Matrix Metalloproteinase Expression and Regulation
During Pregnancy, Term Labour, and Postpartum
by
Tina Tu-Thu Ngoc Nguyen
A thesis submitted in conformity with the requirements
for the degree of Master of Science
Graduate Department of Physiology
University of Toronto
© Copyright by Tina Tu-Thu Ngoc Nguyen 2015
ii
Matrix Metalloproteinase Expression and Regulation
During Pregnancy, Term Labour, and Postpartum
Tina Tu-Thu Ngoc Nguyen
Master of Science, 2015
Department of Physiology, University of Toronto
ABSTRACT
It is widely accepted that pregnancy, spontaneous term labour (TL), and postpartum (PP)
involution is associated with changes in the cellular and extracellular composition of the uterus.
These changes involve metalloproteinases (MMPs) secretion by myometrial smooth muscle cells
and infiltrating leukocytes. MMP activation results in collagenolysis, modulation of cellular
behaviour and barrier function. I hypothesize that during late gestation, the expression and activity
of myometrial MMPs and their tissue inhibitors (TIMPs) increase in preparation for TL, and are
regulated by mechanical stretch. The current in vivo study demonstrated that gene and protein
expression of MMP-7 and MMP-11 were upregulated during TL, suggesting labour promotion;
whereas other MMPs (2, 3, 8, 9, 10, 12) were induced only during the early PP period. The sources
of myometrial MMPs during TL and PP include myocytes and resident leukocytes. In vitro studies
did not support the regulation of myometrial MMP expression by mechanical stretch.
iii
ACKNOWLEDGEMENTS
The cherished amount of time spent in the Lye Lab has been both unforgettable and a life-
changing educational experience. Over the years, not only have I developed long-lasting
relationships with colleagues and fellow graduate students on the 6th floor of the Lunenfeld-
Tanenbaum Research Institute, I have received the opportunity to learn valuable research
techniques and expand on my scientific knowledge. I would like to especially thank my research
supervisor Dr. Stephen Lye for giving the opportunity to study as a Master of Science Candidate
in the Lye Lab and for his constant support. I would also like to thank Dr. Oksana Shynlova for
her remarkable guidance and mentorship during my studies and her dedication towards the
completion of my degree. I definitely cannot forget to thank Anna Dorogin for all of her guidance
and technical assistance with sample collection and performing my experiments. I am also grateful
for all the scientific advice, stories, and laughs from all the members of the Lye and Kingdom lab
who have made my Master’s experience an enjoyable one: Ela Matysiak-Zablocki, Bev Bessey,
Richard Maganga, Tali Farine, Melissa Kwan, Bona Kim, Jovian Wat, Dr. Jan Heng, Dr. Lubna
Nadeem, Dr. Mark Kibschull, Dr. Caroline Dunk, Dr. Jianhong Zhang, Dr. Kristin Connor, Tam
Lye, Dora Baczyk, Farshad Ghasemi, Khrystyna Levytska, and Hala Kufaishi. In addition I would
like to thank Richard Bielecki for his assistance with all microscope equipment. Special thanks to
the members of my Supervisory Committee Dr. Stephen Matthews and Dr. Michelle Bendeck for
their insightful comments and guidance to provide direction for my thesis project.
Thank you to my family, especially my mother for all of her hard work to take care of me
throughout my life and during my studies. Also thanks to my friends, particularly those whom I
have met along my scientific journey, and Julien Sallais, for all the love, support and comfort you
all have given me. I hope to make you all proud.
iv
CONTRIBUTORS
The following people contributed to the results presented in this thesis:
Anna Dorogin assisted in tissue collection, immunohistochemical analysis, and in situ
zymography for the bilaterally pregnant rat model.
Tissue collection and RT-qPCR analysis was performed in collaboration with Dr. Oksana
Shynlova with the assistance of Anna Dorogin.
Tali Farine assisted with enzymatic isolation and sample collection for the in vitro model of
mechanical stretch using primary human myometrial cells.
v
TABLE OF CONTENTS
ABSTRACT...................................................................................................................................ii
ACKNOWLEDGEMENTS..........................................................................................................iii
CONTRIBUTORS.........................................................................................................................iv
TABLE OF CONTENTS................................................................................................................v
LIST OF TABLES.......................................................................................................................viii
LIST OF FIGURES........................................................................................................................ix
LIST OF ABBREVIATIONS........................................................................................................xi
CHAPTER 1: INTRODUCTION AND LITERATURE REVIEW
1.1 Overview: Preterm and Term Labour…………………………………………….….........2
1.2 Overview: Postpartum Uterine Involution…………………………………………….…...4
1.3 The Myometrium during Pregnancy, Labour, and Postpartum………………………….5
1.3.1 Myometrial smooth muscle phenotypes during pregnancy…………………………….…....5
1.3.2 Extracellular matrix modifications in the myometrium during pregnancy………….….…...8
1.3.3 Myometrial Inflammation……………………………………………………………….…..9
1.4 Matrix Metalloproteinases…………………………………………….…..........................11
1.4.1 Matrix metalloproteinases as regulators of tissue remodeling……………………………..11
1.4.1.1 Collagenases…………………………………………………………………….14
1.4.1.2 Gelatinases………………………………………………………………………15
1.4.1.3 Stromelysins……………………………………………………………………..16
1.4.1.4 Stromelysin Subgroup: Matrilysin and Metalloelastase…………………………16
1.4.1.5 Regulation of MMP activity: TIMPs…………………………………………….17
1.4.2 Matrix Metalloproteinases as immunoregulatory proteases…………….……….…………19
1.4.2.1 MMPs as modulators of inflammation…………………………………………..19
1.4.2.2 MMPs as modulators of pregnancy and labour…….……………………………20
1.5 Thesis Rationale and Hypothesis…………………………………………….…………….22
1.6 Specific Aims and Objectives…………………………………………….………………...23
1.6.1 Aim 1: To characterize the expression pattern of myometrial MMPs and TIMPs throughout
pregnancy, labour and postpartum……………………………………………………………….23
1.6.2 Aim 2: Investigate the in vivo regulation of MMP and TIMP expression by mechanical
stretch…………………………………………………………………………………………….24
1.6.3 Aim 3: Investigate the in vitro regulation of MMP and TIMP expression by mechanical
