154
Dissertation for the degree of philosophiae doctor (PhD) at the University of Bergen Dissertation date: atherosclerosis
Dissertation for the degree of philosophiae doctor (PhD)
at the University of Bergen
Dissertation date:
atherosclerosis
© Copyright Rita Vik
The material in this publication is protected by copyright law.
Year: 2015
Title: Bioactive Proteins and Peptides Influence Lipid Metabolism and Inflammation in Relation to Atherosclerosis
Author: Rita Vik
Print: AIT OSLO AS / University of Bergen
3
Scientific environment
This study was carried out at the Lipid Research Group, at the Department of Clinical
Science, University of Bergen from November 2011 until April 2014.
The work was funded by Nordforsk under the Nordic Centers of Excellence program
in Food, Nutrition and Health; Project (070010) “Mitohealth”, The Research Council
of Norway (grant no. 190287/110), The European Community’s Seventh Framework
Programme (FP7/2007-2013) AtheroRemo (grant no. 201668), The Board of
Nutrition Programmes – University of Bergen, Norilia AS and NFR project 212984.
4
Acknowledgements
I would like to thank to my main supervisor Professor Rolf K. Berge for introducing
me to the field of fatty acid metabolism, mitochondrial function and atherosclerosis. I
am very thankful for your enthusiastic support, guidance and encouragement during
my PhD period.
A special thanks to my co-supervisor Dr. Bodil Bjørndal for helping me throughout
these years. Your intellectual guidance, contribution, cooperation and kindness have
been like an essential amino acid; indispensable!
I appreciate my second co-supervisor Dr. Ottar Nygård for his critical thoughts and
useful feedback on manuscript preparations and on my thesis.
I am so grateful to the laboratory technicians Kari Williams, Randi Sandvik, Svein
Krüger, Pavol Bohov, Liv Kristine Øysæd and Kari Helland Mortensen for your
skillful technical support and patience with me during these years. Thank you for
assisting me with my laboratory work and always being ready to help me in times of
trouble! I have appreciated your support and conversations during lunchtime.
In addition, I give my thanks to Dr. Trond Brattelid for teaching me aorta dissection.
Here I will also like to thank Eline M. Nævdal for teaching me animal care and
handling. Thanks to the rest of the staff at The Laboratory Animal facility.
A big thanks to our collaborators abroad; Cinzia Parolini, Marco Busnelli, Stefano
Manzini, Giulia S. Ganzetti, Federica Dellera, Cesare R. Sirtori and Giulia Chiesa at
the Department of Pharmacological and Biomolecular Sciences, Università degli
Studi di Milan, Italy, Veronika Tillander and Stefan E. H. Alexson at Department of
Laboratory Medicine, Division of Clinical Chemistry, Karolinska Institutet,
Karolinska University Hospital, Sweden, and Terhi Vihervaara and Kim Ekroos at
Zora Biosciences Oy, Finland.
I own thanks to all the other co-authors for their interesting insights and contribution
to the papers.
5
Thanks to my fellow PhD-students for creating a friendly atmosphere.
Finally, a warm thanks to my husband Christian. When I first met you, I had just
started my PhD fellowship and I remember my first words to you: I have just started
my PhD degree, so I’m not planning on having a life the next three years… Well, we
both know how that turned out! I am so grateful to you for the consolation,
encouragement and having faith in me. Thank you for finding the time to assist me
with the figures and for taking care of our son during the process of finalizing of my
dissertation. Also, I really appreciated you keeping the apartment neat and bringing
me coffee. I could not have done this without you!
Rita Vik
Bergen, April 2015
6
Abstract
The prevalence of lifestyle diseases emerging from the metabolic syndrome is
increasing and atherothrombotic cardiovascular disease leading to atherosclerosis is
the primary cause of death in the Western world. The development of atherosclerosis
is linked to mitochondrial dysfunction, lipid metabolism and inflammation.
It has been increasingly clear that bioactive protein can affect lipid metabolism and
hydrolyzed peptides possess bioactive potential.
Our aim was to investigate bioactive protein and peptides from salmon (SPH) and
chicken (CP) and determine their ability to influence lipid metabolism, inflammatory
markers and plaque development in rodent models. Further, we wanted to elucidate if
peptides from SPH or protein from CP could ameliorate atherosclerotic development
and inflammation in an apolipoprotein (apo)-E knockout mice model.
In the first study we investigated three different fractions of SPH in C57BL/6 mice.
Two of the fractions displayed plasma and liver lipid-lowering effect linked to
reduced fatty acid synthesis. The opposite was shown in another fraction. Thus,
bioactive peptides with distinct properties could be isolated from salmon protein.
The fraction of SPH showing most lipid-lowering effect in the previous study was
evaluated in apoE-/- mice to investigate atherosclerotic development. After 12 weeks
we detected less atherosclerotic plaque area in aortic arch and sinus of mice fed SPH,
but there was no change in plague composition. Circulating levels of inflammatory
markers were reduced, whereas plasma TAG and cholesterol levels were unchanged.
This study showed that SPH attenuated atherosclerosis in apoE-/- mice both at
vascular and systemic levels, independent of plasma lipids.
CP was used to elucidate potential effects on lipid metabolism in Wistar rats. Rats fed
CP had lower body weight despite a high feed intake. CP displayed TAG and
cholesterol-lowering capabilities in plasma as well as in liver, in addition to
stimulated mitochondrial fatty acid oxidation. Fatty acid synthesis appeared to be
7
reduced as hepatic enzyme activities and gene expression of lipogenesis was
decreased and plasma bile acids were increased. These results suggest a
hypotriglyceridemic property of CP and ability to reduced cholesterol levels, which
could be linked to increase in bile formation.
CP was further evaluated in apoE-/- mice. After 12 weeks of CP intervention, we
detected a small reduction in plasma TAG levels linked to increased energy
combustion from fat during inactive state. There was no change in plasma
cholesterol, TAG or fatty acid composition. En-face analysis of aorta revealed no
change in plaque development compared to controls, accompanied by unaltered
cytokine levels.
We concluded with the assumption that protein from different sources may possess
bioactive potential and hydrolyzing methods could liberate peptides with different
properties. SPH was also able to counteract atherosclerotic development in apoE-/-
mice by reducing plaque area and systemic cytokine levels despite unchanged plasma
lipid levels.
CP revealed promising effect on energy metabolism in rats, which could be related to
the amino acid profile of CP.
CP was not able to influence systemic or local inflammation, nor plaque area in apoE-
/- mice. Although CP displayed great influence on lipid metabolism in rats, it was not
capable of counteract the disrupted lipoprotein metabolism in the apoE-/- mouse
model.
8
List of publications
Paper I Vik, R., Tillander, V., Skorve, J., Vihervaara, T., Ekroos, K., Alexson, S.E.H., Berge, R.K., and Bjørndal, B., Three differently generated salmon protein hydrolysates reveal opposite effects on hepatic lipid metabolism in mice fed a high-fat diet. Food Chemistry, 2015. 183: p. 101-110.
Paper II Parolini, C., Vik, R., Busnelli, M., Bjørndal, B., Holm, S., Brattelid, T., Manzini, S., Ganzetti G.S., Dellera, F., Halvorsen, B., Aukrust, P., Sirtori, C.R., Nordrehaug, J.E., Skorve, J., Berge R.K., Chiesa, G., A salmon protein hydrolysate exerts lipid-independent anti-atherosclerotic activity in ApoE-deficient mice. Plos One, 2014. 9(5): e97598.
Paper III Vik, R., Bjørndal, B., Bohov, P., Brattelid, T., Svardal, A., Nygård, O.K., Nordrehaug, J.E., Skorve, J., and Berge, R.K., Hypolipidemic effect of dietary water-soluble protein extract from chicken: impact on genes regulating hepatic lipid and bile acid metabolism. European Journal of Nutrition, 2014. 54(2): p. 193-204.
Paper IV Vik, R., Brattelid, T., Skorve, J., Nygård, O.K., Nordrehaug, J.E., Berge, R.K., and Bjørndal, B., A water-soluble extract of chicken reduced plasma triacylglycerols, but showed no anti-atherosclerotic activity in apoE-/- mice. (Accepted, In Press)
9
Table of Contents
SCIENTIFIC ENVIRONMENT ......................................................................................................... 3
ACKNOWLEDGEMENTS ................................................................................................................. 4
ABSTRACT........................................................................................................................................... 6
LIST OF PUBLICATIONS ................................................................................................................. 8
TABLE OF CONTENTS ..................................................................................................................... 9
ABBREVIATIONS ............................................................................................................................. 12
LIST OF FIGURES ............................................................................................................................ 14
LIST OF TABLES .............................................................................................................................. 15
1. INTRODUCTION .................................................................................................................... 16
1.1 OBESITY AND CARDIOMETABOLIC SYNDROME ....................................................................... 16
1.2 OBESITY AND INFLAMMATION ............................................................................................... 18
1.3 ATHEROSCLEROSIS ................................................................................................................ 20
1.4 DIETARY PROTEINS ................................................................................................................ 23
1.4.1 Dietary proteins can affect lipid metabolism .............................................................. 24
1.4.2 Amino acid profile ....................................................................................................... 25
1.4.3 Amino acid ratios ........................................................................................................ 26
2. AIMS OF STUDY .................................................................................................................... 28
3. THEORETICAL BACKGROUND ........................................................................................ 29
3.1 LIPIDS .................................................................................................................................... 29
3.1.1 Fatty acids ................................................................................................................... 29
3.1.2 Glycerolipids ............................................................................................................... 29
3.1.3 Digestion, Absorption and Transport ......................................................................... 31
3.1.4 Cholesterol, cholesteryl esters and bile acids ............................................................. 33
3.1.5 Activation to acyl-CoA ................................................................................................ 38
10
3.1.6 Mitochondrial β-oxidation ......................................................................................... 38
3.1.7 Peroxisomal β-oxidation ............................................................................................ 41
3.1.8 Lipogenesis ................................................................................................................. 41
3.1.9 Elongation and desaturation of fatty acids ................................................................ 42
3.1.10 Ceramides and sphingolipids ..................................................................................... 44
3.2 PROTEIN ................................................................................................................................ 44
3.2.1 Catabolism of protein and amino acids...................................................................... 45
3.2.2 Enzymatically breakdown of dietary proteins ............................................................ 45
3.2.3 Transamination and oxidative deamination of amino acids....................................... 46
3.2.4 Nitrogen excretion and pathways of amino acid degradation.................................... 47
3.2.5 Bioactive peptides ...................................................................................................... 47
3.3 TRANSCRIPTIONAL REGULATION OF LIPID AND AMINO ACID METABOLISM ............................ 48
3.3.1 Peroxisome proliferator-activated receptors ............................................................. 48
3.3.2 Sterol regulatory element-binding factors.................................................................. 49
4. EXPERIMENTAL MODELS ................................................................................................ 51
4.1 WISTAR RATS ........................................................................................................................ 51
4.2 C57BL/6J MICE ..................................................................................................................... 51
4.3 APOE-/- MICE ......................................................................................................................... 52
5. SUMMARY OF RESULTS .................................................................................................... 53
6. DISCUSSION ........................................................................................................................... 57
6.1 MARINE BIOACTIVE PEPTIDES................................................................................................ 57
6.1.1 SPH reduced body weight .......................................................................................... 58
6.1.2 TAG-reducing effect of SPH ....................................................................................... 59
6.1.3 Various protein hydrolysates may influence fatty acid composition .......................... 59
6.1.4 Elevated liver ceramide levels did not affect fatty acid catabolism ........................... 61
11
6.1.5 SPH reduced atherosclerotic plaque area in apoE-/- mice .......................................... 62
6.1.6 Plaque stability was unaffected after SPH-treatment ................................................. 63
6.1.7 SPH decreased systemic inflammation ....................................................................... 63
6.2 CP AS A PROTEIN SOURCE ...................................................................................................... 65
6.2.1 CP reduced body weight and lipogenesis in rats ........................................................ 65
6.2.2 Elevated plasma level of bile acids after CP intervention .......................................... 66
6.2.3 Cellular toxicity could be reduced .............................................................................. 67
6.2.4 CP showed no anti-atherosclerotic effect in apoE-/- mice ........................................... 67
7. CONCLUSIONS ....................................................................................................................... 70
8. FUTURE PERSPECTIVES..................................................................................................... 72
9. REFERENCES ......................................................................................................................... 73
12
Abbreviations
AADE Amino Acid Degrading Enzyme
ABCA1 Adenosine Triphosphate-Binding Cassette 1
ACAT Acyl-Coenzyme A Cholesterol Acyltransferase
ACC Acetyl-Coenzyme A Carboxylase
ACE Adenosine-Converting Enzyme
ACOX Acyl-Coenzyme A oxidase
ANOVA Analysis of Variance
APO Apolipoprotein
ASC Acyl-Coenzyme A Synthase
ATP Adenosine Triphosphate
CACT Carnitine Acyltransferase
CoA Coenzyme A
CP Chicken Protein
CPT Carnitine Palmitoyltransferase
CVD Cardiovascular Disease
CYP7A1 Cytochrome P450, family 7, subfamily A, polypeptide 1, or cholesterol
7 alpha-hydroxylase
DAG Diacylglycerol
DGAT Diacylglycerol Acyltransferase
DHA Docosahexaenoic Acid
DPA Docosapentaenoic Acid
EPA Eicosapentaenoic Acid
ER Endoplasmic Reticulum
FAD Flavin Adenine Dinucleotide
FADS Fatty Acid Desaturase
FAS Fatty Acid Synthase
FFA Free Fatty Acid
GPAT Glycero-3-Phospohate Acyltransferase
HDL High-Density Lipoprotein
13
HMG-CoA 3-Hydroxy-3-Methylglutaryl-Coenzyme A
HNF-4α Hepatocyte Nuclear Factor 4 alpha
ICAM Intercellular Adhesion Molecule
IDL Intermediate-Density Lipoprotein
IL Interleukin
IRS1 Insulin Receptor Substrate 1
LDL Low-Density Lipoprotein
LDLr Low-Density Lipoprotein Receptor
LNAA Large Neutral Amino Acids
LPL Lipoprotein Lipase
MCP1 Monocyte chemoattractant protein 1
MUFA Mono-unsaturated Fatty Acid
NADH Nicotinamide Adenine Dinucleotide
NAFLD Non-Alcoholic Fatty Liver Disease
NEFA Non-Esterified Fatty Acid
NF-kB Nuclear Factor KappaB
NOS2 Nitric Oxide Synthase 2
PPAR Peroxisome Proliferator-Activated Receptor
PK Protein Kinase
PUFA Poly-unsaturated Fatty Acid
RER Respiratory Exchange Ratio
SCD1 Stearoyl-Coenzyme A desaturase 1
SFA Saturated Fatty Acid
SPH Salmon Protein Hydrolysate
SREBP Sterol Regulatory Element-Binding Protein
TAG Triacylglycerol
TCA Tricarboxylic Acid
VCAM Vascular Cell Adhesion Molecule
VSMC Vascular Smooth Muscle cell
VLDL Very Low-Density Lipoprotein
14
List of Figures
Figure 1 - Metabolic syndrome ................................................................................ 18
Figure 2 - Development of Atherosclerosis .............................................................. 22
Figure 3 - Glycerolipid synthesis ............................................................................. 30
Figure 4 - Lipoprotein metabolism ........................................................................... 33
Figure 5 - Cholesterol synthesis .............................................................................. 34
Figure 6 - Enterohepatic circulation ......................................................................... 37
Figure 7 - Carnitine shuttle ...................................................................................... 39
Figure 8 - Mitochondrial vs. peroxisomal β-oxidation ............................................... 40
Figure 9 - Fatty acid synthesis ................................................................................ 42
Figure 10 - Elongation and desaturation of fatty acids ............................................. 43
15
List of Tables
Table 1 - Essential and non-essential amino acids in humans .................................27
16
1. INTRODUCTION
1.1 Obesity and cardiometabolic syndrome
The prevalence of overweight and obesity has increased dramatically worldwide and
according to the World Health Organization (WHO) 1.4 billion adults were obese in
2008, when children and adolescent under the age of 20 were omitted [1]. A number
of impairments are closely associated with the rise in overweight and obesity-related
illnesses like atherothrombotic cardiovascular disease (hereafter referred to as CVD),
described as disruption of atherosclerotic lesions, which are the leading cause of
death in the industrialized world. Risk factors for developing lifestyle diseases
attributed obesity are commonly known under the generic term; metabolic syndrome
[2]. The metabolic syndrome is a cluster of conditions occurring in one individual [3],
comprising abdominal obesity, dyslipidemia, hypertension and insulin resistance [4],
all predisposes for developing cardiovascular diseases [5]. An overview of the
metabolic syndrome is given in Figure 1.
Malfunction of lipid metabolism is an originator strongly associated with the criteria
of metabolic syndrome [6], in addition to neurodegenerative and age-related diseases,
like Alzheimer´s [7, 8]. Cardiometabolic syndrome, emerging from the metabolic
syndrome, is a configuration of maladaptive cardiovascular, renal, metabolic,
prothrombotic and inflammatory abnormalities, and defines a well-established cluster
of risk factor for premature CVD and stroke [9]. Since mitochondria is the main
organelle regulating energy metabolism [10-13], attention has been drawn to
mitochondrial dysfunction as being the basal cause of obesity-related conditions [14-
19]. Chronic inflammatory diseases like rheumatoid arthritis [20] and atherosclerosis
[21], are also linked to obesity, and investigators now appreciate that these
inflammatory states may arise from metabolic imbalance [22]. Although genetics are
involved in the development of both metabolic syndrome and cardiometabolic
syndrome, dietary behaviours and a modifiable lifestyle pattern are the main
contributors to metabolic-related illness.
17
A likely explanation for the severe increase in overweight and obesity is simply
energy imbalance. The combination of excess energy intake and a sedentary lifestyle
is related to a developed society. Unlimited access to all sorts of food, in particular
highly processed foods used in the fast food industry, and requirement of
substantially less physical activity is undoubtedly the main causes of the growing
obese epidemic [23, 24]. Besides a large food consumption, the increasing economic
welfare among the Western population leads to great amounts of food being
discarded every year. Hydrolyzation processes of waste products yield useful
products, which can contribute to improve protein and food quality. Protein quality is
of particular importance with regard to protein malnutrition in third world countries
where access to food is limited. Protein hydrolyzed from natural sources are
considered more health-enhancing as nutraceuticals, in addition to a better safety
profile compared to synthetic manufactured supplements and pharmaceutics.
18
Figure 1 - Metabolic syndrome Criteria for the metabolic syndrome are listed in the green box. Metabolic syndrome is diagnosed when 3 out of 5 of these risk factors occur in one individual. Metabolic syndrome is associated with chronic low-grade inflammation and mitochondrial dysfunction predisposing for developing CVD, diabetes and non-alcoholic liver disease. *Waist circumference. CVD, atherothrombotic cardiovascular disease; FFA, free fatty acid; HDL, high-density lipoprotein; TAG, triacylglycerol; VLDL, very low-density lipoprotein.
1.2 Obesity and inflammation
Obesity-induced inflammation is distinctive from classical inflammation
characterized by redness, swelling, itch, heat and pain, as it is asymptomatic. Obesity-
induced inflammation causes systemic reactions, in particular observed in the
vascular system, gastrointestinal tract or liver, thus invisible on the outside of the
body. Another striking different is that the behaviour of classic inflammation is
associated with increased metabolic rate, representing a rapid immune response to
injury, which neutralizes and resolves the inflammatory state, whereas in obesity-
induced inflammation abnormalities in metabolism is the primary cause, in particular
19
excess energy intake. Adipocytes, or fat cells, are specialized cells involved in lipid
storage and metabolic signalling. In response to nutrient overload, the adipocytes are
also responsible for initiating and sustaining the inflammatory program [25]. Besides
being a storage of fatty acids, the adipose tissue also serves as an endocrine organ
secreting hormones, called adipokines [26], i.e lipoprotein lipase (LPL), leptin,
angiotensin and cytokines [27]. The first hallmark of an inflammatory state in adipose
tissue is increased levels of cytokines due to engagement in inflammatory pathways,
involving the nuclear factor kappaB (NF-κB) pathway, by metabolic signals [28, 29].
In response to elevated cytokine levels, inflammatory kinases are activated mediating
a modest low-grade inflammation. Phosphorylation of serine residues in insulin
receptor substrate (IRS)-1 by activated Jun N-terminal kinase (JNK) [30],
extracellular signal regulated kinase (ERK) [31], protein kinase (PK)-Cθ [32] and
mechanistic target of rapamycin (mTOR) [33] may target insulin IRS1 causing
impairment of the insulin receptor signalling cascade [34, 35]. Serine phosphorylation
of IRS1 by the inhibitor KappaB kinase (IKK) complex links inflammatory pathways
to insulin resistance [36]. Obesity-related inflammation is strongly associated with
CVD probably as an indirect effect through insults like hypertension and
hyperlipidemia, which may induce damage and reshaping of the endothelial cells [37-
40]. Endothelial damage provokes an inflammatory response recruiting growth
factors, cytokines, chemokines and potent vasoactive factors [41, 42].
20
1.3 Atherosclerosis
The exact mechanisms of initiation and progression of endothelial cell injury are
unknown, but is assumed to involve genetics, environmental cues, tissue injury,
infections and oxidative stress. Elevated plasma lipid levels and high blood pressure
might contribute to the first event in the development of atherosclerosis; endothelial
cell damage [43]. Also, naturally occurring causes like turbulence, in particular where
arteries branch, can induce injury on endothelial cells [44]. Key factors involved in
the progression of endothelial damage are of therapeutic value and investigators are
trying to survey these elements.
Atherothrombosis is characterized by atherosclerotic lesions and Figure 2 gives a
brief description of the progression of atherosclerosis. Generally, it is hypothesized
that the early onset of atherosclerosis is initiated by endothelial dysfunction and once
wounded, the endothelial cells begin to produce surface adhesion molecules, i.e.
vascular cell adhesion molecule (VCAM)-1 and intercellular adhesion molecule
(ICAM)-1 causing adherence of monocytes and T-lymphocytes, recruited by
chemoattractant cytokines, i.e. monocyte chemoattractant protein (MCP)-1.
Cytokines induce epithelia injury including tight junction dismantling and epithelial
barrier permeability alterations involving the epidermal growth factor receptor
(EGFR) -dependent mitogen activated protein/extracellular signal-regulated kinase
(MAP/ERK) 1/2 -signalling pathway [45]. Although all lipoproteins, with the
exception of the large chylomicrons, are able to cross a normal, intact endothelial
layer circulating low-density lipoprotein (LDL) can infiltrate the arterial wall to a
greater extent in inflammation [37]. Accumulated LDL in the intima, the innermost
layer of the artery wall, is more prone to oxidation. Monocytes in the intima mature
into macrophages secreting interleukin (IL), granulocyte macrophage colony-
stimulating factor (GM-CSF) and granulocyte colony-stimulating factor (G-CSF),
among others. The oxidized LDL is not recognized by LDL receptors (LDLr), but
binds to scavenger receptors [46]. The clustering of oxidized LDL particles in
macrophages, converts them into foam cells, creating a lipid-rich core, and eventually
foam cells undergo apoptosis. Oxidized LDL can also induce migration and
21
proliferation of vascular smooth muscle cells (VSMC) [47]. The T-lymphocytes (T-
cells) secrete cytokines provoking VSMC migration into intima, in addition to
smooth muscle cell proliferation. VSMC are responsible for the synthesis of the
collagen developing a fibrous cap, protecting the plaque from rupture. Recently, our
knowledge on the critical role of VSMC function and plasticity in atherosclerosis has
been substantially extended, indicating that a large portion of foam cells probably are
of VSMC origin [48]. Atherosclerotic plaque can develop without comprising the
lumen due to compensating changes of vessel size expanding the external elastic
membrane, known as positive remodelling [49]. Plaques developing slowly,
containing calcification which creates a mature fibrous cap, are stable and not prone
to rupture [50]. More rapidly growing plaques with a thin fibrin cap, are instable and
more likely to burst [51]. It Is assumed that positive remodelling creates a more
unstable plague compared to negative remodelling [52]. Ruptured plaque triggers
thrombosis and activates platelets and clotting factors, and this clotting cascade can
lead to blood clots resulting in heart attack or stroke [53, 54].
22
Figure 2 - Development of Atherosclerosis 1. The arterial wall. 2. Endothelial cells are prone to damage and circulating LDL enters the intima. Once in the intima, LDL is susceptible to oxidation. 3. Accumulation of oxidized LDL recruits monocytes binding to adhesion molecules and are, together with chemoattractant proteins, responsible for their entrance into intima. 4. Oxidized LDL is recognized by scavenger receptors located on monocytes, which mature into macrophages. 5. Macrophages overloaded with oxidized LDL become foam cells releasing inflammatory cytokines. 6. Migration and proliferation of VSMC synthesize collagen and together with foam cells cluster into fatty streaks,
23
known as atherosclerotic lesions. Remodeling of the vessel causes lesions progression without affecting luminal size. The fibrous cap shoulder is prone to rupture (Adapted from [52]). GM-CSF, granulocyte macrophage colony-stimulating factor; ICAM1, intercellular adhesion molecule 1; IL, interleukin; MCP1, monocyte chemoattractant protein 1; NOS2, nitric oxide synthase 2; VCAM1, vascular cell adhesion molecule 1; VSMC, vascular smooth muscle cell.
1.4 Dietary proteins
Protein is present in every cell throughout the body and is essential for building and
maintaining bones, muscle and skin. Proteins also serve as hormones and cytokines
synthesized, and released, to act as cell-cell signals, transcription factors, enzymes
and more. There are limited data pertaining protein and amino acid metabolism in
humans, thus the exact essential protein requirements is assessed from a minimum
level of protein necessary for maintaining a short-term nitrogen balance under
controlled conditions based on use for body protein synthesis and urea production.
Dietary protein is the source of essential amino acids required for growth and
maintenance. An overview of the essential and non-essential amino acids in humans
is given in Table 1. Also, protein digestibility should be accounted for in a balanced
diet. Differences in the rate of hydrolysis of protein from different sources could
affect digestion, gastric emptying, absorption and rate of removal, thus providing
variation in energy supply.
Whereas some proteins are suggested to suppress appetite [55], proteins from various
meat sources are assumed to affect satiety in different degrees [56]. Amino acid
precursors of the neurotransmitters serotonin and catecholamines, concentrations of
circulating hormones and metabolites (insulin, glucose, amino acids), as well as gut
factors are all believed to influence satiety. In a study comparing beef, chicken and
fish protein, fish was found to give the highest level of satiety [56]. This effect was
assumed to be attributed the tryptophan/large neutral amino acid (LNAA) ratio
suggesting involvement of the neurotransmitter serotonin, and consequently
serotoninergic activity [57-59]. A low plasma ratio of tryptophan/LNAA has shown
less desire to binge in vulnerable women after ingestion of a protein-rich meal [60].
24
1.4.1 Dietary proteins can affect lipid metabolism
It is well known that dietary fatty acids influence lipid metabolism, as well as
carbohydrate and protein metabolism, through cell-specific gene expression [61].
This regulatory mechanism is mainly influenced by the fatty acid composition of
membranes, body fat distribution and excessive consumption of fats [62-64], but
more recent work shows that also dietary protein affects lipid metabolism in rodents
[65, 66] and humans [67]. Diets high in protein causes less lipid accumulation in the
liver due to a rise in very low-density lipoprotein (VLDL) production rate
independent of fat content of the diet [65]. In one study in mice, enhanced expression
of genes involved in protein catabolic processes and transamination was shown, after
ingestion of a high protein diet [65]. Also, increased mitochondrial biosynthesis was
detected and increased expression of genes encoding enzymes participating in the
tricarboxylic acid (TCA) cycle, or citric acid cycle, thus energy utilization was
increased [65].
Proteins from soy are known to reduce cholesterol levels and reduce oxidative
damage to lipids [68], however uncertainty around the mechanisms behind these
effects remain. Also which constituents of the protein the effects are attributed to, the
amino acid content or isoflavones, is also somewhat debated. However, the
cholesterol reducing effect of soy has been linked to increased faecal excretion of
neutral sterols and cholesterol through bile, thus upregulating bile acid synthesis and
LDLr activity in rats [69]. The digestibility of the protein could affect lipid
absorption, and peptides high in hydrophobic amino acids are suggested to reduce
lipid-carrying capacity of micelles by binding bile acids [70], in this way decreasing
fat absorption. To compensate for the increased loss of cholesterol through bile
excretion, increased hepatic cholesterol biosynthesis has been reported, through
enhanced activity of the rate-limiting enzyme in cholesterol synthesis; 3-hydroxy-3-
methylglutaryl-coenzyme A (HMG CoA) reductase [71, 72]. However, this can also
be a compensatory mechanism to reduce plasma cholesterol, thus removal of
cholesterol, in particular LDL from the blood [73]. It is assumed that this effect could
25
be linked to the isoflavone content of soy protein (i.e. genistein and daidzein) [74,
75].
Recently protein from marine sources have emerged as cholesterol and lipid-lowering
diet components [76, 77] affecting VLDL secretion [76]. Meat and fish are the main
sources of protein in the Western world and contain bioactive peptides offering
antioxidant, antihypertensive, antimicrobial and antiproliferative properties [78-81],
all of which can reduce the risk of CVD. Antihypertensive and antioxidant capacities
are of particular interest in this regard. Antioxidants are demonstrated to inhibit LDL
oxidation and cellular lipid peroxidation, thus attenuating cell-mediated LDL
oxidation [82]. Several protein hydrolysates are shown to possess antioxidant effects
[79, 81, 83], and consequently may protect LDL from oxidation [84]. Hypertension is
a major risk factor for coronary disease, myocardial infarction, congestive heart
failure and stroke [85]. Protein from animal muscles [86], a chicken collagen
hydrolysate [87] and a fish protein hydrolysate [88] have appeared antihypertensive
through an angiotensin-converting enzyme (ACE) -inhibiting effect.
1.4.2 Amino acid profile
Taurine is a sulphur-containing organic acid, included among the amino acids, and is
involved in osmoregulation, calcium modulation and stabilization of membranes [89].
Taurine is one of the most abundant amino acid in the body, where it is synthesized
from methionine and cysteine, and is also found in high amounts in seafood. The
most documented effect of taurine is the conjugation with bile, and studies in humans
have shown that taurine levels are lower in obese subject [90] and in persons with
diabetes [91]. Taurine has also been linked to a cholesterol-lowering effect through
its involvement in the catabolism of cholesterol into bile [92], probably due to
increased expression and activity of the rate-limiting enzyme in bile acid synthesis,
cholesterol 7 alpha-hydroxylase (CYP7A1) [93], as well as upregulation of LDLr
activity increasing cholesterol clearance from the circulation [94], and cholesterol
excretion through bile by upregulation of the adenosine triphosphate-binding cassette
(ABC) transporters ABCG5 and ABCG8 [93].
26
1.4.3 Amino acid ratios
The ratios between the amino acids lysine/arginine and methionine/glycine have also
been purposed to influence lipid and cholesterol levels [95]. The low lysine/arginine
ratio of soy has been demonstrated to decrease and increase secretion of insulin and
glucagon, respectively [63], thus favoring lipolysis instead of lipogenesis. Protein
synthesis and proper folding of protein are essential for both cellular function and
avoiding cellular toxicity. Lysine is an indispensable amino acid, as well as a
precursor for other amino acids and is involved in collagen formation via its
hydroxylation to hydroxylysine [96, 97]. A low level of this amino acid may lead to
impaired protein synthesis [97] affecting high-turnover-constituents, which are
dependent on proper protein functions, like the apolipoproteins. Incorrect folding
leads to weakened receptor-mediated uptake of these particles, loss of sensitivity
towards proteolysis and increased susceptibility to oxidation [98], probably
increasing the risk for atherosclerosis. Carnitine is synthesized from lysine (and
methionine) [99], and is essential for fatty acid transportation into mitochondria for β-
oxidation, which could contribute to the lipid-lowering effect of lysine. Arginine is
linked to improved endothelial cell function, as it is the main substrate for nitric oxide
synthase (NOS) synthesizing nitric oxide (NO), which is an important cellular signal
molecule [100].
Low ratio of methionine/glycine has also demonstrated to decrease liver cholesterol
mainly through increasing HMG-CoA reductase activity [101]. High level of
homocysteine is associated with increased risk of endothelial damage and vascular
inflammation, resulting in atherosclerosis [102]. Homocysteine is synthesized from
the amino acid methionine in a multiple-step reaction where methionine is
demethylated ultimately giving homocysteine [103]. Activated methionine is the most
important methyl donor in the body formed by the transfer of an adenosyl group from
adenosine triphosphate (ATP) -yielding S-adenosylmethionine (SAM), catalyzed by
methionine adenosyltransferase (MAT). The methylation reaction takes place when
SAM donates a methyl group, yielding S-adenosylhomocysteine (SAH). SAH is an
inhibitor of methylation reactions, thus rapidly degraded. In this step homocysteine is
27
formed, under the action of SAH hydrolase removing the adenosyl group. It has been
suggested that the methyl group of methionine is responsible for the cholesterol-
elevating effect of methionine [104]. Glycine is associated with lower plasma
cholesterol levels [105].
Although the sulphur of amino acids have been linked to a cholesterol-increasing
effect, cysteine is suggested to reduce oxidative stress [106]. Thus, specific amino
acids have been shown to reduce cholesterol and oxidative stresses related to CVD,
and improve cellular conditions preventing ischemic injury.
Indications of beneficial effects from specific combinations of amino acids, rather
than whole proteins, have caused a growing interest of hydrolyzation of protein from
raw materials aiming for an optimized nutritional value. Hidden within the parental
protein appears to be bioactive peptides offering health improving potentials, which
are released during gastrointestinal digestion or food processing. Hydrolyzation of
proteins seems to have a more prominent effect, perhaps due to increase
bioavailability of the bioactive peptides.
Table 1 - Essential and non-essential amino acids in humans
Essential amino acids Non-essential amino acids
Histidine* Alanine
Isoleucine Arginine
Leucine Asparagine
Lysine Aspartic acid
Methionine Cysteine
Phenylalanine Glutamic acid
Threonine Glutamine
Tryptophan Glycine
Valine Histidine*
Proline
Serine
Tyrosine
*Indispensable in infants
28
2. AIMS OF STUDY
The general purpose of this thesis was to survey the effect of: 1) bioactive peptides
from hydrolyzed salmon and 2) chicken meat as a protein source, and investigate
their influence on lipid metabolism using rodent models. Further, we wanted to
elucidate if peptides from salmon and/or chicken protein (CP) could attenuate
atherosclerotic development and inflammation in an apolipoprotein (apo)-E knockout
mice model.
More specifically:
Study I: In the first experiment we assessed different fractions of a salmon
protein hydrolysate (SPH) and their lipid-lowering effect in male
C57BL/6 mice.
Study II: Based on study I, we used the SPH fraction (E1) showing most lipid-
lowering potential to investigate atherosclerosis and inflammation in
female apoE-/- mice.
Study III: The effect of chicken as a protein source on lipid metabolism was
evaluated in male Wistar rats.
Study IV: CP was further investigated in apoE-/- mice. Our working hypothesis was
that CP would lead to less atherosclerosis.
29
3. THEORETICAL BACKGROUND
3.1 Lipids
Lipids are a group of organic compounds insoluble in water, varying in size and
polarity from hydrophobic triacylglycerols (TAG) to more soluble phospholipids.
Lipids also include cholesterol, cholesteryl esters and phytosterols. The water-
insolubility of lipids forces them into specialized processes during digestion,
absorption, transport, storage and utilization.
3.1.1 Fatty acids
Fatty acid is a common term of aliphatic molecules consisting of a hydrocarbon
backbone with a carboxylic acid end. The hydrocarbon chain length of dietary fatty
acids vary from 12-24 carbons, and can be subdivided into short-chained fatty acids
(SCFA, > 6 carbons), medium-chained fatty acids (MCFA, 6-12 carbons), long-
chained fatty acids (LCFA, 12-22 carbons) and very long-chained fatty acids
(VLCFA, > 22 carbons). The diversity of fatty acids is further increased by the
insertion of double bonds in the hydrocarbon chain. Saturated fatty acids (SFA),
consist exclusively of single bonds, mono-unsaturated fatty acids (MUFA) with a
single double bond, and poly-unsaturated fatty acids (PUFA) containing multiple
double bonds.
3.1.2 Glycerolipids
Glycerol contains three hydroxyl groups, which can be esterified typically by one,
two or three different fatty acids creating a glycerolipid. Diacylglycerols (DAG) have
two fatty acids esterified to the glycerol and have important biological functions, like
activating PK-C [107], whereas TAG have three fatty acids esterified to a glycerol.
Glycerolipid synthesis includes four steps, as shown in Figure 3. Glycerol-3-
phosphate is generated from phosphorylation of glycerol by glycerol kinase, or from
the reduction of dihydroxyacetone phosphate derived from glucose via glycolysis.
30
The latter one is the only source for adipose glycerol-3-phosphate due to the lack of
glycerol kinase. Consequently, the adipose tissue can only store fat in fed state when
glycolysis is active. TAGs are the main storage form of lipids in living organisms,
and are also the largest proportion of dietary fat consumed by humans.
In contrast to glycogen, which is the glucose storage in animals, TAG do not bind
water and the energy density is much higher making it an excellent compound for
energy storage. TAG synthesis takes place mainly in liver in both endoplasmic
reticulum (ER) and mitochondria [108, 109], but also in adipose tissue and mammary
glands. TAG are synthesized from three potential sources; de novo lipogenesis,
plasma non-esterified fatty acids (NEFA) or lipoprotein remnants.
Phospholipids contain a DAG, a phosphate group and an organic molecule such as
choline. Phospholipids are the main constituents of lipid bilayer of cells and involved
in metabolism and cell signaling.
Figure 3 - Glycerolipid synthesis Glycerolipid synthesis includes four steps; acylation of glycerol-3-phosphate to form LPA by the action of GPAT [110]. GPAT exists in four isoforms, GPAT1 and 2 account for half of the activity in liver, whereas GPAT3 and 4 in ER predominates in adipose tissue. The next step involves an acylation of LPA to PPA followed by a hydrolyzation of the phosphate group by PAP forming DAG. The final step in glycerolipid synthesis is the acylation yielding TAG, catalyzed by the enzyme DGAT (Adapted from [111]). DAG, diacylglycerol; DGAT, diacylglycerol acyltransferase; GPAT, glycerol-3-phosphate acyltransferase; LPA, lysophosphatidic acid; PPA, phosphatidic acid; PAP, phosphatidic acid phosphatase; TAG, triacylglycerol.
31
3.1.3 Digestion, Absorption and Transport
A challenge in fatty acid digestion and absorption is the solubility; fatty acids are
hydrophobic whereas the digestive enzyme lipase is hydrophilic. To overcome this
barrier, emulsification is necessary. Bile, combined with motility in the small
intestine, aid the process of emulsification breaking down large fat globules into
smaller particles surrounded by bile salts and phospholipids [112]. These emulsifying
droplets increase the surface area where the enzyme lipase can digest TAG into
monoglycerides and free fatty acids (FFA), which also associate with bile salts and
phospholipids, making micelles. The micelles assist in the absorption of fatty acids by
providing monoglycerides and FFAs into a pool, then fatty acids uses their
hydrophobic advantage diffusing passively through the membrane of enterocytes.
Once inside the enterocytes, TAG are reconstructed from monoglycerols and FFAs,
and then packed together with dietary cholesterol into lipoproteins.
Lipoproteins are macromolecular complexes of specific carrier proteins,
apolipoprotein, with various combinations of phospholipids, cholesterol, cholesteryl
esters and TAG. Each type of lipoprotein has specific functions depending on point of
synthesis, lipid composition, and apolipoprotein content. The largest of the
lipoproteins are the chylomicrons transporting dietary TAG from the intestine to
peripheral tissues, displayed in Figure 4. Chylomicrons travel through exocytosis
from the enterocyte surface and pass into the lymphatic capillaries before entering the
blood [112]. The apolipoproteins in chylomicrons include apoB-48, apoE and apoC-2
[113]. The latter one activates LPL in tissues like skeletal muscle, adipose tissue,
heart and mammary glands releasing the FFAs of the chylomicrons [114], creating
smaller lipoproteins, known as chylomicron remnants. When depleted of most of its
fatty acids, the chylomicrons remnants move to the liver where receptors recognize
apoE and mediates uptake by endocytosis [115]. Excess dietary fats, or carbohydrates
not immediately needed for fuel, are converted to TAG and packed into lipoproteins
called VLDL. VLDLs also contain cholesterol, cholesteryl esters, apoB-100, apoC-1,
apoC-2, apoC-3 and apoE [116]. VLDLs circulate the blood from liver to muscle and
adipose tissue, where apoC-2 activates LPL [117], and FFAs are removed. The
32
VLDL remnants are cleared from the blood stream through receptor-mediated uptake
by apoE of the VLDL particle and liver receptors. Some of the VLDL remnants are
converted to intermediate density lipoprotein (IDL), rich in cholesterol and
cholesteryl esters. Further removal of TAG leads to the formation of LDL [118], as
illustrated in Figure 4. This lipoprotein, also very rich in cholesterol and cholesteryl
esters, contains apoB-100 as the major apolipoprotein [119]. LDL carries cholesterol
to extrahepatic tissue, which have receptors recognizing apoB-100.
High-density lipoprotein (HDL) originates from protein rich particles in the liver and
intestine, and contains little cholesterol and cholesteryl esters [120]. HDL contains
the enzyme lecithin-cholesterol acyl transferase (LCAT), which catalyzes the
synthesis of cholesteryl esters from phosphatidylcholine and cholesterol [121, 122].
Newly synthesized HDL is disk-shaped, but once the cholesterol ester content
increases creating a core, the HDL matures into a spherical HDL particle. This
particle is now rich in cholesterol and returns to the liver, known as reverse
cholesterol transportation, unloading the cholesterol, illustrated in Figure 4.
33
Figure 4 - Lipoprotein metabolism TAG-rich chylomicrons are assembled in the intestine after lipid absorption. Chylomicrons and VLDL, which is synthesized in the liver, are stripped of TAG in peripheral tissues by LPL. TAG-deprived VLDL is remodeled in the liver to LDL, which delivers cholesterol to cells for incorporation into membranes or steroid synthesis. LDL binds to liver LDLr. HDL brings back excess cholesterol through reverse cholesterol transport. HDL, high-density lipoprotein; LDL, low-density lipoprotein; LDLr, low-density lipoprotein receptor; LPL, lipoprotein lipase; TAG, triacylglycerol; VLDL, very low-density lipoprotein.
3.1.4 Cholesterol, cholesteryl esters and bile acids
Cholesterol, like fatty acids, is synthesized from acetyl-CoA [123], but the assembly
is different. Cholesterol synthesis takes place in numerous stages, described in Figure
5.
34
Figure 5 - Cholesterol synthesis Cholesterol synthesis takes place in multiple steps: First, two molecules of acetyl-CoA condense to form acetoacetyl-CoA, catalyzed by thiolase, then a third molecule of acetyl-CoA condense with acetoacetyl-CoA by the action of HMG-CoA synthase, forming a six carbon compound HMG-CoA. Three phosphate groups are transferred to mevalonate, two of these, in addition to a carboxyl group, leave in the next step, producing isopentenyl pyrophosphate, the first activated isoprene, which is isomerized to dimethylallyl pyrophosphate, the second activated isoprene. These two substrates undergo a head-to-tail condensation, forming geranyl pyrophosphate, which undergoes another head-to-tail condensation with isopentenyl pyrophosphate, forming the intermediate farnesyl pyrophosphate. Two molecules of farnesyl pyrophosphate join head-to-head, eliminating both pyrophosphate groups and yield squalene. The enzyme squalene synthase is regulated by the cholesterol content of cells. The addition of
35
an oxygen atom to the squalene chain forms squalene epoxide and the linear squalene epoxide is converted to a cyclic structure, lanosterol, which contains the characteristic four rings of a steroid nucleus. After 19 reactions, lanosterol is finally converted to cholesterol (Adapted from [124]). CoA, coenzyme A; HMG-CoA, 3-hydroxy-3-methylglutaryl-Coenzyme A.
Cholesterol synthesis was believed to takes place mainly in cytosol of hepatocytes as
all of the enzymes involved are present there, except HMG-CoA reductase, which is
found in ER. However, recently all enzymes, with the exception of one, are also
discovered in the peroxisome [125]. Cholesterol is incorporated into membranes
modulating rigidity and permeability [126], and is an important precursor for steroid
hormones [127]. Some of the cholesterol synthesized in liver, is used in membranes
of hepatocytes. The fate of cholesterol in ER is divided into two different pathways;
bile synthesis and cholesteryl ester synthesis.
The major path of cholesterol catabolism is bile acid synthesis where cholesterol is a
substrate for the enzyme CYP7A1 [128]. The majority of liver cholesterol is
converted to bile acid; cholic acid is synthesized by the action of CYP7A1 inserting a
hydroxyl group at C7 of the steroid ring of cholesterol, and is the rate-determining
step of bile synthesis [129]. The primary bile acids, cholic acid and chenodeoxycholic
acid, are conjugated with either taurine or glycine [130], giving eight active
conjugated forms referred to as bile salts. Conjugation of the carboxylic end of bile
acids, gives a negative charge, fully ionized. Bile salts are more efficient detergent,
more secretable and less cytotoxic due to the enhanced amphipathic structure. Biliary
salts are the major solutes in human bile and aids in lipid digestion, as previously
described.
The turnover of the exchangeable pool of cholesterol participates in an incomplete
enterohepatic circulation, represented in Figure 6. Both free cholesterol and
cholesterol converted into bile is excreted through the bile duct into duodenum
mixing with dietary cholesterol. Partially reabsorption takes place in the jejunum,
whereas the majority of bile acid reabsorption takes place in the distal ileum. The
unabsorbed portion of cholesterol and bile acids derived from cholesterol, are
excreted through faeces, thus there is a continuous loss of cholesterol. The loss is
replaced by endogenous synthesis and reabsorption of dietary cholesterol, and the
36
turnover is assumed to be such that 2% is renewed pr. day. As the majority of
cholesterol loss is through intestinal excretion, faecal output of bile acids and neutral
steroids determine the rate of cholesterol turnover.
