Materials and Methods

61

III. MATERIALS AND METHODS

3.1 General considerations

The glassware used in this study were of neutral glass of Corning or Borosil

India Ltd. make. The culture media, buffers and other biochemical reagents were

prepared in MilliQ water (Millipore) water. The chemicals of Analar, Excellar or

molecular biology grade were used for the preparation of various solutions and

reagents. The culture media, buffers, reagents, enzymes, kits and other requirements

were obtained from M/s. Biosciences, Merck specialties Pvt. Ltd., Mumbai; BD, BBL

and DIFCO, USA; E-Merck (India) Ltd; Hi-media, Mumbai; Real Biotech

Corporation, Banqiao city, Taiwan; Sigma Aldrich, USA; Sisco Research

Laboratories Pvt. Ltd., Mumbai and Synergy Scientific Services, Chennai.

Plasticware including microcentrifuge tubes, micropipette tips, cryovials, Petri dishes

and autoclave bags were procured from M/s. Tarson Products Pvt. Ltd., Kolkata and

Axygen Inc., USA.

3.1.1 Preparation of glassware

The glassware used in the study were prepared by soaking them in detergent

(Teepol) solution overnight. The following day, they were washed thoroughly in running

tap water, followed by rinse in deionised/ distilled water (DW). The oven dried glassware

were packed and sterilized in hot air oven for one hr at 160?C as per Collee et al. (1989).

62

3.1.2 Preparation of plasticware

The new plasticware including microcentrifuge tubes and micropipette tips were

sterilized by autoclaving at 121oC for 15 min at 15 psi.

3.1.3 Media and reagents used

Brain Heart Infusion broth and agar, Mannitol salt agar, Blood agar base,

Nutrient agar and broth, Toludine blue DNA agar, Voges-Proskauer’s test medium,

Peptone water, Glycerol, Hydrogen peroxide, and Gram’s staining kit were obtained

from M/s Hi media Laboratories Ltd., Mumbai and, the media and reagents were

prepared as recommended by the manufacturer and sterilized by autoclaving.

3.1.3.1 Blood agar (BA)

Blood agar was either prepared using blood agar base (Hi media Laboratories Ltd.,

Mumbai) to which 5% sheep blood was added as per standard procedure or ready to

use 5% sheep blood agar plates (M/s JDM Technologies, Bangalore) were procured.

3.1.3.2 Nutrient-glycerol broth

Nutrient broth (sterile) 85 ml

Sterile glycerol 15 ml

Glycerol was sterilized in hot air oven at 160o C for one hr and added into nutrient

broth sterilized by autoclaving, mixed well and aliquoted into sterile tubes in 1ml

quantities and stored at 4º C.

63

3.2 Collection of milk samples

A total of 313 bovine milk samples collected from 7 organized Farms (n=158)

and 7 unorganized sectors (n=155) from various geographic locations in and around

Bangalore and Bidar were subjected for study (Table 1). The total samples comprised 222

samples and 91 samples from Bangalore and Bidar, respectively (Table 13.1 and 13.2).

Out of these, a total of 176 bovine milk samples from four organized farms (n=61) and

seven unorganized sectors (n=115) were collected (Bidar-91 samples and Bangalore-85

samples) in this study. The remaining samples (n=137) that were already collected and

processed up to bacteriological isolation were also included in this study, and the relevant

data regarding their history and SCM tests results were also incorporated for further

overall analysis.

In addition, a total of 42 milk samples from clinical mastitis cases were also

collected from the cows that were presented in the clinics attached to Veterinary College,

Bidar/ Bangalore. The relevant history was also collected for all the samples.

Approximately 10 ml of milk was collected in sterile tubes following strict aseptic

measures and was immediately transported to laboratory in refrigerated conditions.

3.3 Screening for subclinical mastitis

All the milk samples (n=313) collected from organized/ unorganized sectors were

screened for subclinical mastitis (SCM) by Somatic Cell Count (SCC), Electrical

Conductivity (EC) test, California Mastitis Test (CMT) and Bromothymol Blue (BTB)

strip tests.

64

Table 1.Farm/ sector-wise details of milk samples collected

Sl. No.

Farm code

No. of milk samples collected Sl. No. Farm code No. of milk

samples collected Organized Sector Unorganized Sector

1 Farm A 10 1 Sector A 40 2 Farm B 21 2 Sector B 31 3 Farm C 66 3 Sector C 26 4 Farm D 28 4 Sector D 21 5 Farm E 20 5 Sector E 15 6 Farm F 8 6 Sector F 9 7 Farm G 5 7 Sector G 13

Total 158 Total 155 Grand Total = 313

3.3.1 Estimation of Somatic Cell Count (SCC)

Freshly collected milk samples were used for SCC estimation and all the milk

samples (n=313) collected from organized/ unorganized sectors were screened for SCM

by either Direct Microscopic Somatic Cell Count in milk (n=176) or using Nucleocounter

(n=137).

3.3.1.1 Direct Microscopic Somatic Cell Count in milk

Procedure: The procedure followed was according to general principle of Prescott and

Breed method as detailed by Schalm et al. (1971).

Preparation of milk films

? The milk samples were mixed 15-20 times to obtain a uniform distribution of cells

and were allowed to stand for 2-5 min to permit air bubbles to rise and foam to

disappear.

65

? A clean, grease-free microscopic slide was placed over the template to outline four

one sq.cm areas.

? Ten µl of milk was placed exactly in the centre of the one sq.cm template and was

spread evenly to cover all the area delineated by the template. From each sample,

two films were prepared using successive areas of the slide. The films were dried at

room temperature and then stained.

Staining by Newman – Lampert staining technique

? The slides with milk smears were placed on the slide rack and were flooded with

modified Newman-Lampert stain (Himedia) for 2 min.

? The excess stain was drained off by standing the slides on absorbent paper and air-

dried.

? The slides were rinsed in three changes of tap water at 42-45°C and air-dried.

Counting of cells

Stained films were examined under oil immersion objective and the number of

cells in 20 fields was counted. The fields were selected by moving the slide horizontally

from one edge of the film through the centre to the opposite edge and then, repeated in a

vertical direction. The average number of cells per field was multiplied by the

microscopic factor.

