finger print means translating all the variable number of tandem repeats to visible records

All VNTR is tested for restriction length polymorphism which differ from species to species.

All the obtained material is blotted to Nylon or Nitrocellulose membrane ( Southern Blotting )

RLFP to PCRIsolation of sufficient DNA for RFLP analysis

is time-consuming and labour intensive. However, PCR can be used to amplify very small amounts of DNA, usually in 2-3 hours, to the levels required for RFLP analysis. Therefore, more samples can be analysed in a shorter time.

Molecular diagnostics – how it worksEvery organism

contains some unique,

species specific DNA sequences

Molecular diagnostics makes the species specific DNA visible

PCR methods are rapid and sensitive PCR, as a specific,

sensitive and rapid technique in the identification of the pathogen in the clinical specimen has been developed extensively over the past decade. Its value as a clinical tool is being increasingly recognized

Polymerase Chain Reaction Methodology A Mile stone in Medical History

He had the idea to use a pair of primers to bracket the desired DNA sequence and to copy it using DNA polymerase, a technique which would allow a small strand of DNA to be copied almost an infinite number of times.

Dr. Kary Mullis, wins Nobel Prize in 1993Kary received a Nobel

Prize in chemistry in 1993, for his invention of the polymerase chain reaction (PCR). The process, which Kary Mullis conceptualized in 1983, is hailed as one of the monumental scientific techniques of the twentieth century.

PCR Liberates a Innocent PrisonerKirkBloods worth

caseA WatermanImprisoned for 9

years on wrong evidences of Rape

Unmatched DNA by PCR makes a freeman

Locates Genes for Color BlindnessColor Blind British John

Dalton died in 1844Request his eyes to be

preserved And to be investigated

why he confused scarlet with green, and pink with blue

Recent PCR studies prove Dalton lacked a gene for making one of the three photo pigments essential for normal color vision.

Color Blindness is x linkedThe genes for our red

and green colour receptors are located on the X-chromosome, giving women a redundant set of receptor genes.

This is why men are far more prone to colour-blindness than women.

DNA – RNA - DNAIn Molecular biology,

the polymerase chain reaction (PCR) is a technique to amplify a single or few copies of a piece of DNA across several orders of magnitude, generating millions or more copies of a particular DNA sequence.

Common Tools of Molecular BiologyNucleic acid fractionationPolymerase chain reactionProbes, Hybridization Vector, Molecular cloningNucleic acid enzymesMicroarrayDNA sequencingElectrophoretic separation of nucleic acidDetection of genes: *DNA: Southern blotting; inSitu hybridization;

FISH Technique *RNA: Northern blotting *Protein: Western blotting,

immunohistochemistry

Current Uses of molecular BiologyThe most recent applied technologies, genetic

engineering, DNA finger-printing in the social and forensic science, pre and postnatal diagnosis of inherited disease, gene therapy and drug Design.

Molecular biology allows the laboratory to be predictive in nature, it gives information that the patients may be at risk for disease (future).

Major tool in Diagnosis of Infectious

Restriction EndonuleaseIf two organisms differ in the distance

between sites of cleavage of a particular restriction endonuclease, the length of the fragments produced will differ when the DNA is digested with a restriction enzyme. The similarity of the patterns generated can be used to differentiate species (and even strains) from one another.

Restriction EndonuleaseRestriction endonucleases are enzymes that

cleave DNA molecules at specific nucleotide sequences depending on the particular enzyme used. Enzyme recognition sites are usually 4 to 6 base pairs in length.

The recognition sequences are randomly distributed through the DNA and recognizes different nucleotide sequences, and snips through DNA molecule.

Taq polymerase

Taq polymerase is a thermos table DNA polymerase named after the thermophilic bacterium Thermus aquaticus from which it was originally isolated by Thomas D. Brock in 1965. It is often abbreviated to "Taq Pol" (or simply "Taq"), and is frequently used in polymerase chain reaction (PCR), methods for greatly amplifying short segments of DNA

Disadvantages of Taq Pol

Taq mis-incorporates 1 base in 104.

A 400 bp target will contain an error in 33% of molecules after 20 cycles.

Error distribution will be random.

Thermo cycler is Back bone of PCR methodology

The method relies on thermal cycling, consisting of cycles of repeated heating and cooling of the reaction for DNA melting and enzymatic replication of the DNA

PCR - Three basic Steps

Cut Paste

Amplify

PCR PrimersTTAACGGCCTTAA . . . TTTAAACCGGTTAATTGCCGGAATT . . . . . . . . . .>and <. . . . . . . . . .