In the opposite pathway, cholesterol is used for cholesteryl ester synthesis. The acyl-
coenzyme A cholesterol acyl transferase (ACAT) catalyzes the liver production of
cholesteryl esters [131]. Cholesteryl esters synthesized in the liver, is packed into
lipoprotein particles and secreted to cholesterol-demanding tissues, as formerly
described.
37
Figure 6 - Enterohepatic circulation Cholesterol is metabolized to cholic acid, conjugated with taurine or glycine and released from the liver/gallbladder through the common bile duct into the small intestine. 95% of the bile is reabsorbed in the distal intestine, 5% excreted through the faeces. 5% of the reabsorbed bile enters the circulation. Plasma and newly synthesized cholesterol can be used for bile acid synthesis (Modified from [132]).
38
3.1.5 Activation to acyl-CoA
Both dietary and de novo synthesized fatty acids requires esterification with a
coenzyme A (CoA) to be activated. This hydrolysis is carried out by the enzyme acyl-
coenzyme A synthase (ASC) present in the outer mitochondrial membrane, in
membranes of ER and peroxisomes. The insertion of this energy-rich thioester bond
is necessary for all fates of fatty acids, ranging from β-oxidation, synthesis of
glycerolipids, phospholipids and cholesteryl esters, desaturation and elongation. The
fatty acyl-CoAs are transported by fatty acyl-binding proteins (FABP).
3.1.6 Mitochondrial β-oxidation
Mitochondria are tubular-shaped, membrane-bound organelles located in cytoplasm
of eukaryotic cells. Mitochondria are the power station of the cell consisting of an
outer and an inner membrane surrounding the core of the organelle known as matrix.
Mitochondria are crucial in ATP synthesis [133] and are present in great numbers in
highly energy demanding tissues like cardiac- and skeletal muscles.
Mitochondria are the principle site of fatty acid oxidation, which takes place in the
matrix [134]. Although SCFAs and MCFAs can passively diffuse through the
mitochondrial membranes, LCFAs, which constitute the majority of dietary fatty
acids, requires a transport system. This challenge is overcome by the action of the
carnitine palmitoyl transferase (CPT) system, a three-step reaction termed carnitine
shuttle [135], shown in Figure 7. After the activation by ASC in the outer membrane,
the fatty acyl-CoA ester formed is transiently attached to the hydroxyl group of a
carnitine giving fatty acyl-carnitine, catalyzed by carnitine acyltransferase (CACT)-1.
After synthesis, the acyl-CoA ester moves into the matrix by facilitated diffusion
under the action of CPT1. The final step in this process is the enzymatically transfer
of the fatty acyl group from carnitine to intra-mitochondrial CoA by CPT2 [136].
39
Figure 7 - Carnitine shuttle Fatty acid transportation across the mitochondrial membranes as fatty esters of carnitine starts off with activation by ASC in the outer membrane. The fatty acyl-CoA ester formed is transiently attached to the hydroxyl group of a carnitine giving fatty acyl-carnitine, catalyzed by CACT1. After synthesis, the acyl-CoA ester moves into the matrix by facilitated diffusion under the action of CPT1. The final step in is the enzymatically transfer of the fatty acyl group from carnitine to intra-mitochondrial CoA by CPT2 [136] (Modified from [137]). ASC, acyl-coenzyme A synthetase; CACT1, carnitine acyltransferase 1; CoA, coenzyme A; CPT, carnitine palmitoyltransferase, IMM, inner mitochondrial membrane; OMM, outer mitochondrial membrane.
Mitochondrial β-oxidation takes place in three stages and results in the removal of
two carbons in the form of acetyl-CoA, and is demonstrated in Figure 8.
40
Figure 8 - Mitochondrial vs. peroxisomal β-oxidation The first step in mitochondrial β-oxidation is catalyzed by ACAD located in the inner mitochondria membrane, using FAD as a prosthetic group receiving the electrons from the fatty acyl-CoA. The electrons enter the respiratory chain contributing to ATP synthesis. After the insertion of a double bond between the α and β carbons, H2O is added to the double bond of trans Δ2-enoyl-CoA to form β-hydroxyacyl-CoA dehydrogenase, catalyzed by enoyl-CoA hydratase. The splitting of the double bond between these two carbons forms L-β-hydroxyacyl-CoA. In the next step, H2O is removed through a dehydrogenation reaction, yielding β-ketoacyl-CoA. In this reaction NAD+ is reduced to NADH by accepting electrons from this reaction and passing them on to NADH dehydrogenase, the first electron carrier in the respiratory chain. The shortening of the fatty acyl chain by the reaction between β-ketoacyl-CoA and a free CoA represent the final step in β-oxidation, catalyzed by thiolase (ACOT), and the resulting fatty acyl is reduced by two carbons, by releasing acetyl-CoA. After finishing one passage through the β-oxidation, the fatty acyl-chain recycles until it is completely oxidized. The first reaction in peroxisomal oxidation does not contribute to ATP synthesis. The two next reactions are similar to mitochondrial oxidation, but involve other enzymes. Both oxidations result in a release of a fatty acyl-CoA and acetyl-CoA (Adapted from [138]). ACAD, acyl-coenzyme A dehydrogenase; ACOT, acyl-coenzyme A thioesterase; ATP, adenosine triphosphate; FAD, flavin adenine dinucleotide; NAD, nicotinamide adenine dinucleotide.
41
The acetyl-CoAs released can enter the TCA cycle to generate ATP, or it can be used
for ketone body synthesis forming acetoacetate, β-hydroxybutyrate and acetone.
Although acetoacetate and β-hydroxybutyrate are synthesized in the liver, they cannot
be used as an energy source here, but are transported to other tissues, like the brain,
reconverted to acetyl-CoA and then used as fuel. Acetone is a waste product of the
decarboxylation reaction of ketone body production and exhaling secretes most of the
acetone. Starvation, high-fat-low-carbohydrate diets or prolonged endurance exercise
leads to production of ketone bodies from fatty acids in the liver [139].
3.1.7 Peroxisomal β-oxidation
β-oxidation is also carried out in the peroxisome [140], as described in Figure 8,
shortening LCFAs to MCFAs making them suitable for mitochondrial β-oxidation
[141]. Oxidation in peroxisomes and mitochondria is quite similar; a comparable
membrane shuttle of fatty acids [142] and activation by addition of acyl-CoA, but
some details differ. The first reaction in peroxisomal oxidation does not contribute to
ATP synthesis [143] and is therefore a less efficient energy-providing source. The
two next enzymes differ from the two in mitochondria, although they catalyze the
same reactions. Both oxidations result in a release of a fatty acyl-CoA and acetyl-
CoA. The shortened fatty acyl is subsequently shuttled to mitochondria for further
oxidation.
3.1.8 Lipogenesis
The body can synthesize a diversity of fatty acids from the substrates acetyl-CoA and
malonoyl-CoA under the action of the rate-limiting enzyme in fatty acid synthesis,
acetyl-coenzyme A carboxylase (ACC). Biosynthesis of fatty acids is a four-step
repeating cycle, catalyzed by the enzyme fatty acid synthase (FAS) complex,
involving the addition of a two-carbon unit, explaining why most natural occurring
fatty acids are even-numbered. Notably, some fatty acids from cow milk are odd-
numbered due to the ruminal bacteria of cattle [144].
42
Figure 9 - Fatty acid synthesis
Biosynthesis of fatty acids is a four-step repeating cycle consisting of a condensation, reduction, dehydration and another reduction, involving the addition of a two-carbon unit (Inspired by [145]). ACP, acyl carrier protein; ADP, adenosine diphosphate; ATP, adenosine triphosphate, BHBA, beta-hydroxy-butyric acid, CoA, coenzyme A, CPT, carnitine palmitoyl transferase, FAS, fatty acid synthase, MUFA, mono-unsaturated fatty acid; NADP, nicotinamide adenine dinucleotide phosphate, SFA, saturated fatty acid
Fatty acid synthesis is outlined in Figure 9 and takes place mainly in the cytosol of
hepatocytes, but also to some extent in adipose tissue. The protein acyl carrier protein
(ACP) activates fatty acid synthesis, a part of the fatty acid synthase (FAS) complex,
which includes all enzymes participating in the pathway. The first reaction is a
carboxylation of acetyl-CoA to malonyl-CoA, catalyzed by the enzyme ACC. The
acetyl-CoA is generated from catabolism of glucose and the carbon skeleton of amino
acids. Malonyl-CoA is considered a precursor of fatty acids synthesis and an inhibitor
of fatty acid oxidation [71].
3.1.9 Elongation and desaturation of fatty acids
Fatty acids synthesis usually produce 16:0 (palmitic acid), and in minor amounts 18:0
(stearic acid). These fatty acids are highly represented in membranes, in brain
43
however, there is a substantial requirement for LCFAs. Mainly liver and brain
mitochondria, or the surface of ER, have the capacity to carry out elongation, ER
being the most active [146, 147]. Elongation and desaturation are shown in Figure 10.
Figure 10 - Elongation and desaturation of fatty acids
Elongation of fatty acids resembles fatty acid synthesis, but the activities are separable involving different enzymes. Malonyl-CoA is the source of the two carbons added. Desaturation involves the removal of two hydrogens from the fatty acid yielding a carbon-carbon double bond.
Elongation in ER is similar to fatty acid biosynthesis, whereas mitochondrial
elongation is essentially the reversal of β-oxidation, but both involve addition, and
subsequent, reduction of acetyl groups. CoA derivatives must be activated for the
donation of a two-carbon unit by malonyl-CoA. The additional steps are followed by
reduction, dehydration and another reduction reaction. Mitochondria mainly elongate
SCFAs.
44
Desaturation of fatty acid is another essential event in lipogenesis. Stearoyl-
coenzyme A desaturase (SCD)-1 is located in the membrane of ER and responsible
for the insertion the first cis-double bond between C-9 and C-10 in the hydrocarbon
chain, therefore often referred to as Δ9 desaturase [148, 149]. SCD1 is the rate-
determining enzyme in the oxidative desaturation of MUFAs and the preferred
substrates are 16:1n-7 (palmitoyl-CoA) and 18:1n-7 (oleoyl-CoA) [150]. The fatty
acid desaturase (FADS) family includes FADS1 and FADS2, also called Δ5
desaturase and Δ6 desaturase, respectively, which catalyze biosynthesis of highly
unsaturated fatty acids.
3.1.10 Ceramides and sphingolipids
Relatively similar to the glycerolipids are the sphingolipids, but sphingolipids are
derived from sphingosine instead of glycerol. Ceramides are the precursors of
sphingolipids and are converted to sphingolipids in the liver [151]. Sphingolipids
serve as structural components of the plasma membrane, however recently their role
in inflammatory disease has been identified. Activity of sphingolipid enzymes have
been shown to increase in response to elevated cytokine levels [152]. Glycerolipids
and sphingolipids cross talk as second messengers to control vesicle movement, cell
division and cell death.
3.2 Protein
Protein is formed when amino acids are joined together by peptide bonds initially
forming peptides. Peptides containing more than 60 amino acids are designated
proteins. The amino acid sequence of a protein is called the primary structure and
further creates helixes or sheets, posing the secondary structure, and subsequent fold
into three-dimensional structures, known as tertiary structure [153]. Protein
containing two or more separate polypeptide chains arranged into a three-dimensional
structure creates a quaternary structure.
45
3.2.1 Catabolism of protein and amino acids
Dietary protein and intracellular protein, mainly from the breakdown of muscles can
be degraded to amino acids to provide energy. Inflammation has shown to increase
muscle breakdown [154] and the amine group of the amino acid is separated from the
carbon skeleton and used in biosynthetic pathways, or excreted as urea. The
remaining carbon skeleton is converted to α-keto acids subsequently entering the
citric acid cycle, and ultimately the carbon skeletons are diverted to gluconeogenesis,
ketogenesis or completely oxidized to CO2 and H2O [155, 156].
Glutamine is the most abundant amino acid in the blood and a general collection
point of amino groups, donating an amino group in both biosynthesis and elimination
of nitrogenous products. In skeletal muscles, the amino groups are transferred to
pyruvate to form alanine, important in transportation of amino groups to the liver,
which is the only organ carrying out a complete urea cycle [157], and the major site
for amino acid metabolism.
3.2.2 Enzymatically breakdown of dietary proteins
In response to ingested protein, the gastric mucosa lining the stomach secretes the
hormone gastrin, stimulating the cascade in which hydrochloric acid and pepsinogen
are secreted as well. The acidity of the gastric juice unfolds globular proteins and
exposes their peptide bond making them available for enzymatic hydrolysis by
proteinases. Through the action of pepsin, polypeptide chains are broken down to
smaller peptides by hydrolysis of peptide bonds on the amino-terminal of the
aromatic amino acid residues; phenylalanine, tryptophan and tyrosine. As the acidic
chyme of the stomach enters the small intestine, the low pH triggers release of
secretin in the blood, which promotes pancreatic deliver of bicarbonate into the upper
part of the small intestine, duodenum, to neutralize the gastric acid. In response to the
presence of amino acids in the duodenum, cholecystokinin is released, stimulating
secretion of the inactive precursors [158] trypsinogen, chymotrypsinogen and
procarboxypeptidases, synthesized and released by the exocrine cells of the pancreas.
Further hydrolysis of the peptides produced under the action of pepsin in the stomach
46
is efficiently performed by trypsin and chymotrypsin due to amino acid specificities
of these three enzymes. The various zinc-containing carboxypeptidases cleave basic
and acidic C-terminal amino acids [159], to complete the degradation of peptides in
the small intestine, together with aminopeptidase, which hydrolyzes the amino-
terminal residues. Breakdown of dietary protein appears to yield more small peptides
than free amino acids [160]. The resulting mixture of free amino acids, di- and some
tripeptides are then transported to the epithelial cells through secondary active
transport via the Na+K+ -pump. The accumulation of amino acids, di- and tripeptides
in the epithelial cells during digestion, results in passive transport of these molecules
via solute carrier to the blood capillaries and subsequent to the liver [137].
Hydrolyzed proteins in the diet are believed to be absorbed more easily, since
peptides are smaller than proteins and the peptides bond more exposed, thus the
peptidases are thought to gain more access to breakage of the peptide bonds. Also,
some peptides could be resistant to digestion, only increasing satiety, thus passing
through the digestive tract without contributing with energy [56].
3.2.3 Transamination and oxidative deamination of amino acids
The catabolism of most amino acids starts with transamination of the amino groups to
α-ketoglutarate by the enzyme pyridoxal phosphate, yielding glutamate. The removal
of the amino group of glutamate in the hepatic mitochondrial matrix for excretion is
called oxidative deamination, catalyzed by glutamate dehydrogenase. and is a
convenient manner to convert amino acids to its α-keto acid forms [161]. The α-
ketoglutarate produced can enter the citric acid cycle or gluconeogenesis whereas the
NH4 can be used for urea production.
In skeletal muscles glucogenic amino acids can be broken down for use as fuel and
the amino group in the form of glutamate can be further transferred to pyruvate by
alanine transferase forming alanine. Blood alanine travels to the liver where pyruvate
and glutamate is reformed. Thus, the glucogenic amino acids are converted glucose in
the liver for use as fuel, while ketogenic acids are converted to ketone bodies as brain
fuel [162].
47
3.2.4 Nitrogen excretion and pathways of amino acid degradation
Urea production takes place mainly in hepatocytes [163]; more precisely it starts off
in mitochondria and continues in the cytosol. Ornithine accept a carbamoyl group
from carbamoyl phosphate forming citrulline, which passes from the matrix to the
cytosol further accepting a second amino group from aspartate, which yields
argininosuccinate. The proceeding of the urea cycle involves two steps of cleavage;
argininosuccinate is cleaved into fumarate and arginine, which is further cleaved into
urea and ornithine. Urea passes into the bloodstream and travels to the kidney for
excretion as urine. All urea enzymes are shown to correspond with protein
consumption in rats [164] As for the carbon skeleton of amino acids, some are
converted to glucose, others to ketone bodies, as previously described. The major
focus of this thesis is on arginine, lysine, methionine and glycine, which all are
glucogenic acids, except lysine which is ketogenic. When degraded, arginine is
converted to glutamate and succinyl-CoA, lysine is converted to acetoacetyl-CoA and
further to acetyl-CoA, methionine is converted to propionyl-CoA and subsequently to
succinyl-CoA, and glycine is converted to pyruvate and further to acetyl-CoA, thus
all is converted to substrates of the citric acid cycle.
3.2.5 Bioactive peptides
In addition to their nutritional value, bioactive peptides exert a physiological
effect in the body. Meat and fish are valuable sources of proteins and appear potential
as novel sources of bioactive peptides displaying antihypertensive, antioxidant,
antimicrobial and antiproliferative effects [80, 81, 165, 166]. Upon hydrolysis by
digestive enzymes or bacterial fermentation, peptides are fractionated based on size,
usually performed by ultrafiltration. To separate individual peptides, reverse-phase
high performance liquid chromatography (RP-HPLC) or gel permeation
chromatography is used. To identify individual peptides, a combination of mass
spectrometry and protein sequencing are performed.
The most established effect of food-derived bioactive peptides is the inhibitory effect
on the vasoconstrictor ACE by binding directly to this enzyme, inhibiting the
48
conversion to its active form [82] , thus reducing hypertension, an important risk
factor for CVD. In order to perform ACE-inhibitory effect, peptides need to arrive at
the target organ in an intact form, thus being resistant to digestion.
Discarded bi-products of food processing are of major concern and are mostly
incorporated to animal feed. Adding value to these side-products could be aided by
the demonstration that they may be used to generate bioactive peptides [167]. Salmon
muscle has also been shown to contain peptide sequences contributing to ACE-
inhibitory effect [168]. Of the peptides showing an ACE inhibitory effect, short
chained, polar and low hydrophobic amino acid content displayed the most prominent
effect [169].
Antioxidant potential from natural foodstuff has emerged as a preferred source
compared to synthetic antioxidants due to less side effects [170]. Antioxidant
potential is dependent on peptide size, amino acid profile, and the content of free
amino acids within the hydrolysate.
3.3 Transcriptional regulation of lipid and amino acid metabolism
Fatty acids regulate gene expression, activity and abundance of the transcription
factors peroxisome proliferator-activated receptors (PPAR), liver X receptor (LXR),
hepatocyte nuclear factor (HNF)-4α, NF-κB and sterol regulatory element-binding
proteins (SREBP) [61]. Also, it has been reported that dietary peptides control amino
acid oxidation through PPARα [171].
3.3.1 Peroxisome proliferator-activated receptors
PPARs are nuclear hormone-receptors regulating lipid and glucose metabolism, and
recent investigation indicate that PPARs participate in the regulation of amino acid
metabolism as well [172, 173]. Three isoforms of PPARs have been discovered; α,
β/δ, and γ. PPARs are ligand-dependent, and are typically activated by fatty acids and
their eicosanoids [174]. Once activated, PPARs form a heterodimer with retinoid-X-
49
receptor (RXR), which bind peroxisome proliferating receptor elements (PPREs),
stimulating, or suppressing, transcription of target genes [175, 176]. PPARα is highly
expressed in energy demanding tissues like liver, heart, skeletal muscle, kidney and
brown fat [177], and regulates genes involved in fatty acid uptake and catabolism,
inflammation and vascular function [178]. PPARα also regulates amino acid
oxidation in the liver, and is assumed to be a key factor regulating intermediate
metabolism during fasting state [173]. PPARγ is primarily limited to brown and white
adipose tissue [179], but also found in the large intestine [180] regulating genes
engaged in fatty acid uptake and storage, inflammation and glucose homeostasis
[180, 181]. PPARδ is moderately expressed in most tissue regulating genes
participating in fatty acid metabolism, inflammation and macrophage lipid
homeostasis [182]. PPARα activation facilitates fatty acid oxidation by increased
expression of LPL and apoA5 [183], and a decrease in apoC3 [184]. This leads to
liberation of fatty acids available for storage in adipocytes or metabolized in muscles.
Once activated, PPARα raises the HDL level due to an increase in hepatic apoA1
synthesis and ABCA1 expression, stimulating HDL-mediated cholesterol efflux
through macrophages [185, 186]. PPAR agonists contribute to increased fatty acid
oxidation and decreased inflammation [187, 188], and are therefore an interesting
field to investigate. Also, it has been suggested that PPARα reduces amino acid
catabolism [189] by regulating hepatic amino acid degrading enzymes (AADE)
through HNF4α activity, preserving amino acids by stimulating fatty acid oxidation
during fasting state [171]. Catabolism of amino acids, catalyzed by AADEs generates
metabolic energy, as well as substrates for gluconeogenesis.
3.3.2 Sterol regulatory element-binding factors
Lipids have many important functions in an organism, and SREBPs are considered a
major regulator of cholesterol synthesis and transportation, and synthesis of fatty
acids, TAG and phospholipids as these transcription factors have the ability to
activate a cascade of enzymes involved in lipogenesis and cholesterol synthesis [190].
In addition, SREBP stimulate synthesis of NADPH [191], which is needed for several
synthesis processes.
50
SREBPs are synthesized in ER as inactive precursors and activated in response to
sterol deprivation, or high circulating insulin levels [192]. SREBP-cleavage
activating protein escorts SREBP precursors to Golgi where cleavage of the amino-
terminal takes place [193-195]. After translocation to the nucleus, SREBPs bind
promotor regions, SREBP response elements, of genes involved in fatty acid and
cholesterol synthesis and transportation [196]. Liver and adipose tissue are the main
tissues involved in export and storage of lipids, thus SREBPs are most active in these
organs. There are three isoforms of SREBP, referred to as SREBP1a, SREBP1c and
SREBP2. SREBP1c is primarily expressed in liver regulating genes involved in fatty
acid synthesis, whereas SREBP2 is mainly present in liver and adipose tissue
modulating genes engaged in cholesterol synthesis. Bioactive compounds can
influence hormones and cholesterol influencing ligands ability to bind receptors,
hence some genes can be preferentially activated. Insulin and glucagon can modulate
gene expression in this manner, and insulin and glucagon promotes and inhibits
SREBP-1c, respectively [197]. Circulating levels of insulin and glucagon are
influenced by diet constituents. Soy protein display a much lower short term insulin
concentration [198, 199], and higher long-term glucagon [200] concentration as
compared to a casein diet, thus SREBP is supressed and lipogenic gene expression is
reduced. Soy proteins are also known to reduce plasma and hepatic cholesterol in
animals and humans [198, 201-204], and in response, SREBP2 expression is
enhanced increasing cholesterol biosynthesis, in particular HMC-CoA reductase
activity, and cholesterol uptake, mainly LDLr activity. The ability of soy protein to
modulate insulin/glucagon levels has been linked to low lysine/arginine ratio
corresponding to a higher glucagon levels. LDLr is under control of SREBP2
transcription and upregulation of LDLr could be linked to the reduced plasma and
hepatic cholesterol levels observed in soy protein feeding. Glycine-containing
peptides, β-conglycinin and glycinin are found to upregulate LDLr activity [205].
51
4. EXPERIMENTAL MODELS
4.1 Wistar rats
Wistar rats are an outbred strain from the albino rats belonging to the strain Rattus
norvegicus [206] developed and distributed in 1906 and throughout 1940s at the
Wistar institute [207]. As early as in the 1800 albino rats were separated from other
rat groups and used for rat shows. During this period the albino rats find their way
into the laboratory and became the first animal used in research. Henry Donaldsen
and colleagues put a lot of effort into optimizing the albino rats for use in many
research fields. In 1960 the Wistar Institute in Philadelphia sold the rights to other
commercial companies.
Wistar rats are bred under standard laboratory conditions and are characterized by
long ears and having a tail-length shorter than body length. The Wistar rats are
domestic rats making them more tractable, calmer and less likely to bite compared to
wild types. There are many advantages using rats in scientific research; they are
inexpensive, available, easy to handle and house, and can be used for a broad
spectrum of disciplines including physiology, nephrology, endocrinology, nutrition,
metabolism, drug evaluation, toxicology and transplantable tumors.
4.2 C57BL/6J mice
The most popular animal for laboratory use are the C57BL/6J mice and this model is
widely used in many research areas studying human disease [206]. These mice are an
inbred strain [208], which means that the mice are traceable to a single ancestral pair
in at least 20 generation. The background of C57BL/6J mice contains both
spontaneous and induced mutations, and is also used in production of transgenic
mice. The mouse strain is homozygous for Cdh23ahl, resulting in age-related hearing
loss with onset after 10 months. The C57BL/6J strain was developed in 1921 by CC
Little at the Bussey Institute for Research in Applied Biology [209], and these mice
develop obesity, hyperlipidemia and insulin resistance on a high-fat diet.
52
4.3 ApoE-/- mice
Mice are highly resistance to atherosclerosis, except the C57BL/6 strain, which
develop plaque when fed a high-fat diet. In 1992 the apoE knockout mice model was
evolved from the C57BL/6 strain and still widely used as an experimental model for
studying atherosclerosis [210]. ApoE is a constituent of chylomicrons and
intermediate density lipoprotein essential for normal TAG catabolism. ApoE is
synthesized in various organs, mainly in liver cells and central nervous system. The
plasma lipoprotein levels and their metabolites are dependent on apolipoproteins. The
apoE-knockout model was developed in the cell line 129P2/olaHsd, derived from cell
line EI4TG2a ES. Two plasmids were used, pJPB63 and pNMC109, founder line T-
89 in the primary reference. ApoEtm1Unc was backcrossed 10 times to C57BL/6J mice
[211] and intercrossed to homozygosity [212]. Insertion of a neomycin resistance
cassette deleted part of the exon 3 and part of intron 3 of the apoE gene, thus the gene
was knocked out. Mice homozygous for the ApoEtm1Unc are hypercholesterolemic
with elevated plasma cholesterol levels independent of age, gender and diet. On a
standard chow diet, apoE mice have a total plasma cholesterol level of 4-500 mg/dL
mainly due to accumulation of VLDL remnants caused by impaired clearance of
these particles due to knockout of the apoE gene [213]. Accordingly, these mice are
prone to develop severe atherosclerotic lesions at a relatively early age. ApoE mice
can be fed a Western diet or a high-fat diet to develop more pronounced lesions at a
shorter time. ApoE-/- mice are widely used in studying atherosclerosis as they give the
opportunity to investigate the involvement of inflammation and immune mechanisms,
pathogenesis and therapy of atherosclerosis, in addition to genetic influence.
53
5. SUMMARY OF RESULTS
Paper I:
Three differently generated salmon protein hydrolysates reveal opposite effects
on hepatic lipid metabolism in mice fed a high-fat diet
We wanted to explore any possible health benefits from 5% SPH generated using
different enzymatic hydrolyzation processes and microfiltration methods, and found
that C57BL/6 mice fed the peptides E1 and E4 displayed lower body weight, despite
a similar feed intake, as well as a lower total weight gain compared to the casein diet.
In contrast, the E2 group displayed a growth curve and feed intake comparable to
controls. Peptide E1 and E4 groups also showed lower plasma and liver TAG levels.
In the E1 group this was linked to reduced hepatic gene expressions of fatty acid
synthase (Fasn) and the rate-limiting enzyme in fatty acid synthesis, Acaca. Also,
Fads1 and Fads2, involved in Δ5 and Δ6 desaturation, respectively, tended to be
lower in E1.
In the E4 group, mitochondrial β-oxidation was increased, demonstrated by higher
activity of CPT2. FAS activity tended to be lower and Fasn expression was
significantly lower in the E4 group, suggesting a concomitant increase in β-oxidation
and reduction in lipogenesis in this group. As seen in E1, Fads1 was lower expressed
in this group. HMG-CoA reductase (Hmgcr) was reduced in both E1 and E4. In
contrast, mice fed the E2-diet demonstrated elevated hepatic TAG content compared
to controls, in addition to increased plasma TAG, cholesterol and phospholipid levels.
FAS activity was up-regulated in the E2 group, as were gene expression of Acot1,
indicating increased synthesis and liberation of fatty acids in this group.
SFAs were unaffected in all peptide groups. MUFAs tended to be reduced in the E1
group and were significantly reduced in the E4 group, whereas n-3 PUFAs were
increased in the E4 group, in accordance with an increase in Δ6 desaturase index. n-6
PUFAs were increased in the E1 group, as were the Δ5 desaturase index. The
opposite was observed in E2 where MUFAs were increased, corresponding to the
54
increase in Δ9 desaturase indices, while n-3 and n-6 PUFAs were reduced compared
to controls. The total hepatic lipid level (TAG, cholesterol and phospholipids) was
unchanged in E1 and E4 compared to controls, whereas hepatic lipids were increased
in E2. This was in line with the relative difference (%) of TAG found in TAG
lipidomics. The differences in TAG in E1 compared to control was seen as a
reduction in all species of TAG, whereas the E2 group-diet primarily increased the
TAG species containing SCFAs, SFAs and MUFAs compared to control. The relative
difference of all d18:1 ceramides were increased in the E1 group, in contrast to the E2
group.
We observed diverse effects from three pre-digested peptide fractions on weight gain,
plasma and liver lipids and lipid synthesis, indicating that enzymatically
hydrolyzation of peptides can lead to distinct, and in some cases, opposite effects.
Paper II:
A salmon protein hydrolysate exerts lipid-independent anti-atherosclerotic
activity in apoE-deficient mice.
The SPH-E1 fraction was further investigated and after 12 weeks with dietary
intervention with 5% SPH treatment apoE-/- mice showed reduced atherosclerotic
plaque area in sinus and aortic arch. Also, a reduced gene expression of Icam in the
aortic arch was detected. Immunohistochemical determination of atherosclerotic
lesions in aortic sinus showed no differences in plaque content of connective tissue,
macrophages or lymphocytes, indicating that plaque stability was not affected.
Plasma arachidonic acid (C20:4n-6) and oleic acid (C18:1n-9) were increased and
decreased, respectively, after SPH-treatment. Plasma concentration of inflammatory
markers IL-1β, IL-6, TNF-α and GM-CSF were decreased, whereas plasma
cholesterol and TAG levels was unchanged.
These results showed that a 5% SPH diet reduced atherosclerotic development in
apoE-/- mice, and tended to decrease expression of adhesion molecules in aortic arch,
55
thus possessed a local anti-atherosclerotic effect, but did not influence the stability of
the plaque area. The decrease of plasma inflammatory markers suggests a systemic
effect of the SPH as well, and that the reduction in plaque was independent of plasma
lipids.
Paper III:
Hypolipidemic effect of dietary water-soluble protein extract from chicken:
Impact on genes regulating hepatic lipid and bile acid metabolism.
After diet intervention with low-fat diets with doses of 6%, 14% or 20% CP for 4
weeks, Wistar rats fed the 20% CP dose displayed the highest feed intake, but gained
less weight. We found a dose-respond effect of CP in lowering the plasma
cholesterol, cholesterol-esters, TAG and phospholipids, measured as delta values.
Dietary supplementation with 20% CP decreased liver contents of TAG, cholesterol
and phospholipids. The 20% CP diet also changed the fatty acid composition in liver,
showing increased levels of α-linoleic acid (C18:3n-3) and docosapentaenoic acid
(DPA) (C22:5n-3). Hepatic β-oxidation was increased, accompanied by increased
CPT2 activity in the 20% CP group compared to the control group. Gene expression
of the transcription factor, Ppara, was increased, which might contribute to the
increase in fatty acid catabolism observed. Enzymes involved in fatty acid synthesis,
ACC and FAS, tended to decrease in the 6% and 14% CP fed groups, but only
reached significance in the 20% group. GPAT, involved in TAG synthesis, was also
significantly decreased in the two highest doses of CP. CP did not show any effect on
cholesterol synthesis, however, the gene expressions of Abcb4 were increased, which
could indicating increased bile transportation.
Carnitine turnover was assessed my measuring carnitine and its precursor and esters,
which all were increased, indicating improved mitochondrial function.
This study demonstrated decreased plasma and liver TAG and cholesterol by diet
intervention with CP. We concluded that the high feed intake and lowered plasma and
56
hepatic lipids, without a high weight gain, could be due to poorer intestinal
absorption, a change in energy balance and/or increased faecal excretion.
Paper IV:
A water-soluble extract of chicken reduced plasma triacylglycerols, but showed
no anti-atherosclerotic activity in apoE-/- mice.
In apoE-/- mice given a 15% CP diet we detected marginal plasma TAG lowering
accompanied by indication of increased mitochondrial β-oxidation in CP-fed mice
compared to casein-fed controls after 12 weeks. Mice fed CP also displayed a lower
respiratory exchange ratio (RER) during inactive state, supporting higher energy
combustion from fat. There was no change in plasma cholesterol levels or fatty acid
composition, and en-face analysis of aorta displayed no change in plaque
development between the two groups. To further support these data, plasma
inflammatory markers were measured revealing unaltered systemic inflammation.
It appears that chicken protein is less potent in counteracting persistent disruptions on
lipid metabolism present in apoE-/- mice, and does not have the capability to affect
atherosclerotic development.
57
6. DISCUSSION
The occurrence of overweight and obesity worldwide is growing in spite of numerous
dietary advices, effort and public education from health authorities. Although
consumers are increasingly attentive to food safety, quality and health-related issues,
obesity is of serious concern in the Western populations and CVD annually causes 17
million deaths [214]. The risk factors of metabolic syndrome resulting from
overweight and obesity lead to metabolic dysfunctions, evident as dyslipidemia and
systemic inflammation, and one of its clinical manifestations is atherosclerosis. The
present thesis aimed to elucidate two protein sources and their bioactive potential to
affect lipid metabolism and mitochondrial fatty acid oxidation, cholesterol and TAG
levels, as well as their capability of influencing inflammation, a hallmark in the
development of atherosclerosis. The major focus of the thesis has been centred on the
liver, plasma and heart/aorta, as liver is the main organ regulating both fatty acid
oxidation and synthesis. Plasma and heart pertain to systemic and local inflammation,
respectively.
6.1 Marine bioactive peptides
Fish consumption has been of great interest to investigate regarding bioactive effects
and the health benefits of fish intake is dedicated to the omega-3 PUFAs. Lately,
protein and peptides from various sources have been a focus of research as they
possess nutritional and essential properties in organisms, and are important
constituents in food production. Seafood is viable source of proteins, both
economically and environmentally, with balanced amino acid contents and high
nutritional value, showing promising health improving effects in both rat [76, 215]
and human studies [216]. Marine proteins possess antioxidant activity [217], ACE –
inhibitory action, anticancer effect [218] and cholesterol-reducing potential [76].
Peptides are inactive in their parental protein structure, but can be liberated by
digestion or commercial hydrolysis. Controlled hydrolysis of protein is the best way
to recover potent bioactive peptides in term of nutritional properties, namely a
58
balanced amino acid composition and high digestibility [219]. Currently, most fish
raw material is discarded. This secondary raw material is well suited for recovery and
utilization as functional foods. The bioactive peptides can be extracted using specific
proteolytic enzymes to cleave definite peptide bonds and defined hydrolysis
conditions to generate desired peptides [220]. For the past 60 years, fish protein has
been hydrolyzed mainly for use in animal feed production. Recent work on
hydrolysis processes of fish protein has led to functional hydrolysates with optimal
nutritional availability for use as food supplements. Commercially manufactured
peptides are designed to achieve a defined molecular size, solubility in water and
nutritional balanced amino acid profile.
6.1.1 SPH reduced body weight
Numerous studies with protein and hydrolysates have shown improvements on blood
lipids, and dietary protein is known to affect lipid metabolism [221-223]. This was in
line with results for two of the salmon peptide fractions we assessed (Paper 1).
Among the three macronutrients, protein has the greatest thermic effect and satiety
value compared to both carbohydrate and fat [224-226] assumed to contribute to
lower body weight, both during normal or high dietary intake [227, 228], as observed
in our experiment (Paper 1). Although, given the same amount of protein, body
weights were distinct between the groups in our study.
Protein differs according to its source; proteins from animal origin are considered
complete protein containing all nine essential amino acids that the human body
requires, whereas proteins from plants are incomplete. Further, proteins from
different meat sources possess distinct effects as well, as varying degrees of satiety.
Fish protein has been shown to increase satiety linked to serotoninergic effect, or
differences in digestibility, thus slower gastric emptying [56]. Fish protein
hydrolysate has demonstrated increased hepatic mitochondrial fatty acid oxidation
[229]. Increase in CPT2 activity in group E4 was detected, which could also be
another likely explanation to lower body weight seen in this group (Paper 1).
59
6.1.2 TAG-reducing effect of SPH
Fish oil has been reported to reduce plasma TAG levels [230], whereas fish protein
lowers cholesterol levels in rats [76, 231-233]. Also, fish protein has been reported to
decrease cholesterol content of LDL particle as compared to casein [234]. However,
in our study in mice we detected plasma TAG-reducing effect in two of the peptide
fractions (E1 and E4) compared to casein, but unchanged plasma cholesterol levels
(Paper 1). The TAG-reducing action of fish oil is attributed to the omega-3 fatty
acids as they are natural PPAR agonists, thus contributing to increased fatty acid
oxidation. However, studies indicate that fish oil lowers TAG through both PPAR-
dependent and independent pathways [235]. It has been proposed that fish oil also
decreases the transcription factor SREBPs, thus down-regulating mRNA expression
of lipogenic genes [236]. In line with studies on n-3 PUFAs [237, 238], we detected
reduced enzyme activity of FAS and decreased gene expression of Fasn and Acaca,
involved in fatty acid synthesis, using fish peptides (Paper 1). Previous studies in rats
have shown reduced plasma cholesterol concentrations connected to elevated plasma
bile acid levels [215], and an increase in both cholesterol clearance through bile and
bile excretion [239]. Despite the decrease in gene expression of Hmgcr in mice fed
the E1 and E4 diets, no reduction in plasma cholesterol levels was observed. This
could be related to the lower dose of SPH, or the animal model. Elevated plasma bile
acid level was detected in group fed the E4 diet (Paper 1). Unfortunately, cholesterol
and bile excretion through faeces were not measured in our study. In contrast, peptide
group E2 displayed increased hepatic TAG, as well as plasma TAG, cholesterol and
phospholipid levels, combined with increased FAS activity and elevated gene
expression of Scd1, indicating stimulated fatty acid synthesis in this group (Paper 1).
Differences in liver and plasma TAG could be explained by opposite regulation of
fatty acid synthesis between the peptide groups.
6.1.3 Various protein hydrolysates may influence fatty acid composition
Bioavailability of a protein is assumed to be varying according to protein source,
some are expected to suppress appetite [55], others increase satiety [56]. Feed intake
60
in our four groups could not explain the divergent effect on body weight, as protein
unequally affect body weight gain independent of feed intake [240]. The variation in
body weight between our treatment groups could thus be explained by distinct
peptide or amino acid profile of each protein hydrolysate fraction (Paper 1). Dietary
protein may influence fatty acid composition and lipogenesis, and desaturation have
been reported to be affected by the aromatic amino acids tyrosine and phenylalanine
[241]. Elimination of tyrosine and phenylalanine from amino acid mixtures, has
shown increased Δ6 activity [241]. Here, the gene expression of Fads2 was
comparable between all groups since they were all dominated by amino acids from
casein. Arginine and leucine have been suggested to regulate gene expression of Scd1
and Fasn [242]. Arginine levels in E1 and E4 groups were lower compared to the E2
group, and fatty acid pattern was similar in E1 and E4, as well as an increase in
18:3n-6/18:2n-6 and 20:4n-6/20:3n-6 ratios in the E4-fed group compared to control.
These fatty acid ratios are often used as an index for the activities of Δ6 and Δ5
desaturases, respectively. As these indices are affected by several pathways [243],
they did not correspond with the gene expression of Fads1 and Fads2 (Paper 1). In
contrast, the unaltered Scd1 expression reflected with the Δ9 desaturase index in
liver. In rats fed the peptide fraction E2 a simultaneously enhanced liver Scd1
expression, increase in Δ9 desaturase index and elevated MUFAs was detected,
further supporting an enhanced fatty acid synthesis in this group. Oleoyl-CoA
(C18:1) is the main product of Δ9 desaturase and is primarily used for TAG
generation, and this was reflected in an increase in short-chained MUFAs. This could
suggest that increase in Scd1 and a corresponding increase in incorporation of
MUFAs into TAG could lead to an increase in VLDL release. In two of the peptide
fraction groups (E1 and E4) MUFAs decreased whereas PUFA increased, thus
favouring PUFA synthesis instead of MUFAs, suggesting that different peptide
effects on lipid levels could have been reinforced by their opposite regulation of fatty
acids influencing cell signaling.
61
6.1.4 Elevated liver ceramide levels did not affect fatty acid catabolism
Ceramides are a subgroup of waxy lipids consisting of sphingosine and a fatty acid
present in the cell membrane. In addition to their physiological role in cell
membranes including adhesion, differentiation and cell senescence, ceramides and
their metabolites are also implemented in pathological states like obesity, diabetes
and inflammation. Elevated liver LCFAs are suggested to contribute to adverse effect
of ceramides on insulin and inflammation, in addition to characterize human subjects
with high liver fat content [244]. However, despite elevated ceramide levels in
C57BL/6J mice livers in the peptide E1 group, we detected lower hepatic TAG level
in this group (Paper 1). Accumulation of ceramides leads to an alteration in energy
metabolism slowing anabolism to ensure that catabolism ensues [245], actions
associated with obesity. We did not find an increase in fatty acid oxidation in this
group, suggesting that, at least fatty acid catabolism was not affected by elevated
ceramide levels (Paper 1). As there was no indication of fatty liver and hepatic
expression of Scd1 and lipogenic activity was unchanged, the elevated ceramide
levels observed in the peptide E1 group might be due to the decrease in hepatic TAG.
TAG species are the most prevalent lipid class in the liver, thus it is reasonable to
assume that a decrease in these levels could affect percentage of other lipid classes,
like ceramides, hence an increase in ceramide levels. On the contrary, in the peptide
E2 group there was a general decrease in ceramides. The increase in Scd1 and FAS
activity in the peptide E2 group, with a simultaneously increase in DAG, but not
ceramide concentrations, could indicate early onset of non-alcoholic fatty liver
disease (NAFLD) [246]. Liver TAG levels in this group were also significantly
increased, further supporting the possibility of early onset of fatty liver. The decrease
in DAG in the E1 group could be of importance in regulating PK-K, modulating cell
processes.
In this study we found diverse effects of three peptide fractions from salmon protein
hydrolysates treated with various proteolytic enzymes on body weight, plasma and
liver lipids and synthesis, indicating that different peptide fractions can have potential
62
for both health-promoting and adverse effects (Paper 1). Digestion of protein leads to
products that can interfere with intestinal absorption and pre-hydrolyzation of protein
is shown to exert a more protruding effect than whole protein [247-249], and gives
the opportunity to optimize nutritional value and bioavailability, resulting in a
specified product regarding its use.
6.1.5 SPH reduced atherosclerotic plaque area in apoE-/- mice
The initiation of CVD is progression of atherosclerotic lesions; whereas the onset of
atherosclerotic development is controversial. Whether, high circulating levels of
inflammatory cytokines represent the degree of atherosclerosis or simply an active
immune system is speculative. There is generally an agreement about interplay
between inflammation and lipid storage, which comes first however, remains unclear
[250-253]. The absent of apoE on chylomicrons and other lipoproteins, cause
accumulation of VLDL remnants in plasma, which contributes to atherosclerotic
development. ApoE-/- knockout mice are widely used in this regard and this animal
model develop atherosclerotic lesions on a standard chow diet. After testing different
SPH-fractions in C57BL/6J mice (Paper 1), accompanied by promising results on
TAG-reducing effects in plasma, in addition to indications of reduced fatty acid
synthesis, the E1 fraction was further evaluated in apoE-/- mice (Paper 2). After 12
weeks, we found reduced atherosclerotic plaque area in aortic sinus as well as in
aortic arch compared to the casein diet (Paper 2). In addition, gene expression of the
atherosclerotic marker in pooled aortic arch, Icam1 was decreased, purposing a local
anti-atherosclerotic potential of SPH (Paper 2).
Metabolites of arachidonic acid (20:4n-6), like prostaglandins and leukotrienes, are
thought to be proatherogenic [254, 255], whereas oleic acid are considered health
beneficial by lowering cholesterol levels and improving insulin sensitivity [256].
Oleic acid (18:1n-9) is proposed to counteract mechanisms of arachidonic acid by
reducing its serum level [256]. Arachidonic acid inhibits Δ9 desaturase, which can
explain the lower level of oleic acid (Paper 2). Additionally, we detected reduced
liver mRNA expression of Δ9 desaturase (Scd1), further contributing to lower level of
63
oleic acid. However, oleic acid, via linoleic acid, is the precursor of arachidonic acid,
thus an increase in arachidonic could be at the expense of oleic acid. Despite an
increase and decrease in the proatherogenic arachidonic acid and health-promoting
oleic acid, respectively, plaque area decreased, indicating that SPH has the potential
to attenuate atherosclerosis independently of plasma fatty acids (Paper 2).
6.1.6 Plaque stability was unaffected after SPH-treatment
The common feature of acute manifestations of atherosclerosis is rupture of the
plaque, which causes heart attacks or stroke. Plaques with a thin fibrous cap tend to
expend as more lipid accumulate and macrophages release enzymes destroying
collagen resulting in a weak, rupture-prone fibrous cap. As the stability of the plaque
is an important factor contributing to the severity of atherosclerosis, the content of the
atherosclerotic plaque was assessed by immunohistochemistry. However, there was
no change in connective tissue, macrophages or lymphocytes, indicating that plaque
stability was not affected by SPH administration (Paper 2). Spontaneous plaque
rupture and subsequent formation of thrombosis in murine models have yet to be
shown and even when the fibrous cap is extremely thin, it does not rupture [257].