stretch…………………………………………………………………………………………….24
vi
CHAPTER 2: MATERIALS AND METHODS
2.2 Rat Gestational Profile of MMP Expression……………………………………………...27 2.2.1 Bilaterally Pregnant Rat Animal Model of Gestation………………………………….…..27
2.2.2 Unilaterally Pregnant Rat Model of Gestation……………………………………………..28
2.2.3 Tissue Collection and Preparation………………………………………………………….28
2.2.4 Real-Time Polymerase Chain Reaction (RT-PCR) Analysis of mRNA expression…….…29
2.2.5. Gelatin Zymography and Western Blot Analysis of Protein Expression ……………….…31
2.2.6 Localization of Myometrial MMPs by immunohistochemistry…………………………….34
2.2.7 Localization of Myometrial MMP expression and activity by in situ zymography…………35
2.2.8 Localization of Leukocyte MMP expression and activity by in situ zymography………….36
2.3 Effect of In Vitro Mechanical Stretch on Human MMP mRNA Expression…………….37 2.3.1 In vitro primary human myometrial cell model of mechanical stretch……………………..37
2.3.2 Assessment of cell viability following in-vitro mechanical stretch experiments…………...38
2.3.3 Characterization of primary human myometrial cells with immunocytochemistry…..……39
2.3.4 Sample collection, preparation and RT-PCR analysis of mRNA expression...…………….40
2.3.5 Analysis of conditioned media for secreted MMPs and TIMPs’ protein expression using a
human MMP 9-plex panel and TIMP 4-plex panel Luminex assay………..……………….…...42
2.3.6 In vitro primary rat myometrial cell model of mechanical stretch………………………….43
2.3.7 Sample collection, preparation and RT-PCR analysis of mRNA expression ….………….44
2.5 Statistical Analysis………………………………………………………………………….45
CHAPTER 3: RESULTS
3.1 Introduction………………………………………………………………………………...47
3.2 Gestational Regulation of MMP Gene Expression in the Rat Myometrium…………….48 3.2.1 Myometrial MMP mRNA expression in the bilaterally pregnant rat model………………..49
3.2.2 Myometrial MMP mRNA expression in the unilaterally pregnant rat model……………...59
3.3 Gestational Regulation of MMP Protein Expression in the Rat Myometrium………….64 3.3.1 Western blot analysis of MMP levels and gelatin zymography of the myometrial tissue
from bilaterally pregnant rats…………………………………………………………………….64
3.3.2 Western blot analysis of MMP levels and gelatin zymography of the myometrial tissue
from unilaterally pregnant rats…………………………………………………………………...70
3.4 Temporal and Spatial Localization of MMPs in the Rat Myometrium………….………74 3.4.1 Tissue localization of MMP in the rat myometrium by immunohistochemistry…………....74
3.4.2 Tissue localization of MMP activity in the rat myometrium by in situ zymography…..……78
3.5 In Vitro Cell Model of Mechanical Stretch…………………..…………………………….85 3.5.1 In vitro primary rat myometrial cell model of mechanical stretch………………………….85
3.5.2 In vitro primary human myometrial cell model of mechanical stretch……………………..86
3.5.3 In vitro mechanical stretch does not influence myometrial MMPs gene expression............89
3.5.4 Secreted myometrial MMPs proteins detected by Luminex assay…………………………93
vii
CHAPTER 4: DISCUSSION
4.1 Gestational Regulation of MMP Gene and Protein Expression in the Rat
Myometrium................................................................................................................................96 4.1.1 The Role of MMPs during Gestation, Term Labour, and Postpartum Involution……….….96
4.1.2 The Role of MMPs in Uterine Inflammation: Mutual Regulation………….………….….104
4.1.3 Regulation of Myometrial MMP Expression: Potential Mechanisms…………….....….…106
4.2 Changes of Myometrial MMPs Are Not an Effect of Mechanical Stretch (In Vitro
Primary Cell Model) ................................................................................................................108
4.3 Conclusion: Proposed Model for the Role of Myometrial MMPs During Late
Gestation, Term Labour, and Postpartum Involution…………………………………..…109
CHAPTER 5: FUTURE DIRECTIONS
5.1 Future Directions.................................................................................................................112
REFERENCES....................................................................................................................115
viii
LIST OF TABLES
CHAPTER 2
Table 2.1 Primer pair information for Rat (Rattus Norvegicus) genes examined using RT-PCR..30
Table 2.2 Information of antibodies used for Rat-specific experiments………………………….33
Table 2.3 Information of antibodies used for immunocytochemistry……..…………….……….40
Table 2.4 Primer pair information for Human (Homo sapien) genes examined using RT-PCR....41
ix
LIST OF FIGURES
CHAPTER 1
Figure 1.1 Myometrial SMC phenotypes during pregnancy, labour and postpartum…………...…7
CHAPTER 3
Figure 3.1: Gestational expression of Gelatinases’ mRNA in bilaterally pregnant, laboring and
postpartum (PP) rat myometrium………………………………….…………………………….51
Figure 3.2: Gestational expression of Collagenases’ mRNA in bilaterally pregnant, laboring and
postpartum rat myometrium………………………………………………………………….….52
Figure 3.3: Gestational expression of Stromelysins’ mRNA in bilaterally pregnant, laboring and
postpartum rat myometrium………………………………………………………………….….53
Figure 3.4: Gestational expression of Matrilysin (MMP7) and Macrophage Metalloelastase’s
(MMP12) mRNA in bilaterally pregnant, laboring and postpartum rat myometrium…………..54
Figure 3.5: Gestational expression of TIMP mRNA in bilaterally pregnant, laboring and
postpartum rat myometrium………………………………………………………………….….55
Figure 3.6 Comparative characteristics of MMP and TIMP gene expression in the pregnant, term
labour, and postpartum rat myometrium……………………………………………………..56-57
Figure 3.7: Expression of Gelatinases MMP-2 and MMP-9 genes in the myometrium of
unilaterally pregnant rats during gestation, term labour and postpartum….………….………….60
Figure 3.8: Expression of Stromelysins MMP-3, MMP-10, and MMP-11 genes in the
myometrium of unilaterally pregnant rats during gestation, term labour and postpartum……….61
Figure 3.9: Expression of Collagenase (MMP-8), Matrilysin (MMP-7) and Metalloelastase
(MMP-12) genes in the myometrium of unilaterally pregnant rats during gestation, term labour
and postpartum………………………………………………………………….……………….62
Figure 3.10: Protein levels of Collagenase MMP-8 in the rat myometrium throughout gestation,
labour and postpartum………………………………………………………………….………..65
Figure 3.11: Protein levels of Stromelysins in the rat myometrium throughout gestation, labour
and postpartum………………………………………………………………….……………….66
Figure 3.12: Protein levels of Matrilysin and Metalloelastase in rat myometrium throughout
gestation, labour and postpartum…………………………………………………………….......67
Figure 3.13: Representative Gelatin Zymography and Densitometric analysis………………….69