66

Calibration of the microscope / Calculation of microscopic factor

The diameter of the microscopic field seen through oil immersion objective was

measured using a stage micrometer slide ruled in 0.1 and 0.01 mm. The diameter of the

field was measured up to two decimal points and the area of the field was calculated

using the formula πr2.

Area of the smear (in mm2 ) Microscopic factor (MF) =

Area of the microscopic field

The diameter was 0.16, then r = 0.08

100 So, MF = = 4976 ? 5000

3.14X 0.082

Since, the milk sample taken on the slide was 0.01 ml, the total number of cells

per ml of milk was given by the formula,

Cell count per ml of milk = Average no. of cells per field ? MF ? 100

3.3.1.2 SCC using Nucleocounter

Somatic Cell Count was estimated using Nucleocounter (ChemoMetec, Denmark)

available at PD_ADMAS, Bangalore. Initially, 500 μl of milk sample was mixed with

equal quantity of the lysis buffer supplied by the manufacturer. The mixture was mixed

gently to lyse the cells. The lysed milk was then aspirated into the cassette and the

cassette was then inserted into the Nucleocounter and the SCC values were recorded.

67

The SCC value > 5,00,000 cells/ml of milk was taken as criteria to declare the

milk / animal as subclinically mastitic / infected.

3.3.2 Measurement of Electrical conductivity (EC)

Milk samples procured were subjected for Electrical conductivity test using hand

held instrument (Milk checker, Oriental instruments limited, Tokyo, Japan or Mastitis

Detector, Draminski, Olsztyn, Poland). Milk sample was poured till the brim marked in

the sampling cup of the instrument. Electrical conductivity of more than 6.5 milli

Siemens (mS)/cm was taken as criteria to declare the milk/animal as subclinically

mastitic /infected.

3.3.3 California Mastitis Test (CMT)

Mastitis reagent obtained from Nice Chemicals Pvt. Ltd. Kochi, Kerala, was used

to perform CMT according to the procedure described by Sharma and Rajani (1969). An

equal quantity of milk was mixed with the mastitis reagent and mixed well on a clean

glass slide or plate using a tooth pick. The results were recorded as positive when it

resulted in thickening and/ or clot/ gel formation within 60 seconds.

3.3.4 Bromothymol Blue (BTB) strip test (Indicator paper method)

The method was employed for detection of SCM and for this a commercially

available Mastrip, a cellulose based BTB strip impregnated with stabilized ion sensitive

indicator (Bromothymol Blue), procured from Ayurvet Ltd., Delhi, was used. A drop of

milk was placed on the strip and observed for changes in colour. The interpretation of

changed colour was read as follows:

68

Yellow - Normal

Greenish yellow - Subclinical Mastitis

Green - Advanced Subclinical Mastitis

Blue - Clinical Mastitis

3.3.5 Statistical analysis of the results of SCM tests

The Pearson chi square test was used to analyze the results of all the four SCM

tests for significant association using PROC MEAN or PROC FREQ procedure of SAS

9.2 software programme and with this, comparative evaluation of the SCM tests

regarding their efficacy to detect SCM cases was made.

3.4 Isolation of Staphylococcal species from milk samples

Isolation of Staphylococcus and the relevant biochemical tests were carried out as

per the standard procedure (Collee et al., 1989). About 0.1 ml of milk sample was

initially enriched in 3 ml of Brain heart infusion (BHI) broth for 8 hrs at 37⁰ C, then

streaked on to Mannitol salt agar and incubated at 37⁰ C for 24 hrs. After reading the

colony morphology on MSA, the cultures were streaked on to BHI agar for further

identification procedures. Purity of the culture was checked by Gram’s staining and

panel of biochemical tests.

3.5 Gram’s staining: Gram’s staining kit, which contained Crystal violet, Gram’s iodine,

Decolourizer and Safranin was procured from M/s Hi-Media, Mumbai. Staining of all the

culture isolates was carried out as per the instructions mentioned in the kit.

69

3.6 Preservation of pure culture and revival of isolates

Pure cultures thus obtained were streaked on to nutrient agar slants and

preserved at 4⁰C for further use. Cultures were also preserved in sterile nutrient

glycerol (15%) broth vials at -20ºC until further use. The isolates were revived once

in three months in slants and once in a year in nutrient glycerol broth.

3.7 Biochemical characterization (Collee et al., 1989) and identification of isolates

3.7.1 Catalase test: Ebullition of gas bubbles after the addition of 24 hr culture to 3%

hydrogen peroxide indicated positive reaction. Absence of ebullition of gas bubbles

indicated negative reaction. Only catalase positive cultures were considered for further

characterization.

3.7.2 Haemolytic pattern: The colonies were further streaked on to blood agar to

study the haemolytic patterns. β haemolysis, a complete zone of clearance and α

haemolysis, a greenish discolouration around and beneath the colonies was recorded on 5

% sheep blood agar plates.

3.7.3 Coagulase test: All the staphylococcal isolates obtained were first subjected to

tube coagulase test. For this, about 0.3 ml of 18 hr old Staphylococcus culture in BHI

broth was mixed with 0.5ml of diluted rabbit plasma (1:4 in PBS) and incubated

overnight at 37°C. The result was recorded at 1 hr, 4 hr and after overnight incubation.

Formation of clot/ stiff gel which remained in place when tube was tilted through 90º

angle or inverted was considered as positive for coagulase production. The tubes were

read negative when plasma remained liquid or showed only a flocculent or ropy

70

precipitate even after overnight incubation and only such isolates negative by coagulase

test were further subjected to various biochemical tests as follows.

3.7.4 Thermonuclease test: Wells of 6mm diameter were punched in the Toluidine blue

DNA agar (M/s Hi-media Laboratories Ltd., Mumbai). Twenty-four hr old CoNS cultures

in BHI broth were boiled for 15 min and cooled. About 20µl of this culture suspension

was loaded onto the wells in the Toluidine blue DNA agar and incubated at 37°C for 24

hr. Presence of a pink halo around the well with a dark blue peripheral ring was

considered as positive for thermonuclease test.