Although, the apoE-/- mouse model is a suitable and extensively used model for
studying atherosclerosis, it is not appropriate for investigate susceptibility of the
plaque to rupture [258]. However, another explanation could be a simultaneously
decrease in macrophages and plaque area, thus no change in a percentage
measurement. Decreased sinus plaque area combined with unchanged macrophage
number could be related to a smaller lipid-rich core, hence a reduction in macrophage
size. Another likely explanation may be related to reduced proliferation of VSMC, as
the majority of foam cells could be derived from VSMC [259].
6.1.7 SPH decreased systemic inflammation
Key markers of inflammation and early stage of atherosclerosis are IL-1β, TNF-α and
IL-6, which all were reduced after SPH treatment, in addition to significantly lower
levels of IL-10 and GM-CSF, suggesting that systemic inflammation was reduced
(Paper 2). Previous studies have shown reduced colon cytokine levels in a rat model
64
of colitis [260], and lower levels of interferon gamma (IFN-γ), in addition to
increased anti-inflammatory index in an inflammatory mouse model [229], after
intervention with the same SPH fraction, further supporting the anti-inflammatory
potential of SPH.
It is generally assumed that high circulating levels of cholesterol and TAG increases
the risk of atherosclerosis, and fish protein display a cholesterol-lowering effect
[233]. In line with our previously results (Paper 1) and by others [229, 260], we
observed no change in plasma cholesterol (Paper 2), however as opposed to our
forgoing findings (Paper 1), plasma TAG levels were unchanged (Paper 2). Activity
of enzymes involved in peroxisomal and mitochondrial fatty acid oxidation, acyl-
coenzyme A oxidase (ACOX)-1, palmitate-CoA production, CPT2, and cholesteryl
ester synthesis, were unchanged, accompanied by unchanged gene expression of the
corresponding genes (Paper 2), thus fatty acid oxidation was not affected by SPH
administration, in agreement with the unchanged plasma TAG level. This could be
explained by the low dose of SPH, as studies showing reduced cholesterol and TAG
levels, have utilized higher doses [76, 215, 233]. However, in our previous study in
wild type mice (Paper 1), reduced liver and plasma levels of TAG were reported.
Thus, persistent lipoprotein disturbance due to the apoE-knockout could be adequate
to interfere, or inhibit a potential effect of SPH on lipogenesis compared to wild type
mice. Reduced hepatic gene expression of Acaca and Scd1, key enzymes in fatty acid
synthesis, was inadequate to significantly reduce plasma and liver TAG levels of SPH
treated mice. SPH administration displayed no effect on the antioxidant defence
system in the heart of apoE-/- mice, as gene expression of the antioxidants superoxide
dismutase (Sod1), Catalase and Nos2 were unaffected (Paper 2). In combination
with the reduced plasma levels of inflammatory markers, these results indicate that
SPH protects against atherosclerotic development by inhibiting inflammation,
independent of plasma lipid changes.
65
6.2 CP as a protein source
Protein from animal sources such as milk and meat from cattle is considered less
health-promoting than leaner meat from i.e. poultry, due to high content of fat.
Increased protein intake is recommended to keep satiety for longer period in an
attempt to reduce energy intake, as protein being the macronutrient requiring most
comprehensive processes in digestion and absorption.
Proteins from plant origin like soy and animal origin like casein, is widely studied,
surpassing others like chicken. Chicken is an abundant supply all over the world and
is considered a well-balanced protein source, rich in essential amino acids. The large
consumption of chicken combined with its nutritional value, makes it interesting to
elucidate potential mechanisms CP may possess regarding improvement of human
health. Previously, CP was shown to have antioxidant [261] and antihypertensive
[262, 263] capacities. Therefore, in Paper 3 we wanted to determine a potential effect
of CP on lipid metabolism, as proteins have been suggested to influence parameters
involved in inflammation.
6.2.1 CP reduced body weight and lipogenesis in rats
After 4 weeks of dietary treatment with a water-soluble extract of CP at three
different doses, we found lower body weight, despite a higher feed intake, in rats fed
CP compared to protein from casein (Paper 3). This result was most prominent in the
group receiving the highest dose of CP, the 20% CP group (Paper 3). There are
several possible explanations for this finding, one of them being poorer digestibility
of the CP. Dietary proteins have been suggested to interrupt with digestion forming
complexes difficult to absorb and proposal that peptides have a higher affinity
towards bile acids lowering micelle solubility [239]. This could decrease fat
absorption, hence reduce energy uptake contributing to lower weight gain. Peptides
are known to affect lipid metabolism, probably through PPAR [171], and an up-
regulation of Ppara gene expression can explain the increase in mitochondrial fatty
acid oxidation we observed, accompanied by reduced plasma and liver TAG content
(Paper 3). The increase in fatty acid oxidation can also partly account for the weight
66
gain, as well as the reduced plasma and liver levels of TAG. Also, activity of the
glycerolipid synthesizing enzyme GPAT was decreased further contributing to lower
TAG levels (Paper 3). Enzymes involved in fatty acid synthesis like the rate-limiting
enzyme ACC and FAS decreased at all three doses, but only significant in the 20%
group (Paper 3). Gene expressions of the corresponding genes, Acaca and Fasn,
were also decreased, indicating a reduced fatty acid synthesis, which also could have
contributed to the lower levels of plasma and liver TAG (Paper 3). Gene expression
of the transcription factor Srebf1, involved in sterol biosynthesis, was significantly
lower in the 20% CP fed group probably contributing to the lipogenic-suppressing
effect of CP. However, gene expression of Srepf2, Hmgcs1 and Hmgcr, all involved
in cholesterol synthesis, was unaltered, thus the lower plasma and liver cholesterol
levels could be due to post-transcriptional mechanisms (Paper 3).
6.2.2 Elevated plasma level of bile acids after CP intervention
Plasma bile acids and gene expression of the bile transporting Abcb4 was
significantly increased, which may indicate increase transportation of bile,
accompanied by the possibility of cholesterol loss through increased bile excretion
(Paper 3). The present amount of the amino acids taurine and glycine were
substantial in the CP diet, and previously findings with taurine and glycine rich diets
fed to rats, have shown increased level of plasma bile acids and enhanced excretion
of bile acids through faeces [215].
There was a change in liver fatty acid composition, and increase in α-linoleic acid and
docosapentaenoic acid (DPA) levels were observed, whereas eicosapentaenoic acid
(EPA) decreased (Paper 3). However, DPA has shown bioactivity by influencing
endothelial cell migration, hence better wound-healing [264] and reducing FAS
activity [265]. We observed an increased level of LCFAs compared to SCFAs, which
can be a consequence of an unchanged peroxisomal oxidation of LCFA and a
preferential increased mitochondrial oxidation of SCFAs and MCFAs (Paper 3). The
tendency towards decreased content of MUFAs and decreased C16:1n7/16:0 ratio
could be related to decreased in gene expression of Scd1 (Paper 3).
67
6.2.3 Cellular toxicity could be reduced
Carnitine is directly involved in fatty acid metabolism by transporting fatty acid
across the two mitochondrial membranes, thus free carnitine, its precursor and
metabolites were measured. The three CP diets demonstrated a clear dose-response
effect of CP on all carnitine parameters measured (Paper 3). Free carnitine increased
significantly at all three doses. The precursor of carnitine, γ-butyrobetaine, was also
increased, as were short-, medium- and long-chained acylcarnitines suggesting
reduced cellular toxicity as acyl-CoA derivatives causes mitochondrial swelling and
cellular toxicity [266], thus increased carnitine levels could improve mitochondrial
capacity as potentially toxic fatty acyl-derivatives may be removed.
The increased β-oxidation and bile formation, and decreased lipogenesis could be
related to the amino acid composition of CP compared to casein. The 20% CP diet
was characterized by low ratios of methionine/glycine and lysine/arginine which have
been suggested to exert cholesterol-reducing [95, 104, 267] and TAG -lowering
effects [268]. Lower ratios of both methionine/glycine and lysine/arginine were also
detected in plasma of the 20% CP-fed rats (Paper 3). Although the content of some
amino acids in the CP diet were lower compared to the casein diet, we did not suspect
amino acid deficiency in CP-treated rats as amino acid deprived rats would have
shown hypercholesterolemia [269], fatty liver and hair loss [270]. In addition, alanine
transaminase (ALT) and aspartate aminotransferase (AST) was unchanged further
supporting a healthy liver. The mechanisms of action behind the possible capacity of
amino acids to influence cholesterol and TAG levels, is unknown and should be
further investigated in future studies.
6.2.4 CP showed no anti-atherosclerotic effect in apoE-/- mice
As elevated plasma levels of cholesterol and TAG are strongly linked to CVD-risk
factors and a water-soluble extract of chicken CP was shown to reduce plasma and
liver lipids, it was of particular interest to investigate the CP extract in the
atheroprone mice model, apoE-/- mice to see if CP could affect lipid metabolism
(Paper 4). In addition, we wanted to see if CP could attenuate atherosclerotic
68
development in accordance with the SPH-diet (Paper 2). Similar to our previous
study (Paper 3), CP exerted plasma TAG-lowering effect; however, the reduction
was relatively small, accompanied by a presumably increase in mitochondrial β-
oxidation as enzyme activity and gene expression of CPT2 was elevated (Paper 4).
The indication of increased mitochondrial fatty acid oxidation could be associated
with our observation of decreased RER after monitoring the mice in metabolic cages.
Also, the lower plasma TAG level could be related to RER as a decrease in RER is
linked to a higher energy contribution from fat. This is also in line with the lower
body weight despite a higher feed intake in CP-fed mice. Noteworthy, apoE-/- mice
are not suitable for studying body weight due to the knockout of a crucial gene
involved in TAG transportation. SPH treatment in apoE-/- mice displayed reduced
atherosclerotic plaque combined with a decreased systemic inflammatory state
(Paper 2). Unlike our previous results, we observed no effect on atherosclerotic
plaque development after CP-intervention in apoE-/- mice (Paper 4). This was further
supported by unaffected heart mRNA levels of the adhesion molecules Icam1 and
Vcam1, the antioxidant Nos2 and the chemoattractant protein, Mcp1, in addition to
unaltered plasma concentrations of proinflammatory cytokines. In our previous study
with CP, we detected plasma and liver cholesterol-reducing effects (Paper 3),
whereas CP administration had no effect on the cholesterol level in apoE-/- mice.
Although rats were fed a low-fat diet compared to high-fat diet-feeding in apoE-/-
mice, could have influenced our results, it is more likely the different rodent models.
Knockout of apoE results in accumulation of TAG-rich VLDL in plasma, however,
due to the extended residence time and a co-occurrence of lipolysis, plasma VLDLs
in apoE-/- could be TAG-deprived and result in a compensating increase of
cholesterol. In contrast to CP-fed Wistar rats, lipogenesis was unaffected in apoE-/-
mice after CP intervention. Further, there was no effect on plasma TAG levels after
SPH treatment in apoE-/- mice (Paper 2), although there was TAG-reducing effect of
SPH in wild type mice (Paper 1). Thus, it seem neither SPH nor CP were able to
influence plasma TAG levels in apoE-/- mice, probably due to the persistent disturbed
lipid metabolism in this mouse model.
69
Our studies suggest that CP have minor potential to offset the negative effect of apoE
knockout and does not have the ability to affect plaque development or reduce
circulating inflammatory markers compared to SPH in this mouse model.
Noteworthy, the hydrolyzing process of SPH was much more comprehensive than the
one producing the water-soluble protein extract of chicken. Protein hydrolysates are
assumed to have more potent health-promoting effects, which is attributed bioactive
peptides hidden within the protein structure. The hydrolyzing process makes these
peptides more accessible, increasing their bioavailability. Thus, it could be that CP
possesses lipid-lowering and anti-atherosclerotic effects if the extract were to be
hydrolyzed. Also, it could be that the knockout of apoE suppresses the effect of CP.
The small reduction in plasma TAG levels and unchanged cholesterol levels was not
sufficient to influence lesion development. Although, the TAG reduction was small,
this may further supporting our speculations from our previous study in apoE-/- mice;
that plaque development is independent of changes in plasma lipids and could be
more closely related to inflammation.
70
7. CONCLUSIONS
This thesis supports the assumption that various protein sources possess different
bioactive potential. In accordance with the aims of the thesis, the following
conclusions can be drawn:
Hydrolyzing methods using different enzymes influence the potential bioactivity of a
salmon protein source. Three different pre-digested fractions of SPH displayed
different effects on lipogenesis as well as liver and plasma TAG levels in male
C57BL/6 mice. The findings show that SPH can possess bioactive peptides with
diverse capability of affecting gene expression and activity of enzymes regulating
fatty acid metabolism, thus affecting plasma and liver lipid levels.
In female apoE-/- mice SPH displayed an ability to attenuate atherosclerosis by
reducing lesion area in the aortic sinus and arch. Systemic inflammation was reduced,
while the effects on fatty acid oxidation and plasma lipid levels were minor. This
indicates that systemic anti-inflammatory effects are crucial in attenuating
atherosclerosis.
CP revealed distinct dose-dependent effects on energy metabolism in male Wistar
rats by increased fatty acid catabolism, lower cholesterol levels and possible
increased excretion of bile. Although effects on weight gain complicate the
interpretation of these results, they could be attributed the distinct amino acid profile
of the CP.
CP showed a small effect on fatty acid oxidation in apoE-/- mice, but did not influence
systemic or local inflammation or plaque area. Thus, despite a lipid-lowering effect in
rats, CP seems to be less potent in counteracting disrupted lipid metabolism in apoE-/-
mice, and had no anti-inflammatory effect. This could explain why CP was not able
to affect atherosclerotic development.
71
Notably, the substantially less hydrolysis degree of the CP compared to SPH could
explain the different capacity of these protein sources and indicates the potential in
hydrolyzing proteins to liberate bioactive peptides.
In addition, it appears that plaque development is more related to inflammatory state
than changes in plasma lipid levels in the apoE-/- mouse model.
72
8. FUTURE PERSPECTIVES
These studies have provided insight into protein and protein hydrolysate effect on
lipid metabolism and inflammation. The difference in anti-atherogenic potential
between the 70% hydrolyzed SPH, in contrast to 30% hydrolysis in the CP, indicates
that a more extensive hydrolyzation of the CP should be considered in future
experiments.
Another atherosclerotic mice model for studying the effect of CP should be
considered.
Mitochondrial oxidative stress is strongly linked to atherosclerosis and based on our
studies it appears that inflammation has a prominent role on plaque development
compared to high plasma lipid levels. Thus markers and mediators of inflammation
both locally and in circulation should be further investigated. Oxidative stress in
mitochondria and inflammation in adipose tissue could be of interest.
After protein hydrolyzation, the peptide amino acid sequences should be determined,
to get a better survey of potential bioactive peptides. However, this is an expensive
process and should only be considered when identification and purification of
bioactive peptides is relevant.
73
9. REFERENCES 1. World Health Organization - Obesity and Overweight. 2013 [cited 2014 15th of March]; Available
from: http://www.who.int/mediacentre/factsheets/fs311/en/. 2. Grundy, S.M., Brewer, H.B., Jr., Cleeman, J.I., Smith, S.C., Jr., and Lenfant, C., Definition of
metabolic syndrome: report of the National Heart, Lung, and Blood Institute/American Heart Association conference on scientific issues related to definition. Arteriosclerosis, Thrombosis and Vascular Biology, 2004. 24(2): p. e13-18.
3. Blaha, M. and Elasy, T.A., Clinical Use of the Metabolic Syndrome: Why the Confusion? Clinical Diabetes, 2006. 24: p. 125-131.
4. Kostoglou-Athanassiou and P, A., Metabolic syndrome and sleep apnea. Hippokratia, 2008. 12: p. 81-86.
5. Kahn, R., Buse, J., Ferrannini, E., and Stern, M., The metabolic syndrome: time for a critical appraisal: joint statement from the American Diabetes Association and the European Association for the Study of Diabetes. Diabetes Care, 2005. 28(9): p. 2289-2304.
6. Carr, M.C. and Brunzell, J.D., Abdominal obesity and dyslipidemia in the metabolic syndrome: importance of type 2 diabetes and familial combined hyperlipidemia in coronary artery disease risk. Journal of Clinical Endocrinology and Metabolism, 2004. 89(6): p. 2601-2607.
7. Garcia-Lara, J.M., Aguilar-Navarro, S., Gutierrez-Robledo, L.M., and Avila-Funes, J.A., The metabolic syndrome, diabetes, and Alzheimer's disease. Revista de Investigación Clínica, 2010. 62(4): p. 343-349.
8. Razay, G., Vreugdenhil, A., and Wilcock, G., The metabolic syndrome and Alzheimer disease. Archives of Neurology, 2007. 64(1): p. 93-96.
9. Castro, J.P., El-Atat, F.A., McFarlane, S.I., Aneja, A., and Sowers, J.R., Cardiometabolic syndrome: pathophysiology and treatment. Current hypertension reports, 2003. 5(5): p. 393-401.
10. Vamecq, J., Dessein, A.F., Fontaine, M., Briand, G., Porchet, N., Latruffe, N., Andreolotti, P., and Cherkaoui-Malki, M., Mitochondrial dysfunction and lipid homeostasis. Current Drug Metabolism, 2012. 13(10): p. 1388-1400.
11. Johannsen, D.L. and Ravussin, E., The role of mitochondria in health and disease. Current Opinion in Pharmacology, 2009. 9(6): p. 780-786.
12. Bratic, I. and Trifunovic, A., Mitochondrial energy metabolism and ageing. Biochimica et Biophysica Acta, 2010. 1797(6-7): p. 961-967.
13. Liesa, M. and Shirihai, O.S., Mitochondrial dynamics in the regulation of nutrient utilization and energy expenditure. Cell Metabolism, 2013. 17(4): p. 491-506.
14. Kim, J.A., Wei, Y., and Sowers, J.R., Role of mitochondrial dysfunction in insulin resistance. Circulation Research, 2008. 102(4): p. 401-414.
15. Gutierrez, J., Ballinger, S.W., Darley-Usmar, V.M., and Landar, A., Free radicals, mitochondria, and oxidized lipids: the emerging role in signal transduction in vascular cells. Circulation Research, 2006. 99(9): p. 924-932.
16. Hojlund, K., Mogensen, M., Sahlin, K., and Beck-Nielsen, H., Mitochondrial dysfunction in type 2 diabetes and obesity. Endocrinology Metabolism Clinics of North America, 2008. 37(3): p. 713-731.
17. Madamanchi, N.R. and Runge, M.S., Mitochondrial dysfunction in atherosclerosis. Circulation Research, 2007. 100(4): p. 460-473.
18. Wilms, L., Larsen, J., Pedersen, P.L., and Kvetny, J., Evidence of mitochondrial dysfunction in obese adolescents. Acta Paediatrica, 2010. 99(6): p. 906-911.
19. Yu, E., Mercer, J., and Bennett, M., Mitochondria in vascular disease. Cardiovascular Research, 2012. 95(2): p. 173-182.
20. Valcárcel-Ares, M.N., Vaamonde-García, C., Riveiro-Naveira, R.R., Lema, B., Blanco, F.J., and López-Armada, M.J., A novel role for mitochondrial dysfunction in the inflammatory response of rheumatoid arthritis. Annals of the Rheumatic Disease, 2010. 69: p. A56.
21. Mercer, J.R., Cheng, K.-K., Figg, N., Gorenne, I., Mahmoudi, M., Griffin, J., Vidal-Pui, A., Logan, A., and P, M., DNA damage links mitochondrial dysfunction to atherosclerosis and the metabolic syndrome. Circulation Research, 2010. 107(8): p. 1021-1031.
22. Escames, G., Lopez, L.C., Garcia, J.A., Garcia-Corzo, L., Ortiz, F., and Acuna-Castroviejo, D., Mitochondrial DNA and inflammatory diseases. Human Genetics, 2012. 131(2): p. 161-173.
23. Racette, S.B., Deusinger, S.S., and Deusinger, R.H., Obesity: overview of prevalence, etiology, and treatment. Physical Therapy, 2003. 83(3): p. 276-288.
74
24. Trayhurn, P., Bing, C., and Wood, I.S., Adipose tissue and adipokines - energy regulation from the human perspective. Journal of Nutrition, 2006. 136(7 Suppl): p. 1935S-1939S.
25. Wisse, B.E., The inflammatory syndrome: the role of adipose tissue cytokines in metabolic disorders linked to obesity. Journal of the American Society of Nephrology, 2004. 15(11): p. 2792-2800.
26. Harwood, H.J., Jr., The adipocyte as an endocrine organ in the regulation of metabolic homeostasis. Neuropharmacology, 2012. 63(1): p. 57-75.
27. Hajer, G.R., van Haeften, T.W., and Visseren, F.L., Adipose tissue dysfunction in obesity, diabetes, and vascular diseases. European Heart Journal, 2008. 29(24): p. 2959-2971.
28. Kalupahana, N.S., Claycombe, K.J., and Moustaid-Moussa, N., (n-3) Fatty acids alleviate adipose tissue inflammation and insulin resistance: mechanistic insights. Advances in Nutrition, 2011. 2(4): p. 304-316.
29. Mowers, J., Uhm, M., Reilly, S.M., Simon, J., Leto, D., Chiang, S.H., Chang, L., and Saltiel, A.R., Inflammation produces catecholamine resistance in obesity via activation of PDE3B by the protein kinases IKK{varepsilon} and TBK1. Elife, 2013. 2: p. e01119.
30. Aguirre, V., Uchida, T., Yenush, L., Davis, R., and White, M.F., The c-Jun NH(2)-terminal kinase promotes insulin resistance during association with insulin receptor substrate-1 and phosphorylation of Ser(307). Journal of Biological Chemistry, 2000. 275(12): p. 9047-9054.
31. Engelman, J.A., Berg, A.H., Lewis, R.Y., Lisanti, M.P., and Scherer, P.E., Tumor necrosis factor alpha-mediated insulin resistance, but not dedifferentiation, is abrogated by MEK1/2 inhibitors in 3T3-L1 adipocytes. Molecular Endocrinology, 2000. 14(10): p. 1557-1569.
32. Liu, Y.F., Paz, K., Herschkovitz, A., Alt, A., Tennenbaum, T., Sampson, S.R., Ohba, M., Kuroki, T., LeRoith, D., and Zick, Y., Insulin stimulates PKCzeta -mediated phosphorylation of insulin receptor substrate-1 (IRS-1). A self-attenuated mechanism to negatively regulate the function of IRS proteins. Journal of Biological Chemistry, 2001. 276(17): p. 14459-14465.
33. Haruta, T., Uno, T., Kawahara, J., Takano, A., Egawa, K., Sharma, P.M., Olefsky, J.M., and Kobayashi, M., A rapamycin-sensitive pathway down-regulates insulin signaling via phosphorylation and proteasomal degradation of insulin receptor substrate-1. Molecular Endocrinology, 2000. 14(6): p. 783-794.
34. Aguirre, V., Werner, E.D., Giraud, J., Lee, Y.H., Shoelson, S.E., and White, M.F., Phosphorylation of Ser307 in insulin receptor substrate-1 blocks interactions with the insulin receptor and inhibits insulin action. Journal of Biological Chemistry, 2002. 277(2): p. 1531-1537.
35. De Fea, K. and Roth, R.A., Modulation of insulin receptor substrate-1 tyrosine phosphorylation and function by mitogen-activated protein kinase. Journal of Biological Chemistry, 1997. 272(50): p. 31400-31406.
36. Gao, Z., Hwang, D., Bataille, F., Lefevre, M., York, D., Quon, M.J., and Ye, J., Serine phosphorylation of insulin receptor substrate 1 by inhibitor kappa B kinase complex. Journal of Biological Chemistry, 2002. 277(50): p. 48115-48121.
37. Libby, P., Inflammation and cardiovascular disease mechanisms. American Journal of Clinical Nutrition, 2006. 83(2): p. 456S-460S.
38. Pearson, T.A., Mensah, G.A., Alexander, R.W., Anderson, J.L., III, R.O.C., Criqui, M., Fadl, Y.Y., Fortmann, S.P., Hong, Y., Myers, G.L., Rifai, N., Jr, S.C.S., Taubert, K., Tracy, R.P., and Vinicor, F., Markers of Inflammation and Cardiovascular Disease. Circulation, 2003. 107: p. 499-511.
39. Willerson, J.T. and Ridker, P.M., Inflammation as a Cardiovascular Risk Factor. Circulation, 2004. 109: p. II-2-II-10.
40. Endemann, D.H. and Schiffrin, E.L., Endothelial dysfunction. Journal of the American Society of Nephrology, 2004. 15(8): p. 1983-1992.
41. Abraham, D. and Distler, O., How does endothelial cell injury start? The role of endothelin in systemic sclerosis. Arthritits Research & Therapy, 2007. 9: p. S2.
42. Albelda, S., Smith, C., and Ward, P., Adhesion molecules and inflammatory injury. Journal of the Federation of American Societies for Experimental Biology, 1994. 8: p. 504-512.
43. Alexander, R.W., Theodore Cooper Memorial Lecture. Hypertension and the pathogenesis of atherosclerosis. Oxidative stress and the mediation of arterial inflammatory response: a new perspective. Hypertension, 1995. 25(2): p. 155-161.
44. McLenachan, J.M., Vita, J., Fish, D.R., Treasure, C.B., Cox, D.A., Ganz, P., and Selwyn, A.P., Early evidence of endothelial vasodilator dysfunction at coronary branch points. Circulation, 1990. 82(4): p. 1169-1173.
45. Petecchia, L., Sabatini, F., Usai, C., Caci, E., Varesio, L., and Rossi, G.A., Cytokines induce tight junction disassembly in airway cells via an EGFR-dependent MAPK/ERK1/2-pathway. Laboratory Investigation, 2012. 92: p. 1140–1148.
75
46. Dhaliwal, B.S. and Steinbrecher, U.P., Scavenger receptors and oxidized low density lipoproteins. Clinica Chimica Acta, 1999. 286(1-2): p. 191-205.
47. Trpkovic, A., Resanovic, I., Stanimirovic, J., Radak, D., Mousa, S.A., Cenic-Milosevic, D., Jevremovic, D., and Isenovic, E.R., Oxidized low-density lipoprotein as a biomarker of cardiovascular diseases. Critical reviews in clinical laboratory sciences, 2014: p. 1-16.
48. Johnson, J.L., Emerging regulators of vascular smooth muscle cell function in the development and progression of atherosclerosis. Cardiovasc Res, 2014. 103(4): p. 452-460.
49. Viles-Gonzalez, J.F., Fuster, V., and Badimon, J.J., Atherothrombosis: a widespread disease with unpredictable and life-threatening consequences. European Heart Journal, 2004. 25(14): p. 1197-1207.
50. Wildgruber, M., Swirski, F.K., and Zernecke, A., Molecular Imaging of Inflammation in Atherosclerosis. Theranostics, 2013. 3(11): p. 865-884.
51. van der Wal, A.C. and Becker, A.E., Atherosclerotic plaque rupture--pathologic basis of plaque stability and instability. Cardiovascular Research, 1999. 41(2): p. 334-344.
52. Schoenhagen, P., Ziada, K.M., Vince, D.G., Nissen, S.E., and Tuzcu, E.M., Arterial remodeling and coronary artery disease: the concept of “dilated” versus “obstructive” coronary atherosclerosi. Journal of the American College of Cardiology, 2001. 38(2).
53. Libby, P., Multiple mechanisms of thrombosis complicating atherosclerotic plaques. Clinical Cardiology, 2000. 23 Suppl 6: p. VI-3-7.
54. Rentrop, K.P., Thrombi in acute coronary syndromes : revisited and revised. Circulation, 2000. 101(13): p. 1619-1626.
55. Nishi, T., Hara, H., Asano, K., and Tomita, F., The soybean beta-conglycinin beta 51-63 fragment suppresses appetite by stimulating cholecystokinin release in rats. Journal of Nutrition, 2003. 133(8): p. 2537-2542.
56. Uhe, A.M., Collier, G.R., and O'Dea, K., A comparison of the effects of beef, chicken and fish protein on satiety and amino acid profiles in lean male subjects. Journal of Nutrition, 1992. 122(3): p. 467-472.
57. Anderson, G.H., Metabolic regulation of food intake. In: (Shils, M. E. & Young, V. R., eds.), ed. 7th. 1989, Philadelphia, PA.: Lea and Febiger.
58. Anderson, G.H. and Li, E.T., Protein and amino acids in the regulation of quantitative and qualitative aspects of food intake. International journal of obesity, 1987. 11 Suppl 3: p. 97-108.
59. Femstrom, J.D., Wurtman, R.J., Hammarstrom-Wiklund, B., Rand, W.M., Munro, N., and Davidson, C.S., Diurnal variations in plasma concentrations of tryptophan, tyrosine, and other neutral amino acids: effect of dietary protein intake. American Journal of Clinical Nutrition, 1979. 32: p. 1912-1922.
60. Gendall, K.A. and Joyce, P.R., Meal-induced changes in tryptophan:LNAA ratio: effects on craving and binge eating. Eating behaviors, 2000. 1(1): p. 53-62.
61. Jump, D.B., Fatty acid regulation of gene transcription. Critical reviews in clinical laboratory sciences, 2004. 41(1): p. 41-78.
62. Hulbert, A.J., Turner, N., Storlien, L.H., and Else, P.L., Dietary fats and membrane function: implications for metabolism and disease. Biological Reviews of the Cambridge Philosophical Society, 2005. 80(1): p. 155-169.
63. Jensen, M.D., Diet effects on fatty acid metabolism in lean and obese humans. American Journal of Clinical Nutrition, 1998. 67(3 Suppl): p. 531S-534S.
64. Jurgonski, A., Juskiewicz, J., and Zdunczyk, Z., A high-fat diet differentially affects the gut metabolism and blood lipids of rats depending on the type of dietary fat and carbohydrate. Nutrients, 2014. 6(2): p. 616-626.
65. Schwarz, J., Tome, D., Baars, A., Hooiveld, G.J., and Muller, M., Dietary protein affects gene expression and prevents lipid accumulation in the liver in mice. PLoS One, 2012. 7(10): p. e47303.
66. Tovar, A.R., Murguia, F., Cruz, C., Hernandez-Pando, R., Aguilar-Salinas, C.A., Pedraza-Chaverri, J., Correa-Rotter, R., and Torres, N., A soy protein diet alters hepatic lipid metabolism gene expression and reduces serum lipids and renal fibrogenic cytokines in rats with chronic nephrotic syndrome. Journal of Nutrition, 2002. 132(9): p. 2562-2569.
67. Bortolotti, M., Kreis, R., Debard, C., Cariou, B., Faeh, D., Chetiveaux, M., Ith, M., Vermathen, P., Stefanoni, N., Le, K.A., Schneiter, P., Krempf, M., Vidal, H., Boesch, C., and Tappy, L., High protein intake reduces intrahepatocellular lipid deposition in humans. American Journal of Clinical Nutrition, 2009. 90(4): p. 1002-1010.
68. Wiseman, H., O'Reilly, J.D., Adlercreutz, H., Mallet, A.I., Bowey, E.A., Rowland, I.R., and Sanders, T.A., Isoflavone phytoestrogens consumed in soy decrease F(2)-isoprostane concentrations and increase resistance of low-density lipoprotein to oxidation in humans. American Journal of Clinical Nutrition, 2000. 72(2): p. 395-400.
76
69. John W. Erdman Jr, Soy Protein and Cardiovascular Disease. Circulation, 2000. 102: p. 2555-2559. 70. Um, M.Y., Ahn, J., Jung, C.H., and Ha, T.Y., Cholesterol-lowering Effect of Rice Protein by
Enhancing Fecal Excretion of Lipids in Rats. Preventive Nutrition and Food Science, 2013. 18(3): p. 210-213.
71. Hunt, M.C., Tillander, V., and Alexson, S.E., Regulation of peroxisomal lipid metabolism: The role of acyl-CoA and coenzyme A metabolizing enzymes. Biochimie, 2014. 98C: p. 45-55.
72. Nagata, Y., Ishiwaki, N., and Sugano, M., Studies on the mechanism of the antihypercholesterolemic action of soy protein and soy protein-type amino acid mixtures in relation to their casein counterparts in rats. Journal of Nutrition, 1982. 112: p. 1614-1625.
73. Potter, S.M., Overview of proposed mechanisms for the hypocholesterolemic effect of soy. Journal of Nutrition, 1995. 125(3 Suppl): p. 606S-611S.
74. Bakhit, R.M., Klein, B.P., Essex-Sorlie, D., Ham, J.O., Erdman, J.W., Jr., and Potter, S.M., Intake of 25 g of soybean protein with or without soybean fiber alters plasma lipids in men with elevated cholesterol concentrations. Journal of Nutrition, 1994. 124(2): p. 213-222.
75. Fatma, Z.N., Bety Wahyu, H., and Waluyo, The effect of peptide (Asp – Glu) synthetic base on sterilized fermented soymilk on lipid profile of Sprague Dawley rats. International Food Research Journal, 2013. 20(6): p. 3047-3052.
76. Wergedahl, H., Liaset, B., Gudbrandsen, O.A., Lied, E., Espe, M., Muna, Z., Mork, S., and Berge, R.K., Fish protein hydrolysate reduces plasma total cholesterol, increases the proportion of HDL cholesterol, and lowers acyl-CoA:cholesterol acyltransferase activity in liver of Zucker rats. Journal of Nutrition, 2004. 134(6): p. 1320-1327.
77. Hosomi, R., Fukunaga, K., Arai, H., Kanda, S., Nishiyama, T., and Yoshida, M., Effect of Simultaneous Intake of Fish Protein and Fish Oil on Cholesterol Metabolism in Rats Fed High-Cholesterol Diets. Open Nutraceuticals Journal, 2011. 4: p. 12-19.
78. Kim, E.K., Lee, S.J., Jeon, B.T., Moon, S.H., Kim, B., Park, T.K., Han, J.S., and Park, P.J., Purification and characterisation of antioxidative peptides from enzymatic hydrolysates of venison protein. Food Chemistry, 2009. 114: p. 1365–1370.
79. Sakanaka, S. and Tachibana, Y., Active scavenging activity of egg-yolk protein hydrolysates and their effects on lipid oxidation in beef and tuna homogenates. Food Chemistry, 2006. 95: p. 243–249.
80. Cinq-Mars, C.D., Hu, C., Kitts, D.D., and Li-Chan, E.C.Y., Investigations into inhibitor type and mode, simulated gastrointestinal digestion, and cell transport of the angiotensin I-Converting enzyme-inhibitory peptides in pacific hake (Merluccius productus) fillet hydrolysate. Journal of Agricultural and Food Chemistry, 2008. 56: p. 410–419.
81. Raghavan, S. and Kristinsson, H.G., Antioxidant efficacy of alkali-treated tilapia protein hydrolysates: A comparison study of five enzymes. Journal of Agricultural and Food Chemistry, 2008. 56: p. 1434–1441.
82. Ahhmed, A.M. and Muguruma, M., A review of meat protein hydrolysates and hypertension. Meat science, 2010. 86(1): p. 110-118.
83. Shahidi, F. and Amarowicz, R., Antioxidant activity of protein hydrolysates from aquatic spe- cies. Journal of American Oil Chemists´ Society. Journal of the American Oil Chemists’ Society, 1996. 73: p. 1197–1199.
84. Manson, J.E., Gaziano, J.M., Jonas, M.A., and Hennekens, C.H., Antioxidants and cardiovascular disease: a review. Journal of the American College of Nutrition, 1993. 12(4): p. 426-432.
85. Lip, G.Y.H., Felmeden, D.C., Li-Saw-Hee, F.L., and Beevers, D.G., Hypertensive heart disease - A complex syndrome or a hypertensive ‘cardiomyopathy’? European Heart Journal, 2000. 21: p. 1653–1665.
86. Vercruysse, L., Van Camp, J., and Smagghe, G., ACE inhibitory peptides derived from enzymatic hydrolysates of animal muscle protein: a review. Journal of Agricultural and Food Chemistry, 2005. 53(21): p. 8106-8115.
87. Saiga, A., Iwai, K., Hayakawa, T., Takahata, Y., Kitamura, S., Nishimura, T., and Morimatsu, F., Angiotensin I-converting enzyme-inhibitory peptides obtained from chicken collagen hydrolysate. Journal of Agricultural and Food Chemistry, 2008. 56(20): p. 9586-9591.
88. Theodore, A.E. and Kristinsson, H.G., Angiotensin converting enzyme inhibition of fish protein hydrolysates prepared from alkaline-aided channel catfish protein isolate. Journal of the Science of Food and Agriculture, 2007. 87: p. 2353-2357.
89. Salze, G.P. and Davis, D.A., Taurine: a critical nutrient for future fish feeds. Aquaculture, 2015. 437: p. 215-229.
90. Rosa, F.T., Freitas, E.C., Deminice, R., Jordao, A.A., and Marchini, J.S., Oxidative stress and inflammation in obesity after taurine supplementation: a double-blind, placebo-controlled study. European journal of nutrition, 2014. 53(3): p. 823-830.
77
91. Merheb, M., Daher, R.T., Nasrallah, M., Sabra, R., Ziyadeh, F.N., and Barada, K., Taurine intestinal absorption and renal excretion test in diabetic patients: a pilot study. Diabetes Care, 2007. 30(10): p. 2652-2654.
92. Hansen, S.H., Andersen, M.L., Cornett, C., Gradinaru, R., and Grunnet, N., A role for taurine in mitochondrial function. Journal of biomedical science, 2010. 17 Suppl 1: p. S23.
93. Chen, W., Guo, J.X., and Chang, P., The effect of taurine on cholesterol metabolism. Molecular Nutrition & Food Research, 2012. 56(5): p. 681-690.
94. Murakami, S., Kondo, Y., Toda, Y., Kitajima, H., Kameo, K., Sakono, M., and Fukuda, N., Effect of taurine on cholesterol metabolism in hamsters: up-regulation of low density lipoprotein (LDL) receptor by taurine. Life sciences, 2002. 70(20): p. 2355-2366.
95. Gudbrandsen, O.A., Wergedahl, H., Liaset, B., Espe, M., and Berge, R.K., Dietary proteins with high isoflavone content or low methionine-glycine and lysine-arginine ratios are hypocholesterolaemic and lower the plasma homocysteine level in male Zucker fa/fa rats. British Journal of Nutrition, 2005. 94(3): p. 321-330.
96. Tome, D. and Bos, C., Lysine requirement through the human life cycle. Journal of Nutrition, 2007. 137(6 Suppl 2): p. 1642S-1645S.
97. Weigensberg, B.I., Stary, H.C., and McMillan, G.C., Effect of lysine deficiency on cholesterol atherosclerosis in rabbits. Experimental and Molecular Pathology, 1964. 90: p. 444-454.
98. Davies, K.J. and Delsignore, M.E., Protein damage and degradation by oxygen radicals. III. Modification of secondary and tertiary structure. Journal of Biological Chemistry, 1987. 262(20): p. 9908-9913.
99. Bach, A., Carnitine biosynthesis in mammals. Reproduction, Nutrition, Development, 1982. 22(4): p. 583-596.
100. Siasos, G., Tousoulis, D., Antoniades, C., Stefanadi, E., and Stefanadis, C., L-Arginine, the substrate for NO synthesis: an alternative treatment for premature atherosclerosis? International Journal of Cardiology, 2007. 116(3): p. 300-308.
101. Oda, H., Fukui, H., Hitomi, Y., and Yoshida, A., Alteration of Serum Lipoprotein Metabolism by Polychlorinated Biphenyls and Methionine in Rats Fed a Soybean Protein Diet. Journal of Nutrition, 1991. 121: p. 925-933.
102. Hadi, H.A., Carr, C.S., and Al Suwaidi, J., Endothelial dysfunction: cardiovascular risk factors, therapy, and outcome. Journal of Vascular Health and Risk Managment, 2005. 1(3): p. 183-198.
103. Zulli, A., Hare, D.L., Buxton, B.F., and Black, M.J., High dietary methionine plus cholesterol exacerbates atherosclerosis formation in the left main coronary artery of rabbits. Atherosclerosis, 2004. 176(1): p. 83-89.
104. Morita, T., Oh-hashi, A., Takei, K., Ikai, M., Kasaoka, S., and Kiriyama, S., Cholesterol-lowering effects of soybean, potato and rice proteins depend on their low methionine contents in rats fed a cholesterol-free purified diet. Journal of Nutrition, 1997. 127(3): p. 470-477.
105. Sugiyama K, Ohkawa S, and K., M., Relationship between amino acid composition of diet and plasma cholesterol level in growing rats fed a high cholesterol diet. Journal of Nutritional Science and Vitaminology (Tokyo), 1986. 32(4): p. 413-423.
106. Fukagawa, N.K., Protein and amino acid supplementation in older humans. Amino Acids, 2013. 44(6): p. 1493-1509.
107. Newton, A.C., Protein Kinase C: Structure, Function, and Regulation. Journal of Biological Chemistry, 1995. 270: p. 28495-28498.
108. Dircks, L. and Sul, H.S., Acyltransferases of de novo glycerophospholipid biosynthesis. Progress in Lipid Research, 1999. 38(5-6): p. 461-479.
109. Lehner, R. and Kuksis, A., Biosynthesis of triacylglycerols. Progress in Lipid Research, 1996. 35(2): p. 169-201.
110. Coleman, R.A. and Lee, D.P., Enzymes of triacylglycerol synthesis and their regulation. Progress in Lipid Research, 2004. 43(2): p. 134-176.
111. Gonzalez-Baró, M.R., Lewin, T.M., and Coleman, R.A., Regulation of Triglyceride Metabolism II. Function of mitochondrial GPAT1 in the regulation of triacylglycerol biosynthesis and insulin action. American Journal of Physiology - Gastrointestinal and Liver Physiology, 2007. 292(5): p. G1195-G1199.
112. Houten, S.M., Watanabe, M., and Auwerx, J., Endocrine functions of bile acids. EMBO Journal, 2006. 25(7): p. 1419-1425.
113. Kowal, R.C., Herz, J., Goldstein, J.L., Esser, V., and Brown, M.S., Low density lipoprotein receptor-related protein mediates uptake of cholesteryl esters derived from apoprotein E-enriched lipoproteins. Proceedings of the National Academy of Sciences of the United States of America, 1989. 86: p. 5810-5814.
78
114. Goldberg, I.J., Scheraldi, C.A., Yacoub, L.K., Saxena, U., and Bisgaier, C.L., Lipoprotein ApoC-II activation of lipoprotein lipase. Modulation by apolipoprotein A-IV. Journal of Biological Chemistry, 1990. 265(8): p. 4266-4272.
115. Cooper, A.D., Hepatic uptake of chylomicron remnants. Journal of Lipid Research, 1997. 38: p. 2173-2192.
116. Ginsberg, H.N., New Perspectives on Atherogenesis: Role of Abnormal Triglyceride-Rich Lipoprotein Metabolism. Circulation, 2002. 106: p. 2137-2142.
117. Kinnunen, P.K., Jackson, R.L., Smith, L.C., Gotto, A.M., Jr., and Sparrow, J.T., Activation of lipoprotein lipase by native and synthetic fragments of human plasma apolipoprotein C-II. Proceedings of the National Academy of Sciences of the United States of America, 1977. 74(11): p. 4848-4851.
118. Have, R.J., The formation of LDL: mechanisms and regulation. Journal of Lipid Research. 25: p. 1570-1576.
119. Segrest, J.P., Jones, M.K., De Loof, H., and Dashti, N., Structure of apolipoprotein B-100 in low density lipoproteins. Journal of Lipid Research, 2001. 42(9): p. 1346-1367.
120. Rader, D.J., Molecular regulation of HDL metabolism and function: implications for novel therapies. Journal of Clinical Investigation, 2006. 116(12): p. 3090-3100.
121. Fielding, C.J. and Fielding, P.E., Molecular physiology of reverse cholesterol transport. Journal of Lipid Research, 1995. 36: p. 211-228.
122. Holleboom, A.G., Kuivenhoven, J.A., Vergeer, M., Hovingh, G.K., Miert, J.N.v., Wareham, N.J., Kastelein, J.J.P., Khaw, K.-T., and Boekholdt, S.M., Plasma levels of lecithin:cholesterol acyltransferase and risk of future coronary artery disease in apparently healthy men and women: a prospective case-control analysis nested in the EPIC-Norfolk population study. Journal of Lipid Research, 2010. 51(2): p. 416-421.
123. Panda, T., Basak, T., Saraswathi, G., and Théodore, T., Kinetic Mechanisms of Cholesterol Synthesis: A Review. Industrial and Engineering Chemistry Research, 2011. 50: p. 12847-12864.
124. Liscum, L., Biochemsitry of Lipids, Lipoprotein and Membranes (4th edition). Cholesterol biosynthesis, ed. D.E. Vance and J.E. Vance. 2002: Elsevier Science B.V.
125. Olivier, L.M. and Krisans, S.K., Peroxisomal protein targeting and identification of peroxisomal targeting signals in cholesterol biosynthetic enzymes. Biochimica et Biophysica Acta, 2000. 1529(1-3): p. 89-102.
126. Crockett, E.L., Cholesterol Function in Plasma Membranes from Ectotherms: Membrane-Specific Roles in Adaptation to Temperature. Integrative & Comparative Biology, 1998. 38(2): p. 291-304.
127. Hu, J., Zhang, Z., Shen, W.J., and Azhar, S., Cellular cholesterol delivery, intracellular processing and utilization for biosynthesis of steroid hormones. Nutrition & Metabolism (Lond), 2010. 7: p. 47.
128. Mast, N., Graham, S.E., Andersson, U., Bjorkhem, I., Hill, C., Peterson, J., and Pikuleva, I.A., Cholesterol binding to cytochrome P450 7A1, a key enzyme in bile acid biosynthesis. Biochemistry, 2005. 44(9): p. 3259-3271.
129. Russell, D.W., The enzymes, regulation, and genetics of bile acid synthesis. Annual Review of Biochemistry, 2003. 72: p. 137-174.