Figure 3.14: Protein levels of Matrilysin and Macrophage Metalloelastase in the unilaterally
pregnant rat myometrium throughout gestation, labour and post-partum………………………..72
x
Figure 3.15: Representative Gelatin Zymography and Densitometric analysis………………….73
Figure 3.16: Temporal and spatial localization of MMP-7 in pregnant, labouring and postpartum
rat uterus…………………………………………………………………………………............75
Figure 3.17: Temporal and spatial localization of MMP-9 in pregnant, labouring and postpartum
rat uterus…………………………………………...…………………………….………………76
Figure 3.18: Temporal and spatial localization of MMP-11 in pregnant, labouring and postpartum
rat uterus…………………………………………...…………………………….………………77
Figure 3.19: Representative images for in situ zymography using fluorescent MMP substrates:
DQ gelatin (second column), DQ collagen type I (third column) and DQ collagen type IV (right
column) for tissue localization of MMP activity………………………………………………...79
Figure 3.20: Gelatinase activity of rat myometrium and tissue leukocytes during late gestation
(GD21, 22), term labour (D23) and post-partum (1PP) ….………………………...……………81
Figure 3.21: Representative images from in situ gelatin zymography and CD68
immunofluorescence….………………………...……………………………………………….82
Figure 3.22: Representative images from in situ collagen I zymography and CD68
immunofluorescence….………………………...……………………………………………….83
Figure 3.23: Representative images from in situ collagen IV zymography and CD68
immunofluorescence….………………………...……………………………………………….84
Figure 3.24: Representative immunocytochemical fluorescent images of primary human
myometrial cells at passage 0, 2 and 4….………………………...……………………………..86
Figure 3.25: Representative images from assessment of cell viability following mechanical stretch
of primary human myometrial cells……………………………………………………………...88
Figure 3.26: Expression changes in mRNA levels of MMPs as an effect of in vitro static
mechanical stretch of primary human myometrial cells…………………………………………90
Figure 3.27: Expression changes in mRNA levels of MMPs as an effect of in vitro static
mechanical stretch of primary human myometrial cells…………………………………………91
Figure 3.28: Expression changes in mRNA levels of TIMPs as an effect of in vitro static
mechanical stretch of primary human myometrial cells…………………………………………92
Figure 3.29: Changes in MMP and TIMP protein secretion primary human myometrial cells as an
effect of in vitro mechanical stretch……………………………………………………………...94
CHAPTER 4
Figure 4.1. Evidence-based model for the role of myometrial MMPs during labour and postpartum
involution………………………………………………………………………………………111
xi
LIST OF ABBREVIATIONS
BM Basement Membrane
BSA Bovine Serum Albumin
CAP Contraction-Associated Protein
CBD Collagen Binding Domain
CCL C-C (motif) Chemokine Ligand
CM Circular Muscle Layer
CXCL C-X-C (motif) Chemokine Ligand
ddH2O Double Deionized Water
DMEM Dulbecco’s Modified Eagle Medium
EC Endothelial Cell
ECM Extracellular Matrix
EDTA Ethylenediaminetetraacetic acid
EtOH Ethanol
FBS Fetal Bovine Serum
FDA Fluorescein Diacetate
GD Gestational Day
HBSS++ Hank’s Buffered Salt Solution (with Calcium and Magnesium)
HBSS-- Hank’s Buffered Salt Solution (without Calcium and Magnesium)
HRP Horseradish Peroxidase
ICC Immunofluorescent Cytochemistry
IF Immunofluorescence
IGF Insulin-like Growth Factor
IGFR Insulin-like Growth Factor Receptor
IHC Immunohistochemistry
IL Interleukin
ITS-A Insulin-Transferrin-Selenium-Sodium Pyruvate Supplement
LM Longitudinal Muscle Layer
MMP Matrix Metalloproteinase
NE Neutrophil Elastase
NSM Non-Stretch-Conditioned Media
NBF Neutral buffered formalin
xii
P4 Progesterone
PBS Dulbecco’s Phosphate-Buffered Saline (without Calcium and Magnesium)
PBS-T Phosphate-Buffered Saline with Tween-20
PDGF-A Platelet-Derived Growth Factor Alpha
PFA Paraformaldehyde
PI Propidium Iodide
PP Postpartum
PPIA Peptidylprolyl Isomerase A (Cyclophilin A)
PTL Preterm Labour
RT Room temperature
RT-qPCR Real Time Quantitative Polymerase Chain Reaction
SCM Stretch-Conditioned Media
SDS Sodium Dodecyl Sulfate
SEM Standard Error of the Mean
SMA Smooth Muscle Actin
SMC Smooth Muscle Cell
TBP TATA Box-binding Protein
TBS-T Tris Buffer Solution with 0.02% Tween-20
TGF-β Transforming Growth Factor-Beta
TIMP Tissue Inhibitor of Metalloproteinases
TNF-α Tumor Necrosis Factor-Alpha
TL Term Labour
WB Western Blot Analysis
ZBF Zinc-Buffered Fixative
1
CHAPTER 1
INTRODUCTION AND LITERATURE REVIEW
Chapter 1: Introduction and Literature Review
2
1.1 Overview: Preterm and Term Labour
Preterm labour (PTL) refers to premature delivery before 37 weeks of gestation [1]. PTL
is a significant clinical problem for modern obstetricians because it occurs in 5-18% of all
pregnancies and is a major contributor of perinatal mortality (70%) and morbidity (75%). Preterm
infants are also 40 times more likely to die than term infants, and are at an increased risk of
developing cerebral palsy, blindness, deafness and respiratory illness [1-6]. However, it is difficult
to define the exact causes of spontaneous PTL as many factors – such as uterine infection,
premature rupture of membranes (PROM), and chronic chorioamnionitis – can contribute to the
early onset of labour [7, 8]. Several studies suggest that normal term labour (TL) in humans is an
inflammatory process and infection/inflammation has been seen as one of the contributing factors
of PTL [9-12].
TL is a highly orchestrated process involving coordinated events in multiple tissues, which
include the myometrium, decidua, fetal membranes, and cervix [13]. However past attention was
mainly given to study the mechanisms that regulate the myometrium and the cervix in preparation
for labour [9, 14]. Nearing the end of pregnancy, the cervix begins to soften and dilate, while the
myometrium progresses to a contractile phenotype. Interestingly, both of these coordinated
changes are associated with remodeling of the tissue environment, and are regulated by the
endocrine and immune systems [14-17]. Current knowledge pertaining to the underlying
mechanisms that regulate pregnancy associates pro-inflammatory pathways with the switch
between myometrial quiescence and myometrial activation [18]. Particularly during pregnancy,
myometrial quiescence is maintained – primarily by increased levels of circulating progesterone
– until the switch to a contractile phenotype is required for labour initiation. Progesterone receptor
signaling suppresses the expression of pro-inflammatory mediators such as chemokine CCL2,
Chapter 1: Introduction and Literature Review
3
(the major chemoattractant for monocytes), contraction-associated proteins (CAPs) such as
connexin-43 (Cx43), and prostaglandin receptors (PGRs) [14, 19-23].