AAATTTGGCCAATTAACGGCCTTAA . . . TTTAAACCGGTT

Cutting, pasting and amplifying is the basis of Reaction

Heat causes DNA strands to separateHeat causes DNA strands to separate3’

5’

5’

3’

Denature DNA strands 94Denature DNA strands 94ooCC

5’

3’

3’

5’

•Primers bind to the template sequencePrimers bind to the template sequence

•Taq Polymerase recognizes double-stranded substrateTaq Polymerase recognizes double-stranded substrate3’

5’

5’

3’

Primers anneal 64Primers anneal 64ooCC3’

5’

5’

3’3’ 5’3’5’

3’

5’3’ 5’3’5’

Extend 72Extend 72ooCC

3’

5’3’ 5’3’5’

5’

3’

5’

3’

•Taq Polymerase extends primerTaq Polymerase extends primer

•DNA is replicatedDNA is replicated

RepeatRepeat denaturing, annealing, and extending denaturing, annealing, and extending 30 cycles30 cycles

Molecular diagnostics is a set of methods

to study primary structure (sequence) of DNA•Hybridization with complementary sequences

•Amplification (synthesis) of species specific sequences PCR – polymerase chain reaction

The 7th Baltic Congress in Laboratory Medicine, Pärnu 11.09.2004

-A-A-T-T-C-G-C-G-A-T-G-- T-T-A-A-G-C-G-C-T-A-C-

-A-A-T-T-C-G-C-G-A-T-G--A-A-T-T-C-G-C-G-A-T-G-

-A-A-T-T-C-G-C-G-A-T-G--A-A-T-T-C-G-C-G-A-T-G-

-A-A-T-T-C-G-C-G-A-T-G-

PCR occurs in cycles and Multiplies the DNA

Applications of PCRThe standard specimen procedure can quantitate HIV-1 RNA in a range of 400-75,000 copies/mL.

Advantages of PCRSpeed Ease of use

Sensitivity

Candida infections can be specifically identified

The fragments of 125-bp (EO3) and 317 bp (HSP) specific for C. albicans were used for amplification.

Molecular methods proving highly SensitiveIt has been

postulated that DNA sequencing of the universal nested PCR product may allow identification of the causative organisms in a number of culture are few

PCR helps in several critical ConditionsPCR has also been

evaluated in the diagnosis of fungal endophthalmitis using broad range primers as well as primers specific for C. albicans. Detection of fungal DNA by PCR in intraocular specimens will prove as a useful means of diagnosing endophthalmitis. It will greatly facilitate management decisions when conventional culture is negative.

The 7th Baltic Congress in Laboratory Medicine, Pärnu 11.09.2004

AdvantagesMolecular

methods•High sensitivity and specificity•Detects pathogen, not immune response•Quick results•High transport toleration

In-house (home-brew) PCR methods•Cost effective•High sensitivity•High quality•Fast implementation of scientific discoveries•Customer friendly

QIAGEN One Step RT-PCR Kit The QIAGEN One

Step RT-PCR Kit is designed for easy and sensitive one-step RT-PCR using any RNA template. A unique enzyme combination and specially developed reaction buffer ensure efficient reverse transcription and PCR in one tube.

RT-PCR in one step The Robus™ T I Kit is base

RobusT RT-PCR Kits perform cDNA synthesis and PCR amplification of cDNA successively in a single tube during a continuous thermal cycling

Nested polymerase chain reactionNested polymerase chain reaction is a

modification of polymerase chain reaction intended to reduce the contamination in products due to the amplification of unexpected primer binding sites.

Nested polymerase chain reaction involves two sets of primers, used in two successive runs of polymerase chain reaction, the second set intended to amplify a secondary target within the first run products

Loop Mediated Isothermal Amplification (LAMP)

Loop mediated isothermal amplification is a simple, rapid, specific and cost effective nucleic acid amplification method characterized by use of 8 distinct regions on the target gene.

The amplification proceeds at a constant temperature using strand displacement reaction.

Multiplex PCRTaqMan probes and

Molecular beacons allow multiple DNA species to be measured in the same sample ( Multiplex PCR) since fluorescent dyes with different emission spectra may be attached to different probes

Multiplex PCR in Real TimeMultiplex real time

quantitative RT-PCR assays have been developed for simultaneous detection identification and quantification of HBV, HCV and HIV!

In plasma and Serum samples.

Prevention of Contamination in PCR Laboratory

PCR contamination be considered as a form of infection. If standard sterile techniques that would be applied to tissue culture or microbiological manipulations are applied to PCR, then the risk of contamination will be greatly reduced. Above all else, common sense should prevail.

Polymerase Chain Reaction Available for several infections ….

Chlamydia trachomatisSlow growing Mycobacterium tuberculosis

viruses like Herpes simplex virus ,Varicella Zoster virus .Adeno virus in our laboratory for corneal specimens

Uses and Advantages in Testing by PCR Methods

Clinical diagnostics: detection and quantification of infectious microorganisms, cancer cells and genetic disorders

Capable of amplifying long targets, up to 6.0 kb

One-tube system allows rapid, sensitive and reproducible analysis of RNA with minimal risk of sample contamination

Amplifies products from a wide variety of total RNA or mRNA sources

Disadvantages of PCR MethodsExpensive to the Developing worldNeed well trained, ManpowerCoordination for quality controlAdoption to changing needsTimely technical supportFalse positive results due to Amplifications

Over 1400 molecular pathology labs in the US, with bulk of genetic testing being provided by a few big labs.