130. Bellentani, S., Pecorari, M., Cordoma, P., Marchegiano, P., Manenti, F., Bosisio, E., Fabiani, E.D., and Galli, G., Taurine increases bile acid pool size and reduces bile saturation index in the hamster. Journal of Lipid Research, 1987. 28: p. 1021-1027.
131. Mathur, F.J.F.a.S.N., Regulation of acyl CoA:cholesterol acyltransferase by 25-hydroxycholesteroI in rabbit intestinal microsomes and absorptive cells. Journal of Lipid Research, 1983. 24: p. 1049-1059.
132. Zerbin, J. Metabolic cholestatic pruritus. 2013 [cited 2014 5th of April]. 133. Jonckheere, A.I., Smeitink, J.A.M., and Rodenburg, R.J.T., Mitochondrial ATP synthase: architecture,
function and pathology. Journal of Inherited Metabolic Disease, 2012. 35(2): p. 211-225. 134. Wanders, R.J.A., Ruiter, J.P.N., IJlst, L., Waterham, H.R., and Houten, S.M., The enzymology of
mitochondrial fatty acid beta-oxidation and its application to follow-up analysis of positive neonatal screening results. Journal of Inherited Metabolic Disease 2010. 33(5): p. 479-494.
135. Flanagan, J.L., Simmons, P.A., Vehige, J., Willcox, M.D.P., and Garrett, Q., Role of carnitine in disease. Nutrition & Metabolism, 2010. 7: p. 30.
136. Houten, S.M. and Wanders, R.J.A., A general introduction to the biochemistry of mitochondrial fatty acid β-oxidation. Journal of Inherited Metabolic Disease, 2010. 33(5): p. 469-477.
137. Nelson, D.L. and Cox, M.M., Lehninger Priciples of biochemistry 4th edition. 2005: W.H. Freeman and Company, New York.
138. BioCarta. Comparison of Beta oxidation in mitochondria and peroxisomes and glyoxysomes. 2001 [cited 2014 10th of March]; Available from: http://www.biocarta.com/pathfiles/boxnpPathway.asp.
79
139. Manninen, A.H., Metabolic Effects of the Very-Low-Carbohydrate Diets: Misunderstood "Villains" of Human Metabolism. Journal of the International Society of Sports Nutrition, 2004. 1: p. 7-11.
140. Reddy, J.K. and Hashimoto, T., Peroxisomal beta-oxidation and peroxisome proliferator-activated receptor alpha: an adaptive metabolic system. Annual Review of Nutrition, 2001. 21: p. 193-230.
141. Reddy, J.K. and Hashimoto, T., Peroxisomal β-oxidation and peroxisiome proliferator-activated receptor α: An Adaptive Metabolic System. Annual Review of Nutrition. 21: p. 193-230.
142. Antonenkov, V.D. and Hiltunen, J.K., Transfer of metabolites across the peroxisomal membrane. Biochimica et Biophysica Acta, 2012. 1822(9): p. 1374-1386.
143. Poirier, Y., Antonenkov, V.D., Glumoff, T., and Hiltunen, J.K., Peroxisomal beta-oxidation - a metabolic pathway with multiple functions. Biochimica et Biophysica Acta, 2006. 1763(12): p. 1413-1426.
144. Vlaemincka, B., Fieveza, V., Cabritab, A.R.J., Fonsecac, A.J.M., and Dewhurstd, R.J., Factors affecting odd- and branched-chain fatty acids in milk: A review. Animal Feed Science and Technology, 2006. 131(3-4): p. 389-417.
145. Fatty acid synthesis. [cited 2014 7th of May]; Available from: http://ansci.illinois.edu/static/ansc438/Milkcompsynth/milksynth_fatfasynthesis.html.
146. Cinti, D.L., Cook, L., Nagi, M.N., and Suneja, S.K., The fatty acid chain elongation system of mammalian endoplasmic reticulum. Progress in Lipid Research, 1992. 31(1): p. 1-51.
147. Seubert, W. and Podack, E.R., Mechanisms and physiological roles of fatty acid chain elongation in microsomes and mitochondria. Molecular and Cellular Biochemistry, 1973. 1(1): p. 29-40.
148. Liu, X., Strable, M.S., and Ntambi, J.M., Stearoyl CoA desaturase 1: role in cellular inflammation and stress. Advances in Nutrition, 2011. 2(1): p. 15-22.
149. Nakamura, M.T. and Nara, T.Y., Structure, function, and dietary regulation of delta6, delta5, and delta9 desaturases. Annual Review of Nutrition, 2004. 24: p. 345-376.
150. Miyazaki, M., Kim, H.-J., Man, W.C., and Ntambi, J.M., Oleoyl-CoA Is the Major de Novo Product of Stearoyl-CoA Desaturase 1 Gene Isoform and Substrate for the Biosynthesis of the Harderian Gland 1-Alkyl-2,3-diacylglycerol. Journal of Biological Chemistry, 2001. 276: p. 39455-39461.
151. Maceyka, M. and Machamer, C.E., Ceramide accumulation uncovers a cycling pathway for the cis-Golgi network marker, infectious bronchitis virus M protein. The Journal of cell biology, 1997. 139(6): p. 1411-1418.
152. Cowart, L.A., Sphingolipids and Metabolic Disease. Vol. 721. New York, NY: Springer Science+Business Media , LLC, Landes Bioscience.
153. Johnson A, A.B. and Lewis, J. Molecular Biology of the cell. 4th edition. 2002 [cited 2015 12th of April]; Available from: http://www.ncbi.nlm.nih.gov/books/NBK26830/.
154. Wernerman, J., von der Decken, A., and Vinnars, E., Protein synthesis in skeletal muscle in relation to nitrogen balance after abdominal surgery: the effect of total parenteral nutrition. Journal of Parenteral Enteral Nutrition, 1986. 10(6): p. 578-582.
155. Cahill, G.F., Jr. and Owen, O.E., Starvation and survival. Transactions of the American Clinical and Climatological Association, 1968. 79: p. 13-20.
156. Rittig, N., Bach, E., Thomsen, H.H., Johannsen, M., Jørgensen, J.O., Richelsen, B., Jessen, N., and Møller, N., Amino acid supplementation is anabolic during the acute phase of endotoxin-induced inflammation: A human randomized crossover trial. Clinical Nutrition, 2015. In Press, Corrected Proof.
157. Butterworth, R.F., Pathophysiology of brain dysfunction in hyperammonemic syndromes: The many faces of glutamine. Molecular Genetics and Metabolism, 2014. 113(1-2): p. 113-117.
158. Silk, D.B.A., Grimble, G.K., and Rees, R.G., Protein digestion and amino acid and peptide absorption Proceedings of the Nutrition Society, 1985. 44: p. 63-72.
159. Lyons, P.J. and Fricker, L.D., Carboxypeptidase O Is a Glycosylphosphatidylinositol-anchored Intestinal Peptidase with Acidic Amino Acid Specificity. Journal of Biological Chemistry, 2011. 286(45): p. 39023–39032.
160. Adibi, S.A. and Morse, E.L., Intestinal transport of dipeptides in man: relative importance of hydrolysis and intact absorption. Journal of Clinical Investigation, 1971. 50(11): p. 2266–2275.
161. Shanbhag, V.M. and Martell, A.E., Oxidative deamination of amino acids by molecular oxygen with pyridoxal derivatives and metal ions as catalysts. Journal of the American Chemical Society, 1991. 113(17): p. 6479–6487.
162. Owen, O.E., Ketone Bodies as a Fuel for the Brain during Starvation. The International Union of Biochemistry and Molecular Biology, 2005. 33: p. 246-251.
163. Sierra-Santoyo, A., López, M.L., Henrnández, T., and Mendoza-Figueroa, T., Urea production in long-term cultures of adult rat hepatocytes. Toxicology in Vitro, 1994. 8(2): p. 293-299.
80
164. T., S.R., Adaptive characteristics of urea cycle enzymes in the rat. Journal of Biological Chemistry, 1962. 237: p. 459-468.
165. Kim, E.K., Lee, S.J., Jeon, B.T., Moon, S.H., Kim, B., Park, T.K., Han, J.S., and Park, P.J., Purification and characterisation of antioxidative peptides from enzymatic hydrolysates of venison protein. Food Chemistry, 2009. 114: p. 1365–1370.
166. Matsui, T., Matsumoto, K., Mahmud, T.H.K., and Arjumand, A., Antihypertensive peptides from natural resources Advances in Phytomedicine. Vol. 2. 2006, UK: Elsevier; Oxford,.
167. Ryan, J.T., Ross, P.R., Bolton, D., Fitzgerald, G.F., and Stanton, C., Bioactive Peptides from Muscle Sources: Meat and Fish. Nutrients, 2011. 3(9): p. 765-791.
168. S. Ono, M. Hosokawa, K. Miyashita, and Takahashi, K., Isolation of Peptides with Angiotensin I–converting Enzyme Inhibitory Effect Derived from Hydrolysate of Upstream Chum Salmon Muscle. Journal of food science, 2003. 68(5): p. 1611-1614.
169. Samaranayaka, A.G., Kitts, D.D., and Li-Chan, E.C., Antioxidative and angiotensin-I-converting enzyme inhibitory potential of a Pacific Hake ( Merluccius productus ) fish protein hydrolysate subjected to simulated gastrointestinal digestion and Caco-2 cell permeation. Journal of Agricultural and Food Chemistry, 2010. 58(3): p. 1535-1542.
170. Valenzuela, A., Sanhueza, J., and Nieto, S., Natural antioxidants in functional foods: From food safety to health benefits. . Grasas Aceites, 2003. 54: p. 295-303.
171. Contreras, A., Rangel, C., Ortiz, V., Aleman, G., Palacios-Gonzalez, B., Tejero, E., Torres, N., and Tovar, A., Dietary protein regulates gene expression of amino acid-degrading enzymes through PPARα. The Journal of the Federation of American Societies for Experimental Biology, 2013. 27: p. 631.
172. Sheikh, K., Camejo, G., Lanne, B., Halvarsso, T., Landergren, M.R., and Oakes, N.D., Beyond lipids, pharmacological PPARα activation has important effects on amino acid metabolism as studied in the rat. American Journal of Physiology - Endocrinology and Metabolism 2007. 292(4): p. E1157-E1165
173. Kersten, S., Mandard, S., Escher, P., Gonzalez, F.J., Tafuri, S., Desvergne, B., and Wahli, W., The peroxisome proliferator-activated receptor alpha regulates amino acid metabolism. Federation of American Societies for Experimental Biology Journal, 2001. 15(11): p. 1971-1978.
174. Krey, G., Braissant, O., L'Horset, F., Kalkhoven, E., Perroud, M., Parker, M.G., and Wahli, W., Fatty acids, eicosanoids, and hypolipidemic agents identified as ligands of peroxisome proliferator-activated receptors by coactivator-dependent receptor ligand assay. Molecular Endocrinology, 1997. 11(6): p. 779-791.
175. Matsuda, S. and Kitagishi, Y., Peroxisome proliferator-activated receptor and vitamin d receptor signaling pathways in cancer cells. Cancers (Basel), 2013. 5(4): p. 1261-1270.
176. Temple, K.A., Cohen, R.N., Wondisford, S.R., Yu, C., Deplewski, D., and Wondisford, F.E., An intact DNA-binding domain is not required for peroxisome proliferator-activated receptor gamma (PPARgamma) binding and activation on some PPAR response elements. Journal of Biological Chemistry, 2005. 280(5): p. 3529-3540.
177. Pruimboom-Brees, I., Haghpassand, M., Royer, L., Brees, D., Aldinger, C., Reagan, W., Singh, J., Kerlin, R., Kane, C., Bagley, S., Hayward, C., Loy, J., O'Brien, P., and Francone, O.L., A critical role for peroxisomal proliferator-activated receptor-alpha nuclear receptors in the development of cardiomyocyte degeneration and necrosis. American Journal of Pathology, 2006. 169(3): p. 750-760.
178. Plutzky, J., The PPAR-RXR transcriptional complex in the vasculature: energy in the balance. Circulation Research, 2011. 108(8): p. 1002-1016.
179. Larsen, T.M., Toubro, S., and Astrup, A., PPARgamma agonists in the treatment of type II diabetes: is increased fatness commensurate with long-term efficacy? International Journal of Obesity Related Metabolic Disorders, 2003. 27(2): p. 147-161.
180. Auboeuf, D., Rieusset, J., Fajas, L., Vallier, P., Frering, V., Riou, J.P., Staels, B., Auwerx, J., Laville, M., and Vidal, H., Tissue distribution and quantification of the expression of mRNAs of peroxisome proliferator-activated receptors and liver X receptor-alpha in humans: no alteration in adipose tissue of obese and NIDDM patients. Diabetes, 1997. 46(8): p. 1319-1327.
181. Staels, B. and Fruchart, J.-C., Therapeutic Roles of Peroxisome Proliferator–Activated Receptor Agonists. American Diabetes Association, 2005. 51: p. 2460-2470.
182. Vosper, H., Patel, L., Graham, T.L., Khoudoli, G.A., Hill, A., Macphee, C.H., Pinto, I., Smith, S.A., Suckling, K.E., Wolf, C.R., and Palmer, C.N.A., The Peroxisome Proliferator-activated Receptor δ Promotes Lipid Accumulation in Human Macrophages. Journal of Biological Chemistry, 2001. 276: p. 44258-44265.
183. Lalloyer, F. and Staels, B., Fibrates, glitazones, and peroxisome proliferator-activated receptors. Arteriosclerosis, Thrombosis and Vascular Biology, 2010. 30(5): p. 894-899.
81
184. Chan, D.C., Watts, G.F., Ooi, E.M., Ji, J., Johnson, A.G., and Barrett, P.H., Atorvastatin and fenofibrate have comparable effects on VLDL-apolipoprotein C-III kinetics in men with the metabolic syndrome. Arteriosclerosis, Thrombosis and Vascular Biology, 2008. 28(10): p. 1831-1837.
185. Berthou, L., Duverger, N., Emmanuel, F., Langouet, S., Auwerx, J., Guillouzo, A., Fruchart, J.C., Rubin, E., Denefle, P., Staels, B., and Branellec, D., Opposite regulation of human versus mouse apolipoprotein A-I by fibrates in human apolipoprotein A-I transgenic mice. Journal of Clinical Investigation, 1996. 97(11): p. 2408-2416.
186. Hossain, M.A., Tsujita, M., Gonzalez, F.J., and Yokoyama, S., Effects of fibrate drugs on expression of ABCA1 and HDL biogenesis in hepatocytes. Journal of Cardiovascular Pharmacology, 2008. 51(3): p. 258-266.
187. Finck, B.N., The PPAR regulatory system in cardiac physiology and disease. Cardiovascular Research, 2006. 73: p. 269-277.
188. Lee, M.Y., Choi, R., Kim, H.M., Cho, E.J., Kim, B.H., Choi, Y.S., Naowaboot, J., Lee, E.Y., Yang, Y.C., Shin, J.Y., Shin, Y.G., and Chung, C.H., Peroxisome proliferator-activated receptor delta agonist attenuates hepatic steatosis by anti-inflammatory mechanism. Experimental & Molecular Medicine, 2012. 44(10): p. 578-585.
189. Alemán, G., Ortiz, V., Contreras, A.V., Quiroz, G., Ordaz-Nava, G., Langley, E., Torres, N., and Tovar, A.R., Hepatic amino acid-degrading enzyme expression is downregulated by natural and synthetic ligands of PPARα in rats. Journal of Nutrition, 2013. 143(8): p. 1211-1218.
190. Amemiya-Kudo, M., Shimano, H., Hasty, A.H., Yahagi, N., Yoshikawa, T., Matsuzaka, T., Okazaki, H., Tamura, Y., Iizuka, Y., Ohashi, K., Osuga, J., Harada, K., Gotoda, T., Sato, R., Kimura, S., Ishibashi, S., and Yamada, N., Transcriptional activities of nuclear SREBP-1a, -1c, and -2 to different target promoters of lipogenic and cholesterogenic genes. Journal of Lipid Research, 2002. 43(8): p. 1220-1235.
191. Horton, J.D., Goldstein, J.L., and Brown, M.S., SREBPs: activators of the complete program of cholesterol and fatty acid synthesis in the liver. Journal of Clinical Investigation, 2002. 109(9): p. 1125-1131.
192. Sakai, J., Nohturfft, A., Cheng, D., Ho, Y.K., Brown, M.S., and Goldstein, J.L., Identification of complexes between the COOH-terminal domains of sterol regulatory element-binding proteins (SREBPs) and SREBP cleavage-activating protein. Journal of Biological Chemistry, 1997. 272(32): p. 20213-20221.
193. Eberle, D., Hegarty, B., Bossard, P., Ferre, P., and Foufelle, F., SREBP transcription factors: master regulators of lipid homeostasis. Biochimie, 2004. 86(11): p. 839-848.
194. Sakai, J., Duncan, E.A., Rawson, R.B., Hua, X., Brown, M.S., and Goldstein, J.L., Sterol-regulated release of SREBP-2 from cell membranes requires two sequential cleavages, one within a transmembrane segment. Cell, 1996. 85(7): p. 1037-1046.
195. Wang, X., Sato, R., Brown, M.S., Hua, X., and Goldstein, J.L., SREBP-1, a membrane-bound transcription factor released by sterol-regulated proteolysis. Cell, 1994. 77(1): p. 53-62.
196. Shimano, H., Sterol regulatory element-binding proteins (SREBPs): transcriptional regulators of lipid synthetic genes. Progress in Lipid Research, 2001. 40(6): p. 439-452.
197. Foufelle, F. and Ferre, P., New perspectives in the regulation of hepatic glycolytic and lipogenic genes by insulin and glucose: a role for the transcription factor sterol regulatory element binding protein-1c. The Biochemical journal, 2002. 366(Pt 2): p. 377-391.
198. Ascencio, C., Torres, N., Isoard-Acosta, F., Gomez-Perez, F.J., Hernandez-Pando, R., and Tovar, A.R., Soy protein affects serum insulin and hepatic SREBP-1 mRNA and reduces fatty liver in rats. Journal of Nutrition, 2004. 134(3): p. 522-529.
199. Tovar, A.R., Ascencio, C., and Torres, N., Soy protein, casein, and zein regulate histidase gene expression by modulating serum glucagon. American journal of physiology. Endocrinology and metabolism, 2002. 283(5): p. E1016-1022.
200. Torres, N., Torre-Villalvazo, I., and Tovar, A.R., Regulation of lipid metabolism by soy protein and its implication in diseases mediated by lipid disorders. The Journal of nutritional biochemistry, 2006. 17(6): p. 365-373.
201. Carroll, K.K., Review of clinical studies on cholesterol-lowering response to soy protein. Journal of the American Dietetic Association, 1991. 91(7): p. 820-827.
202. Lin, Y., Meijer, G.W., Vermeer, M.A., and Trautwein, E.A., Soy protein enhances the cholesterol-lowering effect of plant sterol esters in cholesterol-fed hamsters. Journal of Nutrition, 2004. 134(1): p. 143-148.
203. Moriyama, T., Kishimoto, K., Nagai, K., Urade, R., Ogawa, T., Utsumi, S., Maruyama, N., and Maebuchi, M., Soybean beta-conglycinin diet suppresses serum triglyceride levels in normal and genetically obese mice by induction of beta-oxidation, downregulation of fatty acid synthase, and
82
inhibition of triglyceride absorption. Bioscience, biotechnology, and biochemistry, 2004. 68(2): p. 352-359.
204. Wang, Y., Jones, P.J., Ausman, L.M., and Lichtenstein, A.H., Soy protein reduces triglyceride levels and triglyceride fatty acid fractional synthesis rate in hypercholesterolemic subjects. Atherosclerosis, 2004. 173(2): p. 269-275.
205. Lovati, M.R., Manzoni, C., Gianazza, E., Arnoldi, A., Kurowska, E., Carroll, K.K., and Sirtori, C.R., Soy protein peptides regulate cholesterol homeostasis in Hep G2 cells. Journal of Nutrition, 2000. 130(10): p. 2543-2549.
206. Johnson, M., Laboratory mice and rats. The world of laboratory, 2012. 2: p. 113. 207. Clause, B.T., The Wistar rat as a right choice: Establishing Mammalian Standards and the Ideal of a
Standardized Mammal. Journal of the History of Biology, 1993. 26: p. 329-349. 208. Mekada, K., Abe, K., Murakami, A., Nakamura, S., Nakata, H., Moriwaki, K., Obata, Y., and Yoshiki,
A., Genetic differences among C57BL/6 substrains. Experimental Animals, 2009. 58(2): p. 141-149. 209. Engber, D. The Trouble with black-6. 2011 [cited 2014 10th of April]; Available from:
http://www.slate.com/articles/health_and_science/the_mouse_trap/2011/11/black_6_lab_mice_and_the_history_of_biomedical_research.html.
210. Jawien, J. Mouse Models of Experimental Atherosclerosis as a Tool for Checking a Putative Anti-Atherogenic Action of Drugs. 2012 [cited 2014 10th of April]; Available from: http://cdn.intechopen.com/pdfs-wm/25897.pdf.
211. Laboratory, T.J. B6.129P2-Apoetm1Unc/J. 2006 [cited 2014 10th of April]; Available from: http://jaxmice.jax.org/strain/002052.html.
212. Taconic. Apoe (ApoE) - Model APOE Constitutive Knock Out. [cited 2014 10th of April]; Available from: http://www.taconic.com/apoe.
213. Veniant, M.M., Withycombe, S., and Young, S.G., Lipoprotein size and atherosclerosis susceptibility in Apoe(-/-) and Ldlr(-/-) mice. Arteriosclerosis, Thrombosis and Vascular Biology, 2001. 21(10): p. 1567-1570.
214. Halpin, H.A., Morales-Suárez-Varela, M.M., and Martin-Moreno, J.M., Chronic Disease Prevention and the New Public Health. Public Health Reviews, 2010. 32: p. 120-154.
215. Liaset, B., Madsen, L., Hao, Q., Criales, G., Mellgren, G., Marschall, H.U., Hallenborg, P., Espe, M., Froyland, L., and Kristiansen, K., Fish protein hydrolysate elevates plasma bile acids and reduces visceral adipose tissue mass in rats. Biochimica et Biophysica Acta, 2009. 1791(4): p. 254-262.
216. Zhu, C.F., Li, G.Z., Peng, H.B., Zhang, F., Chen, Y., and Li, Y., Treatment with marine collagen peptides modulates glucose and lipid metabolism in Chinese patients with type 2 diabetes mellitus. Applied Physiology, Nutrition and Metabolism, 2010. 35(6): p. 797-804.
217. Klompong, V., Benjakul, S., Kantachote, D., and Shahidi, F., Antioxidative activity and functional properties of protein hydrolysate of yellow stripe trevally (Selaroides leptolepis) as influenced by the degree of hydrolysis and enzyme type. Food Chemistry, 2007. 102(1317-1327).
218. Cho, J. and Kim, Y., Sharks: a potential source of antiangiogenic factors and tumor treatments. Marine Biotechnology (NY), 2002. 4(6): p. 521-525.
219. Kristinsson, H.G. and Rasco, B.A., Fish protein hydrolysates: production, biochemical, and functional properties. Critical Reviews in Food Science and Nutrition, 2000. 40(1): p. 43-81.
220. Mullally, M.M., O’Callaghan, D.M., FitzGerald, R.J., Donnelly, W.J., and Dalton, J.P., Proteolytic and peptidolytic activities in commercial pancreatin protease preparations and their relationship to some whey protein hydrolysate characteristics. Journal of Agricultural and Food Chemistry, 1994. 42: p. 2973.
221. O'Dea, K., Marked improvement in carbohydrate and lipid metabolism in diabetic Australian aborigines after temporary reversion to traditional lifestyle. Diabetes, 1984. 33(6): p. 596-603.
222. Wolfe, B.M. and Giovannetti, P.M., Short-term effects of substituting protein for carbohydrate in the diets of moderately hypercholesterolemic human subjects. Metabolism, 1991. 40(4): p. 338-343.
223. Wolfe, B.M. and Piche, L.A., Replacement of carbohydrate by protein in a conventional-fat diet reduces cholesterol and triglyceride concentrations in healthy normolipidemic subjects. Clinical & Investigative Medicine, 1999. 22(4): p. 140-148.
224. Crovetti, R., Porrini, M., Santangelo, A., and Testolin, G., The influence of thermic effect of food on satiety. European Journal of Clinical Nutrition, 1998. 52(7): p. 482-488.
225. Johnston, C.S., Day, C.S., and Swan, P.D., Postprandial thermogenesis is increased 100% on a high-protein, low-fat diet versus a high-carbohydrate, low-fat diet in healthy, young women. Journal of the American College of Nutrition, 2002. 21(1): p. 55-61.
226. Stubbs, R.J., Nutrition Society Medal Lecture. Appetite, feeding behaviour and energy balance in human subjects. Proceedings of the Nutrition Society, 1998. 57(3): p. 341-356.
83
227. Cordain, L., Eaton, S.B., Miller, J.B., Mann, N., and Hill, K., The paradoxical nature of hunter-gatherer diets: meat-based, yet non-atherogenic. European Journal of Clinical Nutrition, 2002. 56 Suppl 1: p. S42-52.
228. Skov, A.R., Toubro, S., Ronn, B., Holm, L., and Astrup, A., Randomized trial on protein vs carbohydrate in ad libitum fat reduced diet for the treatment of obesity. International Journal of Obesity Relatated Metabolic Disorders, 1999. 23(5): p. 528-536.
229. Bjørndal, B., Berge, C., Ramsvik, M.S., Svardal, A., Bohov, P., Skorve, J., and Berge, R.K., A fish protein hydrolysate alters fatty acid composition in liver and adipose tissue and increases plasma carnitine levels in a mouse model of chronic inflammation. Lipids in Health and Disease, 2013. 12: p. 143.
230. Harris, W.S., n-3 fatty acids and lipoproteins: comparison of results from human and animal studies. Lipids, 1996. 3: p. 243-252.
231. Shukla, A., Bettzieche, A., Hirche, F., Brandsch, C., Stangl, G.I., and Eder, K., Dietary fish protein alters blood lipid concentrations and hepatic genes involved in cholesterol homeostasis in the rat model. British Journal of Nutrition, 2006. 96: p. 674- 682.
232. Hosomi, R., Fukunaga, K., Arai, H., Nishiyama, T., and Yoshida, M., Effects of dietary fish protein on serum and liver lipid concentrations in rats and the expression of hepatic genes involved in lipid metabolism. Journal of Agricultural and Food Chemistry, 2009. 57: p. 9256-9262.
233. Zhang, X. and Beynen, A.C., Influence of dietary fish proteins on plasma and liver cholesterol concentrations in rats. British Journal of Nutrition, 1993. 69: p. 767-777.
234. Bergeron, N. and Jacques, H., Influence of fish protein as compared to casein and soy protein on serum and liver lipids, and serum lipoprotein cholesterol levels in the rabbit. Atherosclerosis, 1989. 78(2-3): p. 113-121.
235. Wakutsu, M., Tsunoda, N., Shiba, S., Muraki, E., and Kasono, K., Peroxisome proliferator-activated receptors (PPARs)-independent functions of fish oil on glucose and lipid metabolism in diet-induced obese mice. Lipids in Health and Disease, 2010. 9: p. 101.
236. Kim, H.J., Takahashi, M., and Ezaki, O., Fish oil feeding decreases mature sterol regulatory element-binding protein 1 (SREBP-1) by down-regulation of SREBP-1c mRNA in mouse liver. A possible mechanism for down-regulation of lipogenic enzyme mRNAs. Journal of Biological Chemistry, 1999. 274(36): p. 25892-25898.
237. Clarke, S.D. and Jump, D.B., Dietary polyunsaturated fatty acid regulation of gene transcription. Annual Review of Nutrition, 1994. 14: p. 83-98.
238. Pégorier, J.P., Regulation of gene expression by fatty acids. Current Opinion in Clinical Nutrition and Metababolic Care, 1998. 1: p. 329-334.
239. Hosomi, R., Fukunaga, K., Arai, H., Kanda, S., Nishiyama, T., and Yoshida, M., Fish protein decreases serum cholesterol in rats by inhibition of cholesterol and bile acid absorption. Journal of Food Science, 2011. 76(4): p. H116-121.
240. Pilon, G., Ruzzin, J., Rioux, L.E., Lavigne, C., White, P.J., Froyland, L., Jacques, H., Bryl, P., Beaulieu, L., and Marette, A., Differential effects of various fish proteins in altering body weight, adiposity, inflammatory status, and insulin sensitivity in high-fat-fed rats. Metabolism, 2011. 60(8): p. 1122-1130.
241. Peluffo, R.O., Nervi, A.M., Gonzalez, M.S., and Brenner, R.R., Effect of different amino acid diets on delta 5, delta 6 and delta 9 desaturases. Lipids, 1984. 19(2): p. 154-157.
242. Madeira, M.S., Pires, V.M., Alfaia, C.M., Luxton, R., Doran, O., Bessa, R.J., and Prates, J.A., Combined effects of dietary arginine, leucine and protein levels on fatty acid composition and gene expression in the muscle and subcutaneous adipose tissue of crossbred pigs. British Journal of Nutrition, 2014. 111(9): p. 1521-1535.
243. Sjogren, P., Sierra-Johnson, J., Gertow, K., Rosell, M., Vessby, B., de Faire, U., Hamsten, A., Hellenius, M.L., and Fisher, R.M., Fatty acid desaturases in human adipose tissue: Relationships between gene expression, desaturation indexes and insulin resistance. Diabetologia, 2008. 51(2): p. 328–335.
244. Kolak, M., Westerbacka, J., Velagapudi, V.R., Wagsater, D., Yetukuri, L., Makkonen, J., Rissanen, A., Hakkinen, A.M., Lindell, M., Bergholm, R., Hamsten, A., Eriksson, P., Fisher, R.M., Oresic, M., and Yki-Jarvinen, H., Adipose tissue inflammation and increased ceramide content characterize subjects with high liver fat content independent of obesity. Diabetes, 2007. 56(8): p. 1960-1968.
245. Bikman, B.T. and Summers, S.A., Ceramides as modulators of cellular and whole-body metabolism. Journal of Clinical Investigation, 2011. 121(11): p. 4222-4230.
246. Kotronen, A., Seppanen-Laakso, T., Westerbacka, J., Kiviluoto, T., Arola, J., Ruskeepaa, A.L., Oresic, M., and Yki-Jarvinen, H., Hepatic stearoyl-CoA desaturase (SCD)-1 activity and diacylglycerol but
84
not ceramide concentrations are increased in the nonalcoholic human fatty liver. Diabetes, 2009. 58(1): p. 203-208.
247. Nagaoka, S., Futamura, Y., Miwa, K., Awano, T., Yamauchi, K., Kanamaru, Y., Tadashi, K., and Kuwata, T., Identification of novel hypocholesterolemic peptides derived from bovine milk beta-lactoglobulin. Biochemical and Biophysical Research Communications, 2001. 281(1): p. 11-17.
248. Brandsch, C., Shukla, A., Hirche, F., Stangl, G.I., and Eder, K., Effect of proteins from beef, pork, and turkey meat on plasma and liver lipids of rats compared with casein and soy protein. Nutrition, 2006. 22: p. 1162-1170.
249. Morimatsu, F., Ito, M., Budijanto, S., Watanabe, I., Furukawa, Y., and Kimura, S., Plasma cholesterol-suppressing effect of papain-hydrolyzed pork meat in rats fed hypercholesterolemic diet. Journal of Nutritional Science and Vitaminology (Tokyo), 1996. 42(2): p. 145-153.
250. Gabriel, S.E., Cardiovascular morbidity and mortality in rheumatoid arthritis. American Journal of Medicine, 2008. 121(10 Suppl 1): p. S9-14.
251. Kardys, I., de Maat, M.P., Uitterlinden, A.G., Hofman, A., and Witteman, J.C., C- reactive protein gene haplotypes and risk of coronary heart disease: the Rotterdam Study. European Heart Journal, 2006. 27: p. 1331-1337.
252. Prodanovich, S., Kirsner, R.S., Kravetz, J.D., Ma, F., Martinez, L., and Federman, D.G., Association of psoriasis with coronary artery, cerebrovascular, and peripheral vascular diseases and mortality. Archive of Dermatology, 2009. 145: p. 700-703.
253. Zacho, J., Tybjaerg-Hansen, A., Jensen, J.S., Grande, P., Sillesen, H., and Nordestgaard, B.G., Genetically elevated C-reactive protein and ischemic vascular disease. New England Journal of Medicine, 2008. 359(18): p. 1897-1908.
254. Dembinska-Kiec, A. and Gryglewski, R.J., Contribution of arachidonic acid metabolites to atherosclerosis. Wiener Klinische Wochenschrift, 1986. 98(7): p. 198-206.
255. Riccioni, G., Zanasi, A., Vitulano, N., Mancini, B., and D'Orazio, N., Leukotrienes in atherosclerosis: new target insights and future therapy perspectives. Mediators of Inflammation, 2009. 2009: p. 737282.
256. Høstmark, A.T. and Haug, A., Percentages of oleic acid and arachidonic acid are inversely related in phospholipids of human sera. Lipids in Health and Disease, 2013. 12: p. 106.
257. Schwart, S.M., Galis, Z.S., Rosenfeld, M.E., and Falk, E., Plaque rupture in humans and mice. Arteriosclerosis, Thrombosis and Vascular Biology, 2007. 27: p. 705-713.
258. Rioua, L.M., Broisata, A., Ghezzia, C., Finetb, G., Rioufolb, G., Gharibc, A.M., Pettigrewc, R.I., and Ohayond, J., Effects of mechanical properties and atherosclerotic artery size on biomechanical plaque disruption – Mouse vs. human. Journal of Biomechanics 2014. 47(4): p. 765-772.
259. Björkbacka, L., Atherosclerosis: cell biology and lipoproteins. Current Opinion in Lipidology, 2015. 26(1): p. 67-69.
260. Grimstad, T., Bjørndal, B., Cacabelos, D., Aasprong, O.G., Omdal, R., Svardal, A., Bohov, P., Pamplona, R., Portero-Otin, M., Berge, R.K., and Hausken, T., A salmon peptide diet alleviates experimental colitis as compared with fish oil. Journal of Nutritional Science, 2012. 2: p. 1-8.
261. Sun, Y., Pan, D., Guo, Y., and Li, J., Purification of chicken breast protein hydrolysate and analysis of its antioxidant activity. Food and Chemical Toxicology, 2012. 50(10): p. 3397-3404.
262. Zhang, Y., Kouguchi, T., Shimizu, M., Ohmori, T., Takahata, Y., and Morimatsu, F., Chicken collagen hydrolysate protects rats from hypertension and cardiovascular damage. Journal of Medicinal Food, 2010. 13(2): p. 399-405.
263. Saiga-Egusa, A., Iwai, K., Hayakawa, T., Takahata, Y., and Morimatsu, F., Antihypertensive effects and endothelial progenitor cell activation by intake of chicken collagen hydrolysate in pre- and mild-hypertension. Bioscience, biotechnology, and biochemistry, 2009. 73(2): p. 422-424.
264. Kaur, G., Cameron-Smith, D., Garg, M., and Sinclair, A.J., Docosapentaenoic acid (22:5n-3): a review of its biological effects. Prog Lipid Res, 2011. 50(1): p. 28-34.
265. Kaur, G., Sinclair, A.J., Cameron-Smith, D., Barr, D.P., Molero-Navajas, J.C., and Konstantopoulos, N., Docosapentaenoic acid (22:5n-3) down-regulates the expression of genes involved in fat synthesis in liver cells. Prostaglandins, leukotrienes, and essential fatty acids, 2011. 85(3-4): p. 155-161.
266. Singh, A.K., Yoshida, Y., Garvin, A.J., and Singh, I., Effect of fatty acids and their derivatives on mitochondrial structures. International Journal of Experimental Pathology, 1989. 4(1): p. 9-15.
267. Xu, Y.J., Arneja, A.S., Tappia, P.S., and Dhalla, N.S., The potential health benefits of taurine in cardiovascular disease. Experimental & Clinical Cardiology, 2008. 13(2): p. 57-65.
268. Kritchevsky, D., Tepper, S.A., Czarnecki, S.K., and Klurfeld, D.M., Atherogenicity of animal and vegetable protein. Influence of the lysine to arginine ratio. Atherosclerosis, 1982. 41(2-3): p. 429-431.
85
269. Moundras, C., Remesy, C., Levrat, M.A., and Demigne, C., Methionine deficiency in rats fed soy protein induces hypercholesterolemia and potentiates lipoprotein susceptibility to peroxidation. Metabolism, 1995. 44(9): p. 1146-1152.
270. Barakat, H.A. and Hamza, A.H., Glycine alleviates liver injury induced by deficiency in methionine and or choline in rats. European Review for Medical and Pharmacology Sciences, 2012. 16(6): p. 728-736.
I
Three differently generated salmon protein hydrolysates reveal oppositeeffects on hepatic lipid metabolism in mice fed a high-fat diet
Rita Vik a, Veronika Tillander b, Jon Skorve a, Terhi Vihervaara c, Kim Ekroos c, Stefan E.H. Alexson b,Rolf K. Berge a,d, Bodil Bjørndal a,⇑aDepartment of Clinical Science, University of Bergen, N-5020 Bergen, NorwaybDepartment of Laboratory Medicine, Division of Clinical Chemistry, Karolinska Institutet, C1-74, Karolinska University Hospital, SE-141 86 Stockholm, Swedenc Zora Biosciences Oy, Biologinkuja 1, FI-02150 Espoo, FinlanddDepartment of Heart Disease, Haukeland University Hospital, N-5021 Bergen, Norway
a r t i c l e i n f o
Article history:Received 17 October 2014Received in revised form 12 February 2015Accepted 3 March 2015Available online 17 March 2015
Keywords:Marine bioactive peptidesFatty acid compositionDe novo lipogenesisFatty acid desaturaseBeta-oxidationWeight gain
a b s t r a c t
This study investigates the effects of salmon peptide fractions, generated using different enzymatichydrolyzation methods, on hepatic lipid metabolism. Four groups of mice were fed a high-fat diet with20% casein (control group) or 15% casein and 5% of peptide fractions (treatment groups E1, E2 and E4)for 6 weeks. Weight gain was reduced in mice fed E1 and E4-diets compared to control, despite a similarfeed intake. Reduced plasma and liver triacylglycerol levels in E1 and E4-mice were linked to reducedfatty acid synthase (FAS) activity and hepatic expression of lipogenic genes. By contrast, plasma and liverlipids increased in the E2 group, concomitant with increased hepatic FAS activity and D9 desaturase geneexpression. Shotgun lipidomics showed that MUFAs were significantly reduced in the E1 and E4 groups,whereas PUFAs were increased, and the opposite was observed in the E2 group. In conclusion, bioactivepeptides with distinctive properties could potentially be isolated from salmon hydrolysates.� 2015 The Authors. Published by Elsevier Ltd. This is anopenaccess article under the CCBY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
1. Introduction
The role of dietary protein is to provide the body with essentialamino acids for protein synthesis and energy. Beyond this nutri-tional role, ingested proteins have a wide range of biological func-tions affecting protein, glucose and lipid metabolism,transportation, immune function, blood pressure and hormonalfunctions (Chou, Affolter, & Kussmann, 2012). It has been increas-ingly clear that the dietary source of protein can affect cellularenergy metabolism, and that hydrolyzed peptides can have potentand specific bioactive potential (Erdmann, Cheung, & Schroder,2008). Health benefits from fish consumption have been attributedto the n-3 polyunsaturated fatty acids, in particular eicosapen-taenoic acid (EPA) and docosahexaenoic acid (DHA). However,recent studies have drawn attention towards proteins from marinesources, which are considered valuable bioactive components astheir amino acid composition and protein profile differ from terres-trial sources (Kim, Ngo, & Vo, 2012; Larsen, Eilertsen, & Elvevoll,2011). According to Kelleher, 7 million tons of fish byproductswere discarded as processing waste in 2005 (Kelleher, 2005),
which constituted 50% of the total catch being used for human con-sumption (Rustad, 2003). Fish byproducts can be hydrolyzedenzymatically, using various techniques, liberating potentiallybioactive peptides incorporated in the parental molecule, accord-ing to molecule size, stability in water, refined protein and proteinmix. Rodent studies on fish protein hydrolysates have shown thatmarine proteins exhibit cholesterol-lowering (Shukla et al., 2006),antihypertensive (Je, Park, Kwon, & Kim, 2004; Kim & Mendis,2006), immunomodulating and antioxidant effects (Ahn, Cho, &Je, 2015), in addition to reparative properties in the intestine(Fitzgerald et al., 2005), and increased insulin sensitivity (Pilonet al., 2011). How fish protein hydrolysate may affect lipid metabo-lism in liver is less clear. The liver is the major site of lipid metabo-lism and both fatty acid oxidation and liponeogenesis are carriedout here. These processes are dependent on rate-limiting enzymes,e.g., carnitine palmitoyltransferase (CPT)-1 and 2, acetyl-CoA car-boxylase (ACC), and fatty acid synthase (FAS). Several desaturasesare involved in de novo fatty acid synthesis. The D9 desaturase,encoded by the gene Scd1, generates monounsaturated fatty acids.Along with elongases, the D5 and D6 fatty acid desaturases,encoded by the genes Fads1 and 2, respectively, are important inthe biosynthesis of essential polyunsaturated fatty acids (PUFAs).Regulation of these enzymes will influence fatty acid composition
http://dx.doi.org/10.1016/j.foodchem.2015.03.0110308-8146/� 2015 The Authors. Published by Elsevier Ltd.This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
⇑ Corresponding author. Tel.: +47 55975846; fax: +47 55975890.E-mail address: [email protected] (B. Bjørndal).
Food Chemistry 183 (2015) 101–110
Contents lists available at ScienceDirect
Food Chemistry
journal homepage: www.elsevier .com/locate / foodchem
and thus important cellular functions, including cell signaling(Nakamura & Nara, 2004).
In this study, we investigated the effect of three different sal-mon peptide fractions (designated E1, E2, and E4), generated usingdifferent enzymatic hydrolyzation and microfiltration methods, onhepatic lipid metabolism in male C57BL/6J mice. We show that dif-ferent peptide compositions, generated from the same species offish, varied in their beneficial effects on body weight and lipidmetabolism.
2. Materials and methods
2.1. Animals and diets
The animal experiments were carried out with ethical permis-sion obtained from the Norway State Board for BiologicalExperiments and followed the Norwegian Research Councils ethi-cal guidelines. Nine to ten weeks old male C57BL/6J mice werehoused, 3 per cage, at constant temperature (22 ± 2 �C) and humid-ity (55 ± 5%), and exposed to a 12 h light–dark cycle with unrest-ricted access to food and tap water. After 1 week ofacclimatization to these conditions, they were divided into 4groups and fed either a high-fat (HF) diet containing 24% (w/w)fat (21.3% lard and 2.7% soy oil) and 20% casein (control group,n = 9), or the HF diet supplemented with protein hydrolysate E1,E2 or E4 from salmon byproducts (a generous gift from MarineBioproducts, Storebø, Norway) (15% casein and 5% peptide, groupE1, E2 and E4, n = 6) ad libitum for 6 weeks. The different salmonpeptide fractions were produced as follows: for fractions E1 andE2, fish material (spine) was treated enzymatically with alkalineprotease and a neutral protease and the resulting protein hydroly-sate was subjected to a second enzymatic treatment. Fraction E1was treated with an Acid Protease A, while fraction E2 was treatedwith the proteolytic enzyme Umamizyme from Aspergillus oryzae.The final hydrolysate was then filtered, using micro- and ultra-fil-tration, and the size distribution of the peptides analyzed. For bothfractions, more than 50% of the final preparation consisted of pep-tides in the range 200–1200 Da and approximately 25% of the pre-paration consisted of peptides below 200 Da. Salmon backbones,including heads, were hydrolyzed with proteolytic Alcalase 2.4 L(Novozymes, Denmark) and subjected to micro- and ultra-filtra-tion and constituted peptide fraction E4. Nearly 60% of the finalpreparation consisted of peptides in the range below 1200 Da.
Amino acid composition of the control and peptide diets isgiven in Supplementary Table 1. Diets were packed airtight andstored at �20 �C until used to prevent lipid oxidation. Mice werehoused in groups of three per cage at a constant temperature of22 ± 2 �C and a dark/light cycle of 12/12 h. Body weights of themice were measured approximately every seventh day and foodintake was measured 3 times during the study. At sacrifice, animalswere fasted overnight, anesthetized with 2% isoflurane (Schering-Plough, Kent, UK) and blood was collected by heart puncture. Theblood was centrifuged, EDTA–plasma separated and frozen priorto further analysis. Livers were collected and immediately frozenin liquid nitrogen and stored at �80 �C prior to further analysis.
2.2. Lipid and fatty acid analysis
Liver lipids were extracted according to Bligh and Dyer (1959),solvents were evaporated under nitrogen and samples re-dissolvedin isopropanol before analysis. Lipids from liver extracts or plasmawere then measured enzymatically on a Hitachi 917 system (RocheDiagnostics, Mannheim, Germany), using kits for analyzing totalTAG (GPO–PAP kit, Roche Diagnostics), cholesterol (CHOD–PAPkit, Roche Diagnostics), and total phospholipids (Diagnostic
Systems GmbH, Holzheim, Germany). Fatty acid composition wasanalyzed in extracted liver lipid, using gas chromatography, asdescribed previously by Grimstad et al. (2012).
2.3. Lipidomic analysis
Liver samples were stored at�80 �C prior to analysis and lipido-mics analysis was performed on 50–100 mg of liver tissue fromeach mouse from two groups, E1 and E2, in addition to the controlgroup. The tissue samples were pulverized with a CP02 CryoPrepDry Pulverization System (Covaris), and resuspended in ice-coldmethanol containing 0.1% butyl-hydroxytoluene (BHT) at a con-centration of 100 mg/mL.