3.7.5 Biochemical characterization of the isolates using HiStaph™ Identification Kit

All CoNS isolates were further characterized by KB004 HiStaph™ Identification

Kit (Hi-media Laboratories Ltd., Mumbai) which consisted of miniature wells to perform

simultaneously 12 different tests viz., Voges Proskauer test, Phosphatase test, o-

nitrophenyl-ß-D-galactopyranoside (ONPG) test, Urease test, Arginine Utilisation test

and, tests for the fermentation of sugars such as Mannitol, Sucrose, Lactose, Arabinose,

Raffinose, Trehalose and Maltose. Following the manufacturer’s instructions, about 50µl

of 18 hr old bacterial suspension of the isolate adjusted to tube no. 0.5 on the McFarland

scale was overlaid on each of the 12 wells of the kit and then it was incubated at 37ºC for

24 hr. The reagents supplied were added to the wells of Voges Proskauer and

Phosphatase test, and then the results were recorded as per the recommendations of the

manufacturer.

71

3.7.6 Speciation: The biochemical profile was then compared with the index supplied by

the manufacturer and the appropriate Staphylococcus species was assigned for every

isolate.

3.8 Staphylococcal reference cultures

The staphylococcal cultures obtained from Microbial Type Culture Collection

and Gene Bank (MTCC), Chandigarh were included in the study as reference cultures

(Table 2) for biochemical as well as molecular characterization studies.

Table 2. Panel of staphylococcal reference cultures used in the study

Sl. No. Species MTCC No.

1 S. chromogenes 3545

2 S. epidermidis 3382

3 S. epidermidis 3615

4 S. sciuri 6154

5 S. saprophyticus 6155

6 S. haemolyticus 3383

7 S. aureus 96

3.9 Molecular characterization of CoNS isolates by PCR

3.9.1 Reference isolates

In addition to the reference isolates of Staphylococci procured from MTCC,

Chandigarh (Table 2), the CoNS strains viz., Staphylococcus arlettae (GenBanK

accession no. JQ764624) and S. xylosus (isolate no. 48; GenBanK accession number

awaited) obtained in this study were also used as reference isolates after they were

72

confirmed as belonging to the species as detected by the PCR and sequencing based

method of detection mentioned further in the section 3.9.7 of this thesis.

3.9.2 PCR primers

3.9.2.1 Designing of the PCR primers

? The gene sequences of interest were downloaded from the NCBI, GenBank and saved

in the EditSeq format.

? Primers were designed either manually using MegAlign program or using software

such as ‘Prmer3’ / ‘Primerquest’.

? For manual designing of the primers, the downloaded sequences were loaded into the

EditSeq program of “Lasergene DNA STAR” software.

? The saved sequences were then aligned by ClustalV method using MegAlign program

of the same software.

? The alignment report contents were then split to fit them to a page.

? The aligned sequences were then used for designing the primers manually.

? For designing primers using software, the downloaded sequences were then loaded

into the ‘Prmer3’ / ‘Primerquest’ software and the primers meeting all the

requirements of the PCR conditions and in silico specificity were selected.

? Criteria for the selection of the primers:

For the genus specific primers, a region conserved through the genus was chosen.

For species specific primers, variable region was chosen.

Other criteria such as GC content of 40-60% and Tm value of 55-60, nucleotide

sequence length of 18-27 were also considered.

73

3.9.2.1 Synthesis/ Procurement of PCR primers

All sets of primers used in this study were synthesized commercially at M/s.

Bioserve Biotechnologies (India) Pvt. Ltd, Hyderabad, and they were reconstituted in

NFW as per the requirement and stored at - 20OC.

3.9.3 Extraction of genomic DNA

Extraction of genomic DNA was done using “HiYield™ Genomic DNA Mini Kit

(Blood/ Bacteria/ Cultured cells)” procured from Real Biotech Corporation, Banqiao

city, Taiwan.

3.9.3.1 Materials: HiYield™ Genomic DNA Mini Kit (RBC, Banqiao city, Taiwan),

Spectrophotometer, Sterile DNase free Micropipette tips and Microcentrifuge tubes

(Tarsons), Microcentrifuge and Micropipettes (Eppendorf, Germany), Ethanol (96-100

%), Lysozyme Buffer solution.

Materials provided in the kit: GB Buffer (Lysis Buffer), W1 Buffer, Wash Buffer

(concentrated), Elution Buffer, GB Columns, 2 ml Collection tubes.

One hundred µl of ethanol (96-100 %) was added to Wash Buffer (concentrated)

of the kit, labeled as Wash Buffer (ethanol added) and kept ready prior to use.

Composition of Lysozyme Buffer solution:

Lysozyme: 20 mg/ml

Tris HCl : 20 mM (pH 8.0)

EDTA : 2 mM

Triton X : 1.2%

Lysozyme buffer solution was prepared fresh immediately prior to use.

74

3.9.3.2 Protocol for extraction of genomic DNA

The genomic DNA was extracted, as per the standard protocol prescribed by the

manufacturer for Gram-positive bacteria, using the HiYield™ “Genomic DNA Mini Kit

(Blood/ Bacteria/ Cultured cells)” procured from Real Biotech Corporation, Banqiao city,

Taiwan.

Cell harvesting:

? One ml of 18 hr old cultured bacterial cells (up to 1X109) was transferred to a 1.5 ml

microcentrifuge tube, centrifuged at full speed (13,000 rpm) for 1 min. and the

resultant supernatant was discarded.

? Two-hundred µl of Lysozyme buffer was added to the tube and the cell pellet was

resuspended by vortexing or pipetting.

? Then incubated at RT for 10 min. During incubation, the tube was inverted every 2-3

min.

Cell lysis:

? Two-hundred µl of of GB buffer was added to the sample and mixed thoroughly by

vortexing for 5 seconds.

? The mixture was incubated at 70o C water bath for 10 min. until the sample lysate was

clear and inverted the tubes every 2-3 minutes. Meanwhile, the Elution buffer

required for the next step was kept ready by preheating at 70o C.

75

DNA binding:

? Two-hundred µl of ethanol (96-100 %) was added to the sample lysate and mixed by

vortexing for 10 sec. Precipitate, if appeared, was broken up by pipetting.