Large Labs: Quest Diagnostics LabCorp Genzyme

Medium Labs: Mayo ARUP (Associated Regional and University Laboratories Pathologist) MD Anderson Regional clinics and hospital Laboratories

Key End User product feature requirements: Clinical Practicality of test Strong client portfolio and relationship with laboratories Result turnaround time

Important issue in genetic testing market is deciding which testing platform or technology will have highest adoption rates in Clinical labs

Technology issues are throughput, sample concentration, procedure sensitivity and specificity Economic issues are costs of instrument and reagents, current platforms available in the lab, and ease

of use of the procedures Genetic testing looks for genetic marker such as Single Nucleotide Polymorphism

(SNP) , Restriction Fragment length Polymorphism (RFLP) or short tandem repeat (STR)

Theoretically any marker can be identified through any of the platforms Real- Time Polymerase Chain Reaction ( RTPC) Capillary Electrophoresis Micro-array Multiplexing Instruments

Important issue in genetic testing market is deciding which testing platform or technology will have highest rates in Clinical labs

Technology issues are throughput, sample concentration, procedure sensitivity and specificity Economic issues are costs of instrument and reagents, current platforms available in the lab, and ease

of use of the procedures Genetic testing looks for genetic marker such as Single Nucleotide Polymorphism

(SNP) Restriction Fragment length Polymorphism (RFLP), or Short tandem repeat (STR) Theoretically any marker can be identified through any of the platforms

Real- Time Polymerase Chain Reaction ( RTPC) Capillary Electrophoresis Micro-array Multiplexing Instruments

Electrophoresis Platform: A method of detection for specific gene sequences

using gel electrophoresisCurrently high availability of electrophoresis

instrumentation in labs means that kits designed for this platform should have the most rapid uptake.

Least expensive- $15K US for state of the art equipment

Electrophoresis also offers low costs per tests - kit cost $80/patient

Versatile in number of different applicationMajor disadvantage is labor intensity

RT-PCR Platform:A method for rapid and simultaneous

amplification, detection and quantification of gene fragments or gene expression

Slower adoption than electrophoresis due to the cost of machinery - $30K

Expected to have significant uptake because of prevalence in SNP testing

Currently many specialty labs like Quest Diagnostics have high RT-PCR usage

Cost expected to drop

Microarray Platform:A method for rapid detection of multiple simultaneous

gene fragments or gene expression. Probes that react to patient’s genetic material are arranged in grid pattern on glass or plastic platform. Resulting matches constitute a positive test, which are readily identifiable.

Most Expensive $150K-$180K + $500 per testReaction indicate particular genetic sequences, such

as those related to diseases, or how people will respond to certain medications. Microarrays also can enable researchers to see which genes are being switched on and off under different medical conditions.

Currently does not have many clinical applications, so drawback for laboratories to invest in platform

Roche’s AmpliChip is only FDA approved microarray test for diagnostic use

Multiplexing Platform:A method for simultaneous detection of specific gene

fragments, gene expression, immune response proteins and enzymes. Multifunction beads are manipulated to bind and signal the specific presence of a a variety of substrates

More versatile than microarray Allows more variation with regards to type of test - up to

100 assays to be preformed simultaneously on one sample.

Slower than competing technologies however Multiplexing technology are expected to gain field.FDA awarded its first approval for a CF diagnostic test

to TM Bioscience’s multiplexing platform based test.

Regulatory Issues FDA regulates reagents, kits and instruments sold to and performed by clinical labs. Diagnostic tests can be sold as Analyte Specific Reagents (ASR) to highly

sophisticated CLIA-certified labs. FDA exercised restrain in regulating home- brew tests performed by these labs. No specific clinical, validity or performance claims are allowed for unregulated ASRs. Potential liabilities if a lab chooses to provide an ASR rather than a 510(k)-cleared alternative.

Receiving a 510(k) FDA approval is a significant market barrier: Four FDA approved genetic diagnostic tests:

Roche AmpliChip, used to individualize dosage of antidepressants, antipsychotics, beta-blockers, and some chemotherapy drugs

TM Bioscience (Toronto, Canada) TAG-IT assay for detecting cystic fibrosis Visual Genetics (Toronto, Canada acquired by Bayer in ‘02) TRUGENE HIV-1

Genotyping Kit, used to detect variations in the genome of the human immunodeficiency virus that make the virus resistant to some anti-retroviral drugs.

Third Wave’s Invader assay detects variations in a gene that produces the enzyme UDP-glucuronosyltransferase, and predicts adverse events.

http://www.fda.gov/cdrh/oivd/index.htmlhttp://www.fda.gov/cder/genomics/default.htm