Inflammatory responses, which include leukocyte infiltration into uterine tissues, can
spontaneously initiate processes like cervical ripening, rupture of fetal membranes, decidual and
myometrial activation. Numerous studies have reported not only increases in pro-inflammatory
mediators, but especially the influx of macrophages and neutrophils into several uterine
compartments before and during TL [6, 10, 11, 16, 24-26]. Additionally, intrauterine infections
can lead to PTL, suggesting a possible causality link between inflammation and spontaneous PTL
[13, 27]. Hamilton et al. further confirmed this link, through their report of macrophages in the
human and rat decidua – the pregnant endometrial layer acting as the fetal-maternal interphase –
during TL and PTL, also providing evidence to suggest decidual inflammation precedes labour
[26]. Interestingly, Shynlova et al. observed several differences regarding leukocyte infiltration
in the myometrium and decidua between PTL and TL. During TL macrophage infiltration
precedes neutrophil infiltration, whereas neutrophil infiltration specifically increased during
infection-induced PTL and remained elevated PP [20, 28]. These findings indicate that
particularly the myometrium, decidua, and cervix are immunoregulatory tissues capable of
recruiting peripheral leukocytes through the release of different inflammatory mediators. The
discovery that uterine inflammation is associated with labour onset suggests that targeting these
inflammatory pathways or pro-inflammatory mediators could represent a potential approach to
prevent PTL. Thus further investigation into the underlying mechanisms that regulate the
labouring process may reveal more specific targets to efficiently address spontaneous PTL.
Chapter 1: Introduction and Literature Review
4
1.2 Overview: Postpartum Uterine Involution
Following parturition and shedding of the placenta, the uterus undergoes drastic
physiological tissue alterations similar to wound healing, with the aim to return to a pre-pregnant
state (ready for future pregnancies). This process is termed postpartum (PP) uterine involution,
which involves rapid and extensive remodeling of the extracellular matrix (ECM), resulting in a
dramatic reduction (at least 10-fold) in the size of the uterus in the PP period [17, 29-32]. The
myometrium is the main component that undergoes reversible modification to accommodate the
enlarged uterus during pregnancy, making it one of the primary sites of tissue rearrangement
during uterine involution. This myometrial transition includes a reduction in number and size of
the smooth muscles cells (SMCs), along with degradation of ECM components – especially the
collagen and elastin deposited during pregnancy [29, 33-36]. Nishinaka et al. have reported the
presence of myofibroblastic interstitial cells surrounding myometrial SMCs during the PP period
for removal of degraded collagen and elastic fibers by macrophage phagocytosis [34].
Additionally Hsu et al. observed increased myometrial autophagy – degradation of cytoplasmic
organelles using lysosomal machinery – was associated with reduction in SMC size [33].
Shynlova et al. also detected an increase in the expression of genes encoding insulin-like growth
factor (IGF)-1, IGF binding protein (BP)-5 and IGF-1 receptor (IGF1R), associated with
regeneration of uterine tissues [37]. These findings indicate that the uterine smooth muscle
undergoes physiological adaptations and phenotypic differentiation during pregnancy and is
followed by tissue regeneration during the involution phase.
PP involution is a complex biological process involving interactions between a variety of
cells – including fibroblasts, myofibroblasts, SMCs and immune cells – and is mediated by
hormones, growth factors, cytokines and chemokines [29]. In concordance, Shynlova et al.
Chapter 1: Introduction and Literature Review
5
detected high levels of macrophage infiltration during the PP period localized to the endometrium-
myometrium junction and this influx was tightly regulated by a group of chemokines including
CCL2 [22, 38]. Interestingly, chemokines released by myometrial cells not only recruit peripheral
leukocytes, but can also induce cellular proliferation, differentiation, apoptosis, and angiogenesis
– all biological processes necessary for uterine tissue rearrangement during involution [29, 39].
These findings suggest that the maternal immune system not only regulates TL but also regulates
PP uterine involution [20, 40].
1.3 The Myometrium during Pregnancy, Labour and Postpartum
1.3.1 Myometrial smooth muscle phenotypes during pregnancy
In the rodent, the myometrium is organized into two main layers: 1) the outer longitudinal
muscle layer that is oriented along the axis of the uterine horn, and 2) the sub-endometrial circular
muscle layer that is perpendicular to the uterine axis [41, 42]. The outer layer has especially been
seen to be actively associated with parturition, which suggests its primary involvement in
myometrial contractility [43, 44]. SMCs make up approximately half of the cells in the
myometrium, and are known to self-secrete basement membrane (BM) components that
encapsulate and surround each individual SMC [45-47]. These uterine SMCs physiologically
adapt to pregnancy and undergo, near term, a drastic transition from a fairly quiescent state to an
activated contractile state. In particular, the sequential phenotypic transition has been described
as follows: 1) the early proliferative phase is characterized by upregulated IGF-1 and anti-
apoptotic Bcl-2 signaling (SMC hyperplasia); 2) an intermediate synthetic phase, involving
increase in cell size (SMC hypertrophy) and induction of interstitial matrix synthesis; 3) a late
contractile phase fully committed to labour involving SMCs working as a syncytium due to Cx43
Chapter 1: Introduction and Literature Review
6
induction, with increased expression of contractile machinery proteins, and 4) PP involution
following parturition, which returns the myometrium back to a pre-pregnant state (Figure 1.1)
[29, 35, 48-50].
This phenotypic switch to the contractile/labour phase involves expression of well-studied
pro-inflammatory mediators and CAPs [19, 21, 22]. Several studies have addressed the
upregulated expression of CAPs, such as the gap junction protein Cx43 and PGRs, within the
myometrium to promote labour [21, 51, 52]. These protein changes not only are necessary to
increase SMC excitability and connectivity, but also to promote myometrial contractility [21, 51,
52]. Moreover, these myometrial changes are regulated by both hormonal (estrogen and
progesterone) and mechanical stimuli associated with late gestation [29, 49, 53]. These findings
advocate the importance of myometrial activation in labour initiation and further elucidation of
the underlying mechanisms will assist in developing new therapies for PTL.
Chapter 1: Introduction and Literature Review
7
Figure 1.1 Myometrial SMC phenotypes during pregnancy, labour and postpartum. The myometrial SMCs undergo a programmed transition between distinct phenotypes that
include: 1) an early proliferative phase associated with SMC hyperplasia; 2) an intermediate
synthetic phase involving SMC hypertrophy; 3) a late contractile phenotype associated with the
upregulation of CAPs that will commit SMCs to synchronous labour contractions; and 4) a
phase of postpartum involution involving expression of genes associated with wound repair, cell
apoptosis, ECM remodeling, and tissue regeneration, which allows the uterus to resume a pre-
pregnant state. Reproduced with permission from Shynlova et al.[29].