? Then, the GB columns were placed in a 2 ml collection tubes.

? All the mixture from the previous step, including the precipitate, if any, was carefully

applied to the GB column. The cap was closed and centrifuged at full speed (13,000

rpm) for 2 minutes.

? The 2 ml collection tube containing the flow-through was discarded and the GB

column was placed in a new clean 2 ml collection tube.

Wash:

? Four-hundred μl of W1 buffer was added in the GB column without wetting the rim

and centrifuged at full speed (13,000 rpm) for 30 seconds.

? The flow-through was discarded and GB column was placed back in the 2ml

collection tube. Then, 600 μl of Wash buffer (ethanol added) was added in the GB

column and centrifuged at full speed (13,000 rpm) for 30 seconds.

? The flow-through was discarded and GB column was placed back in the 2ml

collection tube. Then, the cap was closed and centrifuged at full speed (13,000 rpm)

for 3 minutes to dry the column matrix.

DNA elution:

? The dried GB column was transferred into a clean 1.5 ml centrifuge tubes.

76

? One hundred μl of preheated Elution buffer was added into the centre of the column

matrix and allowed to stand at RT for 3-5 minutes until the Elution buffer is absorbed

by the matrix.

? Finally, the purified DNA was eluted by centrifuging at full speed (13,000 rpm) for

30 seconds and stored at -20° C until further use.

3.9.3.3 Determination of purity and yield of the DNA samples by UV

spectrophotometry

The purity and concentration of the extracted genomic DNA was estimated by UV

spectrophotometry. An aliquot of 20?l of DNA sample was dissolved in 0.98 ml of sterile

DW. The diluted DNA was transferred into 1 ml microcuvette and the optical density

(OD) was read at 260nm and 280nm in a UV spectrophotometer. Sterile DW was used as

blank.

The ratio of 260/280 OD was calculated. A ratio of 1.7 to 1.9 was considered

pure. Further, the purity of the DNA sample was checked by electrophoresis on 0.8 per

cent agarose gel.

3. 9.3.4 DNA confirmation by Agarose Gel Electrophoresis

The 0.5 µg DNA was used to check the purity by electrophoresis on 0.8 % agarose gel.

3.9.3.4.1 Equipments: Horizontal electrophoresis apparatus with power pack (Bangalore

Genie, India), Micro-wave oven (LG, India), Gel documentation unit (Bio-Rad, USA).

3.9.3.4.2 Reagents

a. Agarose (Synergy Scientific Services, Chennai)

77

b. Tris - Borate EDTA buffer (TBE buffer) (10X, pH 8.2)

Tris base 108.0 g

Boric acid 55.0 g

EDTA disodium salt 8.3 g

Double D.W up to 1000.0 ml

The stock solution was sterilized by autoclaving and made to 1X before use.

c. Gel loading dye (6X) was procured from Biosciences, Merck specialties Pvt. Ltd.,

Mumbai and stored at 4oC.

d. Ethidium bromide (10 mg) was procured from Biosciences, Merck specialties Pvt.

Ltd., Mumbai. One ml of DW was added and the suspension was mixed properly to

dissolve the dye. The stock solution was stored at RT and protected from light.

e. 100 bp DNA ladder (Biosciences, Merck specialties Pvt. Ltd., Mumbai)

3.9.3.4.3 Procedure

About 0.2g of analytical grade agarose was dissolved in 20 ml of 1X TBE buffer

by melting in microwave oven to obtain a clear uniform suspension. Prior to casting the

gel, the molten agarose was allowed to cool to about 50°C, after which ethidium bromide

was added to a final concentration of 0.5?g/ml and mixed thoroughly. Gel was cast on an

appropriate gel casting tray fitted with acrylic comb and left for setting. The acrylic comb

was carefully removed after the gel was set. The tray with gel was then submerged in an

electrophoresis tank containing 1X TBE buffer.

The DNA to be analyzed was mixed with 1/6th volume of 6X loading dye and

carefully loaded into the wells using micropipette alongside 100bp DNA molecular

50

respectively, in cases of bovine mastitis. In this study, 59 strains were detected as S.

aureus by both conventional tests and PCR, and 13 of them were found to be methicillin

resistant and 4 (30.7%) were positive for mecA gene. Only 2 of 59 strains were positive

for both methicillin resistance and slime producing, phenotypically, suggesting lack of

correlation between methicillin resistance and slime production in these isolates.

Capurro et al. (2009) in Sweden identified antimicrobial resistance in 15 (18%) of

82 milk isolates, and β-lactamase production was found in13 of those isolates (1 S.

aureus, 1 S. chromogenes, 5 S. epidermidis, 5 S. haemolyticus, 1 S. xylosus). One S.

epidermidis isolate was multi-resistant, i.e. resistant to more than three antimicrobials.

This isolate, as well as one additional S. epidermidis isolate, were mecA gene positive by

PCR. Two S. chromogenes isolates did not produce β-lactamase, but were resistant to

trimetoprim/sulfametoxazole. Anti-microbial resistance was not associated with specific

CoNS species or ‘tuf’ gene sequences.

Sawant et al. (2009) screened CoNS isolates (n = 168) obtained from milk from

heifers and dairy cows for MIC to antimicrobials used commonly for mastitis therapy. Of

the 10 CoNS species included in the study, the predominant species were S. chromogenes

(n = 61), S.epidermidis (n = 37), S. hyicus (n = 37), and S. simulans (n = 16). The

majority of CoNS was susceptible to ampicillin, oxacillin, cephalothin, and ceftiofur.

Erythromycin and pirlimycin were also very effective in vitro inhibitors of CoNS. The

only exception was observed with S. epidermidis. Of 37 S. epidermidis evaluated, 13

(35%) exhibited efflux-based resistance to erythromycin (≥16 mg/ml) encoded by msrA

and oneisolate carried ermC encoding ribosomal methylase-based resistance to both

78

weight (MW) marker. Electrophoresis was carried out at 5 V/cm until the tracking dye

(Bromophenol Blue) had just reached the anode end of the gel. Following the

electrophoresis, DNA bands were visualized and the images were captured using gel

documentation system; Gel Doc XR (Bio-Rad, USA).