For lipidomics analysis, lipids were extracted from liver homo-genates, using a modified Folch lipid extraction procedure (Ekroos,Chernushevich, Simons, & Shevchenko, 2002). Samples werespiked with known amounts of deuterium-labeled or heptade-canoyl-based synthetic internal standards, serving for quan-tification of the endogenous lipid species, as previously described(Bergan et al., 2013). The samples were stored at �80 �C prior tomass spectrometry analysis.
Molecular glycerophospholipids, glycerolipids, cholesterylesters sphingomyelins and triacylglycerols (TAGs) were analyzedby shotgun analysis on a hybrid triple quadrupole/linear ion trapmass spectrometer (QTRAP 5500, ABSCIEX) equipped with arobotic nanoflow ion source (NanoMate HD, Advion Biosciences)(Stahlman et al., 2009). In shotgun lipidomics a 5 lL volume wasinfused at a concentration of 0.5 lg liver/lL. For TAG analysis,the concentration was diluted to 0.05 lg/lL. The analyses wereperformed in both positive and negative ion modes, using multipleprecursor ion scanning (MPIS) and neutral loss (NL)-based meth-ods (Ekroos et al., 2002, 2003). Sphingolipids were analyzed byreverse phase ultra-high pressure liquid chromatography (RheosAllegro UHPLC, Flux Instruments AG), using an Acquity BEH C18,2.1 � 50 mm column with a particle size of 1.7 lm (Waters,Milford, Massachusetts, USA) coupled to a hybrid triplequadrupole/linear ion trap mass spectrometer (QTRAP 5500,ABSCIEX). A 25 min gradient, using 10 mM ammonium acetate inwater with 0.1% formic acid (mobile phase A) and 10 mM ammo-nium acetate in acetonitrile:2-propanol (4:3, v/v), containing0.1% formic acid (mobile phase B), was used. The column tempera-ture was set to 60 �C and the flow rate to 500 lL/min. 10 lL sam-ples were injected. Sphingolipids were monitored, using multiplereactions monitoring (MRM) as described by Merrill, Sullards,Allegood, Kelly, and Wang (2005).
The MS data files were processed, using Lipid Profiler™ andMultiQuant™ software for producing a list of lipid names and peakareas. The individual lipids measured can be found inSupplementary Table 2. Masses and counts of detected peaks wereconverted into a list of corresponding lipid names. Lipids were nor-malized to their respective internal standard (Bergan et al., 2013)and tissue weight to retrieve their concentrations. Data were ana-lyzed, using the software Tableau Desktop 7.0 and the percentagedifferences between the groups (E1 vs. controls and E2 vs. controls)were estimated in pairwise comparisons, using a Hodges–Lehmannestimator, and the significances were calculated using Wilcoxonrank-sum t-test.
2.4. Hepatic enzyme activities
Liver samples were homogenized and a post-nuclear fractionwas prepared as previously described (Berge, Flatmark, &Osmundsen, 1984). The activity of CPT-1 was measured in the pres-ence and absence ofmalonyl-CoA, as previously described (Vik et al.,2014). The assay conditions for CPT-2 were identical to CPT-1, apartfrom some changes in the reaction mix; BSA and KCN were
102 R. Vik et al. / Food Chemistry 183 (2015) 101–110
exchanged with 0.01% Triton X-100, and 35 lg of total protein wereused for the assays. Acyl-CoA oxidase (ACOX)-1 activity was mea-sured, using 20 lg protein, by a coupled assay, described by Small,Burdett, and Connock (1985), with some modifications (Madsenet al., 1999). Glycerol-3-phosphate acyltransferase (GPAT) activitywas measured, as described by Skorve et al. (1993).
2.5. RNA isolation, cDNA synthesis, and real-time PCR
Total RNA from liver tissue was purified, using theMagMax totalRNA isolation system (Applied Biosystems, Carlsbad, CA, USA) aftertissue homogenization. The quantity of the RNA was measuredspectrophotometrically, using a NanoDrop 1000 (NanoDropProducts,Wilmington, DE, USA) and the quality of the RNAwas ana-lyzed, using the Experion Automated Electrophoresis System (Bio-Rad Laboratories, Hercules, CA, USA). Quality limit for further useof RNA was set to a R/Q value of P7 (out of 10). cDNA was synthe-sized with 500 ng of RNA per reaction, using High Capacity RNA tocDNAMastermix (Applied Biosystems). Genes of interest were ana-lyzed in individual samples from liver, using SYBR Green geneexpression assays, and using primers for acetyl-CoA carboxylasealpha (Acaca, 50acctgtacaagcagtgtgggct, 30cacatggcctggcttggaggg),acyl-CoA thioesterase (Acot1, 50ctggcgcatgcaggatc, 30ggcacttttcttg-gatagctcc), fatty acid desaturase 1 (Fads1, 50ggctcccgggtcatcag,30acccttgttgatgtggaatgc), (Fads2, 50ggacataaagagcctgcatgtg, 30gggcaggtatttcagcttcttc), (Fas, 50ggcatcattgggcactcctt, 30gctgcaag-cacagcctctct), 3-hydroxy-3-methylglutaryl-coenzyme A reductase(Hmgcr, 50ccggcaacaacaagatctgtg, 30atgtacaggatggcgatgca), fattyacid binding protein, liver (L-fabp, 50ccatgactggggaaaaagtc, 30gc-ctttgaaagttgtcaccat), stearoyl-CoA desaturase (Scd1, 50acgggctccggaaccgaagt, 30ctggagatctcttggagcatgtggg). SYBRGreen primerswereused at concentrations ranging from100 to 200 nMand runwith thePower SYBR GreenMasterMix (Applied Biosystems) in an ABI Prism7500 sequence detection system. Gene expression was estimated,using the average threshold (Ct) value, in triplicate calculated, usingthe 2�DDCtmethod, according to Livak and Schmittgen (2001), usinghypoxanthine phosphoribosyltransferase 1 (Hprt1, 50ggtgaaaaggac-ctctcgaagtg, 30atagctaagggcatatccaacaac) as reference gene and oneindividual sample in the high-fat group as calibrator.
2.6. Statistics
All values are presented as means ± standard deviation (SD).One-way ANOVA was used for analysis of differences betweengroups, followed by Dunnett’s multiple comparison test betweenall groups vs. control when data followed Gaussian distributionand the Kruskal–Wallis test, with Dunn’s multiple comparison test,was used when data were not normally distributed. Significancewas set to (P < 0.05). All statistics were calculated usingGraphPad Prism 6 for Mac OS X with the exception of the lipido-mics data where software Tableau Desktop 7.0 was used.
3. Results
3.1. Body weight was influenced by dietary intake of salmon peptidefractions
C57BL/6J mice, fed high-fat diets with 15% casein and 5% (w/w)of salmon peptide fractions E1 or E4, demonstrated lower bodyweight gain throughout the 6 weeks feeding period (Fig. 1A), aswell as a significantly lower total weight gain than did control micefed 20% (w/w) casein as protein source (Fig. 1B). By contrast, micefed peptide E2 had a body weight curve and total weight gain moresimilar to the control group. Feed intake was measured 3 timesduring the experiment, and the average feed intakes were similar
in control, E2 and E4-fed mice (Fig. 1C), while it was higher inpeptide E1-fed mice, despite the low weight gain in this group. Asmall, but significant reduction was observed in the liver index(% liver weight/body weight) of E4-fed mice compared to controls(Fig. 1D).
3.2. The salmon peptide fractions differentially affected plasma lipidsbut not bile acid levels
Plasma lipids were measured in samples from fasted animals.While mice fed peptides E1 and E4 demonstrated significantlylower plasma TAG levels than did the control, the TAG level in micefed peptide E2 was elevated (Fig. 2A). The peptide E2 group alsodemonstrated elevated levels of total cholesterol, phospholipidsand HDL-cholesterol compared to the control (Fig. 2B–D). Nochange was observed in LDL-cholesterol or the HDL/LDL ratio inany of the feeding groups (Fig. 2E and F), but non-esterified fattyacids showed a tendency to increase in the E4 group (Fig. 2G, con-trol vs. E4, Mann–Whitney, P-value = 0.044). There was a smallincrease in plasma bile acids in the E4 group, when measured inplasma samples pooled from 2 to 4 animals (Fig. 2H). However,statistical significance could not be analyzed (n = 2–3).
3.3. The effect of salmon peptide fractions on hepatic enzymes
As the studied salmon peptide fractions affected weight gainand lipid levels differently in C57BL/6J mice, we analyzed the activ-ity of hepatic enzymes involved in lipid catabolism and synthesis.CPT-1 is the rate-limiting enzyme in fatty acid import intomitochondria for b-oxidation. In mice fed E1, no change wasobserved in the activity of CPT-1 (Fig. 3A), or its % inhibition bymalonyl-CoA (Fig. 3B). CPT-2 activity was also unchanged, furthersupporting no influence on mitochondrial b-oxidation in this group(Fig. 3C). The activity of GPAT, involved in the synthesis of TAG,was unchanged (data not shown). However, de novo lipogenesiscould be affected, as FAS activity tended to be reduced in E1-fedmice compared to control-mice (Fig. 3D). In E4 mice, a potentialconcomitant increase in b-oxidation and reduction in lipogenesiswas observed; CPT-1 and -2 activities demonstrated small, but sig-nificantly higher levels than the control, suggesting more CPT-mediated mitochondrial import of fatty acids in these mice. Also,FAS activity was significantly lower in E4-fed mice than in controlmice. By contrast, E2 mice demonstrated a significantly higher FASactivity than did control mice, suggesting increased de novolipogenesis in this group, while CPT-1 and -2 activity wereunchanged.
We further analyzed hepatic expression of genes involved infatty acid metabolism. The liver fatty acid binding protein (L-fabp)was not affected by the diets (Fig. 4A). Acot1, which regulates thecytosolic levels of acyl-CoA, CoASH and free fatty acids, was signifi-cantly increased in the E2 and E4 groups compared to control mice(Fig. 4B). In agreement with the enzyme activity data, Fas geneexpression was significantly reduced in the E1 and E4 groups com-pared to control (Fig. 4C). The expression of another importantgene in fatty acid synthesis, Acaca, was significantly decreased inthe E1 group compared to the control (Fig. 4D). The D9 desat-urase (Scd1) mRNA level tended to be increased in livers fromE2-fed mice, supporting an increase in de novo lipogenesis in thisgroup (Fig. 4E). There was also indication of a differential effecton D5 and D6 desaturation of fatty acids, as Fads1was significantlylower expressed in the E4 group vs. the control group (Fig. 4F)and Fads1 and Fads2 tended to be lower in the E1 group comparedto the control (Fig. 4G). HMG-CoA reductase (Hmgcr), the rate-limiting enzyme in cholesterol synthesis, was significantly reducedin the E1 and E4 groups compared to the control (Fig. 4H).
R. Vik et al. / Food Chemistry 183 (2015) 101–110 103
3.4. A differential effect of salmon peptide fractions on hepatic fattyacid composition
To determine if the differently processed peptide fractionscould influence fatty acid composition, total fatty acids in liverwere analyzed. Saturated fatty acids (SFAs) were unaffected in allpeptide diet groups compared to the control. Largely similar effectson monounsaturated fatty acid (MUFA) and polyunsaturated fattyacid (PUFA) composition were observed in the E1 and E4 groups:While MUFAs tended to be reduced in the E1 group, and were sig-nificantly reduced in the E4 group (Table 1), n-3 PUFAs were sig-nificantly increased in the E4 group, and n-6 PUFAs increased inthe E1 group compared to the control (Table 1). The opposite effectwas observed in the liver of E2 mice, where MUFAs increasedstrongly, while n-3 and n-6 PUFAs were significantly reduced com-pared to control mice. In line with these results, the D9 desaturaseindex, calculated by the ratio C16:1n-7/C16:0 or the ratio C18:1n-9/C18:0, was increased in the E2 group compared to the control.The D5 desaturase (n-6) index, calculated by the ratio C20:4n-6/C20:3n-6, increased in the E1 and E4 group, while the D6 desat-urase (n-3) index, calculated by the ratio C20:5n-3/C20:4n-3, wassignificantly increased only in E4 (Table 1). In addition, the D5desaturase (n-3) index was significantly increased in the E4 groupcompared to the control, while no change was seen in the D6desaturase (n-6) index (data not shown).
3.5. Comparison of the effect of salmon peptide fractions on hepaticlipids
In the enzymatic measurements of lipids from liver extracts, wefound that TAG tended to be reduced by peptides E1 and E4 (E1 vs.
control, student’s t-test, P-value = 0.042) (Supplementary Table 3).Surprisingly, cholesterol showed a small but significant increasein E4 vs. control, while phospholipids were increased by both E1and E4. However, the total hepatic lipid levels (TAG, cholesteroland PL) were unchanged in E1 and E4 compared to the control. Inthe livers of E2 mice, both TAG and total hepatic lipids were signifi-cantly increased (Supplementary Table 3), in line with plasma lipidresults.
Since the E1 and E2 salmon peptide fractions were generatedfrom the same raw-material, but showedopposite effects on hepaticlipid metabolism, liver samples frommice fed these diets were fur-ther compared to controls in three separate analytical runs in shot-gun, sphingolipid and TAG lipidomics. Fig. 5A shows a summary ofthe effects of these two salmon protein hydrolysate fractions atthe level of the major lipid classes. In line with the enzymatic mea-surement, the relative difference (%) of TAG was significantly ele-vated in the E2 group vs. control, and tended to decrease in the E1group vs. control. Striking differences were also seen with the cera-mides (Cer) and glycerophosphoethanolamines (PE), whichincreased significantly in E1 vs. control, diacylglycerols (DAG),which increased in E2 vs. control, and glycosyl/galactosylceramide(Glc/GalCer), which were specifically reduced in E1 vs. control.The difference in TAG in the E1 group compared to the controlwas seen as a reduction in all species of TAG, whereas the E2-dietprimarily increased the TAG species containing short, saturated ormonounsaturated fatty acids compared to the control (Fig. 5B).The peptide fractions had a prominent different effect on hepaticceramide levels. The relative differences of all d18:1 ceramideswereincreasedwith the E1 diet compared to the control,while largely theopposite effect was observed in the E2 group, apart from a sta-tistically significant increase in Cer (d18:1/18:0) (Fig. 5C).
A
C
B
Feed intake
Control
Peptid
e E1
Peptid
e E2
Peptid
e E4
0
2
4
6
g/da
y/m
ouse
Control
Peptid
e E1
Peptid
e E2
Peptid
e E4
0
2
4
6
liver
/bod
y w
eigh
t(%
)
Liver index
**
Weight gain
Control
Peptid
e E1
Peptid
e E2
Peptid
e E4
0
5
10
15
gram ** ***
Body weight
0 8 14 22 27 3625
30
35
40
gram
ControlPeptide E1Peptide E2Peptide E4
D
Fig. 1. (A) Body weight curve, (B) weight gain, (C) feed intake, and (D) hepatic index in mice fed a high-fat casein diet (control, n = 9) or a diet where 5% of the protein sourcewas replaced with 5% of three different salmon protein hydrolysates E1, E2 or E4 (n = 6). Data are shown as means with SD and dissimilar letters indicate significantlydifferent values (P < 0.05). Statistical significance could not be calculated in (C) since data from 3 mice were pooled.
104 R. Vik et al. / Food Chemistry 183 (2015) 101–110
TAG
mm
ol/L
Control
Peptid
e E1
Peptid
e E2
Peptid
e E4
0.0
0.5
1.0
1.5
2.0
**
**
**
Phospholipids
mm
ol/L
Control
Peptid
e E1
Peptid
e E2
Peptid
e E4
0
1
2
3
4
5 **
LDL
mm
ol/L
Control
Peptid
e E1
Peptid
e E2
Peptid
e E4
0.0
0.1
0.2
0.3
0.4
NEFA
mm
ol/L
Control
Peptid
e E1
Peptid
e E2
Peptid
e E4
0.0
0.1
0.2
0.3
0.4
Cholesterol
Control
Peptid
e E1
Peptid
e E2
Peptid
e E4
0
1
2
3
4
5
mm
ol/L
***
HDL
mm
ol/L
Control
Peptid
e E1
Peptid
e E2
Peptid
e E4
0
1
2
3
4 *
HDL/LDL
Rat
io
Control
Peptid
e E1
Peptid
e E2
Peptid
e E4
0
5
10
15
20
25
Control
Peptid
e E1
Peptid
e E2
Peptid
e E4
0.0
0.5
1.0
1.5
2.0
μmol
/L
Bile acids
BA
DC
FE
HG
Fig. 2. Plasma lipids in mice fed a high-fat casein diet (control, n = 8) or a diet where 5% of the protein source was replaced with 5% of three different salmon proteinhydrolysates, E1, E2, and E4, respectively (n = 6). (A) Triacylglycerol (TAG), (B) cholesterol, (C) phospholipids, (D) high-density lipoprotein (HDL), (E) low-density lipoprotein(LDL), (F) HDL/LDL ratio, and (G) non-esterified fatty acids (NEFA). Bile acids in pooled plasma samples from 2 to 4 mice (n = 2–3) are shown in (G). Data are shown as meanswith SD and values significantly different from control were determined by one-way ANOVA (A–C and F) or Kruskal–Wallis test (D, E and G), ⁄P < 0.05, ⁄⁄P < 0.01, ⁄⁄⁄P < 0.001.Statistics could not be performed in (H).
R. Vik et al. / Food Chemistry 183 (2015) 101–110 105
4. Discussion
Based on recent studies, fish proteins and peptides have diversebioactive properties (Kim & Mendis, 2006). The purpose of ourstudy was to evaluate the effects of three different fractions of sal-mon protein hydrolysate on body weight development and plasmalipids, as well as hepatic lipid metabolism, as the liver is the mainorgan maintaining lipid homeostasis. The novel findings of ourstudy were the divergent effects on body weight, plasma and hep-atic TAG levels, hepatic lipogenesis and b-oxidation, and hepaticfatty acid composition by peptide fractions generated using differ-ent enzymatic methods.
The groups fed peptide fractions E1 and E4 exhibited a lowerweight gain throughout the study, despite the same or higher feedintake than control. Furthermore, both E1 and E4-fed groups hadreduced plasma TAG levels and a tendency to reduced liver TAG.In E1 mice, this was linked to decreased expression of the Fasand Acaca genes, as well as a tendency to decrease FAS activity.The reduction in these rate-limiting steps in fatty acid synthesisindicates a repression of de novo lipogenesis by the E1 peptide.Similar to E1-fed mice, key enzymes in lipogenesis were signifi-cantly reduced by E4, and in addition, an increased CPT-1 and -2activity suggested that increased fatty acid oxidation could havecontributed to the lower body weight and plasma TAG observedin this group.
The generation of the E2 peptide fraction differed from that ofthe E1 peptide fraction in the secondary enzymatic treatment,and opposite effects were observed in these treatment groups.E2-fed mice had a body weight gain curve similar to that of
control-fed mice, and importantly, displayed increased hepaticTAG, as well as plasma TAG, cholesterol, and phospholipid levels.FAS activity was significantly increased by E2, and thus the differ-ences in plasma and liver TAG could partly be explained by anopposite regulation of fatty acid synthesis in mice fed the E2 vs.the E1 and E4 peptide fractions. In support of this, the increasedD9 index, and the tendency to increase in hepatic gene expressionof Scd1, the enzyme performing the crucial D9 unsaturation stepduring fatty acid synthesis, indicates stimulated fatty acid synthe-sis in E2-fed mice. The GPAT activity was not altered in the inter-vention groups; thus TAG synthesis was probably not affected bythe diets.
A number of studies, using high doses of fish protein or proteinhydrolysate from Atlantic salmon (15–20% of diet), have demon-strated reduced plasma cholesterol levels in Wistar rats (Hosomiet al., 2011; Liaset et al., 2009). This has been linked to increasedplasma bile acid levels, and cholesterol clearance through the bile.However, in a number of comparable studies in rabbits and mice,no influence on plasma cholesterol levels has been shown(Bergeron & Jacques, 1989; Bjørndal et al., 2013). In line with this,no plasma cholesterol-reducing effects or increases in plasma bileacids were observed in the treatment groups compared to control,despite a reduction in the gene expression of Hmgcr, involved incholesterol biosynthesis, in the E1 and E4 groups. This could eitherbe due to the animal model or the lower dose of salmon proteinhydrolysate used compared to previous studies.
Different sources of protein are assumed to differ in digestibil-ity, thus contributing unequally to energy supply; other proteinsor peptides are believed to suppress appetite (Nishi, Hara, Asano,
CPT-1 activity
Control
Peptid
e E1
Peptid
e E2
Peptid
e E4
0
1
2
3
4nm
ol/m
g/m
in
FAS activity
Control
Peptid
e E1
Peptid
e E2
Peptid
e E4
0.0
0.2
0.4
0.6
nmo
l/mg/
min
*
BA
DC CPT-2 activity
Control
Peptid
e E1
Peptid
e E2
Peptid
e E40
1
2
3
4
nmol
/mg
/min
**
% inhibition
Control
Peptid
e E1
Peptid
e E2
Peptid
e E4
0
10
20
30
40
50
% in
hibi
tion
by
Mal
onyl
-Co
A
Fig. 3. Hepatic enzyme activities in mice fed a high-fat casein diet (control) or a diet where 5% of the protein source was replaced with 5% of three different salmon proteinhydrolysates, E1, E2, and E4, respectively. (A) Carnitine palmitoyltransferase-1 (CPT-1) activity, (B) % inhibition of CPT-1 activity by malonyl-CoA, (C) carnitinepalmitoyltransferase-2 (CPT-2) activity and (D) fatty acid synthase (FAS) activity. Data are shown as means with SD (n = 6) and values significantly different from control weredetermined by one-way ANOVA (⁄P < 0.05, ⁄⁄P < 0.01).
106 R. Vik et al. / Food Chemistry 183 (2015) 101–110
Fig. 4. Hepatic gene expressions in mice fed a high-fat casein diet (control) or a diet where 5% of the protein source was replaced with 5% of three different salmon proteinhydrolysates, E1, E2, and E4, respectively. (A) Fatty acid binding protein, liver (L-fabp), (B) acyl-coenzyme A thioesterase 1 (Acot1), (C) fatty acid synthase (Fas), (D) acetyl-coenzyme A carboxylase alpha (Acaca), (E) stearyl-coenzyme A desaturase (Scd1), (F) fatty acid desaturase 1 (Fads1), (G) fatty acid desaturase 2 (Fads2), and (H) 3-hydroxy-3-methylglutaryl CoA reductase (Hmgcr). Data are shown as means with SD (n = 6) and dissimilar letters indicate significantly different values.
R. Vik et al. / Food Chemistry 183 (2015) 101–110 107
& Tomita, 2003), while some are suggested to increase satiety. Inaddition, a previous study showed that salmon protein uniquelyprotects against body weight gain, independently of feed intake(Pilon et al., 2011). In support of this, feed intake in the four groupswas unable to explain the divergent effect on body weight. Thus, inthe present study, the distinct peptide or amino acid compositionof each salmon protein hydrolysate-fraction may explain the varia-tion in body weight gain between the treatment groups(Supplementary Table 1). The degree of hydrolysis of corn glutenmeal has been reported to affect bioavailability and weight gainin rats (Jin et al., 2014); however, in our study, the three differenthydrolysates had similar compositions with regard to peptidesequence size, indicating similar degrees of hydrolysis.
Dietary proteins may play a role in mechanisms affecting fattyacid composition (Bjørndal et al., 2013; Leveille, Tillotson, &Sauberlich, 1963). The amino acid composition of the diet has beenshown to influence lipogenesis and desaturation, as tyrosinedown-regulates hepatic D6 activity (Peluffo, Nervi, Gonzalez, &
Brenner, 1984), and arginine and leucine can regulate the geneexpression of Scd1 and Fas in muscle and adipose tissue (Madeiraet al., 2014). Here, the amino acid composition did not differ to alarge extent since they were all dominated by amino acids fromcasein. However, tyrosine and leucine were higher in the E2 dietcompared to the control, E1 and E4, while arginine was reducedin the E1 and E4 diets compared to the control and E2. In line withthis, the E1 and E4 groups displayed similar patterns in fatty acidcomposition, including an increase in the fatty acid ratios 18:3n-6/18:2n-6 and 20:4n-6/20:3n-6 compared to the control. Theseratios are commonly used as an index for the activities of D6-and D5 desaturase, respectively. As also reported by others(Sjogren et al., 2008), the D5 and D6 desaturation indices are influ-enced by a number of pathways, and failed to reflect the expressionof Fads1 and Fads2. In contrast, Scd1 expression correlated with theD9 desaturase index in liver. Thus, concomitant with increasedScd1 expression in E2-mice, an increase in monounsaturated fattyacids and the D9 desaturase index was observed. Interestingly,while hepatic MUFA increased, n-3 PUFA and n-6 PUFAs decreasedin the E2 group. The main product of D9 desaturase, oleoyl-CoA(C18:1), is mainly used to generate TAG (Mauvoisin & Mounier,2011), and this was reflected in the predominant increase in TAGspecies containing short MUFAs. Studies investigating the effectof MUFA supplementation on plasma lipid levels in humans areinconclusive; however, in rats, a high MUFA amount in a diet con-taining 40% energy from fat was shown to increase plasma totalcholesterol, TAG and phospholipid levels as compared to a lowdietary MUFA amount (Chang & Huang, 1998). The current studysuggests that an increased hepatic expression of Scd1, and acorresponding increase in MUFAs incorporated into TAG could leadto increased VLDL release.
The E1 and E4 diets resulted in increased hepatic PUFA levels,indicating increased biosynthesis of PUFAs at the expense ofMUFAs. Dietary and endogenous fatty acids, in particular PUFAs,are involved in metabolic regulation of lipid and glucose metabo-lism. Thus, the differential peptide-effects on lipid levels couldhave been reinforced by their opposite regulation of fatty acidsimportant in cell signaling.
Table 1Hepatic fatty acid composition mice fed a casein control diet or diets with 5% of threedifferent salmon protein hydrolysates for 4 weeksa.
Fatty acids Control E1 E2 E4
SFAs 34.8 ± 1.4 36.3 ± 0.9 34.2 ± 0.7 35.3 ± 1.3MUFAs 23.8 ± 6.4 17.8 ± 1.8 31.1 ± 4.1⁄⁄ 18.1 ± 4.4n-3 PUFAs 9.8 ± 1.4 10.7 ± 0.9 7.7 ± 1.1⁄⁄⁄ 14.1 ± 1.4⁄⁄⁄
n-6 PUFAs 31.4 ± 3.8 34.9 ± 0.7 26.8 ± 2.5⁄⁄⁄ 32.4 ± 1.8bD9-desat. (C16:0) 0.06 ± 0.03 0.05 ± 0.01 0.10 ± 0.02⁄⁄ 0.05 ± 0.02bD9-desat. (C18:0) 2.1 ± 1.3 1.2 ± 0.1 3.1 ± 0.9⁄⁄ 1.3 ± 0.5cD5-desat. 9.5 ± 2.1 13.5 ± 1.2⁄ 9.3 ± 1.3 17.6 ± 4.6⁄⁄⁄dD6-desat. 0.08 ± 0.02 0.10 ± 0.02 0.11 ± 0.02 0.12 ± 0.03⁄
Data are shown as means ± SD (n = 6–9).Values significantly different from control were determined by one-way ANOVA(⁄P < 0.05, ⁄⁄P < 0.01, ⁄⁄⁄P < 0.001).Abbreviations: SFAs, saturated fatty acids; MUFAs, monounsaturated fatty acids,PUFAs, polyunsaturated fatty acids.
a wt%.b Delta9 desaturase index (C16:1n-7/C16:0 and C18:1n-9/C18:0).c Delta5 desaturase index (C20:4n-6/C20:3n-6).d Delta6 desaturase index (C20:5n-3/C20:4n-3).
Fig. 5. Summary of lipid classes (A), TAG species (B), and ceramide species (C) in liver, presented as relative molar percentage differences between treatment groups andcontrol, in mice fed a high-fat casein diet (control) or the replacement with 5% of the protein source with 5% of peptide fraction E1 or E2 (n = 6). Significance is indicated as⁄P < 0.05 and ⁄⁄P < 0.01.
108 R. Vik et al. / Food Chemistry 183 (2015) 101–110
Assessment of liver lipids, using lipidomics, also revealed a sig-nificantly elevated level of ceramides in the E1 group. These waxylipid molecules can induce both inflammation and insulin resis-tance (Summers, 2006). Increased ceramide levels in adipose tissuehave been linked to higher levels of liver fat (Kolak et al., 2012);however, in our study, TAG decreased while ceramides increasedin the liver of E1-fed mice. A reduction in diacylglycerols (DAG)in the E1 group could be of significance in view of its physiologicalimportance in activating protein kinase C (PKC). PKC phos-phorylates the hydroxyl-groups of serine and threonine amino acidresidues on several important target proteins and modulatesphysiological processes in all cells. In our study, DAG and TAG dis-played a simultaneous decrease in the E1 group and increase in theE2 group, relative to control. The significant increase of DAG in thepeptide E2 group, combined with increased gene expression ofScd1, but not in ceramide levels, is similar to findings in the liverof patients with non-alcoholic fatty liver disease (Kotronen et al.,2009). In further studies, it will be interesting to evaluate the effectof the E1 and E4 fish protein hydrolysate fractions on animal mod-els, on NAFLD, as well as obesity and insulin resistance.
5. Conclusions
The three different peptide fractions from salmon proteinhydrolysate show diverse effects on weight gain, plasma and liverlipids and lipid synthesis, suggesting that protein products that areenzymatically hydrolyzed exhibit distinct and, in some cases,opposite effects. Thus, prior to their potential use as dietary sup-plements, it is of importance to analyze protein hydrolysates thor-oughly to exclude possible negative metabolic effects. Pre-digestion of proteins gives the opportunity to optimize nutritionalvalue and bioavailability of the peptides, thus obtaining a morespecific product regarding its use, either as a balanced food supple-ment, food aid or simply healthy food.
Acknowledgments
The authors wish to thank Svein Krüger, Randi Sandvik, LivKristine Øysæd, Kari Williams and Kari Mortensen for valuabletechnical assistance. We also wish to thank Eline Milde Nævdaland the staff at the animal facility. We also thank MarineBioproducts, Storebø, Norway for providing the salmon proteinhydrolysates. This work was supported by NordForsk under theNordic Centers of Excellence program in Food, Nutrition, andHealth; Project (070010) ‘‘MitoHealth’’.
Appendix A. Supplementary data
Supplementary data associated with this article can be found, inthe online version, at http://dx.doi.org/10.1016/j.foodchem.2015.03.011.
References
Ahn, C. B., Cho, Y. S., & Je, J. Y. (2015). Purification and anti-inflammatory action oftripeptide from salmon pectoral fin byproduct protein hydrolysate. FoodChemistry, 168, 151–156.
Bergan, J., Skotland, T., Sylvanne, T., Simolin, H., Ekroos, K., & Sandvig, K. (2013). Theether lipid precursor hexadecylglycerol causes major changes in the lipidome ofHEp-2 cells. PLoS One, 8(9), e75904.
Berge, R. K., Flatmark, T., & Osmundsen, H. (1984). Enhancement of long-chain acyl-CoA hydrolase activity in peroxisomes and mitochondria of rat liver byperoxisomal proliferators. European Journal of Biochemistry, 141(3), 637–644.
Bergeron, N., & Jacques, H. (1989). Influence of fish protein as compared to caseinand soy protein on serum and liver lipids, and serum lipoprotein cholesterollevels in the rabbit. Atherosclerosis, 78(2–3), 113–121.
Bjørndal, B., Berge, C., Ramsvik, M., Svardal, A., Bohov, P., Skorve, J., et al. (2013). Afish protein hydrolysate alters fatty acid composition in liver and adipose tissue
and increases plasma carnitine levels in a mouse model of chronicinflammation. Lipids Health Disease, 12, 143.
Bligh, E. G., & Dyer, W. J. (1959). A rapid method of total lipid extraction andpurification. Canadian Journal of Biochemistry an Physiology, 37(8), 911–917.
Chang, N. W., & Huang, P. C. (1998). Effects of the ratio of polyunsaturated andmonounsaturated fatty acid to saturated fatty acid on rat plasma and liver lipidconcentrations. Lipids, 33(5), 481–487.
Chou, C. J., Affolter, M., & Kussmann, M. (2012). A nutrigenomics view of proteinintake: Macronutrient, bioactive peptides, and protein turnover. Progress inMolecular Biology and Translational Science, 108, 51–74.
Ekroos, K., Chernushevich, I. V., Simons, K., & Shevchenko, A. (2002). Quantitativeprofiling of phospholipids by multiple precursor ion scanning on a hybridquadrupole time-of-flight mass spectrometer. Analytical Chemistry, 74(5),941–949.
Ekroos, K., Ejsing, C. S., Bahr, U., Karas, M., Simons, K., & Shevchenko, A. (2003).Charting molecular composition of phosphatidylcholines by fatty acid scanningand ion trap MS3 fragmentation. Journal of Lipid Research, 44(11),2181–2192.
Erdmann, K., Cheung, B. W., & Schroder, H. (2008). The possible roles of food-derived bioactive peptides in reducing the risk of cardiovascular disease. Journalof Nutritional Biochemistry, 19(10), 643–654.
Fitzgerald, A., Rai, P., Marchbank, T., Taylor, G., Ghosh, S., Ritz, B., et al. (2005).Reparative properties of a commercial fish protein hydrolysate preparation. Gut,54, 775–781.
Grimstad, T., Bjorndal, B., Cacabelos, D., Aasprong, O. G., Janssen, E. A., Omdal, R.,et al. (2012). Dietary supplementation of krill oil attenuates inflammation andoxidative stress in experimental ulcerative colitis in rats. Scandinavian Journal ofGastroenterology, 47(1), 49–58.
Hosomi, R., Fukunaga, K., Arai, H., Kanda, S., Nishiyama, T., & Yoshida, M. (2011).Fish protein decreases serum cholesterol in rats by inhibition of cholesterol andbile acid absorption. Journal of Food Science, 76(4), H116–H121.
Je, J. Y., Park, P. J., Kwon, J. Y., & Kim, S. K. (2004). A novel angiotensin I convertingenzyme inhibitory peptide from Alaska pollack (Theragra chalcogramma) frameprotein hydrolysate. Journal of Agricultural and Food Chemistry, 52(26),7842–7845.
Jin, J., Ma, H., Zhou, C., Luo, M., Liu, W., Qu, W., et al. (2014). Effect of degree ofhydrolysis on the bioavailability of corn gluten meal hydrolysates. Journal of theScience of Food and Agriculture.
Kelleher, K. (2005). Discards in the world’s marine fisheries: An update. Rome, Italy:Food and Agriculture Organization of the United Nations (p. 131).
Kim, S.-K., & Mendis, E. (2006). Bioactive compounds from marine processingbyproducts – A review. Food Research International, 39, 383–393.
Kim, S. K., Ngo, D. H., & Vo, T. S. (2012). Marine fish-derived bioactive peptides aspotential antihypertensive agents. Advances in Food and Nutrition Research, 65,249–260.
Kolak, M., Gertow, J., Westerbacka, J., Summers, S. A., Liska, J., Franco-Cereceda, A.,et al. (2012). Expression of ceramide-metabolising enzymes in subcutaneousand intra-abdominal human adipose tissue. Lipids in Health and Disease,11(115).
Kotronen, A., Seppanen-Laakso, T., Westerbacka, J., Kiviluoto, T., Arola, J., Ruskeepaa,A. L., et al. (2009). Hepatic stearoyl-CoA desaturase (SCD)-1 activity anddiacylglycerol but not ceramide concentrations are increased in thenonalcoholic human fatty liver. Diabetes, 58(1), 203–208.
Larsen, R., Eilertsen, K. E., & Elvevoll, E. O. (2011). Health benefits of marine foodsand ingredients. Biotechnology Advances, 29(5), 508–518.
Leveille, G. A., Tillotson, J. A., & Sauberlich, H. E. (1963). Fatty acid composition ofplasma and liver lipid components as influenced by diet in the growing chick.Journal of Nutrition, 81, 357–362.
Liaset, B., Madsen, L., Hao, Q., Criales, G., Mellgren, G., Marschall, H. U., et al. (2009).Fish protein hydrolysate elevates plasma bile acids and reduces visceral adiposetissue mass in rats. Biochimica et Biophysica Acta, 1791(4), 254–262.
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression datausing real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods,25(4), 402–408.
Madeira, M. S., Pires, V. M., Alfaia, C. M., Luxton, R., Doran, O., Bessa, R. J., et al.(2014). Combined effects of dietary arginine, leucine and protein levels on fattyacid composition and gene expression in the muscle and subcutaneous adiposetissue of crossbred pigs. British Journal of Nutrition, 111(9), 1521–1535.
Madsen, L., Rustan, A. C., Vaagenes, H., Berge, K., Dyroy, E., & Berge, R. K. (1999).Eicosapentaenoic and docosahexaenoic acid affect mitochondrial andperoxisomal fatty acid oxidation in relation to substrate preference. Lipids,34(9), 951–963.
Mauvoisin, D., & Mounier, C. (2011). Hormonal and nutritional regulation of SCD1gene expression. Biochimie, 93(1), 78–86.
Merrill, A. H., Jr., Sullards, M. C., Allegood, J. C., Kelly, S., & Wang, E. (2005).Sphingolipidomics: High-throughput, structure-specific, and quantitativeanalysis of sphingolipids by liquid chromatography tandem massspectrometry. Methods, 36(2), 207–224.
Nakamura, M. T., & Nara, T. Y. (2004). Structure, function, and dietary regulation ofdelta6, delta5, and delta9 desaturases. Annual Review of Nutrition, 24, 345–376.
Nishi, T., Hara, H., Asano, K., & Tomita, F. (2003). The soybean beta-conglycinin beta51–63 fragment suppresses appetite by stimulating cholecystokinin release inrats. Journal of Nutrition, 133(8), 2537–2542.
Peluffo, R. O., Nervi, A. M., Gonzalez, M. S., & Brenner, R. R. (1984). Effect of differentamino acid diets on delta 5, delta 6 and delta 9 desaturases. Lipids, 19(2),154–157.
R. Vik et al. / Food Chemistry 183 (2015) 101–110 109
Pilon, G., Ruzzin, J., Rioux, L. E., Lavigne, C., White, P. J., Froyland, L., et al. (2011).Differential effects of various fish proteins in altering body weight, adiposity,inflammatory status, and insulin sensitivity in high-fat-fed rats. Metabolism,60(8), 1122–1130.
Rustad, T. (2003). Utilisation of marine by-products. Electronic Journal ofEnvironmental, Agricultural and Food Chemistry, 2, 458–463.
Shukla, A., Bettzieche, A., Hirche, F., Brandsch, C., Stangl, G. I., & Eder, K. (2006).Dietary fish protein alters blood lipid concentrations and hepatic genesinvolved in cholesterol homeostasis in the rat model. British Journal ofNutrition, 96(4), 674–682.
Sjogren, P., Sierra-Johnson, J., Gertow, K., Rosell, M., Vessby, B., de Faire, U., et al.(2008). Fatty acid desaturases in human adipose tissue: Relationships betweengene expression, desaturation indexes and insulin resistance. Diabetologia,51(2), 328–335.
Skorve, J., al-Shurbaji, A., Asiedu, D., Bjorkhem, I., Berglund, L., & Berge, R. K. (1993).On the mechanism of the hypolipidemic effect of sulfur-substituted
hexadecanedioic acid (3-thiadicarboxylic acid) in normolipidemic rats. Journalof Lipid Research, 34(7), 1177–1185.
Small, G. M., Burdett, K., & Connock, M. J. (1985). A sensitive spectrophotometricassay for peroxisomal acyl-CoA oxidase. The Biochemical Journal, 227(1),205–210.
Stahlman, M., Ejsing, C. S., Tarasov, K., Perman, J., Boren, J., & Ekroos, K. (2009). High-throughput shotgun lipidomics by quadrupole time-of-flight massspectrometry. Journal of Chromatography. B, Analytical Technologies in theBiomedical and Life Science, 877(26), 2664–2672.
Summers, S. A. (2006). Ceramides in insulin resistance and lipotoxicity. Progress inLipid Research, 45(1), 42–72.
Vik, R., Bjorndal, B., Bohov, P., Brattelid, T., Svardal, A., Nygard, O. K., et al. (2014).Hypolipidemic effect of dietary water-soluble protein extract from chicken:Impact on genes regulating hepatic lipid and bile acid metabolism. EuropeanJournal of Nutrition.
110 R. Vik et al. / Food Chemistry 183 (2015) 101–110
II
A Salmon Protein Hydrolysate Exerts Lipid-IndependentAnti-Atherosclerotic Activity in ApoE-Deficient MiceCinzia Parolini1*., Rita Vik2*., Marco Busnelli1, Bodil Bjørndal2, Sverre Holm3, Trond Brattelid4,
Stefano Manzini1, Giulia S. Ganzetti1, Federica Dellera1, Bente Halvorsen3, Pal Aukrust3,
Cesare R. Sirtori1, Jan E. Nordrehaug5, Jon Skorve2, Rolf K. Berge2,5, Giulia Chiesa1
1Department of Pharmacological and Biomolecular Sciences, Universita degli Studi di Milano, Milan, Italy, 2Department of Clinical Science, University of Bergen, Bergen,
Norway, 3 Research Institute of Internal Medicine, Rikshospitalet University Hospital, Oslo, Norway, 4National Institute of Nutrition and Seafood Research, NIFES, Bergen,
Norway, 5Department of Heart Disease, Haukeland University Hospital, Bergen, Norway
Abstract
Fish consumption is considered health beneficial as it decreases cardiovascular disease (CVD)-risk through effects on plasmalipids and inflammation. We investigated a salmon protein hydrolysate (SPH) that is hypothesized to influence lipidmetabolism and to have anti-atherosclerotic and anti-inflammatory properties. 24 female apolipoprotein (apo) E2/2 micewere divided into two groups and fed a high-fat diet with or without 5% (w/w) SPH for 12 weeks. The atherosclerotic plaquearea in aortic sinus and arch, plasma lipid profile, fatty acid composition, hepatic enzyme activities and gene expressionwere determined. A significantly reduced atherosclerotic plaque area in the aortic arch and aortic sinus was found in the 12apoE2/2 mice fed 5% SPH for 12 weeks compared to the 12 casein-fed control mice. Immunohistochemical characterizationof atherosclerotic lesions in aortic sinus displayed no differences in plaque composition between mice fed SPH compared tocontrols. However, reduced mRNA level of Icam1 in the aortic arch was found. The plasma content of arachidonic acid(C20:4n-6) and oleic acid (C18:1n-9) were increased and decreased, respectively. SPH-feeding decreased the plasmaconcentration of IL-1b, IL-6, TNF-a and GM-CSF, whereas plasma cholesterol and triacylglycerols (TAG) were unchanged,accompanied by unchanged mitochondrial fatty acid oxidation and acyl-CoA:cholesterol acyltransferase (ACAT)-activity.These data show that a 5% (w/w) SPH diet reduces atherosclerosis in apoE2/2 mice and attenuate risk factors related toatherosclerotic disorders by acting both at vascular and systemic levels, and not directly related to changes in plasma lipidsor fatty acids.
Citation: Parolini C, Vik R, Busnelli M, Bjørndal B, Holm S, et al. (2014) A Salmon Protein Hydrolysate Exerts Lipid-Independent Anti-Atherosclerotic Activity inApoE-Deficient Mice. PLoS ONE 9(5): e97598. doi:10.1371/journal.pone.0097598
Editor: Andrea Cignarella, University of Padova, Italy
Received November 20, 2013; Accepted April 22, 2014; Published May 19, 2014
Copyright: � 2014 Parolini et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permitsunrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This work was supported by grants from NordForsk, grant no. 070010, MitoHealth; the Research Council of Norway, grant no. 190287/110; and theEuropean Community’s Seventh Framework Programme (FP7/2007-2013) AtheroRemo, grant no. 201668. The funders had no role in study design, data collectionand analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: [email protected] (CP); [email protected] (RV)
. These authors contributed equally to this work.
Introduction
Cardiovascular disease (CVD) is responsible for approximately
16–17 million deaths annually, making it the leading cause of
mortality in Western countries [1,2]. The disease encompasses
conditions such as coronary artery disease, carotid and cerebral
atherosclerotic disease and peripheral artery atherosclerosis
resulting in chronic and acute ischemia in affected organs. The
underlying pathological process is lipid accumulation leading to
atherosclerosis, a slowly progressing chronic disorder of large and
medium-sized arteries that can lead to intravascular thrombosis
with subsequent development of complications like myocardial
infarction (MI), stroke and acute ischemia of the limb [3]. In the
last years, inflammation has emerged as an additional key factor in
the development of atherosclerosis and seems to be involved in all
stages, from the small inflammatory infiltrate in the early lesions,
to the inflammatory phenotype characterizing an unstable and
rupture-prone atherosclerotic lesion [4]. In fact, today atheroscle-
rosis is regarded as a disorder characterized by a status of non-
resolved inflammation, with bidirectional interaction between
lipids and inflammation as a major phenotype. Inflammation in
atherosclerosis leads to activation of endothelial cells, enhanced
expression of adhesion molecules, inflammatory cytokines and
macrophage accumulation.
Liver is the main organ regulating lipid metabolism, affecting
blood lipids, especially plasma triacylglycerols (TAG) [5]. Recent-
ly, investigators have suggested that the liver plays a key role in the
inflammatory state of an individual [6,7], and that dietary
cholesterol absorbed by the liver contributes to inflammation
[8]. Research into atherosclerosis has led to many compelling
discoveries about the mechanisms of the disease and together with
lipid abnormalities and chronic inflammation, oxidative stress has
a crucial involvement in the initiation and progression of
atherosclerosis [9].