Chapter 1: Introduction and Literature Review
8
1.3.2 Extracellular matrix modifications in the myometrium during pregnancy
The ECM is an important component of all tissues, providing a stable three-dimensional
environment for the growth and function of parenchymal cells. The ECM is a non-cellular
structure that has a unique tissue-specific composition to support biological function and
encompasses both cellular – fibroblasts that secrete matrix proteins – and non-cellular components
[54, 55]. The ECM can be further divided into two types, the interstitial connective tissue matrix
that provides structural support for tissues, and the basal lamina – secreted by epithelial cells and
separates them from the surrounding stroma [54]. Mammalian ECM is composed of
approximately 300 proteins (the core matrisome) and includes the structural proteins fibrillar
collagens (type I, II and III collagen) and elastin, substrate adhesion molecules: fibronectin,
laminin and collagen IV, as well as numerous glycoproteins, and proteoglycans. Additionally, the
components of the ECM constantly interact with their integrin cell-surface receptors to regulate
and maintain tissue integrity [35, 54]. The ECM is also constantly remodeled to maintain tissue
homeostasis – such as cell proliferation, apoptosis or differentiation [56].
It is well understood that extensive remodeling of the uterine ECM throughout the course
of pregnancy transpires to accommodate fetal growth and promote the SMC transition from a
quiescent to a contractile phenotype (Figure 1.1) [35, 57-59]. One of the early reports of
myometrial remodeling by Granstrom et al., reported extensive collagenolytic activity in the
uterine body – similar to the cervical ripening process – following the onset of labour [60]. The
myometrium particularly exhibits changes in the expression of ECM components as a result of
hormonal and mechanical stimuli throughout pregnancy [35]. Garfield and Hayashi suggested that
the degradation of the myometrial ECM facilitates the formation of gap junctions between SMCs
to increase cellular connectivity for coordinated uterine contractions [61]. It is indicative that
Chapter 1: Introduction and Literature Review
9
activation of myometrial ECM remodeling is also an essential physiological process to maintain
synchronized labour contractions.
Interestingly, changes in gene and protein expression of myometrial ECM components
can be induced by biological mechanical stretch of the uterus in vivo using a well-established
unilaterally pregnant rat model of gestation. Shynlova et al. reported significant alterations in the
expression of multiple myometrial ECM genes, specifically a coordinated decrease in gene
expression of fibrillar proteins (i.e. type I collagen) and an increase in elastin, fibronectin and BM
proteins (laminin, and collagen IV) towards term in rats [35]. This model provided evidence that
ECM modifications can be stretch-regulated, specifically in the gravid (pregnant) uterine horn to
accommodate the growing fetus/es, placenta and amniotic fluid, whereas the ECM in the empty
horn is not influenced by mechanical stimuli [17, 35]. It was suggested that remodeling of the
ECM increases elasticity of the uterus, and supports the change in SMC phenotype in preparation
for labour contractions by restoring the BM surrounding individual SMCs [35]. These findings
were consistent with the immunohistochemical results from Nishinaka et al. that suggested the
BM of individuals SMCs are structurally modified during late gestation to support labour
contractions [34]. The organized structures of BM and focal adhesion proteins during TL further
confirmed that stretched-induced modification of ECM provides cell-matrix stability for optimal
labour contractions [47].
1.3.3 Myometrial inflammation
Several studies have investigated the role of immune cells and inflammatory mediators
contributing to events preceding TL and PTL [10, 11, 62]. For instance, the mRNA and protein
expression level of certain pro-inflammatory cytokines and chemokines were elevated before,
Chapter 1: Introduction and Literature Review
10
during, and immediately after TL in reproductive tissues [11, 17, 20, 28]. In particular, Thomson
et al. first reported the predominant presence of neutrophils and macrophages accumulating in the
human myometrium during spontaneous TL [10]. Osman et al. further reported increased
expression of IL-1β, IL-6, and IL-8, and similar infiltration of macrophages and neutrophils, in
the myometrium and cervix [11]. Our lab also recently reported that macrophage and neutrophil
populations were increased in parallel with pro-inflammatory cytokine induction in the mouse
myometrium and decidua during TL, which further increased during the early PP period [20, 28].
It is well understood that activated leukocytes further amplify the inflammatory signal via
additional secretion of cytokines – such as IL-1β, IL-6, and TNF-α – in the targeted reproductive
tissue during late gestation and TL [63]. The pro-inflammatory state that develops in reproductive
tissues (i.e. in the myometrium) as a result of the increased inflammatory mediators, has been
widely accepted to be essential for the induction of labour – for instance IL-1β can upregulate
prostaglandin production [6, 11, 16, 24-26, 62]. Since PGRs are constantly expressed in the
myometrium, the cytokine-mediated upregulation of prostaglandin production would directly
promote myometrial contractions.
Interestingly, it was observed that the expression of Monocyte Chemoattractant Protein-1
(MCP-1, also known as CCL2), a chemokine involved in macrophage migration, was significantly
upregulated in the pre-partum rat myometrium due to mechanical stretch from the growing fetus
and was inhibited by progesterone signaling [22]. MCP-1 expression was also associated with the
infiltration of macrophages into the term rat myometrium. This study links endocrine and
mechanical signalling to the regulation of leukocyte infiltration by inflammatory mediators and
labour induction. Lee et al. recently demonstrated that cytokines produced by mechanically
stretched human myometrial SMCs were able to upregulate the expression of cell adhesion
molecules (such as ICAM-1, major ligand for leukocyte integrin LFA-1) on endothelial cells
Chapter 1: Introduction and Literature Review
11
(ECs), and promoted leukocyte transendothelial migration [64]. These results collectively show a
potential association between the increase in uterine inflammatory mediators as a result of
mechanical stretch of the myometrium, leukocyte infiltration and the induction of labour [20, 28,
64]. However, the exact molecular mechanism that regulates the influx of leukocytes into uterine
tissue following cell adhesion requires further investigation [17, 20, 28].
1.4 Matrix Metalloproteinases
1.4.1 Matrix Metalloproteinases as regulators of tissue remodeling
Apart from ECM proteins and inflammatory mediators, the application of defined
mechanical stimuli to different types of cells has been shown to influence gene expression and
protein synthesis of a group of zinc-containing endopeptidases capable of degrading ECM
proteins, known as matrix metalloproteinases (MMPs). All MMPs are grouped based on substrate
preference or the organization of their domain constituents, such as collagenases (MMP-1, 8, 13),
gelatinases (MMP-2 and 9), and stromelysins (MMP-3, 10, 11). However all MMPs contain a
common sequence motif His-Glu-X-Gly-His-X-X-Gly-X-X-His within their catalytic site, where
the three His residues coordinate the catalytic zinc ion (Zn2+) [65]. MMPs are either secreted (as
pro- or active enzymes) or anchored to the cell surface and their physiological substrates include
ECM components (i.e. collagen, proteoglycans, fibronectin, and laminin), as well as non-matrix
proteins (i.e. cytokines, chemokines, receptors and antimicrobial peptides) [66-69].