3.9.4 PCR based confirmation of CoNS to genus level

All the CoNS isolates obtained in the study were first confirmed at genus level by

the partial amplification of Staphylococcus genus specific sequence of the tuf gene. For

this, genus specific primers (Table 3) targeting the tuf gene of staphylococci designed

earlier (Hegde, 2011) and made available in the Dept. of Veterinary Microbiology,

Veterinary College, Bangalore-24, were used.

3.9.4.1 Reagents: As listed in section 3.9.3.4.2 and Table 3 and 4.

3.9.4.2 Partial amplification of tuf gene by Staphylococcus genus specific primers

Staphylococcus genus specific primers (Table 3) synthesized and stored as

mentioned in section 3.9.2.1 were used for the amplification of target sequence.

Table 3. Oligonucleotide sequences of Staphylococcus genus specific (tuf gene) primers

Name of the primer Primer sequence 5’─ 3’ Product length (bp)

Staph tuf-F GAA GAA TTA TTA GAA TTA GT 235

Staph tuf-R GTG ATT GAG AAT ACG TCC TCA AC

The reaction mixture of 25 µl each was prepared in 0.2 ml thin walled PCR tubes

placed in mini cooler as shown below (Table 4).

79

Table 4. Contents of 25µl PCR mixture for tuf gene based PCR

Reagents (Conc.) Volume

10X Taq Buffer (10 mM Tris HCl, 15mM MgCl2pH 8.4) 2.5 µl

Taq Polymerase (1U/µl) 0.8 µl

dNTPs (100µM/µl i.e., 25mM each dNTP) 1.0 µl

Primer F (Staph tuf-F) (10 pmoles/µl) 1.0 µl

Primer R (Staph tuf-R) (10 pmoles/µl) 1.0 µl

Template (Staphylococcal DNA) 3.0 µl

Nuclease Free Water - to make a final volume of 25µl 15.7 µl

Total 25.0 µl

After mixing the contents, tubes were centrifuged to collect the contents in the

bottom. Then the tubes with cap were placed firmly into the thermal cycler and the

thermal cycler conditions were set as detailed below (Table 5).

Table 5. Thermal cycling conditions for tuf gene based PCR

Initial denaturation Denaturation Annealing Extension Final

extension

94oC, 5 min. 94oC,30 sec. 50oC, 30 sec. 72oC, 30sec.

72oC,10 min. Repeated for 30 cycles

PCR was carried out using a programmable master cycler (Eppendorf, Germany).

After completion of PCR reaction, 3µl of the amplified products along with 100bp DNA

ladders, added with 6X gel loading dye, were subjected to electrophoresis on 2.0 per cent

agarose gel. The images were captured using gel documentation system; Gel Doc XR

(Bio-Rad., U.S.A).

80

3.9.5 Development and Standardization of m-PCR for detection of CoNS species

3.9.5.1 Species considered for detection by m-PCR

Five predominant CoNS species (S. arlettae, S. fluerettii, S. equorum, S.

epidermidis and S. saprophyticus) identified based on the outcome of phenotype-based

speciation were considered to be included for detection by m-PCR. However, to rule out

the possibility of incorrect identification of species by biochemical typing, five CoNS

species (S. chromogens, S. simulans, S. sciuri, S. haemolyticus and S. xylosus) which

were reported to be predominant elsewhere by molecular methods, were also included in

the study. In all, a total of 10 different sets of species specific primers were designed in

this study to detect CoNS at species level and used for PCR studies.

3.9.5.2 Designing of primers for detection of CoNS species

Species specific primers were designed by targeting ‘gap’ / ‘sodA’/ ‘rpoB’ genes

(anyone) of CoNS as detailed in the section 3.9.2.1. All the designed primer sets (reverse

and forward) were analyzed for their compatibility using Primerstat software for all

primer secondary structures including hairpins, self-dimers, cross-dimers in primer pairs

and primer dimers. Primers are enlisted with their base sequences, accession no. of the

gene sequence used for primer designing along with other details in Table 6.

Although there was no positive reference for S. fluerettii and S. equorum, the

primers specific for these species in silico were included in the two-tube multiplex PCR

assay in this study with the aim of detecting these species, if any.

81

3.9.5.2 Standardization of uniplex assay PCR for CoNS species

Initially, the gradient PCRs were set up for each of the species targeted in the

study by using known positive reference cultures listed in Table 2. A temperature range

of 5° C above and below the annealing temperature calculated based on the Tm value of

the each primer set was used in the gradient PCR. The temperature range at which the

primers amplified the target species was noted down for every species.

For S. arlettae and S. xylosus, for which the positive references were not

available, all the biochemically identified S. arlettae and S. xylosus isolates were

screened by the uniplex PCR using respective species specific primers and, those which

were confirmed as belonging to the corresponding species both by PCR and subsequent

sequencing of the amplicon were used as positive reference strain.

3.9.5.3 Evaluation of the primers

Then uniplex PCR was standardized using known reference cultures (Table 2).

Specificity of each set of primers was confirmed by the standardized unipex PCR using

known positive and negative controls. All the reference cultures of Staphylococcus

(Table 2) were used as negative controls for the uniplex PCR except the species targeted

which served as positive control. In addition to these, the isolates maintained at the

Department of Veterinary Microbiology, KVAFSU, Veterinary College, Bangalore viz.,

Sterptococcus agalactiae (AD1), Streptococcus dysgalactiae (AD3), Streptococcus

uberis (AD6) and E. coli with GenBank accession nos. HM 355961, HC 359248, HC

355972, JF926686, respectively, all of which are the etiological agents of mastitis, were

also used as negative controls in this assay.