Improvement of life style and dietary habits can reduce some
risk factors such as high levels of low density lipoprotein (LDL)-
cholesterol, TAG and inflammatory molecules [10]. Fish con-
sumption is consider health beneficial as it lowers plasma lipids
PLOS ONE | www.plosone.org 1 May 2014 | Volume 9 | Issue 5 | e97598
and attenuates inflammation [11]. This is linked to the long-
chained n-3 polyunsaturated fatty acids (PUFA) content, in
particular eicosapentaenoic acid (EPA) and docosahexaenoic acid
(DHA). However, fish protein is a rich source of bioactive peptides
with valuable nutraceutical and pharmaceutical potentials beyond
that of n-3 PUFAs [11]. Fish protein hydrolysates are generated by
enzymatic conversion of fish proteins into smaller peptides, which
normally contain 2–20 amino acids. In recent years, fish protein
hydrolysates have attracted much attention from food scientists
due to a highly balanced amino acid composition, as well as the
presence of bioactive peptides [12]. The organic acid taurine is
mainly found in marine proteins, and is suggested to induce
cholesterol-lowering effect by increasing excretion through bile,
thus potentially exerting an anti-atherosclerotic effect [13]. Recent
studies show TAG-lowering effects [14,15], antioxidant capacity
[12], antihypertensive [11] and cholesterol-lowering effects
[16,17], and potential to reduce markers of reactive oxygen
species [18] from fish protein. Therefore, fish protein hydrolysates
have been implicated in several processes with potential anti-
atherogenic effects. In this study, we examined the anti-athero-
sclerotic potential of a salmon protein hydrolysate (SPH) on
atherosclerotic development in apolipoprotein E-knockout
(apoE2/2) mice.
Materials and Methods
Experimental DesignThe study was conducted according to national (D.L. 116, G.U.
Suppl. 40, February 18, 1992, Circolare No. 8, G.U July 1994)
and international laws and policies (EEC Council Directive 2010/
63, September 22, 2010: Guide for the Care and Use of
Laboratory Animals, United States National Research Council,
2011). The Italian Ministry of Health approved the protocol (nu04/2012).
24 female apoE2/2 mice from the breeding strain C57BL/6, 8
weeks old, were purchased from Charles River Laboratories
(Calco, Italy), and kept under standard laboratory conditions (12
hours light cycle, temperature 2261uC, humidity 5565%), with
free access to standard chow and tap water. After 1 week of
acclimatization under these conditions, mice were randomly
divided into two groups of 12 mice. Although apoE2/2 mice
spontaneously develop atherosclerosis, both groups were fed a
high-fat diet (23.7% w/w) consisting of 21,3% lard (Ten Kate
Vetten BV, Musselkanaal, Netherlands) and 2.4% soy oil (Dyets.
Inc., Betlehem, PA, USA) to accelerate the atherosclerotic
formation. The control diet contained 21% w/w casein as protein
source, whereas 5% casein was replaced with an equal amount of
salmon protein hydrolysate (SPH) (Marine Bioproducts, Storebø,
Norway) in the intervention diet. The SPH was produced by
enzymatic hydrolysis from salmon by-products (spine) using
controlled autolysis with an alkaline protease and a neutral
protease, and the resulting protein hydrolysate was then subjected
to a second enzymatic treatment with an acid protease A. The
final hydrolysate was fractionated using micro- and ultra- filtration
and the size distribution of the peptides was analysed. The final
preparation consisted of peptides ,1200 Da and 25% of the
peptides were below 200 Da. The diets were isocaloric containing
21% protein, 24% fat, 42% carbohydrates and 6% micronutrients,
and administered for 12 weeks. Other diet ingredients were from
Dyets. Inc., and the full composition of the diets, as well as amino
acid composition, is given in Table S1.
Harvesting of TissueDuring the treatment period, blood samples were collected at
day 1 and after 77 days from the retro-orbital plexus into tubes
containing 0.1% (w/v) EDTA after an overnight fast. Blood
samples were chilled on ice for at least 15 minutes and stored at 280uC until analyses.
After 12 weeks of treatment, mice were sacrificed under general
anaesthesia with 2% isoflurane (Forane, from Abbot Laboratories
Ltd, Illinois, USA) and blood was removed by perfusion with
phosphate-buffered saline (PBS). Aorta was rapidly dissected from
the aortic root to the iliac bifurcation, periadventitial fat and
connective tissue was removed as much as possible. Aorta was
longitudinally opened pinned flat on a black wax surface in ice-
cold PBS, photographed unstained [19] for subsequent plaque
quantification (see En face analysis), and then immediately put in a
tissue-freezing medium, snap-frozen in liquid nitrogen and stored
at 280uC. For histological/immunohistochemical analysis, six
hearts from each group were removed, fixed in 10% formalin for
30 min and transferred into PBS containing 20% sucrose (w/v)
overnight at 4uC before being embedded in OCT compound
(Sakura Finetek Euope B.V., Alphen aan den Rijn, The Nether-
lands) and stored at280uC. An equal subset of hearts and all livers
were immediately snap-frozen in liquid nitrogen for subsequent
analyses.
En Face AnalysisAorta images were recorded with a stereomicroscope-dedicated
camera (IC80 HD camera, MZ6 microscope, Leica Microsystems,
Germany) and analysed using ImageJ image processing program
(http://rsb.info.nih.gov/ij/). An operator blinded to dietary
treatment quantified the atherosclerotic plaques.
Aortic Sinus Histology/immunohistochemistrySerial cryosections (7 mm thick) of the aortic sinus were cut.
Approximately 25 slides with 3 cryosections/slide were obtained,
spanning the three cusps of the aortic valves. Every fifth slide was
fixed and stained with hematoxylin and eosin (Bio-Optica, Milano,
Italy) to detect plaque area. Plaque area was calculated as the
mean area of those sections showing the three cusps of the aortic
valves. Adjacent slides were stained to characterize plaque
composition. Specifically, Masson’s Trichrome (04-010802, Bio-
Optica, Milano, Italy) was used to detect extracellular matrix
deposition and Oil red O staining (Sigma-Aldrich, St. Louis, MO,
USA) was used to detect intraplaque neutral lipids.
Macrophages and T-lymphocytes were detected using an anti-
F4/80 antibody (ab6640, Abcam, Cambridge, UK), and an anti-
CD3 antibody (ab16669, Abcam, Cambridge, UK), respectively.
A biotinylated secondary antibody was used for streptavidine-
biotin-complex peroxidase staining (Vectastain Abc Kit, Vector
Laboratories, Peterborough, UK). 3,39-Diaminobenzidine was
used as chromogen (Sigma-Aldrich, St. Louis, MO, USA), and
sections were counterstained with hematoxylin (Gill’s Hematox-
ylin, Bio-Optica, Milano, Italy). To acquire and process digital
images an Aperio ScanScope GL Slide Scanner (Aperio Technol-
ogies, Vista, CA, USA), equipped with a Nikon 206/0.75 Plan
Apochromat objective producing a 0.25 mm/pixel scanning
resolution with a 406magnification and the Aperio ImageScope
software (version 8.2.5.1263) was used. A blinded operator to the
study quantified plaque area, extracellular matrix and lipid
deposition, as well as inflammatory cell infiltrate. The amount of
extracellular matrix, lipids, macrophages and T-lymphocytes was
expressed as percent of the stained area over the total plaque area.
Salmon Protein Hydrolysate Reduces Atherosclerosis
PLOS ONE | www.plosone.org 2 May 2014 | Volume 9 | Issue 5 | e97598
Plasma Lipid and Fatty Acid Composition MeasurementsEnzymatically measurements of plasma lipids were performed
with an automated method for direct measurement of lipids on a
Hitachi 917 system (Roche Diagnostics GmbH, Mannheim,
Germany) using triacylglycerol (GPO-PAP), total- and free
cholesterol kits (CHOD-PAP) from Roche Diagnostics, and
phospholipids FS kit and a non-esterified fatty acids (NEFA) kit
from DiaSys (Diagnostic Systems GmbH, Holzheim, Germany).
Total plasma fatty acid composition was analyzed as previously
described [20].
Gene Expression in Liver, Heart and AortaTotal cellular RNA was purified from 20 mg liver, total
homogenized heart and pooled aorta samples from six mice using
the RNeasy kit and the protocol for purification of total RNA from
animal cells and fibrous tissue (Qiagen GmbH, Hilden, Germany),
as described by Vigerust et al. and Strand et al., respectively
[21,22]. cDNA was obtained as described by Strand et al. [22].
Real-time PCR was performed on an ABI prism 7900 H sequence
detection system (Applied Biosystems, Foster City, CA, USA) using
384-well multiply PCR plates (Sarstedt Inc., Newton, NC, USA)
and probes and primers from Applied Biosystems, Foster City,
CA, USA as described by Strand et al. [22]. The primers used are
listed in Table S2. Six different reference genes were included for
liver: 18s (Kit-FAM-TAMRA (Reference RT-CKFT-18s)) from
Eurogentec (Seraing, Belgium), ribosomal protein, large, P0
(Rplp0, AX-061958-00-0100), hypoxanthine guanine phosphor-
ibosyltransferase 1 (Hprt1, AX-045271-00), ribosomal protein,
large, 32 (Rpl32, AX-055111-00), polymerase (RNA)II(DNA
directed) polypeptide A, (Polr2a, AX-046005-00) and TATA-box
binding protein (Tbp, AX-041188-00) all five from Thermo Fisher
Scientific Inc. (Waltham, MA, USA). For the heart 18s, Rplp0 and
Hprt1 were used, and for aorta 18s, Rplp0, Rpl32 and Hprt1. The
software GeNorm (http://www.gene-quantification.de/hkg.html)
was used to evaluate the reference genes, and data normalized to
Rplp0 and Rpl32 for liver, Hprt1 for heart and Rplp0 and Hprt1 for
aorta, are presented.
Hepatic Enzyme ActivitiesLivers were homogenized and the post-nuclear fraction isolated
as described earlier [23]. The assay for carnitine palmitoyltrans-
ferase (CPT)-2 was performed according to Bremer [24] and
Skorve et al. [25], but with some modifications: the reaction mix
contained 17.5 mM HEPES pH 7.5, 52.5 mM KCl, 5 mM KCN,
100 mM palmitoyl-CoA and 0.01% Triton X-100. The reaction
was initiated with 100 mM [methyl-14C]-L-carnitine (1100 cpm/
gmol), and 35 mg total protein was used. Palmitoyl-CoA oxidation
was measured in the post-nuclear fraction from liver as acid-
soluble products [26]. The activity of fatty acyl-CoA oxidase
(ACOX)-1 and acyl-CoA: cholesterol transferase (ACAT) were
measured in post-nuclear fractions as described by Madsen et al.
[26] and Field et al. [27], respectively.
Measurements of Plasma Inflammatory MarkersLevels of interleukin (IL)-1b, IL-6, IL-10, tumor necrosis factor
(TNF)-a and granulocyte-macrophage colony-stimulating factor
(GM-CSF) were analyzed on plasma samples collected at day 77 of
treatment by Multiplex suspension technology using a customized
Bio-Plex Pro Mouse assay (Bio-Rad Laboratories, Hercules, CA).
Statistical AnalysisThe results are presented as mean with standard deviation (SD)
for 4–12 mice per group. Normal distribution was assessed by the
Kolmogorov-Smirnov test. Unpaired Student’s t-test was used to
evaluate statistical differences between groups; Mann-Whitney test
was applied when data were not normally distributed. A value of
P,0.05 was considered statistically significant. Statistical analyses
were performed using Prism Software (GraphPad Prism version
5.0; GraphPad Prism, San Diego, CA, USA).
Results
The SPH-diet Decreased Atherosclerotic PlaqueDevelopmentAfter 12 weeks on a high-fat diet, 5% SPH-fed mice displayed a
weight gain similar to the control group. At sacrifice, the average
weight gain was 5.9861.78 g (mean 6 SD) in controls and
5.0460.88 g in SPH mice (P.0.05). A significantly lower plaque
development was observed in the aortic arch in SPH-fed mice
compared to control mice (0.5560.33 vs. 1.6360.996106 mm2;
Fig. 1, corresponding to 0.9160.55 vs. 2.7261.72% of the aortic
surface covered by plaque). There were no differences in thoracic
(1.0860.47 vs. 0.8560.416106 mm2; Fig. 1, corresponding to
1.7160.84 vs. 1.4160.68% of the aortic surface covered by
plaque) or abdominal aorta sections (0.8160.53 vs.
0.7860.536106 mm2; Fig. 1, corresponding to 1.3660.89 vs.
1.2960.88% of the aortic surface covered by plaque).
A significant reduction in lesion area was observed at the aortic
sinus of mice fed SPH compared to controls (1.2760.416105 mm2
vs. 2.0260.316105 mm2; Fig. 2A–C). Plaque stability is an
important factor concerning the severity of atherosclerosis.
However, histological/immunohistochemical characterization of
atherosclerotic lesions displayed no significant difference in plaque
composition between mice fed SPH and controls, showing a
comparable percentage of area occupied by extracellular matrix
(34.5660.56% vs. 30.31618.25%; Fig. 2D–F), lipids
(74.0667.48% vs. 79.6866.45%; Fig. 2G–I), macrophages
(64.4764.47% vs. 60.5763.71%; Fig. 2J–L), and lymphocytes
(27.36611.73% vs. 22.6267.24%; Fig. 2M–O).
Inflammation and oxidative stress are strong contributing
factors in atherosclerosis, thus gene expression of inflammatory
markers and redox regulators in aorta and heart were measured.
Accompanied by decreased plaque area in sinus and aortic arch,
mRNA level of intracellular adhesion molecule (Icam1) was
decreased with 59.54%, in addition to a small decrease in
expression of vascular cell adhesion molecule (Vcam1) and
monocyte chemoattractant protein 1 (Mcp1) in pooled aortic arch
from six mice, whereas mRNA level of inducible nitric oxidase 2
(Nos2) was not modified by the dietary treatment with SPH
(Fig. 3A). In contrast, no changes were found in gene expression
in the heart of Icam1, Vcam1, Mcp1, Nos2 or Tnfa, nor of the
antioxidant markers superoxide dismutase 1, soluble (Sod1),superoxide dismutase 2, mitochondrial (Sod2) or catalase (Cat)(data not shown).
Decreased Plasma Levels of Inflammatory MarkersTo further elucidate the potential anti-inflammatory effects of
SPH in this experimental model of atherosclerosis, we examined
plasma levels of inflammatory mediators. As shown in Fig. 3B–F,levels of IL-1b, IL-6, IL-10, TNF-a and GM-CSF were
significantly lower in SPH-treated mice compared to controls.
SPH-intervention Affected Hepatic mRNA ExpressionInvolved in LipogenesisHyperlipidemia is closely linked to atherosclerotic development.
Liver is the main tissue regulating lipid metabolism, and
mitochondrial b-oxidation is important in regulating plasma
Salmon Protein Hydrolysate Reduces Atherosclerosis
PLOS ONE | www.plosone.org 3 May 2014 | Volume 9 | Issue 5 | e97598
TAG. Hepatic gene expression showed a significant downregula-
tion in mRNA level of Acaca in SPH-fed mice (Fig. 4A). Moreover,
the mRNA level of Scd1 was significantly downregulated as well
(Fig. 4B).
Noteworthy, SPH administration had no effect on palmitoyl-
CoA oxidation in the presence and absence of malonyl-CoA (Fig.A in Table S1), nor on mitochondrial and peroxisomal fatty acid
oxidation as the enzyme activities of CPT2 and ACOX1,
respectively, were unchanged (Fig. B and C in Figure S1).ACAT activity, involved in cholesteryl ester synthesis, was also
unaltered (Fig. D in Figure S1).
Effects of SPH on Lipid Concentration and Fatty AcidComposition in PlasmaIn order to evaluate the effect of SPH treatment on plasma lipid
concentration, blood was collected for enzymatic measurement of
lipid profile after 77 days of dietary treatment. As shown in
Table 1, plasma total- and free-cholesterol, as well as TAG,
cholesteryl esters and phospholipids concentrations displayed
comparable levels between SPH-group and control group at the
end of treatment period, whereas NEFAs increased in SPH-fed
mice vs. controls (Table 1). Moreover, no difference was observed
between the two groups in the relative amount of saturated fatty
acids (SFA) (Table 2). The relative amount of monounsaturated
fatty acids (MUFA) in SPH-fed mice was slightly lower than
controls at day 77, mainly due to a small decrease in 18:1n-9 (oleic
acid) and 18:1n-7 (vaccenic acid) (Table 2). Total n-6 PUFAs
displayed a higher amount after 77 days of treatment in the SPH-
group, probably due to the increase of C18:2n-6 (linoleic acid) and
C20:4n-6 (arachidonic acid) compared to controls. In contrast, no
differences were detected in the weight % of n-3 PUFAs between
the two groups. As a consequence, a small reduction in n-3/n-6
ratio was observed after 77 days. Overall, the effect of the SPH-
diet on plasma lipids and fatty acids was modest.
Discussion
Fish intake is inversely correlated to CVD-risk factors in both
observational and clinical interventional trials [28]. Particular
attention has been drawn to the cardio-protective effects of fatty
fish species with high levels of omega-3 PUFAs through their lipid-
lowering, anti-inflammatory, antiplatelet and antiarrhythmic
mechanisms [29,30]. Marine organisms are also a rich source of
bioactive proteins and peptides that may induce health benefits
through antihypertensive and antioxidative [28], immunomodu-
lating [31] and lipid-lowering effects [14,17]. Thus, marine
proteins and peptides have been shown to influence the two
major risks for atherosclerotic development, namely hyperlipid-
emia and inflammation. Therefore, it was of interest to investigate
a potential anti-atherosclerotic effect of SPH-diet in apoE2/2 mice
fed a high-fat diet. Although these mice spontaneously develop
atherosclerosis on a standard rodent diet, a high-fat diet regimen,
Figure 1. Atherosclerotic plaque level in apoE2/2 mice fed a high-fat diet (control) or a diet with 5% SPH. After 12 weeks of dietarytreatment, whole aorta was collected and en-face analysis was performed to quantify aortic surface covered by atherosclerotic plaques. Bars representmeans 6 SD of 12 mice for each diet. Unpaired t-test was used to detect statistical significance (*P,0.05).doi:10.1371/journal.pone.0097598.g001
Salmon Protein Hydrolysate Reduces Atherosclerosis
PLOS ONE | www.plosone.org 4 May 2014 | Volume 9 | Issue 5 | e97598
combined with female mice, was preferred to accelerate the
progression. We showed that apoE2/2 mice fed a high-fat diet
containing 5% (w/w) SPH for 12 weeks developed less athero-
sclerotic plaques compared to controls. In particular, we observed
a significant reduction of plaque area in the aortic arch as well as
in the aortic sinus. The pathophysiological complication of
atherosclerosis is plaque rupture causing heart attack and stroke
in humans. Vulnerability of plaque rupture is an important
element in the fatal outcomes of atherosclerosis, and content and
stability of the plaque is therefore of interest. However, there was
no change in aortic sinus plaque composition of connective tissue,
macrophages or lymphocytes, indicating that SPH had no effect
on plaque stability. Unfortunately, apoE2/2 mice are not
susceptible to the progress of plaque rupture unless treated with
a high-fat diet for over a year, thus studying plaque stability in this
model is limited.
During plaque development, accumulation of adhesion mole-
cules contributes to foam cell formation. In addition to decreased
plaque area in aortic arch, a decrease in expression of the adhesion
molecule Icam1, as well as a small reduction in Vcam1 and the
chemokine Mcp1, was detected in pooled aortic arch of SPH-
treated mice, suggesting a local anti-atherosclerotic effect of the
SPH-diet. The plaque area decreased, but no reduction in number
of macrophages was observed with immunostaining in the aortic
sinus. This could be due to a simultaneous decrease in number of
macrophages and plaque area, which would not be reflected in a
percentage measurement. The mRNA level of inflammatory
markers in heart was unaltered, and could explain the unchanged
levels of macrophages. However, mRNA levels were measured in
total heart that may weaken a potential reduction of these
inflammatory markers. The decrease in sinus plaque area, without
a change of macrophages could also be explained by shrinkage of
the lipid-rich core due to fewer lipids, thus the macrophages
decrease in size.
Liver is the main organ regulating lipoprotein metabolism,
including plasma TAG and cholesterol levels, and a high dietary
cholesterol intake has been reported to elevate liver inflammation
[8]. Noteworthy, the plasma concentrations of cholesterol and
TAG were not affected by SPH-treatment. This was accompanied
by unchanged fatty acid oxidation and ACAT activity. These
results are in contrast with previous reports showing cholesterol-
lowering effects of fish protein hydrolysates in both rats and mice
[14,16]. Although gene expressions of Acaca and the D9-desaturaseScd1 were decreased, it did not affect plasma TAG in apoE2/
2mice. This lack of effect could be explained, at least partially, by
the lower amount of fish protein used in the present study (5%)
compared to previous studies, where 10–25% fish protein
hydrolysate were applied [14,16,17]. In C57BL/6 mice fed 5%
Figure 2. Histological and immunohistochemical characterization of plaques in the aortic sinus in apoE2/2 mice fed a high-fat diet(control) or a diet with 5% SPH for 12 weeks. Representative photomicrographs and quantification of maximum plaque area (panels A–C).Representative photomicrographs and quantification of extracellular matrix deposition (panels D–F), Lipid deposition (panels G–I), Macrophages(panels J–L) and T lymphocytes (panels M–O). The amount of extracellular matrix, lipids, macrophages and T-lymphocytes is expressed as percentageof the stained area over the total plaque area. Bar in panel A = 100 mm. Positive area (%) refers to the percentage of the plaque area occupied byconnective tissue, lipids, macrophages and T lymphocytes, respectively. Data are shown as means 6 SD for 6 mice for each diet and unpaired t-testwas used to detect significance (*P,0.05).doi:10.1371/journal.pone.0097598.g002
Salmon Protein Hydrolysate Reduces Atherosclerosis
PLOS ONE | www.plosone.org 5 May 2014 | Volume 9 | Issue 5 | e97598
SPH for 6 weeks, a 32% decrease in plasma TAG has been found,
but no change in plasma cholesterol (data to be published). Thus,
in the present study, the disturbed plasma lipid transport in the
apoE2/2 mouse model might have interfered with the potential
TAG-lowering mechanism of SPH, while cholesterol-lowering
effect might not be expected at this dose. A lower cholesterol level
has been observed in animal studies when taurine was added in the
diets [32,33]. However, in our study, the cholesterol level was not
affected after intervention despite the presence of taurine in the
SPH-diet.
The plasma level of NEFAs was unchanged by SPH adminis-
tration and only minor alterations were observed in plasma fatty
acid composition. During the 12 weeks of feeding the plasma level
of MUFAs was slightly lower in the SPH-fed group, but this was
probably not of biological significance. Total n-6 PUFAs in plasma
was higher in SPH-fed mice at the end-point measurement.
Figure 3. Levels of mRNA expression in aorta and inflammatory mediators in plasma in apoE2/2 mice fed a high-fat diet (control) ora diet with 5% SPH for 12 weeks. (A) The gene expressions of the inflammatory markers Icam1, Vcam1, Nos2 and Mcp1 were measured in pooledaortic arch from six mice. Inflammatory markers in blood samples collected at day 77 of treatment were analysed (B) IL-1b, (C) IL-6, (D) IL-10, (E) TNF-a,(F) GM-CSF and bars represent means6 SD of 4 pooled samples of 3 mice for each diet. Unpaired t-test was used to assess statistical significance andresults significantly different from control are indicated (*P,0.05, **P,0.01).doi:10.1371/journal.pone.0097598.g003
Figure 4. Hepatic gene expression in apoE2/2 mice fed a high-fat diet (control) or a diet with 5% SPH for 12 weeks. Hepatic mRNAlevels of (A) Acaca and (B) Scd1. Data for gene expressions are shown as mean values relative to control6 SD for 4 mice for each diet. Mann-Whitneytest was used to assess statistical significance (*P,0.05).doi:10.1371/journal.pone.0097598.g004
Salmon Protein Hydrolysate Reduces Atherosclerosis
PLOS ONE | www.plosone.org 6 May 2014 | Volume 9 | Issue 5 | e97598
Arachidonic acid and oleic acid was increased and decreased in
the SPH group and controls, respectively, after the feeding period.
The increase in arachidonic acid and linoleic acid with a
simultaneously decrease in oleic acid might be due to increased
synthesis of arachidonic acid and linoleic acid from their precursor
oleic acid. Although arachidonic acid is considered pro-inflam-
matory [34], we detected reduction in plaque area in aortic arch
and sinus, suggesting that SPH reduced atherosclerotic activity
independent of the plasma arachidonic acid level. n-3 PUFAs, the
n3/n6 ratio and anti-inflammatory index were not affected by
SPH feeding, which is in contrast to previous findings [35].
However, as stated previously, in the current study we used a
smaller amount of fish protein (5% vs. 15%) and the mouse model
could also influence the effect on fatty acid composition. Knockout
of the apoE gene causes an abnormal plasma lipid composition
and metabolism, which apparently this SPH-diet cannot counter-
act.
Cytokines play a key role in the progression of atherosclerosis
and it was of interest to note that the reduction in plaque area in
the aortic arch was accompanied by a lowering of inflammatory
markers in plasma, as reported in another study using salmon
protein on inflammatory bowel disease in rats [18]. Peroxisome
proliferator-activated receptors (PPAR), which are ligand-depen-
dent transcriptional factors regulating both fatty acid [36] and
amino acid metabolism [37], are shown to exert anti-inflammatory
potential by inhibiting expression of cytokines and other pro-
inflammatory factors [38]. The mechanism is unclear, but Zhu
et al. has recently shown that marine peptides may act as PPAR-
agonists and exert an anti-inflammatory effect [39]. Altogether,
these results suggest that SPH administration might prevent
atherosclerotic development by inhibiting activation of systemic
inflammation.
A small dose of SPH 3.5% in rats has been shown to potentially
exert antioxidant activities by reducing markers for oxidative stress
in colon [18]. In the current study, gene expressions of the
Table 1. Plasma lipids in apoE2/2 mice fed a high-fat casein diet (control) or a high-fat diet with 5% SPH after 77 days of dietarytreatment.
1Lipid class Day 77
Control SPH
Cholesterol 1260.9 1161.0
TAGs 1.460.1 1.360.1
Phospholipids 3.060.1 3.060.1
NEFAs 0.860.2 1.160.1*
Cholesteryl esters 8.160.8 7.960.8
Free Cholesterol 3.760.1 3.460.2
1mmol/L.Data are shown as mean 6 SD (n= 4).Abbreviations: NEFA, non-esterified fatty acid; SPH, salmon protein hydrolysate; TAG, triacylglycerol.*P,0.05 vs. control.doi:10.1371/journal.pone.0097598.t001
Table 2. Plasma fatty acid composition in apoE2/2 mice fed a high-fat casein diet (control) or a high-fat diet with 5% SPH after 77days of dietary treatment.
1Fatty acids Control SPH
gSFAs 3260.5 3460.5
gMUFAs 3160.4 3060.4*
C18:1n-9 (oleic acid) 2560.4 2460.5
C18:1n-7 (vaccenic acid) 1.360.0 1.260.0*
n-6 PUFAs 2860.4 3060.4**
C18:2n-6 (linoleic acid) 1560.1 1660.2***
C20:4n-6 (arachidonic acid) 1260.4 1360.2*
n-3 PUFAs 6.460.3 6.360.3
C20:5n-3 (eicosapentaenoic acid) 0.5360.0 0.460.0
C22:6n-3 (docosahexaenoic acid) 5.060.3 5.060.2
n-3/n-6 0.260.0 0.260.0*
1Fatty acids (% w/w).Data are shown as mean 6 SD (n= 4).Abbreviations: MUFAs, monounsaturated fatty acids; PUFAs, polyunsaturated fatty acids; SFAs, saturated fatty acids; SPH, salmon protein hydrolysate.*P,0.05 vs. control.**P,0.01 vs. control.***P,0.001 vs. control.doi:10.1371/journal.pone.0097598.t002
Salmon Protein Hydrolysate Reduces Atherosclerosis
PLOS ONE | www.plosone.org 7 May 2014 | Volume 9 | Issue 5 | e97598
antioxidants Sod1, Catalase and Nos2 in the heart were unchanged
by SPH administration, suggesting that SPH did not affect the
antioxidant defence system in the heart of apoE2/2 mice.
Although the present study has some limitations, such as absent
protein data on inflammatory mediators within the aortic lesions,
it gives indication that a salmon protein source may have a
protective role in atherosclerotic development through mecha-
nisms linked to inhibition of inflammation, and not directly related
to plasma lipid changes. Although the apoE2/2 mice model has
been used extensively in experiments studying atherosclerosis as it
gives the opportunity to study genetic influence on atherosclerosis
without using a high-fat diet rich in cholesterol, it is also a
challenging model to use. These mice develop severe atheroscle-
rosis due to accumulation of VLDL in plasma carrying most of the
cholesterol. VLDL, containing apoB-48, is considered more
atherogenic than the apoB-100-containing LDL. High plasma
levels of LDL are also most present in humans with atherosclerosis,
therefore in future studies it would be of interest to test this SPH in
LDLr2/2 mice.
Supporting Information
Figure S1 Hepatic enzyme activities of enzymes involved in
peroxisomal and mitochondrial b-oxidation; (Figure A) Palmi-
toyl-CoA-b-oxidation with and without inhibition with malonyl-
CoA, (Fig. B) CPT2 activity, (Fig. C) ACOX1 activity and (Fig.D) ACAT activity.
(TIFF)
Table S1 Composition and amino acid contents of the diets.
(DOCX)
Table S2 Overview of analysed genes.
(DOCX)
Acknowledgments
We thank Kari Williams, Liv Kristine Øysæd, Randi Sandvik and Svein
Kruger for excellent technical assistance, and Eline Milde Nevdal for
assisting with the animal experiment.
Author Contributions
Conceived and designed the experiments: CP BB TB JS RKB GC.
Performed the experiments: RV MB SH TB SM GSG BH. Analyzed the
data: RV BB FD. Contributed reagents/materials/analysis tools: CRS
JEN. Wrote the paper: CP RV BB PA RKB.
References
1. Lloyd-Jones DM (2010) Cardiovascular risk prediction: basic concepts, current
status, and future directions. Circulation 121: 1768–1777.
2. Woollard KJ (2013) Immunological aspects of atherosclerosis. Clinical Science
125: 221–235.
3. Hansson GK, Robertson A-KL, Soderberg-Naucler C (2006) Inflammation and
atherosclerosis annual review of pathology: Mechanisms of disease. Annual
Reviews 1 297–329.
4. van der Wal AC, Becker AE, van der Loos CM, Das PK (1994) Site of intimal
rupture or erosion of thrombosed coronary atherosclerotic plaques is
characterized by an inflammatory process irrespective of the dominant plaque
morphology. Circulation 89: 36–44.
5. Sabesin SM (1981) Lipid and lipoprotein abnormalities in alcoholic liver disease.
Circulation 64: III 72–84.
6. Kleemann R, Kooistra T (2005) HMG-CoA reductase inhibitors: effects on
chronic subacute inflammation and onset of atherosclerosis induced by dietary
cholesterol. Curr Drug Targets Cardiovasc Haematol Disord 5: 441–453.
7. Rein D, Schijlen E, Kooistra T, Herbers K, Verschuren L, et al. (2006)
Transgenic flavonoid tomato intake reduces C-reactive protein in human C-
reactive protein transgenic mice more than wild-type tomato. J Nutr 136: 2331–
2337.
8. Kleemann R, Verschuren L, van Erk MJ, Nikolsky Y, Cnubben NH, et al.
(2007) Atherosclerosis and liver inflammation induced by increased dietary
cholesterol intake: a combined transcriptomics and metabolomics analysis.
Genome Biol 8 R200.
9. Singh U, Jialal I (2006) Oxidative stress and atherosclerosis. Pathophysiology 13:
129–142.
10. Ridker PM, Rifai N, Cook NR, Bradwin G, Buring JE (2005) Non-HDL
cholesterol, apolipoproteins A-I and B100, standard lipid measures, lipid ratios,
and CRP as risk factors for cardiovascular disease in women. JAMA 294: 326–
333.
11. Harnedy PA, FitzGerald RJ (2012) Bioactive peptides from marine processing
waste and shellfish: A review. Journal of Functional Foods 4: 6–24.
12. Chalamaiah M, Dinesh Kumar B, Hemalatha R, Jyothirmayi T (2012) Fish
protein hydrolysates: proximate composition, amino acid composition, antiox-
idant activities and applications: a review. Food Chem 135: 3020–3038.
13. Elvevoll EO, Eilertsen KE, Brox J, Dragnes BT, Falkenberg P, et al. (2008)
Seafood diets: hypolipidemic and antiatherogenic effects of taurine and n-3 fatty
acids. Atherosclerosis 200: 396–402.
14. Liaset B, Madsen L, Hao Q, Criaeles G, Mellgren G (2009) Fish protein
hydrolysate elevates plasma bile acids and reduces visceral adipose tissue mass in
rats. Biochim Biophys Acta 1791: 254–262.
15. Jacques H, Gascon A, Bergeron N, Lavigne C, Hurley C, et al. (1995) Role of
dietary fish protein in the regulation of plasma lipids. Can J Cardiol 11: Suppl G
63G–71G.
16. Zhang X, Beynen AC (1993) Influence of dietary fish proteins on plasma and
liver cholesterol concentrations in rats. Br J Nutr 69: 767–777.
17. Wergedahl H, Liaset B, Gudbrandsen OA, Lied E, Espe M, et al. (2004) Fish
protein hydrolysate reduces plasma total cholesterol, increases the proportion of
HDL cholesterol, and lowers acyl- CoA:cholesterol acyltransferase activity in
liver of Zucker rats. Journal of Nutrition 134: 1320–1327.
18. Grimstad T, Bjorndal B, Cacabelos D, Aasprong OG, Omdal R, et al. (2012) A
salmon peptide diet alleviates experimental colitis as compared with fish oil.
Journal of Nutritional Science 1: 1–8.
19. Palinski W, Ord VA, Plump AS, Breslow JL, Steinberg D et al. (1994) ApoE-
deficient mice are a model of lipoprotein oxidation in atherogenesis.
Demonstration of oxidation-specific epitopes in lesions and high titers of
autoantibodies to malondialdehyde-lysine in serum. Arterioscler Thromb 14:
605–616.
20. Bjorndal B, Vik R, Brattelid T, Vigerust NF, Burri L, et al. (2012) Krill powder
increases liver lipid catabolism and reduces glucose mobilization in tumor
necrosis factor-alpha transgenic mice fed a high-fat diet. Metabolism 61: 1461–
1472.
21. Vigerust NF, Bjorndal B, Bohov P, Brattelid T, Svardal A et al. (2012) Krill oil
versus fish oil in modulation of inflammation and lipid metabolism in mice
transgenic for TNF-alpha. Eur J Nutr 52: 1315–1325.
22. Strand E, Bjorndal B, Nygard O, Burrin L, Berge C, et al. (2012) Long-term
treatment with the pan-PPAR agonist tetradecylthioacetic acid or fish oil is
associated with increased cardiac content of n-3 fatty acids in rat. Lipids in
Health and Disease 11: 82
23. Berge RK, Flatmark T, Osmundsen H (1984) Enhancement of long-chain acyl-
CoA hydrolase activity in peroxisomes and mitochondria of rat liver by
peroxisomal proliferators. Eur J Biochem 141: 637–644.
24. Bremer J (1981) The effect of fasting on the activity of liver carnitine
palmitoyltransferase and its inhibition by malonyl-CoA. Biochim Biophys Acta
665: 628–631.
25. Skorve J, al-Shurbaji A, Asiedu D, Bjorkhem I, Berglund L, et al. (1993) On the
mechanism of the hypolipidemic effect of sulfur-substituted hexadecanedioic
acid (3-thiadicarboxylic acid) in normolipidemic rats. J Lipid Res 34: 1177–
1185.
26. Madsen L, Rustan AC, Vaagenes H, Berge K, Dyroy E, et al. (1999)
Eicosapentaenoic and docosahexaenoic acid affect mitochondrial and peroxi-
somal fatty acid oxidation in relation to substrate preference. Lipids 34: 951–
963.
27. Field FJ, Albright E, Mathur S (1991) Inhibition of acylcoenzyme A: cholesterol
acyltransferase activity by PD128O42: effect on cholesterol metabolism and
secretion in CaCo-2 cells. Lipids 26: 1–8.
28. Cinq-Mars DC, Hu C, Kitts DD, Li-Chan EC (2008) Investigations into
inhibitor type and mode, simulated gastrointestinal digestion, and cell transport
of the angiotensin i-converting enzyme-inhibitory peptides in pacific hake
(merluccius productus) fillet hydrolysate. J Agric Food Chem 56: 410–419.
29. Raatz SK, Silverstein JT, Jahns L, Picklo MJ (2013) Issues of fish consumption
for cardiovascular disease risk reduction,. Nutrients 5: 1081–1097.
30. Jung UJ, Torrejon C, Tighe AP, Deckelbaum RJ (2008) n-3 Fatty acids and
cardiovascular disease: mechanisms underlying beneficial effects. Am J Clin Nutr
87: 2003S–2009S.
Salmon Protein Hydrolysate Reduces Atherosclerosis
PLOS ONE | www.plosone.org 8 May 2014 | Volume 9 | Issue 5 | e97598
31. Duarte J, Vinderola G, Ritz B, Perdigon G, Matar C (2006) Immunomodulating
capacity of commercial fish protein hydrolysate for diet supplementation.Immunobiology 211: 341–350.
32. Murakami S, Kondo-Otha Y, Tomisawa (1998) Improvement in cholesterol
metabolism in mice given chronic treatment of taurine and fed a high-fat diet.Life Sciences 64: 83–91.
33. Chen W, Matuda K, Nishimura N, Yokogoshi H (2004) The effect of taurine oncholesterol degradation in mice fed a high-cholesterol diet. Life Sciences. 74:
1889–1898.
34. Dembinska-Kiec A, Gryglewski RJ (1986) Contribution of arachidonic acidmetabolites to atherosclerosis. Wien Klin Wochenschr 98: 198–206.
35. Bjorndal B, Berge C, Ramsvik MS, Svardal A, Bohov P, et al. (2013) A fishprotein hydrolysate alters fatty acid composition in liver and adipose tissue and
increases plasma carnitine levels in a mouse model of chronic inflammation.
Lipids Health Dis 12: 143.36. Muoio DM, Way JM, Tanner CJ, Winegar DA, Kliewer SA, et al. (2002)
Peroxisome proliferator-activated receptor-alpha regulates fatty acid utilization
in primary human skeletal muscle cells. Diabetes 51: 901–909.37. Kersten S, Mandard S, Escher P, Gonzalez FJ, Tafuri S, et al. (2001) The
peroxisome proliferator-activated receptor alpha regulates amino acid metab-olism. FASEB J 15: 1971–1978.
38. Delerive P, Fruchart JC, Staels B (2001) Peroxisome proliferator-activated
receptors in inflammation control. J Endocrinol 169: 453–459.39. Zhu CF, Li GZ, Peng HB, Zhang F, Chen Y et al (2010) Treatment with marine
collagen peptides modulates glucose and lipid metabolism in Chinese patientswith type 2 diabetes mellitus. Appl Physiol Nutr Metab. 36: 797–804.
Salmon Protein Hydrolysate Reduces Atherosclerosis
PLOS ONE | www.plosone.org 9 May 2014 | Volume 9 | Issue 5 | e97598
III
ORIGINAL CONTRIBUTION
Hypolipidemic effect of dietary water-soluble protein extractfrom chicken: impact on genes regulating hepatic lipid and bileacid metabolism
Rita Vik • Bodil Bjørndal • Pavol Bohov • Trond Brattelid •
Asbjørn Svardal • Ottar K. Nygard • Jan E. Nordrehaug •
Jon Skorve • Rolf K. Berge
Received: 11 November 2013 / Accepted: 3 April 2014 / Published online: 23 April 2014
� European Union 2014
Abstract
Background Amount and type of dietary protein have
been shown to influence blood lipids. The present study
aimed to evaluate the effects of a water-soluble fraction of
chicken protein (CP) on plasma and hepatic lipid metabo-
lism in normolipidemic rats.
Methods Male Wistar rats were fed either a control diet
with 20 % w/w casein as the protein source, or an exper-
imental diet where casein was replaced with CP at 6, 14, or
20 % w/w for 4 weeks.
Results Rats fed CP had markedly reduced levels of
triacylglycerols (TAG) and cholesterol in both plasma and
liver, accompanied by stimulated hepatic mitochondrial
fatty acid oxidation and carnitine palmitoyltransferase 2
activity in the 20 % CP group compared to the control
group. In addition, reduced activities and gene expression
of hepatic enzymes involved in lipogenesis were observed.
The gene expression of sterol regulatory element-binding
transcription factor 1 was reduced in the 20 % CP-fed rats,
whereas gene expression of peroxisome proliferator-acti-
vated receptor alpha was increased. Moreover, 6, 14, and
20 % CP-fed rats had significantly increased free carnitine
and acylcarnitine plasma levels compared to control rats.
The plasma methionine/glycine and lysine/arginine ratios
were reduced in 20 % CP-treated rats. The mRNA level of
ATP-binding cassette 4 was increased in the 20 % CP
group, accompanied by the increased level of plasma bile
acids.
Conclusions The present data suggest that the hypotri-
glyceridemic property of a water-soluble fraction of CP is
primarily due to effects on TAG synthesis and mitochon-
drial fatty acid oxidation. The cholesterol-lowering effect
by CP may be linked to increased bile acid formation.
Keywords Chicken protein � Lipogenesis � b-Oxidation
Abbreviations
ABC ATP-binding cassette
Acaca/ACC Acetyl-coenzyme A carboxylase alpha
ACE Angiotensin-converting enzyme
AST Alanine aminotransferase
ALT Aspartate aminotransferase
CP Chicken protein
CPT Carnitine palmitoyltransferase
CV Coefficient of variation
Fasn/FAS Fatty acid synthase
GPAT Glycerol-3-phosphate acyltransferase
HDL High-density lipoprotein
HMG-CoA
reductase
3-hydroxy-3-methylglutaryl-coenzyme
A reductase
HMG-CoA
synthase
3-hydroxy-3-methylglutaryl-coenzyme
A synthase
LDL Low-density lipoprotein
MUFA Monounsaturated fatty acid
NAFLD Nonalcoholic fatty liver disease
NEFA Nonesterified fatty acid
PC Phospholipid phosphatidylcholine
PL Phospholipid
R. Vik (&) � B. Bjørndal � P. Bohov � A. Svardal �O. K. Nygard � J. E. Nordrehaug � J. Skorve � R. K. BergeDepartment of Clinical Science, University of Bergen,
5020 Bergen, Norway
e-mail: [email protected]
T. Brattelid
National Institute of Nutrition and Seafood Research, NIFES,
5817 Bergen, Norway
O. K. Nygard � R. K. BergeDepartment of Heart Disease, Haukeland University Hospital,
5021 Bergen, Norway
123
Eur J Nutr (2015) 54:193–204
DOI 10.1007/s00394-014-0700-5
PPARa Peroxisome proliferator-activated
receptor alpha
PUFA Polyunsaturated fatty acid
SFA Saturated fatty acid
Srebf/SREBP Sterol regulatory element-binding
transcription factor
TAG Triacylglycerol
T2DM Type 2 diabetes mellitus
VLDL Very-low-density lipoprotein
Background
Diets and lifestyle influence key metabolic pathways in
lipid metabolism implicated in the pathogenesis of meta-
bolic syndrome, including disturbed mitochondrial fatty
acid oxidation [1]. Hypertriglyceridemia and lower plasma
HDL cholesterol are characteristic features in metabolic
syndrome, and an increasing body of evidence has linked
hypertriglyceridemia to decreased mitochondrial fatty acid
oxidation [1, 2].
Peroxisome proliferator-activated receptor alpha
(PPARa) is a nuclear protein that belongs to the super-
family of nuclear hormone receptors [3]. PPARa can be
activated by long-chain fatty acids, and this receptor is
involved in both mitochondrial and peroxisomal fatty acid
oxidation [4]. Interestingly, PPARa also regulates amino
acid metabolism [4]. Sterol regulatory element-binding
proteins (SREBPs) are membrane-bound transcription
factors regulating transcription of genes involved in cho-
lesterol biosynthesis and uptake, fatty acid and lipid pro-
duction, and glucose metabolism [5, 6]. Soy proteins are
known to affect these transcription factors [7–9], and a
number of recent studies have reported hypolipidemic
effects and lowered blood pressure of processed protein
hydrolysates and peptides in animal studies. Proteins from
fish and other marine species and from vegetables such as
soy, pea, and lupin exert both triacylglycerol (TAG)- and
cholesterol-lowering effects in animal as well as in human
studies [10–13]. Moreover, a dietary single-cell protein
reduced fatty liver in obese Zucker rats [14], and recently, a
chicken collagen hydrolysate was shown to exert a strong
angiotensin-converting enzyme (ACE)-inhibitory activity
and antihypertensive effect in spontaneously hypertensive
rats [15, 16]. Thus, the amount and type of dietary proteins
may influence blood lipid concentrations and blood pres-
sure. Specific amino acids of the protein sources are most
likely involved in the hypolipidemic effects of dietary
proteins. From animal experiments, it has been suggested
that low ratios of dietary methionine/glycine and lysine/
arginine contribute to the cholesterol-lowering effect [17].
The aim of the present study was to evaluate the hypo-
lipidemic properties of a water-soluble fraction of chicken
protein (CP) in rats and to investigatewhether aCP diet could
affect mitochondrial fatty acid oxidation and lipogenesis.
Materials and methods
Animals and diets
Twenty-four male Wistar rats (Mollegaard and Blom-
holtgaard, Denmark) 12-week old were housed in Makro-
lon III cages in groups of three, in an open system. They
were kept under standard laboratory conditions with tem-
perature 22 ± 1 �C, dark/light cycles of 12/12 h, relative
humidity 55 ± 5 %, and 20 air changes per. h. The animal
study was conducted according to the Guidelines for the
Care and Use of Experimental Animals, and the Norwegian
State Board of Biological Experiments with Living Ani-
mals approved the protocol.