The majority of MMPs are secreted with a self-inhibitory pro-domain upstream of the
catalytic domain, and contain a conserved Cys residue that interacts with Zn2+ in the active site to
inhibit catalytic activity. The pro-domain requires either proteolytic removal or oxidative
modification of the thiol group for protease activation [54, 65, 69]. The expression and activity
Chapter 1: Introduction and Literature Review
12
level of MMPs was first believed to be regulated in two ways: 1) physiologically, by a group of
proteins called Tissue Inhibitors of MMPs (TIMPs) and 2) by the α2-macroglobulin. TIMPs form
non-covalent 1:1 complexes with MMPs and either inhibit or promote the enzymatic activity of
MMPs; whereas α2-macroglobulin acts as a general proteinase inhibitor and regulates MMPs
activity by entrapping them and leading the macroglobulin-MMP complex to be cleared by
receptor-mediated endocytosis [68]. Now it is recognized that MMP gene expression can be
regulated by several factors including cell-receptor signaling, growth factors, and cytokines [31,
70, 71]. Recently, a major extracellular MMP inducer, called EMMPRIN has been characterized.
EMMPRIN is a member of the Ig superfamily that includes T cell receptors, major
histocompatibility complex (MHC) antigens, and neural cell adhesion molecules. It was first
identified as a tumor cell-surface molecule capable of stimulating collagenase expression by
fibroblasts however Braudmeier et al. have shown that EMMPRIN treatment of human uterine
fibroblasts also resulted in stimulation of MMP-1 and MMP-2 expression [72]. Interactions
between cell-surface integrin receptors with ECM ligands such as collagen and fibronectin can
also induce MMP expression to reorganize the ECM [73, 74].
Typically, MMPs are not actively expressed in healthy tissues, but they can be detected in
all diseased, inflamed, or injured tissues [75, 76]. MMPs can be produced and secreted by a variety
of cells within the tissue that undergoes remodeling, which include fibroblasts, epithelial and
endothelial cells [54, 76]. Once activated, MMPs initiates ECM remodeling primarily by cleavage
of ECM components to modulate composition and structure, but can also release any biological
molecules (i.e. growth factors) bound to ECM components [54]. Several studies investigating the
phenotypes of MMP-null mice have deduced that MMPs are not only important for regulation of
physiological processes including wound healing, ovulation, implantation, angiogenesis, and
embryogenesis via remodeling of the ECM architecture, but also are capable of regulating cellular
Chapter 1: Introduction and Literature Review
13
behaviour – such as promoting cellular migration and increasing permeability between cell-cell
junctions [77-80]. For instance, MMPs can promote angiogenesis by degrading the vascular BM
to allow ECs to invade the surrounding tissue, releasing ECM-bound angiogenic growth factors
like VEGF, and by cleaving cell-cell adhesion molecules between ECs [79]. Interestingly,
activated leukocytes infiltrating reproductive tissues also produce several MMPs and TIMPs,
supporting the role of MMPs in regulating inflammation and reproductive function [10].
As previously mentioned, since MMPs are involved in a variety of physiological
processes, their expression must be highly regulated to maintain tissue-specific activity. MMP
synthesis and activation can be regulated for both tissue-specific remodeling (i.e. isolated wound
healing) and differential expression of specific MMPs can be required for certain functions (i.e.
MMP-9 is essential for embryo implantation) [71, 74, 81, 82]. Conversely, failure to maintain
MMP homeostasis leads to excess MMP activity and uncontrolled proteolysis, which has been
associated with impaired barrier function and several diseases – autoimmune, cardiovascular
diseases, and cancer [83]. As MMPs are synthesized and secreted as zymogens, physiological
activation becomes a checkpoint for their regulation. Plasmin, urokinase type plasminogen
activator (uPA) and tissue type plasminogen activator (tPA) have been previously implicated in
MMP activation [84]. Pro-inflammatory cytokines IL-1β and TNF-α have been shown to induce
MMP expression in numerous tissues, while progesterone and TGF-β can suppress MMP
expression [71, 85]. As was previously mentioned, the principal method of MMP regulation is
physical inhibition by TIMPs or inactivation through proteolytic degradation (by other proteases),
and/or physical clearance by α2-macroglobulin [74, 77, 81]. Furthermore, TGF-β has been shown
to induce TIMP-1 production by endometrial stromal cells to further inhibit MMP activity [71,
86]. Graham et al. have also demonstrated that TGF-β regulates MMP expression in first trimester
Chapter 1: Introduction and Literature Review
14
trophoblasts by up-regulating TIMP-1 and TIMP-2 and down-regulating plasminogen activator
expression [87].
1.4.1.1 Collagenases
One of the major class of MMPs is the collagenases, named based on their preference to
enzymatically process fibrillar collagens for collagenolysis. This class is comprised of MMP-1
(fibroblast collagenase), MMP-8 (neutrophil collagenase) and MMP-13 (collagenase-3). The
collagenases share a similar structural organization of their domains that contains a pro-peptide
domain at the N-terminus, catalytic domain, a linking hinge region, and a hemopexin-like domain
at the C-terminus [76, 80]. For collagenases, the hinge region coordinates the interaction between
the catalytic region and the hemopexin-like domain [88]. This interaction is important for
substrate recognition and positioning, necessary for their primary physiological role in remodeling
of the collagenous components of the ECM [49, 89]. Interestingly, collagenases are able to cleave
collagen molecules without unwinding the triple helical structure of their substrate.
Although they can cleave all fibrillar collagens, MMP-1 preferentially targets type III
collagen, MMP-8 prefers type I collagen, and MMP-13 prefers type II collagen [76]. Furthermore,
besides efficient degradation of collagens, the collagenases also cleave a wide variety of non-
collagenous substrates, such as aggrecan, chemokines, and IGFs [76, 90]. The collagenases have
been previously shown to regulate reproductive function. Specifically, MMP-1 has been
associated with the breakdown of the stromal components of the uterine endometrial lining during
menstruation [30]. In addition, since collagen I makes up a large portion of the uterine ECM it
was suggested that collagenases may play a role in remodeling of uterine tissues during gestation
to accommodate the growing fetus [35]. It is also feasible to speculate that collagenases may
Chapter 1: Introduction and Literature Review
15
become important participants during the PP uterine involution when this organ undergoes
extensive remodeling to return to its pre-pregnant state [91].
1.4.1.2 Gelatinases
The gelatinases encompass MMP-2 (gelatinase A) and MMP-9 (gelatinase B), and are
defined as such based on their affinity for denatured collagen (i.e. gelatin) [76]. What makes the
gelatinases structurally different from the collagenases is the additional presence of a collagen
binding domain (CBD), comprised of three type II fibronectin-like repeating elements inserted
into the catalytic domain [80, 81, 92]. The CBD is the main domain for substrate recognition for
MMP-2, and is essential for specific binding and positioning of substrates to the catalytic site for
both gelatinases [76, 93, 94]. The mechanism of MMP-2 activation has been defined in detail,
where one proposed model involves the interaction with TIMP-2 and the membrane-bound MT1-
MMP (MMP-14) for removal of the pro-peptide [95, 96]. On the other hand, removal of the pro-
peptide for MMP-9 activation can be exerted by several soluble MMPs, such as MMP-2, 3 & 7
and other proteases [94, 97].