82

3.9.5.3 Standardization and development of two-tube m-PCR

Once the uniplex PCR was standardized, the temperature at which amplification

was fairly better was considered suitable for multiplexing. Primers in each tube were

analyzed using FastPCR software for all primer secondary structures including hairpins,

self-dimers, cross-dimers in primer pairs and primer dimers before multiplexing. Then,

based on the outcome of the analysis of FastPCR, five compatible primer sets with a

difference of minimum 50bp in their expected amplicon size were considered to be

included in each tube for the standardization of two tube multiplex PCR. Thus, the

primer sets specific for S. arlettae, S. chromogenes, S. sciuri, S. epidermidis and

S. saprophyticus were used in one tube reaction and, the primer sets specific for

S. equorum, S. haemolyticus, S. xylosus, S. simulans and S. fluerettii were used in the

other tube reaction in a two-tube m-PCR (Table 6).

83

Table 6. Primers used for the detection of CoNS species

Primer sets used in used in tube-1 Sl. No

Name of the

Primer

Species and gene targeted Oligonucleotide Sequence 5’─ 3’ Length Start

position

Product Size (bp)

Accession No.

1 Sarl-gap S. arlettae, gap F: ATCTCTGCTCCAGCATCAGG 20 333 216 DQ321674 R: AGGAGCGTCTTGTGTGCTTT 20 548

2 Schrom-sodA

S. chromogens, sodA F: CGTGACTAAGTTAAACGATGCAG 23 54 303 AJ343901 R: CCATTATTTACAACGAGCCATG 22 356

3 Ssci-gap S. sciuri, gap F: ATTTCAGCTCCAGCATCAGG 20 333 354 FJ578004 R: TGGAACACGTTGAGCTGATC 20 686

4 Sepi-rpoB S. epidermidis, rpoB F: AGGGCCTGGTGGATTAACAC 20 182 466 EF173659 R: TTGCATGTTTGCTCCCATTA 20 647

5 Ssap-gap S. saprophyticus, gap F: CGTTGACGGAATCGACGTAG 20 47 630 DQ321695 R: TGCGCTCCTCCATCTAATTT 20 676

Primer sets used in used in tube-2 6 Seq- sodA S. equorum, sodA F: AACGCTGCAGTTGAAGGAAC 20 82 245 AY818175

R: GCAGCTTGGTTAGCAAACTCTTC 23 326 7 Shaem-

sodA S. haemolyticus, sodA F: GCAGTTGAGGGAACAGATCTTG 22 76 292 EU652775

R: CTAACTGACCATTGTTAACTACTAACC 27 367 8

S xyl-rpoB

S. xylosus, rpoB F: GTCTAGTTATGCCCGTGTGAATG 23 126 433 FJ906727 R: AACAATTGCAGCACCTGAGTC 21 558

9 Ssim-gap S. simulans, gap F: CTACACTAGCGACGAAAAAGCAC 23 275 482 AF495498 R: CGTTTACTTCTTCGATTGTTACGTC 25 756

10 Sflu- rpoB S. fluerettii, rpoB F: ATCAGCTCTTGGACCCGG 18 7 550 GQ222236 R: GTCACGAGCAGTTACGTGTTCC 22 556

84

3.9.5.3.1 Preparation of PCR mixture for two-tube m-PCR

The reaction mixture of 25 µl prepared in 0.2 ml thin walled PCR tubes, on ice, in

each of the two-tubes comprised of the following reagents (Table 7). The primers were

added, 5 sets in each tube, as dsecribed above in section 3.9.5.3 and Table 6.

Table 7. Contents of the PCR mixture used in two-tube m-PCR

Sl. No Reagents (Conc.) Volume

1 10X Taq Buffer (10 mM Tris HCl, 15mM MgCl2, pH 8.4) 2.5 µl

2 Taq Polymerase (1U/µl) 0.8 µl

3 dNTPs (100µM/µl i.e., 25mM each dNTP) 1.0 µl

4 Primer F – 1 µl each from the 5 sets of the primers (10 pmoles/µl) 5.0 µl

5 Primer R – 1 µl each from the 5 sets of the primers (10 pmoles/µl) 5.0 µl

6 Template - 1 µl each from the 5 samples 5.0 µl

7 Nuclease Free Water - to make a final volume of 25µl 5.7 µl

Total 25.0 µl

3.9.5.3.2 Protocol for two-tube m-PCR

PCR with required cycling conditions (Table 8), electrophoresis of the PCR

products and the documentation of the gel images were carried out in a similar manner as

described in section 3.10.4.

Table 8. Cycling conditions used for two-tube m-PCR

Initial denaturation Denaturation Annealing Extension Final

extension

94oC, 5 min. 94oC,30 sec. 60oC, 30 sec. 72oC, 30sec.

72oC,10 min. Repeated for 30 cycles

85

3.9.6 Triplex PCR for the detection of S. aureus

CoNS isolates that were negative by two-tube m-PCR including phenotypically

thermonuclease positive isolates were subjected for triplex PCR specific for S. aureus

developed and standardized by Raju et. al. (manuscript under preparation), to identify

coagulase negative S. aureus, if any.

3.9.6.1 Preparation of PCR mixture

PCR mixture was prepared as described in 3.10.5.3.1. The reagents were same but

the primers were different (Table 9).

Table 9. Primers used in the S. aureus specific triplex PCR

Sl. No

Species and gene targeted Primer Length Product

size (bp)

1 Fib F: AATTGCGTCAACAGCAGATGCGAG 24

210 R: GGACGTGCACCATATTCGAATGTACC 26

2 Nuc F: GTGCTGGCATATGTATGGCAATTGT 25

461 R: TCTTTGACCTTTGTCAAACTCGA 23

3 23S rRNA F: ACGGAGTTACAAAGGACGAC 20

1250 R: AGCTCAGCCTTAACGAGTAC 20

3.9.5.3.2 Triplex PCR Protocol

The amplification reaction was also carried out in a similar manner as described

in the section 3.10.4., but only the PCR conditions were different as follws.

86

Cycling conditions used for Triplex PCR

Initial denaturation Denaturation Annealing Extension Final

extension

94oC, 5 min. 94oC,30 sec. 60oC, 30 sec. 72oC, 30sec.

72oC,10 min. Repeated for 30 cycles

Electrophoresis of the PCR products and the documentation of the gel images

were also carried out in a similar manner as described earlier in section 3.9.4.