After 7 days of acclimatization under standard conditions,
rats were divided at random into four groups of six rats. The
control group was fed a 20 % casein diet with 7 % fat (5 %
lard and 2 % soy oil), while the intervention diets were sup-
plemented with 6, 14, or 20 %CP, respectively. The 20 %CP
dose was selected to constitute a full exchange of casein for
CP, while the low (6 %) and intermediate (14 %) doses were
chosen based on comparable studies with fish protein [18, 19].
All groups had free access to tap water and feed during the
28 days of experiment. The composition of the diets is given
in Table 1. The water-soluble fraction of CP (Norilia, Oslo,
Table 1 Composition of the experimental diets
Treatment
Control 6 % CP 14 % CP 20 % CP
Ingredients (g/kg)
Caseina 219.31 163.82 86.87 21.62
Chickenb 0 58.36 139.32 208.05
Soy oil 19.52 19.45 19.35 19.16
Lard 48.81 48.63 48.38 48.16
Corn starch 387.65 386.22 384.23 382.51
Dyetrose 128.85 128.38 127.72 127.15
Sucrose 97.62 97.26 96.76 96.32
Fiber 48.81 48.63 48.63 48.16
AIN-93G mineral mix 34.37 34.15 33.97 33.82
AIN-93 vitamin mix 9.76 9.73 9.68 9.63
L-Cysteine 2.93 2.92 2.90 2.89
Choline–baritrate 2.45 2.44 2.43 2.42
Tert-butylhydroquinone 0.014 0.014 0.014 0.014
The diets were isoenergetic and isonitrogenous, and contained 20 g
protein per 100 g diet. The final diet contained 20 % (w/w) watera Casein consisted of 91.1 % (w/w) protein and 0.2 % fat (w/w)b Water-soluble fraction of chicken protein consisted of 97 % (w/w)
protein and 3 % fat (w/w)
194 Eur J Nutr (2015) 54:193–204
123
Norway)was prepared as follows:Meat fromchicken legs and
wings were milled, and water was added. The mixture was
treated for 20 min in a pressure cooker at a pressure about 3
bar and at a temperature of approximately 136 �C. The
resulting water-soluble fraction of chicken protein was
evaporated and spray dried. The amino acid composition of
the 20 %CPdiet compared to control is shown inTable 2. Rat
feed intake and weight gain were measured twice a week. On
day 28, rats were anesthetized after an overnight fast by
inhalation of 2 % isofluorane (Forane, from Abbot Labora-
tories Ltd, Illinois, USA) in an anesthesia chamber, and tho-
racotomy, cardiac puncture, and exsanguination were
performed. Blood was collected in tubes with K3EDTA,
chilled on ice for approximately 15 min, and stored at-80 �Cuntil analyses. Livers were harvested, freeze-clamped, and
stored at-80 �C.
Plasma and liver lipids and fatty acid composition
Liver lipids were extracted according to Bligh and Dyer
[20], evaporated under nitrogen, and redissolved in
isopropanol before analysis. Lipids from liver extracts or
plasma were then measured enzymatically on a Hitachi 917
system (Roche Diagnostics GmbH, Mannheim, Germany)
using the triacylglycerol (GPO-PAP) and cholesterol kit
(CHOD-PAP) from Roche Diagnostics, and the phospho-
lipid kit from DiaSys (Diagnostic Systems HmbH, Holz-
heim, Germany). Coefficient of variation (CV) was
determined as 6.3 % for total cholesterol, 2.2 % for TAG,
3.2 % for LDL, 3.8 % for PL, and below 1.5 % for NEFAs,
HDL, and free cholesterol. Total liver fatty acid composi-
tion was analyzed in controls and 20 % CP-fed rats as
described previously [21]. The procedure of fatty acid
determination was regularly verified for specificity, inter-
day, and intra-day reproducibility (CV around 1 % for
major fatty acids and 2–4 % for minor fatty acids), preci-
sion (CV below 2 %), stability, and other validation
parameters.
Plasma carnitine composition
Free carnitine, short-, medium-, and long-chain acylcarni-
tines, and the precursor for carnitine, c-butyrobetaine, wereanalyzed in plasma using LC MS/MS as described previ-
ously [22], with some modification as described by Vige-
rust et al. [23].
Plasma and diet pattern of amino acids and amine
metabolites
The amino acids in the diets were determined after
hydrolysis in 6 M HCl at 110 �C for 22 h and pre-
derivatization with phenylisothiocyanate according to the
method of Cohen and Strydom [24]; thus, the sum of
aspartic acid and aspargine, and the sum of glutamic acid
and glutamine, is written as Asx and Glx, respectively.
EDTA plasma from controls and 20 % CP-fed rats
(200 lL) was deproteinized by adding 10 % sulfosalisylic
(1:1, v/v) with norleucine as internal standard (final
0.5 mM) and stored for 1 h at 4 �C before centrifugation
at 8,000 rpm for 30 min as described by Liaset et al. [25].
The supernatant was filtered, and amino acids were
characterized by a Biochrom 20 plus amino acid analyser
as previously described [25].
Quantitative determination of total bile acids
Measurement of bile acids was performed enzymatically
on frozen plasma samples on a Molecular P Roche Diag-
nostics instrument using kit from Diazyme Laboratories
(Cat. No. 05471605001). Total bile acids were measured as
the rate of formation of Thio-NADH determined by mea-
suring specific change of absorbance at 405 nm.
Table 2 Amino acid composition in the control diet and 20 % CP
diet fed to male Wistar rats for 4 weeks
Control 20 % CP
Amino acid (mg/g)
Hyp 0 11.86
His 5.39 3.20
Tau 0.01 0.64
Ser 11.07 5.68
Arg 5.77 9.98
Gly 3.65 22.67
Asx 15.87 11.58
Glx 49.44 22.11
Thr 9.15 4.71
Ala 6.37 11.79
Pro 23.46 15.04
Lys 17.15 7.69
Tyr 8.24 2.34
Met 5.73 2.60
Val 13.47 5.41
Ile 11.20 4.11
Leu 19.65 8.49
Phe 10.32 5.01
Amino acid ratio
Met/Gly 1.57 0.11
Lys/Arg 2.97 0.77
Ala alanine, Arg arginine, Asx apsartic acid ? aspargine, Glc glu-
tamic acid ? glutamine, Gly glycine, His histidine, Hyp hydroxy-
proline, Ile isoleucine, Leu leucine, Lys lysine, Met methionine, Phe
phenylalanine, Pro proline, Ser serine, Tau taurine, Thr threonine, Tyr
tyrosine, Val valine
Eur J Nutr (2015) 54:193–204 195
123
Hepatic enzyme activities
After killing, livers were removed, chilled on ice,
weighed, and snap-frozen in liquid nitrogen. About
100 mg liver from each rat was homogenized in 1 mL
ice-cold sucrose medium (0.25 M sucrose, 10 mM
HEPES, and 1 mM Na4EDTA, adjusted to a pH of 7.4
with KOH) giving 10 % (w/v). The homogenates were
centrifuged at 600g force for 10 min at 4 �C, and the
post-nuclear fraction was removed and used for further
analysis. The assay for carnitine palmitoyltransferase 1
(CPT1) was performed according to Bremer et al. [26],
but with some modifications: The reaction mix contained
17.5 mM HEPES pH 7.5, 52.5 mM KCl, 5 mM KCN,
100 mM palmitoyl-CoA, and 6.67 mg BSA/mL. The
reaction was initiated with 100 lM [methyl-14C]-L-car-
nitine (1,100 cpm/gmol), and 30 lg total protein was
used. Palmitoyl-CoA oxidation was measured in the post-
nuclear fraction from liver as acid-soluble products [27].
Assay conditions for CPT2 were identical except that
BSA and KCN were omitted, 0.01 % Triton X-100 was
included, and a total of 35 lg protein was used. The
activity of fatty acyl-CoA oxidase 1 (ACOX1) was
measured in post-nuclear fractions using 20 lg protein, as
described by Madsen et al. [27]. Fatty acid synthase
(FAS) and glycerol-3-phosphate acyltransferase (GPAT)
were measured in post-nuclear fractions as described by
Skorve et al. [28], but with some modifications: FAS
activity was measured in post-nuclear fractions using
60 lg protein. GPAT was assayed for 5 min at 35 �C, andthe reaction was initiated by the addition of post-nuclear
fractions (150 lg protein) and terminated by the addition
of 400 ll water-saturated butanol.
Gene expression analysis
Total cellular RNA was purified from frozen liver samples
from the controls and 20 % CP-fed rats only, and cDNA
was produced as previously described [29]. Real-time PCR
was performed with Sarstedt 384 well multiply-PCR Plates
(Sarstedt Inc., Newton, NC, USA) on the following genes,
using probes and primers from Applied Biosystems:
ATP-binding cassette, subfamily B, member 4 (Abcb4,
Rn01529224_m1), acetyl-CoA carboxylase alpha (Acaca,
Rn00573474_m1), acyl-CoA oxidase 1 (Acox1, Rn005
69216), apolipoprotein B (Apob, Rn01499050_g1), bile
acid CoA:amino acid N-acyl transferase (Baat, Rn0056
8867_m1), CD36 antigen (Cd36 (Fat), Rn00580728_m1),
carnitine palmitoyltransferase 1a (Cpt1a Rn00580702_m1),
Cpt2 (Rn00563995_m1), cytochrome P450, family 7, sub-
family A, polypeptide 1 (Cyp7a1, Rn00564065_m1), fatty
acid synthase (Fasn, Rn00569112_m1), 3-hydroxy-3-
methylglutaryl-CoA synthase 1 (Hmgcs1, Rn00568579_
m1), Hmgcs2, (Rn00597339_m1), 3-hydroxy-3-methyl-
glutaryl-CoA reductase (Hmgcr, Rn00565598_m1), low-
density lipoprotein receptor (Ldlr, Rn00598438_m1),
peroxisome proliferator-activated receptor alpha (Ppara,
Rn00566193_m1), stearoyl-CoA desaturase 1 (Scd1,
Rn00594894_g1), and sterol regulatory element-binding
transcription factor 1 (Srebf1, Rn01495769_m1) and
Srebf2 (Rn01502638_m1). Three different reference genes
were included: 18 s [Kit-FAM-TAMRA (Reference RT-
CKFT-18 s)] from Eurogentec, Belgium, glyceraldehyde-
3-phosphate dehydrogenase (Gapdh, Rodent 4308313)
from Applied Biosystems, and ribosomal protein, large, P0
(Rplp0, Rn00821065_g1). GeNorm was used to evaluate
the reference genes [30], and data normalized to Gapdh are
presented.
Statistical analysis
Data sets were analyzed using Prism Software (Graph-Pad
Software, San Diego, CA) to determine statistical signifi-
cance. The results are shown as means of six rats per group
with their standard errors of the mean (SEM). Normal
distribution was determined by the Kolmogorov–Smirnov
test (with Dallal–Wilkinson–Lillie for p value). One-way
ANOVA with Tukey’s post hoc test was used to assess
statistical differences between groups. Unpaired t test was
performed to evaluate statistical differences between two
groups. p values\0.05 were considered significantly dif-
ferent from controls.
Results
The effect of CP on body weight, liver weight, and feed
intake
No change in weight gain was observed in rats fed 6 or
14 % CP compared to control (Fig. 1a, b). However, rats
fed 20 % CP gained less weight than rats fed a 20 %
casein diet (Fig. 1b). Already after 1 week, the 20 % CP-
fed rats reduced their growth rates (Fig. 1a) and continued
at this rate for the following 3 weeks. The average total
weight gain was 105 ± 12 g versus 152 ± 14 g (mean-
s ± SEM) for the 20 % CP group and control rats,
respectively (Fig. 1b). The overall mean feed consump-
tion was higher in the 14 and 20 % CP-fed rats as
compared to the control rats (Fig. 1c), and the overall
feed efficiency (g weight gain/g feed intake) was signif-
icantly lower for the 20 % CP-fed rats (Fig. 1d). Liver
weight was significantly reduced in the 20 % CP-fed rats
compared to casein-fed rats without affecting the liver/
body index (Fig. 1e, f).
196 Eur J Nutr (2015) 54:193–204
123
CP-reduced plasma lipids and altered hepatic lipid
profile
The plasma concentrations of cholesterol, cholesterol esters,
TAG, and phospholipids were reduced in the CP-treated rats
compared to the casein-fed rats, measured as the difference
between the end and start of the experiment (D-values)(Fig. 2a–d). 14 and 20 % CP-fed rats had a similar choles-
terol- and phospholipid-reducing effect, while 6 % CP did
not affect these parameters. Moreover, plasma TAG
(Fig. 2c) and bile acids (Fig. 2e) levelswere reduced at 20 %
CP. The plasma values ofHDL cholesterol, LDL cholesterol,
nonesterified fatty acids (NEFAs), and glucose were not
significantly affected (data not shown). Hepatic lipids dem-
onstrated significantly lower total liver TAG (p = 0.017),
cholesterol (p = 0.002), and phospholipids (p = 0.0003) in
the 20 %CP group compared to control rats (Fig. 2f–h). The
plasma lipid levels of the Wistar rats were comparable to a
previous study [31].
Dietary supplementation with 20 % CP also changed the
fatty acid composition in the liver compared to the control
diet (Table 3). The n3 polyunsaturated fatty acids (PUFAs)
alpha-linolic acid (C18:3n3) and docosapentaenoic acid
(DPA) (C22:5n3) were significantly increased in liver after
20 % CP feeding, but eicosapentaenoic acid (EPA)
(C20:5n3) was decreased. The total n6 PUFAs tended to
increase, but did not reach significant (p = 0.064)
(Table 3). Altogether, the 20 % CP diet resulted in a
decrease in the n3/n6 PUFAs ratio. It was of interest to note
that the weight % of SFAs was significantly increased in
liver of 20 % CP-treated rats, and long-chain fatty acids
were increased more than short-chain fatty acids as C14:0
and C16:0 were unchanged, whereas C20:0–C24:0 were
increased. The amounts of monounsaturated fatty acids
(MUFAs) displayed a trend toward decrease (p = 0.061) in
liver of rats fed 20 % CP compared to controls (Table 3),
although probably contributing to significant decrease in
the D9 desaturase index (C16:1n7/C16:0) (Table 3).
Fig. 1 a Body weight, b body
weight gain, c feed intake,
d feed efficiency, e liver weight,and f liver index in male Wistar
rats fed a control diet with 20 %
casein or a diet with 6, 14, or
20 % CP for 4 weeks. Values
are means with their standard
errors represented by vertical
bars (n 6). a,bMean values with
unlike letters were significantly
different (p\ 0.05; one-
ANOVA with Tukey’s post hoc
test). (*p\ 0.05, **p\ 0.01;
unpaired t test)
Eur J Nutr (2015) 54:193–204 197
123
The CP diets increased hepatic fatty acid oxidation
and decreased lipogenesis
Hepatic mitochondrial b-oxidation of long-chain fatty
acids with palmitoyl-CoA as substrate was significantly
increased in rats fed 20 % CP compared to casein-fed rats,
but no increase was observed with 6 % or 14 % CP
(Fig. 3a). In the presence of malonyl-CoA, the results were
unchanged in all groups (Fig. 3a). Gene expression of
Cpt1a was unchanged (Table 4), but the CPT2 activity was
increased by the dietary administration of 20 % CP
(Fig. 3b). CP feeding did not seem to increase the perox-
isomal b-oxidation capacity, as the ACOX1 activity and
gene expression were not changed (Fig. 3c; Table 4,
respectively). HMG-CoA synthase 2, which is involved in
ketone body production, was not affected at the levels of
activity (data not shown) or mRNA expression after the CP
treatment (Table 4), neither was the level of ketone bodies
(data not shown). Interestingly, the mRNA level of the
nuclear transcription factor Ppara, involved in the regula-
tion of lipid catabolic pathways, was significantly increased
in the rats fed 20 % CP (Table 4).
We then looked at enzymes involved in the fatty acid
synthesis pathway. The activity of ACC was significantly
reduced by the 20 % CP diet and tended to be reduced by
14 % CP (p = 0.103, Fig. 3d). A tendency toward reduc-
tion in the expression of the ACC-gene (Acaca) by the
20 % CP diet was observed at the mRNA level (Table 4).
The fatty acid synthase (FAS) activity showed a tendency
to decrease in all the CP-treated groups, but only signifi-
cantly by 20 % CP administration (Fig. 3e), and this
reduction in activity was reflected at the mRNA level
(Table 4). The activity of GPAT, which is involved in
TAG biosynthesis, was significantly decreased in both the
14 and 20 % CP-fed rats (Fig. 3f). Rats fed 20 % CP also
showed a lower expression level of the important lipogenic
gene stearoyl-CoA 1 (Scd1), also called delta 9 desaturase
(Table 4). Accordingly, the lipogenic transcription factor,
Srebf1, was significantly reduced at the mRNA level by
20 % CP (Table 4). Apob, which is the main apolipopro-
tein of VLDL, was not changed after 20 % CP adminis-
tration compared to control (Table 4).
CP showed no effect on cholesterol synthesis
While the mitochondrial Hmgcs2 is involved in the pro-
duction of ketone bodies, the cytosolic HMG-CoA syn-
thase 1 (Hmgcs1) is involved in cholesterol synthesis. Gene
expression of this enzyme was not significantly reduced by
20 % CP treatment (p = 0.277, Table 4). The 20 % CP-fed
rats showed a trend for enhanced Srebf2 mRNA level, but
the gene expression of Hmgcr, the rate-limiting enzyme in
cholesterol synthesis, was not affected compared to control
rats (Table 4). Gene expression of Ldlr was not altered by
the 20 % CP diet compared to the control diet (Table 4).
Elevated plasma bile acids level after intervention
with CP
The plasma concentration of total bile acids was signifi-
cantly increased in the 20 % CP-treated rats compared to
the casein-fed rats (Fig. 2e). Bile acids are normally con-
jugated with taurine and/or glycine, but the gene expression
of Baat, responsible for this conjugation, was unchanged
Fig. 2 a D cholesterol, b D cholesterol esters, c D triacylglycerols,
d D phospholipids, e plasma bile acids, f hepatic cholesterol, g hepatictriacylglycerols, and h hepatic phospholipids in male Wistar rats fed a
control diet with 20 % casein or a diet with 6, 14, or 20 % CP after
4 weeks. Values are means with their standard errors represented by
vertical bars (n 6). a,bMean values with unlike letters were
significantly different (p\ 0.05; one-way ANOVA with Tukey’s
post hoc test). (*p\ 0.05, **p\ 0.01, ***p\ 0,001; unpaired t test)
198 Eur J Nutr (2015) 54:193–204
123
by the 20 % CP diet (Table 4). Hepatic gene expression of
the rate-limiting enzyme in bile acid synthesis, Cyp7a1,
was increased in the 20 % CP-fed rats compared to the rats
fed casein (Table 4), but the difference did not reach sta-
tistical significance (p = 0.102). It was of interest to note
that the gene expression of the canalicular exporter Abcb4,
an ATP-dependent efflux pump that may be involved in
bile export from liver to bile [32] and bile excretion
through urine [33], was significantly increased (Table 4).
No changes in the plasma activity levels of alanine ami-
notransferase (ALT) and aspartate aminotransferase (AST)
were found after CP treatment (data not shown).
CP influenced plasma amino acids and amine
metabolites
The plasma concentrations of the following free amino
acids were increased in the 20 % CP-treated rats compared
to controls: aspartic acid, hydroxyproline, serine, glycine,
citrulline, ornithine, L-methylhistidine, and arginine
(Table 5). Moreover, threonine, asparagine, valine, methi-
onine, isoleucine, tyrosine, phenylalanine, lysine, and
tryptophan were present in significantly lower concentra-
tions in 20 % CP-treated rats. Interestingly, a lower
methionine/glycine and lysine/arginine ratios were found
in plasma of rats fed a 20 % CP diet (Table 5). Plasma
concentrations of taurine, urea, and ammonium were
unchanged (Table 5). The taurine level in the 20 % CP
diet, however, was higher than in the control diet (Table 2).
Plasma acyl-carnitines in male Wistar rats increased
after feeding with CP
The CP-fed rats showed a significantly increased plasma-
free carnitine level compared to the control rats at all three
doses of CP in the diet (Fig. 4a). The direct carnitine pre-
cursor c-butyrobetaine was significantly increased in CP-
treated rats at doses of 6 and 20 % (Fig. 4b). Plasma acet-
ylcarnitine (two-carbon chain) was significantly increased
with CP diets at 14 and 20 % compared to control (Fig. 4c),
as were octanoylcarnitine (eight-carbon chain) and palmi-
toylcarnitine (16-carbon chain) (Fig. 4e, f). Propionylcar-
nitine (three-carbon chain) was elevated at all three doses
(Fig. 4d). The product of branched-chain amino acid
catabolism or odd-chain fatty acid metabolism, isovaleryl-/
valerylcarnitine (five-carbon chain), was not affected by the
CP diets (data not shown).
Discussion
In the present study, we demonstrate that a water-soluble
fraction of chicken protein has marked hypolipidemic
properties in rats and that this is related to differential
effects on lipid metabolic pathways. Hypolipidemic prop-
erties have previously been shown with a chicken collagen
hydrolysate [34], but to our knowledge, no studies have
investigated the mechanism of action of lipid lowering by
dietary chicken proteins.
The results from this study suggest a TAG-lowering effect
in CP-fed rats mediated through increased catabolism and
decreased synthesis of fatty acids. Indeed, the mitochondrial
Table 3 Fatty acid composition in liver of male Wistar rats given an
20 % casein diet (control) or a 20 % CP diet for 4 weeks (mean
values with standard errors, n 6 per group)
Control 20 % CP
Mean SEM Mean SEM
Fatty acids(w/w)
R SFAs 35.18 0.22 36.39* 0.35
C14:0 0.56 0.03 0.42 0.07
C16:0 19.00 0.33 18.83 0.80
C17:0 0.22 0.01 0.33*** 0.01
C18:0 14.13 0.32 15.41 0.74
C20:0 0.05 0.00 0.06*** 0.00
C22:0 0.15 0.00 0.20** 0.01
C24:0 0.44 0.01 0.57* 0.04
R MUFAs 20.69 0.38 16.85 1.78
C16:1n7 3.15 0.27 1.33*** 0.30
C16:1n9 0.23 0.01 0.13*** 0.01
C18:1n7 4.58 0.21 2.22*** 0.11
C18:1n9 11.90 0.21 12.36 1.42
R n6 PUFAs 35.18 0.57 38.35 1.41
C18:2n6 11.41 0.57 14.46*** 0.27
C18:3n6 0.15 0.01 0.26*** 0.01
C20:3n6 1.21 0.11 1.04 0.04
C20:4n6 21.36 1.10 21.08 1.23
C22:4n6 0.33 0.45 0.54** 0.03
C22:5n6 0.44 0.05 0.65*** 0.07
R n3 PUFAs 8.50 0.24 8.02 0.42
C18:3n3 0.25 0.03 0.37* 0.04
C18:4n3 0.01 0.00 0.03*** 0.00
C20:5n3 0.53 0.05 0.39* 0.03
C22:5n3 0.64 0.02 1.06*** 0.07
C22:6n3 6.93 0.30 6.02 0.39
R n3/R n6 ratio 0.24 0.01 0.21* 0.00aD5 (n3) desat index 4.10 0.27 2.72* 0.18bD9 desat index 0.17 0.80 0.07*** 0.37cD9 desat index 0.84 0.27 0.80 0.78
* Mean values were significantly different from controls (* p\ 0.05,
** p\ 0.01, *** p\ 0.001)a D5 (n3) desaturase index = C20:5n3/C20:4n3b D9 desaturase index = C16:1n7/16:0c D9 desaturase index = C18:1n9/18:0
Eur J Nutr (2015) 54:193–204 199
123
b-oxidation of fatty acids, mitochondrial CPT2 activity, and
the acetylcarnitine plasma levelwere increased in rats fedCP
compared to rats fed casein. In agreement with this, the 20 %
CP component significantly increased gene expression of
Ppara. The increase inmitochondrial b-oxidation seen in the20 %CP-fed rats compared to controlsmay have contributed
to the lower bodyweight in these rats. Ketone body synthesis
is directly related to the concentration of acetyl-CoA.
However, induced acetyl-CoA formation due to increased
mitochondrial b-oxidation in CP-fed rats may have been
used for Krebs cycle intermediates and not ketone body
production, as HMG-CoA synthase activity and gene
expression of Hmgcs2 were not increased. The peroxisomal
fatty acid oxidation system was unchanged by dietary CP, as
ACOX1 activity and gene expression were not affected.
About 20 % CP-treated rats showed increased hepatic and
plasma levels of long-chain fatty acids (C17:0 and C20:0–
C24:0) compared to control. This increase in long-chain fatty
acids is presumably a consequence of the lack of stimulated
chain-shortening by the peroxisomal fatty acid system, and
thus a preferential increase in the mitochondrial b-oxidationof short-chain fatty acids. The lower liver n3/n6 ratio relates
to the lower D5 desaturation of n3 PUFAs (Table 3).
Although the C18:1n9/18:0 ratio was unchanged, the sig-
nificantly lower C16:1n7/16:0 ratio in the 20 % CP-fed rats
corresponds to the significantly lower gene expression of
Scd1. This indicates a decrease in D9 desaturation [35] and
thus may have caused the trend to decrease in MUFAs
compared to control.
The overall changes in the mitochondrial b-oxidationprocess were further assessed by measuring plasma carni-
tine, carnitine precursor, and acyl-carnitines, as such pro-
files reflect the intramitochondrial accumulation of acyl-
CoA esters [36]. The increase in both plasma carnitine and
the carnitine precursor c-butyrobetaine at all three doses
shows that CP affected carnitine biosynthesis differently
from a casein diet. The increased level of acetylcarnitine in
the CP-fed rats is probably due to increased fatty acid
oxidation, or amino acid degradation, as acyl-CoA is the
end product of both processes. The increased propionyl-
carnitine level reflects increased oxidation of odd-chain
fatty acids or activated degradation of branched amino
acids [37]. Altogether, by increasing carnitine levels
through the CP treatment, a balanced acyl-CoA/CoA ratio
is maintained, potentially lipotoxic mitochondrial metabo-
lites are exported, and mitochondrial capacity could be
improved.
Compared to the control rats, the amount of hepatic
TAG in the 20 % CP-fed rats was reduced. CP treatment
resulted in an inhibition of the enzyme activities of FAS
and GPAT. Moreover, the gene expression of the lipogenic
genes Fasn, Acaca, and Scd1 was lower in rats treated with
20 % CP than in casein-fed rats. The reduction in lipo-
genesis and TAG biosynthesis together with stimulated
fatty acid catabolism can explain the decrease in liver and
plasma TAG content. The parallel decrease in GPAT and
FAS activities, as well as in hepatic and plasma TAG
concentrations, without any effect on gene expression of
Fig. 3 Mitochondrial b-oxidation with a palmitoyl-CoA as a sub-
strate, b enzyme activity of carnitine palmitoyltransferase 2 (CPT2),
c enzyme activity of acyl-CoA oxidase (ACOX1), d enzyme activity
of acetyl-CoA carboxylase (ACC), e enzyme activity of glycerol-3-
phosphate acyltransferase (GPAT), and f enzyme activity of fatty acid
synthase (FAS) in male Wistar rats fed a control diet with 20 %
casein or a diet with 6, 14 or 20 % CP for 4 weeks. Values are means
with their standard errors represented by vertical bars (n 6). a,bMean
values with unlike letters were significantly different (p\ 0.05; one-
way ANOVA with Tukey’s post hoc test)
200 Eur J Nutr (2015) 54:193–204
123
Cd36 and Apob mRNA, suggests that the hypotriglyceri-
demic effect, combined with reduced liver fat of 20 % CP-
fed rats, is caused by effects on both synthesis and catab-
olism as transportation is unaffected.
The effects of CP on plasma cholesterol levels could be
due to reduced cholesterol synthesis and/or increased
degradation and secretion. The gene expressions of cyto-
solic Hmgcs1 and Hmgcr were not altered in 20 % CP-fed
rats. However, the 20 % CP-fed rats had an increased
plasma level of bile acids, with a tendency to increased
gene expression of Cyp7a1 (p\ 0.102) compared to
casein-fed rats. Therefore, we suggest that the decrease in
plasma and hepatic cholesterol was mediated largely by
increased cholesterol degradation, and not at the synthesis
level. Bile acids and phosphatidylcholine (PC) are the main
components of bile and are essential for uptake of dietary
fat. After synthesis, bile acids conjugate with glycine or
taurine making them more soluble. The bile salt export
pump, ABCB11, and the PC floppase, ABCB4, are both
Table 4 Hepatic gene expression in male Wistar rats fed an 20 %
casein diet (control) or a 20 % CP diet for 4 weeks (mean values with
their standard errors, n 6)
Gene Function Diet groups p value
Control 20 % CP
Mean SEM Mean SEM
Transcriptional factors
Srebf1 Fatty acid
synthesis
1.00 0.12 0.42 0.02 0.000
Srebf2 Cholesterol
homeostasis
1.00 0.24 1.22 0.14 0.138
Ppara Energy
metabolism
1.00 0.05 1.22 0.08 0.019
Lipid import, b-oxidation, and ketogenesis
Cd36 Fatty acid
import
1.00 0.10 1.56 0.40 0.217
Cpt1a b-Oxidation 1.00 0.96 1.55 0.40 0.851
Acox1 b-Oxidation 1.00 0.10 1.04 0.15 0.264
Hmgcs2 Ketogenesis 1.00 0.02 0.91 0.07 0.467
Lipogenesis and cholesterol synthesis and import
Fasn Fatty acid
synthesis
1.00 0.11 0.42 0.06 0.001
Acaca Fatty acid
synthesis
1.00 0.07 0.77 0.09 0.071
Scd1 D9 desaturase 1.00 0.11 0.28 0.05 0.000
Hmgcs1 Cholesterol
synthesis
1.00 0.08 1.68 0.59 0.277
Hmgcr Cholesterol
synthesis
1.00 0.12 1.18 0.27 0.562
Ldlr Cholesterol
import
1.00 0.05 0.96 0.09 0.684
Apob Cholesterol
import
1.00 0.09 0.90 0.04 0.349
Cyp7a1 Bile acid
synthesis
1.00 0.20 4.37 1.80 0.102
Baat Bile
conjugation
1.00 0.05 1.03 0.06 0.704
Abcb4 Bile transporter 1.00 0.06 1.66 0.15 0.002
Mean values were significantly different from controls (* p\0.05, **
p\ 0.01, *** p\ 0.001)
Table 5 Plasma pattern of selected amino acid and amino metabo-
lites in male Wistar rats given a 20 % casein diet (control) or an 20 %
CP diet for 4 weeks (mean values with their standard errors, n 6)
Amino acids and amine
metabolites (lmol/ll)Control 20 % CP
Mean SEM Mean SEM
Tau 22.55 1.20 23.11 1.30
Urea 745.62 34.30 695.69 44.73
Amm 12.59 1.49 13.01 1.01
Asp 1.50 0.20 2.29** 0.08
Hypro 2.86 0.18 16.07*** 0.79
Thr 47.11 3.35 27.46*** 1.99
Ser 26.55 1.47 70.91*** 3.38
Asn 11.11 0.69 4.81*** 0.17
Glu 13.90 2.91 17.53 0.86
Gln 72.40 1.48 71.18 3.45
Pro 45.23 4.13 27.94** 1.05
Gly 17.23 0.79 77.33*** 2.40
Ala 7.79 4.35 47.74*** 1.95
Citr 10.18 0.47 12.02* 0.61
Val 31.39 1.24 11.83*** 0.36
Cysteine 2.69 0.24 2.26 0.22
Met 7.82 0.52 5.9*** 0.11
Ile 13.58 0.66 5.23*** 0.18
Leu 21.25 1.21 8.52*** 0.27
Tyr 16.49 1.98 9.33** 0.23
Phe 7.36 0.27 5.50*** 0.26
Orn 5.03 0.21 7.06** 0.41
Lys 59.17 1.68 44.35*** 1.28
1-Mhis 0.89 0.10 10.74*** 0.27
His 7.22 0.34 6.45 0.17
Trp 11.16 0.43 4.94*** 0.24
Arg 12.77 0.41 19.23*** 0.73
Amino acid ratio
Met/Gly 0.46 0.05 0.08*** 0.00
Lys/Arg 4.65 0.19 2.32*** 0.11
Ala alanine, Amm ammonium, Arg arginine, Asn asparagine, Asp
aspartic acid, Citr citrulline, Cys cysteine, Gln glutamine, Glu glu-
tamate, Gly glycine, His histidine, Hypro hydroxyproline, Ile iso-
leucine, Leu leucine, Lys lysine, Met methionine, 1-Mhis 1-
methylhistidine, Orn ornithine, Phe phenylalanine, Pro proline, Ser
serine, Tau taurine, Thr threonine, Trp tryptophane, Tyr tyrosine, Val
valine
* Mean values significantly different from the control group (*
p\ 0.05, ** p\ 0.01, *** p\ 0.001)
Eur J Nutr (2015) 54:193–204 201
123
members of the ATP-binding cassette (ABC) superfamily
of transport proteins, and responsible for the efflux of bile
acids [38]. A significantly increased Abcb4 mRNA level
was observed in parallel with an increased concentration in
plasma bile acids. We support the previous findings that
ABCB4 may be involved in bile acids excretion from liver
to blood [39]. The increase in bile acids in the 20 % CP
group concomitantly with decreased body weight and high
feed intake could indicate a poorer digestibility of the
protein. Also, some of the undigested peptides might bind
bile acids, increasing bile excretion through feces [40, 41].
Although the CP diets were not deficient in indispensible
amino acids, in further studies protein and bile acids in
feces should be investigated. However, the increase in
plasma bile acids is not caused by liver damage as no
increased plasma activities of ALT and AST were found.
Treatment with bile acids has been shown to decrease
plasma TAG concentrations in humans [42], as well as in
animals, and to prevent TAG accumulation in liver [43], as
observed in our study. Thus, the increase in plasma bile
acids in the 20 % CP group may have been partly involved
in the mechanism of lipid lowering.
The effect of CP on b-oxidation, bile formation, and
lipogenesis may be due to changes in the amino acid
composition compared to casein. Several studies have
suggested that dietary proteins with low ratios of methio-
nine/glycine and lysine/arginine have both cholesterol-
lowering [17, 44, 45] and TAG-lowering effects [46]. Data
suggest that dietary methionine and lysine are hypercho-
lesterolemic, whereas arginine has anti-atherogenic effects
and glycine has hypocholesterolemic effects [46, 47].
Compared to casein supplementation, it was of interest to
note that rats treated with 20 % CP had lower plasma
lysine levels and higher plasma arginine level, resulting in
a lower lysine/arginine ratio. The 20 % CP diet was
characterized by low ratio of lysine/arginine. In the present
study, 20 % CP-treated rats showed an almost sevenfold
lower ratio of plasma methionine/glycine than control rats.
It is also noteworthy that the 20 % CP diet was charac-
terized of a low methionine/glycine ratio. However, the
lower body weight of the 20 % CP rats is probably not
caused by methionine deficiency as studies of methionine-
deprived rats have shown hypercholesterolemia [48] and
fatty liver [49]. Although it is likely that the amino acid
composition of CP has indirect effects on energy metabo-
lism in rats, the mechanisms behind the hypolipidemic
effect of dietary amino acids are unknown and must be
further studied.
In summary, the present study demonstrates that the
treatment of normolipidemic rats with a water-soluble
fraction of CP decreases plasma and liver TAG and cho-
lesterol compared to casein as a protein source. The plasma
TAG-lowering effect seems to be primarily mediated at the
synthesis level by reducing lipogenesis thereby lowering
the flux of fatty acids for TAG biosynthesis, in addition to
an increase in the mitochondrial fatty acid oxidation. The
hypocholesterolemic effect of CP might be related to the
enterohepatic circulation and bile excretion. Whether the
hypolipidemic effect and the bioactivity of CP are related
to low lysine/arginine and methionine/glycine ratios should
Fig. 4 Plasma levels of a free carnitine, b c-butyrobetaine, c acetyl-
carnitine, d propionylcarnitine, e octanoylcarnitine, and f palmitoyl-
carnitine in male Wistar rats fed a control diet with 20 % casein or a
diet with either 6, 14, or 20 % CP for 4 weeks. Values are means with
their standard errors represented by vertical bars (n 6). a,b,cMean
values with unlike letters were significantly different (p\ 0.05; one-
way ANOVA with Tukey’s post hoc test)
202 Eur J Nutr (2015) 54:193–204
123
be considered. The most striking finding in this study was
the low body weight despite the high feed intake in the
20 % CP-fed rats compared to control. This might be due
to a change in energy balance.
Acknowledgments We thank Kari Williams, Liv Kristine Øysæd,
Randi Sandvik, Kari Helland Mortensen, Svein Kruger and Torunn
Eide for technical assistance, and Eline Milde and the staff at the
Laboratory Animal Facility, University of Bergen, for care of the
animals. This project has been founded by the University of Bergen
through the Clinical Nutrition Program and the company Norilia AS.
Conflict of interest The authors declare that they have no com-
peting interests.
References
1. Ren J, Pulakat L, Whaley-Connell A, Sowers JR (2010) Mito-
chondrial biogenesis in the metabolic syndrome and cardiovas-
cular disease. J Mol Med (Berl) 88:993–1001
2. Subramanian S, Chait A (2012) Hypertriglyceridemia secondary
to obesity and diabetes. Biochim Biophys Acta 1821:819–825
3. Burri L, Thoresen GH, Berge RK (2010) The role of PPARalpha
activation in liver and muscle. PPAR Res. doi:10.1155/2010/
542359
4. Rakhshandehroo M, Knoch B, Muller M, Kersten S (2010) Per-
oxisome Proliferator-activated receptor alpha target genes. PPAR
Research, Vol 2010, Article ID 612089. doi:10.1155/2010/
612089
5. Eberle D, Hegarty B, Bossard P, Ferre P, Foufelle F (2004)
SREBP transcription factors: master regulators of lipid homeo-
stasis. Biochimie 86:839–848
6. Osborne TF (2000) Sterol regulatory element-binding proteins
(SREBPs): key regulators of nutritional homeostasis and insulin
action. J Biol Chem 275:32379–32382
7. Ascencio C, Torres N, Isoard-Acosta F, Gomez-Perez FJ, Her-
nandez-Pando R, Tovar AR (2004) Soy protein affects serum
insulin and hepatic SREBP-1 mRNA and reduces fatty liver in
rats. J Nutr 134:522–529
8. Moriyama T, Kishimoto K, Nagai K, Urade R, Ogawa T, Utsumi
S, Maruyama N, Maebuchi M (2004) Soybean beta-conglycinin
diet suppresses serum triglyceride levels in normal and geneti-
cally obese mice by induction of beta-oxidation, downregulation
of fatty acid synthase, and inhibition of triglyceride absorption.
Biosci Biotechnol Biochem 68:352–359
9. Velasquez MT, Bhathena SJ (2007) Role of dietary soy protein in
obesity. Int J Med Sci 4:72–82
10. Choi JY, Jeon JE, Jang SY, Jeong YJ, Jeon SM, Park HJ, Choi
MS (2011) Differential effects of powdered whole soy milk and
its hydrolysate on antiobesity and antihyperlipidemic response to
high-fat treatment in C57BL/6 N mice. J Agric Food Chem
59:2584–2591
11. Lee YP, Mori TA, Puddey IB, Sipsas S, Ackland TR, Beilin LJ,
Hodgson JM (2009) Effects of lupin kernel flour-enriched bread
on blood pressure: a controlled intervention study. Am J Clin
Nutr 89:766–772
12. Rigamonti E, Parolini C, Marchesi M, Diani E, Brambilla S,
Sirtori CR, Chiesa G (2010) Hypolipidemic effect of dietary pea
proteins: impact on genes regulating hepatic lipid metabolism.
Mol Nutr Food Res 54(Suppl 1):S24–S30
13. Wergedahl H, Liaset B, Gudbrandsen OA, Lied E, Espe M, Muna
Z, Mork S, Berge RK (2004) Fish protein hydrolysate reduces
plasma total cholesterol, increases the proportion of HDL
cholesterol, and lowers acyl-CoA: cholesterol acyltransferase
activity in liver of Zucker rats. J Nutr 134:1320–1327
14. Gudbrandsen OA, Wergedahl H, Liaset B, Espe M, Mork S,
Berge RK (2008) Dietary single cell protein reduces fatty liver in
obese Zucker rats. Br J Nutr 100:776–785
15. Zhang Y, Kouguchi T, Shimizu M, Ohmori T, Takahata Y, Mor-
imatsu F (2010) Chicken collagen hydrolysate protects rats from
hypertension and cardiovascular damage. J Med Food 13:399–405
16. Saiga A, Iwai K, Hayakawa T, Takahata Y, Kitamura S, Ni-
shimura T, Morimatsu F (2008) Angiotensin I-converting
enzyme-inhibitory peptides obtained from chicken collagen
hydrolysate. J Agric Food Chem 56:9586–9591
17. Morita T, Oh-hashi A, Takei K, Ikai M, Kasaoka S, Kiriyama S
(1997) Cholesterol-lowering effects of soybean, potato and rice
proteins depend on their low methionine contents in rats fed a
cholesterol-free purified diet. J Nutr 127:470–477
18. Bjorndal B, Berge C, Ramsvik MS, Svardal A, Bohov P, Skorve
J, Berge RK (2013) A fish protein hydrolysate alters fatty acid
composition in liver and adipose tissue and increases plasma
carnitine levels in a mouse model of chronic inflammation. Lipids
Health Dis 12:143
19. Grimstad T, Bjørndal B, Cacabelos D, Aasprong OG, Omdal R,
Svardal A, Bohov P, Pamplona R, Portero-Otin M, Berge RK,
Hausken T (2013) A salmon peptide diet alleviates experimental
colitis as compared with fish oil. J Nutr Sci 2:1–8
20. Bligh EG, Dyer WJ (1959) A rapid method of total lipid
extraction and purification. Can J Biochem Physiol 37:911–917
21. Bjorndal B, Vik R, Brattelid T, Vigerust NF, Burri L, Bohov P,
Nygard O, Skorve J, Berge RK (2012) Krill powder increases
liver lipid catabolism and reduces glucose mobilization in tumor
necrosis factor-alpha transgenic mice fed a high-fat diet.
Metabolism 61:1461–1472
22. Vernez L, Wenk M, Krahenbuhl S (2004) Determination of
carnitine and acylcarnitines in plasma by high-performance liquid
chromatography/electrospray ionization ion trap tandem mass
spectrometry. Rapid Commun Mass Spectrom 18:1233–1238
23. Vigerust NF, Bohov P, Bjorndal B, Seifert R, Nygard O, Svardal
A, Glintborg D, Berge RK, Gaster M (2012) Free carnitine and
acylcarnitines in obese patients with polycystic ovary syndrome
and effects of pioglitazone treatment. Fertil Steril 98:1620–1626
24. Cohen SA, Strydom DJ (1988) Amino acid analysis utilizing
phenylisothiocyanate derivatives. Anal Biochem 174:1–16
25. Liaset B, Julshamn K, Espe M (2003) Chemical composition and
theoretical nutritional evaluation of the produced fractions from
enzymic hydrolysis of salmon frames with Protamex (TM). Proc
Biochem 38:1747–1759
26. Bremer J (1981) The effect of fasting on the activity of liver
carnitine palmitoyltransferase and its inhibition by malonyl-coa.