Apart from gelatin degradation, the gelatinases also have an affinity for components of the
BM, intercellular gap junctions (i.e. occludin), cytokines (i.e. IL-1β), growth factors (i.e. pro-
TNFα) and ECM receptors (i.e. integrins) [66, 76, 78, 81, 98]. The expression of MMP-2&9 has
been highly associated with reproductive tissues, during ovulation and implantation, making them
key players in maintaining reproductive function as well as tissue remodeling within reproductive
organs [30, 71, 99, 100]. Their affinity for denatured collagen and degradation of ECM
components also supports their role in PP involution.
Chapter 1: Introduction and Literature Review
16
1.4.1.3 Stromelysins
This class comprises of the three stromelysins MMP-3 (stromelysin-1), MMP-10
(stromelysin-2) and MMP-11 (stromelysin-3), all of which are capable of degrading a wide range
of ECM proteins including gelatin, fibronectin, and BM component laminin, with the exception
of collagen I [76, 101, 102]. The stromelysins, however, can cleave other collagens (with varying
affinities) such as components of the BM (i.e. collagen type IV), and MMP-3 can efficiently
activate other pro-MMPs, such as pro-MMP-1 [69, 76, 102]. The stromelysins also play a role in
the activation or inactivation of non-ECM proteins such as cytokines (i.e. TNF-α precursor and
IL-1β) and growth factors (i.e. EGF) [76].
MMP-3 & 10 are structurally similar and contain a pro-peptide domain, a catalytic domain,
and a C-terminal hemopexin-like domain responsible for substrate recognition. These two
stromelysins share substrate specificity; however, MMP-3 has a higher affinity and proteolytic
efficiency than MMP-10 [30, 69, 76, 80]. Whereas MMP-11 is structurally different, containing
a motif for intracellular activation by furin (and other furin-like proteases) within the Golgi and
is secreted extracellularly in its active form [76, 103]. Importantly, all stromelysins, especially
MMP-3 &11 have been shown to be highly associated with reproductive tissues such as the uterus
(during menstruation, implantation, pregnancy, labour and PP), placenta and involuting mammary
gland [30, 76].
1.4.1.4 Stromelysin subgroup: Matrilysin and Metalloelastase
MMP-7 (matrilysin) and MMP-12 (macrophage metalloelastase) are two MMPs often
classified in the stromelysin subgroup as they share similarities with MMP-11. MMP-7 was first
described as putative uterine metalloprotease-1 (PUMP-1) but now is generally referred to as
matrilysin. MMP-7 structurally is the smallest MMP as it only contains the pro-peptide and
Chapter 1: Introduction and Literature Review
17
catalytic domain, while MMP-12 contains the additional hinge region and hemopexin domain (for
substrate binding and recognition) [76]. Like the stromelysins, MMP-7&12 can cleave a wide
variety of ECM substrates such as collagen I&IV, gelatin, elastin, fibronectin and laminin, and
have an affinity towards non-ECM proteins like cytokines (i.e. pro-TNF-α) and able to activate
other pro-MMPs [69, 76, 78]. In addition, MMP-7 can also cleave cell-surface junctional
molecules (i.e. VE-cadherin) to modulate tissue permeability [104, 105].
The broad range of substrates supports the notion that MMP-7&12’s main biological
function is to remodel the ECM, regulate immune function and promote immune cell recruitment
and migration [30, 76, 78]. MMP-7 is expressed in a variety of tissues and has been seen to be
associated with reproductive tissues, especially in the uterus during the menstrual cycle,
implantation, labour and PP period [30, 99, 106]. MMP-12 is essential for leukocyte
transmigration into tissues, where knock-out of MMP-12 expression led to restricted macrophage
infiltration [78]. These correlations suggest that MMP-7&12 may play a role in regulating tissue
remodeling and inflammation within the uterus.
1.4.1.5 Regulation of MMP activity: TIMPs
The TIMPs (TIMP-1-4) are one of the endogenous forms of MMP broad spectrum
regulation/inhibition factors that bind to MMPs in a 1:1 stoichiometric configuration, and like
MMPs, are regulated in response to the need for tissue remodeling [69, 107, 108]. TIMPs are
structurally comprised of two domains, the N- and C-terminus; the N-terminal domain can fold
into a separate unit and independently inhibit MMPs [107, 108]. TIMPs normally form complexes
with pro-MMPs via the interactions of their C-terminal domains with the MMP’s hemopexin
domain, and since this does not involve the N-terminal domain, these complexes can further
interact with a second MMP [108]. Although the four TIMPs share sequential similarities, their
Chapter 1: Introduction and Literature Review
18
differences confer specificity such that certain TIMPs have higher affinities for certain MMPs,
which affects their biological function [69, 107, 108]. For instance, TIMP-1 has a more restricted
inhibitory range compared to TIMP-2-4, particularly for membrane-type (MT) MMPs, but
strongly inhibits MMP-3&7 [108, 109]. TIMP-2 plays an important role in the recruitment and
cell-surface activation of pro-MMP-2 via MT1-MMP, while TIMP-1 cannot bind to pro-MMP-2,
but instead can form an inhibitory complex with MMP-3 or pro and active MMP-9 [95, 110, 111].
TIMP-4 can also form a complex with MT1-MMP and pro-MMP-2 however, this does not lead
to its activation but rather inhibits the action of MT1-MMP [112]. Interestingly, TIMP-2 and pro-
MMP-2 can form a large inhibitor of MMP (LIMP) complex that can additionally inhibit MMP-
2, the collagenases, and stromelysins [113]. Unlike the other TIMPs that are primarily soluble and
remain diffused within tissues, TIMP-3 is also tightly bound to the ECM through its C-terminal
domain [109].
In addition to MMP inhibition or activation, TIMPs can have various other biological
functions including regulation of cell proliferation and migration, and be involved in angiogenic
and apoptotic pathways. For example, TIMP-3 has been observed to have pro-apoptotic functions
whereas, TIMP-1, 2&4 are anti-apoptotic [69, 109, 114-117]. TIMP regulation of cell signaling
to promote the aforementioned processes can be either MMP-dependent, such as TIMP-1
inhibition of MMP-mediated degradation of IGF binding protein-3 (IGFBP-3), or can be through
direct interactions with specific cell-surface receptors (i.e. CD63) or cell-surface integrins (i.e. α3
and β1 subunits) [109, 118]. However, it has been shown that TIMPs can either promote cell
growth and survival, inhibit cell death or cell growth depending on the cell types and downstream
effectors involved [109].