3.9.7 Sequencing of Polymerase Chain Reaction products

All reference CoNS strains, few representative test isolates from different species

and geographic locations were chosen for sequencing. In all, 30 samples were sent for

sequencing which included 7 reference strains, 24 test isolates from 8 different CoNS

species, 2 coagulase negative S. aureus isolates. Details are shown in results (Table 22).

3.9.7.1 Polymerase chain reaction

The PCR was carried out in 100 µl reaction volume for the reference strains

and test isolates as described in this thesis depending on the species/ gene targeted.

3.9.7.2 Purification of PCR product

All the amplified products were purified using HiYield™ Gel/PCR Fragments

Extraction Kit procured from Real Biotech Corporation, Banqiao city, Taiwan.

3.9.7.2.1 Materials: Supplied with kit:- DF Buffer, Wash Buffer (concentrated), Elution

Buffer, DF Columms, 2 ml Collection Tubes; Additional requirements: 1.5 ml

microcentrifuge tubes, Micropipettes, Microtips.

87

3.9.7.2.2 Protocol for the purification of PCR product

Sample preparation

One hundred μl of the PCR product was transfered to a 1.5 ml microcentrifuge

tube. Five volumes of DF Buffer were added to one volume of the sample and mixed by

vortexing.

DNA Binding

A DF column was placed in a 2 ml collection tube. Sample mixture from previous

step was applied into the DF column and centrifuged at 6,000 x g (8,000 rpm) for 30

seconds. The flow-through was discarded and the DF column was placed back in the

collection tube.

Wash

Five hundred μl of Wash Buffer (ethanol added) was added into the DF column

and centrifuged at 6,000 x g (8,000rpm) for 30 seconds. The flow-through was discarded

and the DF column was placed back in the collection tube. DF column in the collection

tube was centrifuged again at full speed (13,000 RPM) for 2 minutes.

DNA Elution

Dried column was transferred into a new 1.5 ml microcentrifuge tube. Fifteen μl

of elution buffer or NFW was added into the center of the column matrix and it was

allowed to stand for 2 minutes until Elution buffer or NFW was absorbed by the matrix.

Then, the column was centrifuged for 2 minutes at full speed (13,000 RPM) to elute

purified DNA. The DNA eluted was detected by running 3 µl of each product in agarose

88

gel. The purified PCR products were either stored at -20⁰ C for further use or sent for

sequencing.

3.9.7.3 Sequencing of the purified PCR products

The purified PCR amplicons were commercially sequenced at Sequencing Dept.

of Eurofins Genomics India Pvt Ltd., Bangalore, sequencing facility on an ABI-PRlSM

dye terminator DNA sequencing apparatus using T3 sequencing. The sequence data

generated was received as colored electropherograms and text files.

3.9.8 Analysis of Nucleotide sequence and submission to GenBank

The nucleotide sequence data obtained were edited by Bio-edit/ Mega5 software

before they were submitted to GenBank. The sequence data was further analyzed by

BLAST and Clustal method with Weighted residue weight table software program.

MegAlign of DNA STAR was used for further analysis of nucleotide sequences.

CoNS isolates obtained in this study were compared and phylogenetically

analyzed species-wise with the sequence data available in GenBank (http:/ncbi.com).

Details are shown in results. All the sequences were aligned and phylogenetic analysis

was carried out using Clustal method with Weighted residue weight table software

program of MegAlign of DNA STAR or MEGA5. Additional analysis (Percentage

similarity / difference) in nucleotide sequence was estimated using MegAlign program

available in the DNA STAR.

89

3.10 Antimicrobial resistance of CoNS isolates

3.10.1 In-vitro antimicrobial sensitivity of CoNS isolates (Disc diffusion method)

All the isolates obtained in this study were subjected for antibiogram to determine

the resistance pattern of CoNS to various antibacterials. For this, in-vitro antimicrobial

sensitivity test was performed using twelve commercially available antimicrobials by

adopting Kirby- Bauer Method (Bauer et al., 1966). Twelve commercially available

antimicrobial sensitivity discs (Himedia Laboratories, Mumbai), including the commonly

used antibiotics for treatment of mastitis in the study area, were used for antimicrobial

susceptibility test (Table 10).

3.10.1.1 Materials: BHI broth, Muller Hinton Agar (MHA) plates, PBS, 0.5 Mc Farland

scale, sterile swab with wooden applicator, antibiotic zone scale (Himedia Laboratories,

Mumbai).

Table 10. List of antimicrobial susceptibility test discs used in the study

Sl. No. Antimicrobial agent Symbol Disc content

Breakpoint value considered to declare resistance*

1 Oxacillin OX 1 µg/disc 18 2 Methicillin M 5µg/disc 17 3 Penicillin G P 10U/disc 26 4 Ampicillin AMP 10µg/disc 27 5 Amoxycillin with Sulbactum AMS 30/15µg/disc 32 6 Ceftriaxone with Sulbactum CIS 30/15µg/disc 24 7 Ceftraixone with Tazobactum CIT 30/10µg/disc 24 8 Ceftraixone CTR 30µg/disc 22 9 Chloramohenicol C 30µg/disc 19 10 Gentamicin GEN 10µg/disc 19 11 Streptomycin S 10µg/disc 14 12 Enrofloxacin EX 10µg/disc 22

* Diameter of the zone of inhibition measured in mm

90

3.10.1.2 Protocol:

1. To prepare pure culture inoculum, 3-4 similar colonies of CoNS isolates were

transferred into BHI broth in 5 ml test tubes incubated at 37° C for 6 hrs or till

light to moderate turbidity develops. Then, the tubes were centrifuged at 3,000

RPM for 3 min. The supernatant was discarded and the cell pellet was suspended

in 1-2 ml sterile PBS.

2. The bacterial suspension of the isolates were adjusted to tube no. 0.5 on Mc

Farland scale using sterile PBS to yield a uniform suspension containing 105 – 106

cells/ ml.

3. A sterile non-toxic swab on a wooden applicator was dipped into the standardized

inoculum (whose turbidity was so adjusted as above to obtain a confluent growth)

and the soaked swab was rotated firmly against the upper inside wall of the tube

to express excess fluid.

4. Then, the entire agar surface of the plate was streaked with the swab three times,

turning the plate at 60° angle between each streaking. The inoculum was allowed

to dry for 5 – 10 minutes with lid in place.