Biochim Biophys Acta 665:628–631
27. Madsen L, Rustan AC, Vaagenes H, Berge K, Dyroy E, Berge
RK (1999) Eicosapentaenoic and docosahexaenoic acid affect
mitochondrial and peroxisomal fatty acid oxidation in relation to
substrate preference. Lipids 34:951–963
28. Skorve J, Al-Shurbaji A, Asiedu D, Bjorkhem I, Berglund L,
Berge RK (1993) On the mechanism of the hypolipidemic effect
of sulfur-substituted hexadecanedioic acid (3-thiadicarboxylic
acid) in normolipidemic rats. J Lipid Res 34:1177–1185
29. Vigerust NF, Cacabelos D, Burri L, Berge K, Wergedahl H,
Christensen B, Portero-Otin M, Viste A, Pamplona R, Berge RK,
Bjørndal B (2011) Fish oil and 3-thia fatty acid have additive
effects on lipid metabolism but antagonistic effects on oxidative
damage when fed to rats for 50 weeks. J Nutr Biochem
23:1384–1393
30. Rekawiecki R, Rutkowska J, Kotwica J (2012) Identification of
optimal housekeeping genes for examination of gene expression
in bovine corpus luteum. Reprod Biol 12:362–367
Eur J Nutr (2015) 54:193–204 203
123
31. Onyeali EU, Onwuchekwa AC, Monaga CC, Monanu MO (2010)
Plasma lipid profile of Wistar albino rats fed palm oil-supple-
mented diets. Int J Biol Chem Sci 4:1163–1169
32. Liaset B, Madsen L, Qin Haob GC, Mellgrenc G, Marschall H-U,
Hallenborg P, Espea M, Frøylanda L, Kristiansen K (2009) Fish
protein hydrolysate elevates plasma bile acids and reduces vis-
ceral adipose tissue mass in rats. Biochim Biophys Acta Mol Cell
Biol Lipid 1791:254–262
33. Trauner M, Halilbasic E (2011) Nuclear receptors as new per-
spective for the management of liver diseases. Gastroenterology
140(1120–1125):e1112
34. Zhang Y, Kouguchi T, Shimizu K, Sato M, Takahata Y, Mor-
imatsu F (2010) Chicken collagen hydrolysate reduces proin-
flammatory cytokine production in C57BL/6.KOR-ApoEshl
mice. J Nutr Sci Vitaminol (Tokyo) 56:208–210
35. Flowers MT (2009) The delta9 fatty acid desaturation index as a
predictor of metabolic disease. Clin Chem 55:2071–2073
36. Hoppel C (2003) The role of carnitine in normal and altered fatty
acid metabolism. Am J Kidney Dis 41:S4–S12
37. Lysiak W, Toth PP, Suelter CH, Bieber LL (1986) Quantitation
of the efflux of acylcarnitines from rat heart, brain, and liver
mitochondria. J Biol Chem 261:13698–13703
38. Dikkers A, Tietge UJ (2010) Biliary cholesterol secretion: more
than a simple ABC. World J Gastroenterol 16:5936–5945
39. Belinsky MG, Bain LJ, Balsara BB, Testa JR, Kruh GD (1998)
Characterization of MOAT-C and MOAT-D, new members of the
MRP/cMOAT subfamily of transporter proteins. J Natl Cancer
Inst 90:1735–1741
40. Gatchalian-Yee M, Arimura Y, Ochiai E, Yamada K, Sugano M
(1997) Soybean protein lowers serum cholesterol levels in ham-
sters: effect of debittered undigested fraction. J Nutr 13:633–639
41. Sugano M, Goto S, Yamada Y, Yoshida K, Hashimoto Y, Matsuo
T, Kimoto M (1988) The hypocholesterolemic action of the
undigested fraction of soybean protein in rats. Atherosclerosis
72:115–122
42. Angelin B, Einarsson K, Leijd B (1978) Effect of chenodeoxy-
cholic acid on serum and biliary lipids in patients with hyper-
lipoproteinaemia. Clin Sci Mol Med 54:451–455
43. Watanabe M, Houten SM, Wang L, Moschetta A, Mangelsdorf
DJ, Heyman RA, Moore DD, Auwerx J (2004) Bile acids lower
triglyceride levels via a pathway involving FXR, SHP, and
SREBP-1c. J Clin Invest 113:1408–1418
44. Gudbrandsen OA, Wergedahl H, Liaset B, Espe M, Berge RK
(2005) Dietary proteins with high isoflavone content or low
methionine-glycine and lysine-arginine ratios are hypocholeste-
rolaemic and lower the plasma homocysteine level in male
Zucker fa/fa rats. Br J Nutr 94:321–330
45. Xu YJ, Arneja AS, Tappia PS, Dhalla NS (2008) The potential
health benefits of taurine in cardiovascular disease. Exp Clin
Cardiol 13:57–65
46. Kritchevsky D, Tepper SA, Czarnecki SK, Klurfeld DM (1982)
Atherogenicity of animal and vegetable protein: influence of the
lysine to arginine ratio. Atherosclerosis 41:429–431
47. Vega-Lopez S, Matthan NR, Ausman LM, Harding SV, Rideout
TC, Ai M, Otokozawa S, Freed A, Kuvin JT, Jones PJ, Schaefer
EJ, Lichtenstein AH (2010) Altering dietary lysine: arginine ratio
has little effect on cardiovascular risk factors and vascular reac-
tivity in moderately hypercholesterolemic adults. Atherosclerosis
210:555–562
48. Moundras C, Remesy C, Levrat MA, Demigne C (1995) Methi-
onine deficiency in rats fed soy protein induces hypercholester-
olemia and potentiates lipoprotein susceptibility to peroxidation.
Metabolism 44:1146–1152
49. Barakat HA, Hamza AH (2012) Glycine alleviates liver injury
induced by deficiency in methionine and or choline in rats. Eur
Rev Med Pharmacol Sci 16:728–736
204 Eur J Nutr (2015) 54:193–204
123
IV
1
A water-soluble extract of chicken reduced plasma triacylglycerols, but showed 1
no anti-atherosclerotic activity in apoE-/- mice 2
3
Rita Vika*, Trond Brattelidb, Jon Skorvea, Ottar Nygårda.c, Jan E. Nordrehauga,d, Rolf 4
K. Bergea,c and Bodil Bjørndala 5 6 aDepartment of Clinical Science, University of Bergen, 5020 Bergen, Norway 7 bNational Institute of Nutrition and Seafood Research, NIFES, 5817 Bergen, Norway 8 cDepartment of Heart Disease, Haukeland University Hospital, 5021 Bergen, Norway 9 dSection of Cardiology, Stavanger University Hospital, 4068 Stavanger, Norway 10
11
*Corresponding author at: Department of Clinical Science, University of Bergen, 12
5020 Bergen, Norway. Tel.: +4755975846. E-mail address: [email protected] (R. 13
Vik). 14
15
E-mail addresses: 16
TB: [email protected] 17
JS: [email protected] 18
ON: [email protected] 19
JEN: [email protected] 20
RKB: [email protected] 21
BB: [email protected] 22
23
24
25
2
ABSTRACT 26
27
Background 28
A water-soluble protein extract of chicken (CP) has been reported to modulate plasma 29
lipids and hepatic lipid catabolism. Atherosclerosis is the primary contributing factor 30
for cardiovascular disease and there is evidence that both lipid abnormalities and 31
chronic inflammation have crucial involvement in the initiation and progression of 32
atherosclerosis. The aim of the study was to assess the impact of CP on 33
atherosclerotic development in mice predisposed for developing atherosclerotic 34
lesions. 35
36
Methods 37
24 apoE-/- mice were divided into two groups and fed a high-fat diet. The control 38
group received a 20% casein diet, whereas the intervention group was fed a diet with 39
15% water-soluble extract of chicken protein and 5% casein. Body weight and feed 40
intake was measured regularly, and indirect calorimetry was measured at week 1 and 41
10. After 12 weeks the mice were sacrificed, and blood, liver, heart and aorta were 42
harvested. Plasma and liver lipids and fatty acid composition analyses were carried 43
out, in addition to gene expression in liver and heart. Also, en-face analysis was 44
performed on aorta, and plasma inflammatory markers were determined. 45
46
Results 47
The dietary intervention with CP only resulted in minor reduction of plasma 48
triacylglycerol (TAG) and no change in the plasma cholesterol level compared to 49
control. The TAG lowering was associated with induction of hepatic carnitine 50
acyltransferase 2 activity and gene expression. Mice fed CP also displayed a lower 51
respiratory exchange ratio during the light cycle, indicating a higher degree of fatty 52
acid oxidation in the fasting state. Aorta images displayed no differences in plaque 53
development between mice fed CP or control diet, and gene expression of 54
inflammatory markers in heart was unchanged. Moreover, CP administration did not 55
influence plasma levels of several inflammatory cytokines in apoE-/- mice. 56
57
Conclusion 58
3
CP displayed a slight potential to increase mitochondrial fatty acid oxidation and 59
reduce plasma TAG. However, CP did not affect plasma cholesterol levels, 60
inflammation status or atherosclerotic development in apoE-/- mice. Based on these 61
results, dietary intervention with CP does not have sufficient capacity to influence 62
atherosclerotic development in apoE-/- mice. 63
64
Key Words: Atherosclerosis, Chicken protein, Triacylglycerol, mitochondrial β-65
oxidation 66
67
68
4
1. Introduction 69
70
Apolipoprotein E (apoE) is primarily synthesized in liver and most commonly found 71
in circulating chylomicrons and intermediate density lipoprotein (IDL) particles. 72
ApoE is involved in lipid metabolism through the catabolism of triacylglycerol 73
(TAG)-rich particles, in that it binds to receptors belonging to the low-density 74
lipoprotein (LDL) receptor family thus clearing chylomicrons and remnants from 75
plasma [1]. As a ligand for receptor-mediated hepatic clearance of remnant particles, 76
apoE is essential in removing excess TAG and cholesterol from the blood stream. 77
Elevated cholesterol, particularly LDL cholesterol, is strongly associated with 78
atherosclerosis as it contributes to a clustering of LDL and its oxidized form in the 79
intima. ApoE knockout mice (apoE-/-) lack this apolipoprotein leading to an 80
accumulation of VLDL remnants in plasma and the development of spontaneous 81
atherosclerotic lesions [2, 3]. This characteristic gives the opportunity to investigate 82
atherogenesis, without a diet rich in fats and cholesterol. A high-fat, cholesterol-83
containing diet will however, accelerate the process. 84
85
Atherosclerosis, together with hypertension, is the primary cause of coronary artery 86
disease (CAD), stroke peripheral arterial disease and cardiovascular disease (CVD), 87
which is responsible for the majority of morbidity and mortality in the Western world 88
(World Health Organization Global Health Observatory, http://www.who.int/gho/en/). 89
Intervention studies have suggested that consumption of certain protein sources lower 90
cholesterol levels and thus may lower the risk of cardiovascular events. Soy protein is 91
most studied in this regard [4-6], and suggested mechanisms for its cholesterol-92
lowering effect are linked to the presence of non-protein content, i.e isoflavones, the 93
potential role in up-regulation of LDL receptor activity [7], or the low 94
methionine/glycine- and lysine/arginine ratios [8, 9]. Proper folding of apoB, the main 95
protein in LDL, is essential for its function after synthesis. The amino acid 96
composition in optimal diets may influence protein synthesis, hence counteract 97
potential conformational changes in the apoB entity of LDL by facilitating proper 98
folding. This is important as changes in the surface charge of the protein can promote 99
atherosclerosis [10] because loss of apoB characteristic structure will contribute to 100
increased uptake by alternate receptors, like scavenger receptors, accumulation of 101
LDL due to resistance towards proteolysis, and also the promotion of oxidation [11]. 102
5
Arginine is the principal substrate of nitric oxide (NO) production, and elevated levels 103
of this amino acid has been linked to improved endothelial cell function [12]. In 104
contrast, high levels of methionine is linked to elevated levels of homocysteine, which 105
might cause endothelial damage by decreasing NO-bioavailability [13]. More 106
recently, a lipid-lowering effect of protein from marine origin has been found. Plasma 107
cholesterol-lowering as a result of dietary fish protein is proposed to be due to 108
increased cholesterol excretion through bile. This has been associated with the 109
presence of the organic acid taurine, which conjugates with bile acids forming bile 110
salts, thus increasing their solubility [14, 15]. Recently, chicken protein has showed 111
promising results in lowering hypertension through an angiotensin I-converting 112
enzyme (ACE)-inhibitory effect [16]. 113
We previously found that water soluble chicken protein (CP) affected hepatic lipid 114
and bile acid metabolism in Wistar rats, displaying a decrease in both plasma and 115
hepatic TAG, increased mitochondrial β-oxidation, accompanied by a cholesterol-116
lowering effect linked to increased bile acid formation [17]. Based on these data, we 117
wished to investigate whether a CP-diet could attenuate the progression of 118
atherosclerosis in the apoE knockout mouse model. 119
120
2. Methods 121
122
2.1. Animals and diets 123
124
The animal study was conducted according to Guidelines for the care and use of 125
Experimental Animals, and the Norwegian state Board of Biological Experiments 126
with Living Animals approved the protocol. 24 female apoE knockout mice (apoE-/-) 127
generated in the strain B6, 129P2-Apoetm1Unc/J, four weeks old, were purchased from 128
Jackson Laboratory, Italy. They were randomised and housed in groups of three mice 129
per cage in a closed system under standard laboratory conditions with temperature 22 130
2 C, light/dark cycles of 12/12 h, relative humidity 55 5% and with unrestricted 131
access to chow feed and tap water. The animals were allowed to adjust to this 132
environment for 1 week before cages were distributed into two groups of twelve mice. 133
The control diet contained 20% (w/w) protein from bovine milk casein (Dyets Inc., 134
Bethlehem, PA, USA), and 21% (w/w) fat consisting of 19% lard (Ten Kate Vetten 135
6
BV, Musselkanaal, Netherlands) and 2% soy oil (Dyets Inc.). The diet also contained 136
0.15% cholesterol (Sigma-Aldrich AS, St. Louis, MO, USA). In the intervention 137
group, 75% of the casein was replaced with chicken protein constituting 15% of the 138
diet (Norilia, Oslo, Norway). The chicken protein was obtained as previously 139
described [17]. The other constituents of the diets were cornstarch, dyetrose, sucrose, 140
fiber, AIN-93G-MX, AIN-93 vitamin mix, L-cysteine, choline bitartrate (all from 141
Dyets Inc.), and tert-Butyl-hydroquinone (Sigma-Aldrich). All mice were fed ad 142
libitum for 12 weeks. 143
144
2.2. Indirect calorimetry 145
After 1 week and 10 weeks of feeding, 5 to 6 animals from each group were 146
transferred to metabolic cages for 3 consecutive days under standard laboratory 147
conditions with free access to feed and water. The cages were monitored by a 148
Comprehensive Laboratory Animal Monitoring system (CLAMS) (Columbus 149
Instruments, Columbus, OH, USA) of individual live-in cages to measure energy 150
expenditure by indirect calorimetry continuously for 30 sec every 17 minutes. 151
CLAMS allow automated, non-invasive data collection monitoring oxygen 152
consumption (VO2) and carbon dioxide production (VCO2). The respiratory exchange 153
ratio (RER) was calculated as the ratio between VCO2 and VO2, while heat was 154
calculated by the formula: 3.815 + 1.232 × RER. The first 7 hours was excluded from 155
the results as acclimatization to the CLAMS cages. 156
157
2.3. Tissue harvesting 158
159
EDTA-blood was collected from the retro-orbital plexus at start and after 11 weeks of 160
the experiment. At sacrifice, mice were anesthetized by inhalation of 2-5% 161
sevoflurane (Abbolt Laboratories Ltd., Berkshire, UK) after four hours of fasting. 162
Blood was collected from the heart into a tube containing 7.5% EDTA, the samples 163
were chilled on ice for about 15 minutes, plasma was separated by centrifugation and 164
stored at -80°C until further analysis. After perfusion with phosphate-buffered saline 165
(PBS), aorta was dissected from the aortic root to the iliac bifurcation, adventitial 166
tissue present was carefully removed, the aorta was put in a tube with 10% formalin 167
overnight, and then transferred to PBS containing tubes. Heart and liver were freeze-168
clamped in liquid nitrogen and stored at -80°C until further analysis. 169
7
170
2.4. En-face analysis of the aorta 171
172
Aorta dissection took place in a pan filled with PBS. The aorta was split open 173
circumferentially under a magnifier (Carl Zeiss OPMI pico), pinned flat on a pad of 6 174
layers of parafilm covered with black vulcanized insulation tape, placed in 70% 175
ethanol for 10 minutes, and then soaked in Sudan IV (Sigma) for 20 minutes, and 176
finally destained using 80% ethanol for 3 minutes. To avoid particle-interference 177
when photographed, the pinned aorta was rinsed under running water to remove all 178
ethanol. Images were then captured with a digital camera (Canon 5D Mark II). 179
Assessment of plaque area was performed using the software Image J 180
(http://rsb.info.nih.gov/ij/download.html). 181
182
2.5. Plasma lipids and fatty acid composition 183
184
Plasma lipids were measured enzymatically on a Hitachi 917 system (Roche 185
Diagnostics GmbH, Mannheim, Germany) using the triacylglycerol (GPO-PAP) and 186
cholesterol kit (CHOD-PAP) from Roche Diagnostics, and the phospholipids FS kit 187
from DiaSys (Diagnostic Systems GmbH, Holzheim, Germany). Total plasma fatty 188
acid composition was analyzed as previously described [18]. 189
190
2.6. Hepatic enzyme activities 191
192
Fresh liver samples were homogenized as described earlier [19]. Briefly; 100 mg liver 193
were homogenized in 1 mL ice-cold sucrose medium, centrifuged, and the post-194
nuclear fraction removed. Palmitoyl-CoA oxidation was measured in the post-nuclear 195
fraction from liver as acid-soluble products, as described by Bremer et al. [20], with 196
some modifications [21]. The activities of carnitine palmitoyltransferase (CPT)-2, 197
fatty acyl-CoA oxidase (ACOX)-1, glycerol-3-phosphate acyltransferase (GPAT) 198
were measured in the post-nuclear fraction after storage at 80°C as described by 199
Skorve et al. [22], with some modifications [17]. 200
201
2.7. Gene expression analysis 202
203
8
Total cellular RNA was purified from frozen heart and liver samples, and cDNA was 204
produced as previously described [23]. Real-time PCR was performed with Sarstedt 205
384 well multiply-PCR Plates (Sarstedt Inc., Newton, NC, USA) on the following 206
genes, using probes and primers from Applied Biosystems (Foster City, CA, USA): 207
Acetyl-CoA carboxylase (Acaca, Mm01304277_m1), acyl-coenzyme A oxidase 208
(Acox1, Mm00443579), apolipoprotein B (Apob, Mm01545156), CD36 antigen 209
(Cd36/Fat, Mm00432403), carnitine palmitoyltransferase (Cpt1a, Mm00550438), 210
Cpt2 (Mm00487202), cytochrome P450, family 7, subfamily A, polypeptide 1 211
(Cyp7a1, Mm00484152), glycerol-3-phosphate acyltransferase, mitochondrial (Gpam, 212
Mm00833328), intracellular adhesion molecule (Icam, Mm00516023_m1), low-213
density lipoprotein receptor (Ldlr, Mm00440169), monocyte chemoattractant protein 214
(Mcp1, Mm00441242), nitric oxide synthase 2 (Nos2, Mm00440502_m1), solute 215
carrier family 25, also known as carnitine/acylcarnitine translocase (Slc25a20, 216
Mm00451571_m1), stearoyl-CoA desaturase (Scd1, Mm0077229_m1), vascular cell 217
adhesion molecule 1 (Vcam1, Mm00443281), very low-density lipoprotein receptor 218
(Vldlr, Mm00443281_m1), and Solaris qPCR gene Expression Assays (Thermo 219
Fisher Scientific Inc.,Waltham, MA, USA): fatty acid desaturase 1 (Fads1, AX-220
064722-00-0100), fatty acid/Δ6 desaturase 2 (Fads2, AX-049816-00-0100). 221
Reference genes used in liver: 18s (Kit-FAM-TAMRA (Reference RT-CKFT-18 s)) 222
from Eurogentech, Seraing, Belgium, ribosomal protein, large, P0 (Rplp0, AX-223
061958-00-0100) and TATA-box binding protein (Tbp, AX-041188-00) both from 224
Thermo Fisher Scientific Inc. (Waltham, MA, USA). Reference genes tested for heart: 225
Rplp0, polymerase (RNA) II (DNA directed) polypeptide A, (Polr2a, AX-046005-00) 226
and hypoxanthine guanine phosphoribosyltransferase 1 (Hprt1, AX-045271-00) also 227
from Thermo Fisher Scientific Inc. Normfinder (moma.dk/normfinder-software) was 228
used to assess the optimal reference genes, and data normalized to 18s, Rplp0 and Tbp 229
were used for liver, and Rplp0 for heart. 230
231
2.8. Plasma inflammatory markers 232
233
Plasma concentrations of interleukin (IL)-1 IL-1β, IL-2, IL-6, IL-10, IL-17, 234
granulocyte colony-stimulating factor (G-CFS), granulocyte macrophage colony-235
stimulating factor (GM-CFS), interferon gamma (INF- ), monocyte chemotactic 236
9
protein 1 (MCP-1/CCL2), chemokine (C-C motif) ligand 5 (Rantes/ CCL5), and 237
tumour necrosis factor alpha (TNF- ) were determined using a custom-made 238
multiplex MILLIPLEX MAP kit (Millipore Corp., St. Charles, IL, USA). The 239
antibody-conjugated beads were allowed to react with the sample and a secondary 240
antibody in a 96-well plate to form a capture sandwich immunoassay. Finally, the 241
assay solution was read by the Bio-Plex array reader (Bio-Rad, Hercules, CA, USA) 242
and determined with the Bio-Plex Manager Software 4.1. 243
244
2.9. Statistical analysis 245
246
Data sets were analyzed using Prism Software (Graph-Pad Software, San Diego, CA) 247
to create figures and to evaluate statistical significance. The results are shown as 248
means of 8-12 animals pr. group with their standard deviations, unless otherwise 249
stated. Shapiro-Wilk test was used to estimate normal distribution and unpaired t-test 250
was used to determining statistical significance between the two groups. P-values < 251
0.05 were considered significant. 252
253
3. Results 254
255
3.1. Increased feed intake and energy expenditure in CP treated mice 256
257
After 12 weeks of CP-feeding we found no change in body weight, but a significant 258
increased feed intake compared to control (Table 1). The CP group displayed an 259
increase in liver weight, but the liver index was unchanged (Table 1). The metabolic 260
rate of the animals was measured by indirect calorimetry after 1 week and 10 weeks 261
on high-fat diets. No change was seen in metabolic cage-feed intake, activity or 262
calculated RER in this period (data not shown). Energy expenditure calculated as heat 263
production was reduced in week 10 compared to week 1 in both feeding groups (Fig. 264
1A). During the first stay in CLAMS the feeding groups had a similar weight gain 265
(data not shown). However, in week 10, the control group gained weight (mean ± SD; 266
0.89 ± 0.8 g), while the CP group lost weight (mean ± SD; -0.4 ± 0.6 g), despite a 267
similar feed intake (Fig. 1B). Activity was comparable in CP-fed and control-fed mice 268
both in the dark (night) and light (day) phase (Fig. 1C). However, during the light 269
10
phase, the CP-fed group demonstrated lower RER than control after 10 weeks of 270
dietary intervention (Figure 1D). Figure 1E and F show a graphic representation of 271
heat production and RER during the day/night cycle, respectively. 272
273
3.2. Minor influence of CP on plasma lipids 274
275
Non-fasted plasma TAG levels decreased over time in both the intervention and 276
control group, although more so in CP-fed mice (Fig. 2A). Thus, the ΔTAG 277
(difference between week 11 and baseline) value was lower in the CP group than the 278
control group (Fig. 2B). The end-point measurements of TAG at week 12 showed a 279
minor lower level of plasma TAG in CP-treated mice compared to controls (Fig. 2C). 280
Plasma total cholesterol levels increased in both groups over time (Fig. 2D, E), with 281
no difference between the two groups at the end of the treatment period (Fig. 2F). The 282
HDL cholesterol, LDL cholesterol, phospholipids, NEFAs and cholesteryl esters all 283
increased in both groups during the treatment period, and there was no difference 284
between the two groups at termination (data not shown). The CP intervention did not 285
change the plasma fatty acid composition after 12 weeks of diet (data not shown). 286
287
3.3 Hepatic enzyme activity and gene expression after CP intervention 288 289 The CP-diet did not affect palmitoyl-CoA catabolism in hepatic homogenates, and the 290
activity with and without the inhibitory component malonyl-CoA was not influenced 291
(Fig. 3A). However, the CPT2 activity and mRNA level of Cpt2 was tended to 292
increased, which could contribute to increased mitochondrial fatty acid oxidation (Fig. 293
3B and Table 2) as CPT2 participate in fatty acid transport into the matrix, essential 294
for their oxidation. Peroxisomal fatty acid oxidation was not affected, as ACOX1 295
activity and gene expression was unchanged (Fig. 3C and Table 2). CP did not seem 296
to have an effect on fatty acid synthesis as FAS activity and the mRNA level of Fasn 297
as well as the rate-limiting enzyme in lipogenesis, Acaca, displayed comparable levels 298
between CP-treated mice and controls (Fig. 3D, Table 2, respectively). The gene 299
expression of Slc25a20, mediating the transport of acylcarnitines into the 300
mitochondrial matrix, was not modified in CP-treated mice (Table 2). In addition, no 301
change was observed in the expression Scd1, Fads1 and Gpam, involved in 302
desaturation and glycerolipid synthesis, respectively (Table 2). Fads2 was 303
11
significantly down regulated, while Cd36, probably involved in fatty acid import, was 304
unchanged. No influence on cholesterol import was observed as Apob, Ldlr and Vldlr 305
were unchanged (Table 2). 306
307
3.4. Atherosclerotic lesion formations and gene expression in the heart 308
309
En-face analysis was used to reveal plaque development in the aortic arch (Fig. 4A). 310
As shown in Figure 4B, we detected a comparable amount of plaque in the aorta of 311
CP-fed mice compared to controls. Expression in the heart of genes related to 312
inflammation supported these findings as no change was found in mRNA levels of 313
Icam, Vcam1, Nos2 and Mcp1 (Fig. 4C-F, respectively). 314
315
3.5. Effect of CP on systemic inflammation 316
317
To assess systemic inflammation, plasma levels of several inflammatory components 318
were determined after 12 weeks on high-fat diets. CP administration did not influence 319
the cytokines and chemokines measured, except a small, but significant increase in 320
IFN- levels in CP-fed mice compared to controls. 321
322
4. Discussion 323
324
Atherosclerosis is a multifactorial complex CVD with a bidirectional interaction 325
between lipids and inflammation as a major feature. Risk factors such as dyslipidemia 326
are involved in the progression of atherosclerosis. Specific amino acid content from 327
certain protein sources have emerged as both cholesterol- and TAG-lowering 328
constituents of foods [8, 9, 24]. In the present study, we only found a small reduction 329
in plasma TAG levels of apoE-/- mice after CP-feeding and all classes of cholesterol 330
increased over time in both control and CP-treated apoE-/-- mice in response to high-331
fat feeding. The minimal TAG-lowering effect in the CP group seemed to be related 332
to a slight increase in mitochondrial fatty acid oxidation, as both CPT2 activity and 333
gene expression displayed a marginal increase. These results are in line with a 334
reduced RER during the fasting state observed in CP-fed mice. However, these 335
findings are not nearly as prominent as in a previous experiment with CP in Wistar 336
12
rats, where a clear reduction in plasma and liver TAG were detected, linked to both 337
increased fatty acid oxidation and reduced lipogenesis [17]. In the present study in 338
apoE-/- mice, lipogenesis seemed unaffected, as FAS activity and gene expression of 339
lipogenic genes were unchanged. 340
341
The atherosclerotic development in aortic arch in apoE-/- mice was not influenced by 342
CP administration, further supporting that the vague reduction in plasma TAG was 343
insufficient to prevent plaque development in this model. As implied previously [21], 344
differences in atherosclerotic development in response to protein diets could be 345
independent of plasma lipids and fatty acids, and more related to anti-inflammatory 346
processes. Studies have demonstrated anti-inflammatory potential of marine bioactive 347
peptides in apoE-/- mice as well as cell culture [21, 25]. Here, plasma inflammatory 348
markers were unchanged, as were gene expression of Vcam1, Icam, Nos2 and Mcp1 in 349
the heart. Another study using chicken collagen hydrolysate fed C57BL/6.KOR-350
ApoEshl mice, revealed unaltered TAG levels between the intervention group and 351
control, accompanied by no differences in aortic plaque area [26]. The failure to 352
reduce plaque area, plasma cholesterol level and lipogenesis, combined with the 353
physiologically irrelevant reduction in plasma TAG levels in the present study, 354
indicate that CP is not able to counteract the negative effect of disrupted lipoprotein 355
metabolism in apoE-/- mice. 356
357
An interesting observation was the higher feed intake in CP-fed mice compared to 358
controls, without a corresponding increase in weight gain. This could be connected to 359
the observed reduction in RER, when monitoring the mice in metabolic cages 360
(CLAMS), implying that fat was the preferred energy source. We detected no 361
differences in fat deposit weights between the CP-fed group and controls (data not 362
shown), suggesting that the increased energy intake was compensated for with 363
increased fat combustion, thus avoiding weight gain in the CP-fed mice. Noteworthy, 364
the apoE-/- model is not suitable for studying body weight due to the lack of a gene 365
important for lipoprotein metabolism; therefore these allegations are strictly 366
speculations. Heat production as well as activity level displayed comparable levels 367
between the two groups both the first period (1 week) and second period (10 week) of 368
CLAMS, meaning that energy consumption was approximately similar. The lower 369
heat production observed in both groups in the second period of CLAMS is probably 370
13
related to adaptation to the high-fat diet. As heat production constitutes energy 371
expenditure, and levels of activity and heat production were similar between groups, 372
the lower RER value in the CP-fed mice suggest a higher energy contribution from fat 373
in this group. 374
375
4. Conclusion 376
377
After feeding apoE-/- mice a high-fat casein control diet or a high-fat CP diet for 12 378
weeks, we detected no differences regarding plasma inflammatory markers or 379
atherosclerotic lesions area. Although slightly lower plasma TAG concentration was 380
detected, linked to a possible increase in hepatic mitochondrial fatty acid oxidation 381
and energy expenditure from fat, the reduction was insignificant to counteract 382
atherosclerotic development. Previously, CP displayed promising results in Wistar 383
rats in reducing body weight, plasma TAG and cholesterol levels. However, CP did 384
not seem to influence lipid metabolism in apoE-/- mice compared to normolipidemic 385
rats, and was not able to ameliorate atherosclerosis. 386
387
ACKNOWLEDGMENTS 388 389 The authors are grateful to Liv Kristine Øysæd, Randi Sandvik, Kari Williams, and 390
Svein Krüger for technical assistance, and Kari Helland Mortensen, Eline Milde 391
Nævdal and the staff at the animal facility Vivariet, UiB, for assisting with care of the 392
animals. 393
394
FUNDING 395
396
The research was supported by The Board of Nutrition Programmes – University of 397
Bergen, Norilia AS (Oslo, Norway) and NFR project 212984. 398
399
DISCLOSURE STATEMENT 400
Norilia AS provided the chicken protein and partly funded the animal experiment, but 401
had no involvement in the study design, interpretation of the data, writing of the 402
manuscript, or decision to publish. 403
14
404
AUTHOR CONTRIBUTION 405
BB, RKB, ON, JEN, and RV designed the study. RV and BB conducted the animal 406
study and TB performed the aorta dissection. RV and BB performed the plaque 407
staining, and RV analyzed the images. RV, JS, and BB analyzed the CLAMS data. 408
RV performed the qPCR. RV and BB analyzed and interpreted the data. RV wrote the 409
first draft, and BB and RKB participated in the finalization of the manuscript. All 410
authors revised the manuscript critically and approved the final version of the 411
manuscript. 412
413
REFERENCES 414
415
[1] Eichner JE, Dunn ST, Perveen G, Thompson DM, Stewart KE, Stroehla BC. 416
Apolipoprotein E polymorphism and cardiovascular disease: a HuGE 417
review. Am J Epidemiol. 2002;155:487-95. 418
[2] Ishibashi S, Herz J, Maeda N, Goldstein JL, Brown MS. The two-receptor model 419
of lipoprotein clearance: tests of the hypothesis in "knockout" mice 420
lacking the low density lipoprotein receptor, apolipoprotein E, or both 421
proteins. Proc Natl Acad Sci U S A. 1994;91:4431-5. 422
[3] Zhang SH, Reddick RL, Piedrahita JA, Maeda N. Spontaneous 423
hypercholesterolemia and arterial lesions in mice lacking apolipoprotein 424
E. Science. 1992;258:468-71. 425
[4] Erdman JW, Jr. AHA Science Advisory: Soy protein and cardiovascular 426
disease: A statement for healthcare professionals from the Nutrition 427
Committee of the AHA. Circulation. 2000;102:2555-9. 428
15
[5] Rebholz CM, Reynolds K, Wofford MR, Chen J, Kelly TN, Mei H, et al. Effect of 429
soybean protein on novel cardiovascular disease risk factors: a 430
randomized controlled trial. Eur J Clin Nutr. 2013;67:58-63. 431
[6] Sirtori CR, Lovati MR. Soy Proteins and Cardiovascular Disease. Current 432
Atherosceloris Reports 2001;3:47–53. 433
[7] Kirk EA, Sutherland P, Wang SA, Chait A, LeBoeuf RC. Dietary isoflavones 434
reduce plasma cholesterol and atherosclerosis in C57BL/6 mice but not 435
LDL receptor-deficient mice. J Nutr. 1998;128:954-9. 436
[8] Kritchevsky D, Tepper SA, Czarnecki SK, Klurfeld DM. Atherogenicity of 437
animal and vegetable protein. Influence of the lysine to arginine ratio. 438
Atherosclerosis. 1982;41:429-31. 439
[9] Morita T, Oh-hashi A, Takei K, Ikai M, Kasaoka S, Kiriyama S. Cholesterol-440
lowering effects of soybean, potato and rice proteins depend on their low 441
methionine contents in rats fed a cholesterol-free purified diet. J Nutr. 442
1997;127:470-7. 443
[10] Ursini F, Davies KJA, Maiorino M, Parasassi T, Sevanian A. Atherosclerosis: 444
another protein misfolding disease? TRENDS in Molecular Medicine 445
2002;8:370-374. 446
[11] Davies KJ, Delsignore ME. Protein damage and degradation by oxygen 447
radicals. III. Modification of secondary and tertiary structure. J Biol Chem. 448
1987;262:9908-13. 449
[12] Siasos G, Tousoulis D, Antoniades C, Stefanadi E, Stefanadis C. L-Arginine, 450
the substrate for NO synthesis: an alternative treatment for premature 451
atherosclerosis? Int J Cardiol. 2007;116:300-8. 452
16
[13] Zulli A, Hare DL, Buxton BF, Black MJ. High dietary methionine plus 453
cholesterol exacerbates atherosclerosis formation in the left main 454
coronary artery of rabbits. Atherosclerosis. 2004;176:83-9. 455
[14] Balkan J, Oztezcan S, Hatipoglu A, Cevikbas U, Aykac-Toker G, Uysal M. Effect 456
of a taurine treatment on the regression of existing atherosclerotic lesions 457
in rabbits fed on a high-cholesterol diet. Biosci Biotechnol Biochem. 458
2004;68:1035-9. 459
[15] Elvevoll EO, Eilertsen KE, Brox J, Dragnes BT, Falkenberg P, Olsen JO, et al. 460
Seafood diets: hypolipidemic and antiatherogenic effects of taurine and n-461
3 fatty acids. Atherosclerosis. 2008;200:396-402. 462
[16] Saiga A, Iwai K, Hayakawa T, Takahata Y, Kitamura S, Nishimura T, et al. 463
Angiotensin I-converting enzyme-inhibitory peptides obtained from 464
chicken collagen hydrolysate. J Agric Food Chem. 2008;56:9586-91. 465
[17] Vik R, Bjorndal B, Bohov P, Brattelid T, Svardal A, Nygard OK, et al. 466
Hypolipidemic effect of dietary water-soluble protein extract from 467
chicken: impact on genes regulating hepatic lipid and bile acid metabolism. 468
Eur J Nutr. 2014; DOI: 10.1007/s00394-014-0700-5. 469
[18] Bjorndal B, Vik R, Brattelid T, Vigerust NF, Burri L, Bohov P, et al. Krill 470
powder increases liver lipid catabolism and reduces glucose mobilization 471
in tumor necrosis factor-alpha transgenic mice fed a high-fat diet. 472
Metabolism. 2012;61:1461-72. 473
[19] Berge RK, Flatmark T, Osmundsen H. Enhancement of long-chain acyl-CoA 474
hydrolase activity in peroxisomes and mitochondria of rat liver by 475
peroxisomal proliferators. Eur J Biochem. 1984;141:637-44. 476
17
[20] Bremer J. The effect of fasting on the activity of liver carnitine 477
palmitoyltransferase and its inhibition by malonyl-coa. Biochim Biophys 478
Acta 665. 1981628-631. 479
[21] Parolini C, Vik R, Busnelli M, Bjorndal B, Holm S, Brattelid T, et al. A salmon 480
protein hydrolysate exerts lipid-independent anti-atherosclerotic activity 481
in ApoE-deficient mice. PLoS One. 2014;9:e97598. 482
[22] Skorve J, al-Shurbaji A, Asiedu D, Bjorkhem I, Berglund L, Berge RK. On the 483
mechanism of the hypolipidemic effect of sulfur-substituted 484
hexadecanedioic acid (3-thiadicarboxylic acid) in normolipidemic rats. J 485
Lipid Res. 1993;34:1177-85. 486
[23] Vigerust NF, Cacabelos D, Burri L, Berge K, Wergedahl H, Christensen B, et 487
al. Fish oil and 3-thia fatty acid have additive effects on lipid metabolism 488
but antagonistic effects on oxidative damage when fed to rats for 50 489
weeks. J Nutr Biochem. 2012;23:1384-93. 490
[24] Xu YJ, Arneja AS, Tappia PS, Dhalla NS. The potential health benefits of 491
taurine in cardiovascular disease. Exp Clin Cardiol. 2008;13:57-65. 492
[25] Ahn CB, Cho YS, Je JY. Purification and anti-inflammatory action of tripeptide 493
from salmon pectoral fin byproduct protein hydrolysate. Food Chem. 494
2015;168:151-6. 495
[26] Zhang Y, Kouguchi T, Shimizu K, Sato M, Takahata Y, Morimatsu F. Chicken 496
collagen hydrolysate reduces proinflammatory cytokine production in 497
C57BL/6.KOR-ApoEshl mice. J Nutr Sci Vitaminol (Tokyo). 2010;56:208-498
10. 499
500
18
501
502
503
19
504
505
506
Table 1 Body weight and feed intake in apoE-/- mice on a high-fat diet casein diet
(Control), or a high-fat diet supplemented with 15% water-soluble extract of chicken
protein (CP) for 12 weeks
Control CP
Start weight (g) 16.69 3.20 17.33 1.85
End Weight (g) 24.40 2.11 25.24 0.78
Weight gain (g) 6.22 1.70 8.11 1.34
Liver Weight (g) 1.08 0.12 1.20 0.14*
Liver index % of body weight 4.42 0.46 4.77 0.46
Total feed intake (g/mouse) 188 5.22 225 22.9*
Feed efficiency (weight gain/feed intake) 0.03 0.033 0.04 0.058
Data are shown as mean values SD (n = 12). Statistical differences from control wer
determined by unpaired t-test. *P < 0.05.
20
Table 2 Hepatic gene expression in female apoE-/- mice fed a high-fat casein diet (Control), or a
high-fat diet with 15% water-soluble extract of chicken protein (CP) diet for 12 weeks
Diet groups
Lipid import and β-oxidation
Control CP
Gene Function Mean SD Mean SD P-value
Acox1 β-oxidation 1.00 0.160 1.10 0.186 0.235
Cpt1a β-oxidation 1.00 0.441 1.25 0.142 0.100
Cpt2 β-oxidation 1.00 0.134 1.28 0.243 0.011*
Cd36 Fatty acid import 1.00 0.269 1.12 0.380 0.478
Slc25a20 Fatty acid import 1.00 0.206 1.05 0.172 0.599
Lipogenesis and cholesterol synthesis and
import
Control CP
Gene Function Mean SD Mean SD P-value
Acaca Fatty acid synthesis 1.00 0.208 1.20 0.323 0.151
Apob Cholesterol import 1.00 0.763 0.69 0.105 0.224
Fads1 Δ5 desaturase 1.00 0.204 0.97 0.212 0.767
Fads2 Δ6 desaturase 1.00 0.177 0.75 0.234 0.023*
Gpam Glycerolipid synthesis 1.00 0.136 1.00 0.234 0.876
Ldlr Cholesterol import 1.00 0.208 0.92 0.184 0.379
Scd1 Δ9 desaturase 1.00 0.380 0.95 0.220 0.750
Vldlr Cholesterol import 1.00 0.390 0.92 0.167 0.709
21
507
508
Bile synthesis
Control CP
Gene Function Mean SD Mean SD P-value
Cyp7a1 Bile acid synthesis 1.00 0.581 0.71 0.487 0.260
Data are shown as mean values SD (n = 8-10). Statistical differences from control were
determined by unpaired t-test, *P < 0.05.
Abbr.: Acaca, Acetyl-CoA carboxylase; Acox1, acyl-CoA oxidase; Apob, apolipoprotein B;
Cd36/Fat, CD36 antigen; Cpt1a, carnitine palmitoyltransferase 1a; Cpt2, carnitine
palmitoyltransferase; Cyp7a1, cytochrome P450, family 7, subfamily A, polypeptide 1; Fads1,
fatty acid desaturase 1; Fads2, fatty acid desaturase 2; Gpam, glycerol-3-phosphate
acyltransferase, mitochondrial; Icam, intracellular adhesion molecule; Ldlr, low-density
lipoprotein receptor; Mcp1, monocyte chemoattractant protein; Nos2, nitric oxide synthase 2;
Slc25a20, solute carrier family 25; Scd1, stearoyl-CoA desaturase; Vcam1, vascular cell
adhesion molecule 1, Vldlr, very low-density lipoprotein receptor.
22
509
Table 3 Plasma cytokine levels in apoE-/- mice fed a high-fat casein diet (Control), or
a high-fat diet containing 15% water-soluble extract of chicken protein (CP) for 12
weeksa
Cytokine Control-diet CP-diet P-value
IL-1 43.6 ± 14.1 53.8 ± 13.0 0.182
IL-1 707.1 ± 152.1 589.0 ± 82.2 0.077
IL-2 56.5 ± 16.3 64.9 ± 30.3 0.524
IL-6 26.0 ± 9.0 28.2 ± 6.6 0.597
IL-10 316.2 ± 67.5 363.4 ± 62.2 0.201
IL-17 3732.7 ± 1742.6 5178.7 ± 885.1 0.059
G-CFS 267.0 ± 78.8 469.8 ± 547.0 0.351
GM-CFS 3589.6 ± 866.4 3472.8 ± 251.3 0.720
INF- 108.1 ± 28.0 138.3 ± 23.8 0.042*
MCP-1 780.2 ± 93.6 686.2 ± 177.5 0.866
Rantes 55.1 ± 18.3 57.7 ± 26.8 0.829
TNF- 1901.8 ± 149.5 2106.9 ± 374.7 0.200
23
apmol/mL
Abbreviations: G-CFS, granulocyte colony-stimulating factor; GM-CFS, granulocyte
macrophage colony-stimulating factor; IL, interleukin; INF- interferon gamma,
MCP-1, monocyte chemotactic protein 1; Rantes, chemokine (C-C motif) ligand 5;
TNF- , tumour necrosis factor alpha.
Data are shown as mean ± SD (n = 6-9). Student´s t-test was used to determine
significantly different values (P < 0.05).
510
24
FIGURE LEGENDS 511
512
Figure 1: Metabolic parameters in apoE-/- mice fed a high-fat casein diet (control), or 513
a high-fat diet with 15% water-soluble extract of CP during a 40 h stay in CLAMS. 514
A) Energy expenditure (heat) after 1 and 10 weeks of dietary intervention. B) Feed 515
intake, C) Activity, and D), Respiratory exchange ratio (RER) during the day/night 516
cycle after 10 weeks of dietary intervention. E) Plot of continuous energy expenditure 517
(heat) and F) RER at week 10. Data are shown as mean ± SD (n = 5-6). Unpaired t-518
test was used to detect statistical significance (***P < 0.001). 519
520
Figure 2: Plasma lipid levels in apoE-/- mice fed a high-fat casein diet (control), or a 521
high-fat diet with 15% water-soluble extract of chicken protein (CP). A) 522
Triacylglycerols (TAG; n = 2, pooled samples) at week 1, 5 and 11, B) ΔTAG (n = 2), 523
week 1-11, C) TAG end-point, week 12 (n = 7-9), D) Cholesterol (n = 2) at week 1, 5 524
and 11, E) ΔCholesterol (n = 2), week 1-11, and F) Cholesterol end-point, week 12 (n 525
= 7-9). Data are shown as mean ± SD. Unpaired t-test was used to detect statistical 526
significance (**P < 0.01). 527
528
Figure 3: Hepatic mitochondrial β-oxidation and enzyme activity in apoE-/- mice fed 529
a high-fat casein diet (control), or a high-fat diet with 15% water-soluble extract of 530
chicken protein (CP). A) Palmitoyl-CoA catabolism in the presence and absence of 531
malonyl-CoA, B) Carnitine palmitoyltransferase 2 (CPT2) activity, C) Acyl-CoA 532
oxidase activity (ACOX1) and D) Fatty acid synthase (FAS) activity. Data are shown 533
as mean ± SD (n = 6-12). Unpaired t-test was used to detect statistical significance 534
(**P < 0.01). 535
25
536
Figure 4: Atherosclerotic development and mRNA levels in the heart of apoE-/- mice 537
fed a high-fat casein diet (Control), or a high-fat diet with 15% chicken protein (CP). 538
A) Representative images of aortic arch from a control and a CP mouse, and B) 539
calculated plaque area. mRNA levels of: C) intracellular adhesion molecule (Icam), 540
D) vascular cell adhesion molecule 1 (Vcam1), E) inducible nitric oxide synthase 541
(Nos2), and F) monocyte chemotactic protein 1 (Mcp1). Data are shown as mean ± 542
SD (B: n = 12, C – F: n = 8). Unpaired t-test was used to detect statistical 543
significance. 544
545
26
546
Figure 1 547
548 549
550
551
552
553
554
RER week 10
Time
VCO
2/VO
2
19:0
0
00:0
0
07:0
0
12:0
0
19:0
0
00:0
0
07:0
0
19:0
0
00:0
0
07:0
0
0.7
0.8
0.9
1.0 ControlCP
Night Day
0.6
0.7
0.8
0.9
1.0
VCO
2/VO
2
ControlCP
***
RER week 10
0.0
Heat production
Week 1 Week 100
5
10
15
20
25
Kcal
/hr/k
g
Control CP
*** ***
Activity week 10
Night Day0
1×104
2×104
3×104
4×104
Cou
nts
ControlCP
Feed intake week 10
g/m
ouse
/12
hour
s
Night Day0.0
0.5
1.0
1.5
2.0
2.5
ControlCP
A B
C
F
E
D
Heat week 10
19:0
0
00:0
0
07:0
0
12:0
0
19:0
0
00:0
0
07:0
0
12:0
0
19:0
0
00:0
0
07:0
0
0.25
0.30
0.35
0.40
0.45
0.50
0.55
Time
Kcal
/hr
ControlCP
27
Figure 2 555
556
557 558 Figure 3 559 560
561 562 563
TAG
0 5 110
1
2
3
mm
ol/L
Week
ControlCP
Cholesterol
0 5 110
10
20
30
40
mm
ol/L
Week
ControlCP
Control CP0.0
0.2
0.4
0.6
0.8
1.0
mm
ol/L
TAG at sacrifice
**
Control CP0
10
20
30
mm
ol/L
Cholesterol at sacrifice
Control CP-1.5
-1.0
-0.5
0.0
mm
ol/L
TAG
Cholesterol
Control CP0
5
10
15
20
mm
ol/L
A B C
D E F
28
Figure 4564
565 566