5. Then, the antimicrobial susceptibility test discs were deposited aseptically onto

the agar surface with centres at least 30 mm apart. Sterile disc was used as a

control. The plates were incubated immediately at 37° C and examined after 16 –

18 hrs.

91

6. The diameter of zone of inhibition was measured in mm with the help of

antibiotic zone scale. The zone size recorded as diameter in mm was compared

with the interpretative chart supplied with the discs (Table 10) to declare the

result as either sensitive or resistant. The interpretation was done in accordance to

performance standards for antimicrobial disks susceptibility tests, Clinical

Laboratory Standard Institute (CLSI, 2010).

3.10.1.3 Statistical analysis of the results

The data obtained on the species-wise antimicrobial resistance was subjected to

the Pearson’s chi square test using PROC FREQ procedure of SAS 9.2 software

programme. As some of the expected frequencies were very less, Fisher’s exact test was

also applied.

3.10.2 Amplification of antibiotic resistant genes and coa gene of by m-PCR

3.10.2.1 Antibiotic resistant genes targeted and primers used

The antibiotic resistane genes to be targeted were decided based on the

phenotypic resistance pattern of the CoNS isolates. As the highest resistance was noticed

against the β-lactam antibiotics and aminoglycosides, these genes were targeted and the

published primers were used except for mecA (Table 11). Upon detection of

phenotypically coagulase negative S. aureus in the present study, the coa gene encoding

the enzyme coagulase, was also targeted and included in the multiplex PCR.

92

Table 11. Primers used in m-PCR for antibiotic resistance genes and coa gene

Sl. No

Species and gene targeted Primer Length Product

size (bp) References

1 Staph mecA F: TGG CTA TCG TGT CAC AAT CG 20

304 Designed* R: CTG GAA CTT GTT GAG CAG AG 20

2 novel mecA F: TCA CCA GGT TCA ACCT[Y] CAA AA 21

450 Garcia-Alvarez et al. (2011) R: CCT GAA TCAT[W] GCT AAT AAT ATT TC 24

3 Staph aacA-D

F: TAA TCC AAG AGC AAT AAG GGC 21

228 Strommenger et al. (2003) R: GCC ACA CTA TCA TAA CCA CTA 21

R:CAC ACT ATC ATA ACC ATC ACC G 22

4 aph3'-IIIa F: CTG ATC GAA AAA TAC CGC TGC 21

272 Vanhoof et al. (1994) R: TCA TAC TCT TCC GAG CAA AGG 21

5 coa F: AAC AAA GCG GCC CAT CAT TAA G 22

851 Montesinos et al. (2002) R: TAA GAA ATA TGC TCC GAT TGT CG 23

93

The PCR was initially standardized using phenotypically positive and negative

controls. The isolates that were phenotypically resistant to a group of antibacterials were

used as positive controls for the standardization of uniplex PCR to their respective genes,

and those that were sensitive were used as negative controls. Oxacillin and methicillin

were considered as the indicators of methicillin resistance mediated by mecA and novel

mecA gene. Similarly, gentamicin and streptomycin were considered as the indicators of

aminoglycoside resistance mediated by AME genes viz., aacA-D and aph3' -IIIa.

3.10.2.2 Protocol

The preparation of PCR mixture, amplification reaction, electrophoresis of the

PCR products and documentation of images was carried out in a similar manner as

described in section 3.10.5.3. PCR reagents were same but the conditions and the primers

were different (Table 11 and 12).

Table 12. PCR conditions for the amplification of antibiotic resistant genes and coa

gene

Initial denaturation Denaturation Annealing Extension Final extension

94oC, 10 min. 94oC, 20 sec. 55oC, 60 sec. 72oC, 50sec.

72oC,10 min. Repeated for 30 cycles

3.10.2.3 Sequencing of Polymerase Chain Reaction products

Three PCR products obtained by the amplification of antibiotic resistant genes

i.e., mecA, aacA-D and aph3'-IIIa as well as coa were sequenced (details are shown in

results section in Table 22). PCR, purification of PCR products and sequencing was

carried out as per the method described in 3.9.7.

94

3.10.2.3 Analysis of Nucleotide sequence and submission to GenBank

The nucleotide sequence data obtained were edited and analyzed as detailed in the

section 3.9.8.

3.10.3 Determination of minimum inhibitory concentration (MIC) values

MIC values were determined using commercial MIC determination paper strips

either HiComb or Ezy MIC strips obtained from Himedia Laboratories, Mumbai. These

were discs with pre-coated antibacterials in a concentration gradient manner capable of

showing MICs in the range of 0.016 µg to 256µg/ml or 001 µg to 240µg/ml, on testing

against the test organism.

3.10.3.1 Isolates

The isolates which were positive for mecA gene by PCR and a few negative

isolates were used for determination of MIC levels of oxacillin and methicillin. Similarly,

the isolates which were positive for AME genes (aacA-D and Staph aph3'-IIIa) by PCR

and a few negative isolates were used for determination of MIC levels of gentamicin.

3.10.3.2 Protocol for the determination of MIC values

1) Preparation of the inoculum and inoculation to MHA plates were carried out in a

similar manner as mentioned in section 3.9.2 from step 1 to step 4.

2) HiComb MIC strips / Ezy MIC strips stored at 2 – 8⁰ C were first brought to room

temperature or 25⁰ C before they were used.

95

3) The strips were applied aseptically with sterile forceps on to the agar surface with

MIC scale facing upwards and the plates were incubated at 37⁰ C for 18 – 24 hrs.

4) Then, the plates were examined for the zone of inhibition in the form of an

ellipse.

5) MIC value was read as the value at which the zone convenes the comb-like

projections of the strips and not the handle. When no zone of inhibition was

observed, the MIC was recorded as greater than the highest concentration of the

strip. When the zone of inhibition was below the concentration, then the MIC was

recorded as less than the highest concentration of the strip.

The MIC values recorded were compared with the interpretative chart (supplied

with the MIC strips) which was in accordance to the performance standards for

antimicrobial disk suceptility tests, Clinical Laboratory Standards Institute (CLSI, 2010).