Chapter 1: Introduction and Literature Review
19
1.4.2 Matrix Metalloproteinases as immunoregulatory proteases
1.4.2.1 MMPs as modulators of inflammation
The involvement of MMPs in inflammatory processes has suggested their potential role
to modulate leukocyte influx into inflamed tissues. For instance, in a mouse model for
autoimmune skin blistering disease, MMP-9-null mice exhibited decreased neutrophil recruitment
due to the lack of α1-proteinase inhibitor inactivation by MMP-9, which results in deficiency of
neutrophil elastase (NE) function [119]. MMPs can also regulate the activity of cytokines and
chemokines, and the formation of chemotactic gradients to affect the movement of leukocytes by
being either pro-inflammatory – by activation of IL-1β and TNF-α – or anti-inflammatory –
MMP-3 can degrade active IL-1β [120-123]. Several studies have shown that specific MMPs
regulate chemotactic gradients by direct cleavage of chemokines or indirectly by cleaving
ECM/non-ECM molecules that bind to chemokines at certain locations. For instance, Li et al.
have observed MMP-7 is able to regulate the trans-epithelial efflux of neutrophils by shedding
syndecan-1 bound to chemokine CXCL1 (KC) in the lung [124]. MMP-2-mediated cleavage of
macrophage-derived CCL7 (MCP-3) leads to the formation of antagonistic peptides of the CC
chemokine receptor [122]. MMP-9 and MMP-8 can cleave and activate CXCL8 (IL-8) and LIX
(mouse equivalent of human CXCL5&6), respectively. However, proteolytic processing by
MMP-9 inactivates CXCL1 and CXCL4. This provides evidence that MMPs can both amplify or
reduce inflammatory signals, specifically affecting leukocyte recruitment by mediating the
change in the bioavailability of local chemokines [125-128]. Processing/activating of these
inflammatory mediators suggest that in addition to tissue remodeling, MMPs are involved in the
labour process by regulating leukocyte infiltration into the uterus.
Leukocytes can follow two pathways of migration: 1) transcellular (through the
cytoplasm) or 2) paracellular (in between ECs) [129, 130]. Several studies have indicated
Chapter 1: Introduction and Literature Review
20
leukocyte infiltration into tissues is associated with regulated modifications to increase junctional
permeability while preserving endothelial barrier function [131, 132]. Specifically ECs can
experience delocalization and decreased expression of their cellular junction molecules or
proteolytic degradation of those complexes to disrupt and loosen the tight junctions [132-134]. It
has been previously shown that leukocyte adhesion initiated intracellular signalling pathways to
enhance permeability to promote migration [134, 135]. Deem et al. revealed that lymphocyte-
mediated VCAM-1 crosslinking activates downstream production of NADPH oxidase and
reactive oxygen species (ROS). ROS then mediates the activation of EC-associated MMPs to
enable leukocyte migration; inhibition of endothelial MMPs block VCAM-1-dependent migration
[135]. MMPs are suggested to modulate leukocyte migration by regulating the permeability of
cell barriers. Specifically, the activity of gelatinases (MMP-2&9), are known to be responsible for
the degradation of intercellular junction proteins (i.e. occludin and VE-cadherin), leading to an
increase in microvascular permeability [78, 136, 137].
1.4.2.2 MMPs as modulators of pregnancy and labour
It has been well-established that MMPs are important modulators of ovulation (MMP-1),
implantation of the fertilized embryo (gelatinases), and decidualization and trophoblastic invasion
during early pregnancy [30, 82, 106, 138]. It has been hypothesized that late gestational changes,
labour, and parturition are associated with increased expression and activation of MMPs, which
would result in relaxation of uterine muscle, inhibit myometrial contraction, and/or promote tissue
remodeling during PP period [139]. Yin et al. reported an increase in gelatinase gene expression
but a decrease in MMP-7 in pregnant rat myometrium strips collected at mid- and late gestation,
and these findings were augmented in response to prolonged mechanical stretch. These authors
suggested that these changes in MMP expression inhibit contraction and induce uterine relaxation
Chapter 1: Introduction and Literature Review
21
in response to mechanical stretch imposed by the growing fetus during pregnancy [139]. Roh et
al. observed that the release of pro-inflammatory cytokines (IL-1 and TNF-) by activated
macrophages and neutrophils induced the production of MMP-9 by myometrial SMCs prior to
TL, suggesting a link between MMP expression and labour-associated inflammation [31]. As
previously mentioned, MMP-9 is capable of cleaving 1) degraded collagen in the extracellular
matrix, 2) endothelial tight junctions, and 3) activating non-matrix proteins such as IL-1β and IL-
8 [31, 78].
PTL in humans has been linked to ECM degradation, caused by imbalance between MMPs
and their TIMPs. Tency et al. reported that during PTL, there was an increase in the ratio of MMP-
9:TIMP-1 and MMP-2:TIMP-2, favouring gelatin degradation [57]. Xu et al. also observed an
increase in MMP-9 in fetal membranes (FM) and human placental (PL) tissue during TL and PTL,
supporting their importance in facilitating rupture of FM and PL detachment by degrading
components of the uterine ECM [58]. MMP-3, capable of activating latent forms of other MMPs
(specifically MMP-2), was also significantly increased in the amniotic fluid at TL and PTL
(associated with amniotic infection) [125]. MMPs may be important for the amplification of
inflammatory signals in uterine tissues before and during TL and PTL; targeting premature MMP
activation can be insightful in treating premature delivery. Importantly, through the use of a mouse
model of inflammation-induced PTL, Koscica et al. reported that the administration of a broad
spectrum MMP inhibitor (GM6001) resulted in reduction of the rate of PTL, suggesting a direct
involvement of MMPs in regulating the labouring process [140].
Chapter 1: Introduction and Literature Review
22
1.5 Thesis Rationale and Hypothesis
Current PTL therapeutic strategies primarily focus on inhibiting myometrial contractions
(i.e. tocolytic drugs), but have been found to ineffectively delay labour onset in the majority of
women. Particularly due to these therapies targeting later stages of the labour cascade – when
irreversible changes in the reproductive tissues have already occurred [141, 142]. Research aiming
to characterize the exact mechanisms underlying the onset of TL will assist in understanding
whether similar changes occur during PTL. Dr. Lye and colleagues have suggested a new model
for labour initiation where mechanical stretch of the uterine tissues by the growing fetus increases
myometrial cytokine/chemokine expression which 1) upregulates cell adhesion molecules on
endothelial cells; 2) activates peripheral leukocytes and induces their infiltration into the
myometrium. Here, leukocytes contribute to labour initiation by inducing myometrial contractility
and play a role in decidual activation – by promoting synthesis of prostaglandins [17, 64].
Prostaglandins (i.e. PGF2α) not only stimulate myometrial contractions, they can also induce
gelatinolytic activity by increasing MMP and down-regulating TIMP expression, and modulate
the secretion of pro-inflammatory cytokines and chemokines [51, 143, 144].
The increasingly recognized role of MMPs as activators and regulators of inflammatory
pathways suggests their potential involvement in remodeling of reproductive tissue (i.e.
myometrium). My research 1) characterized the myometrial expression of MMPs and TIMPs
during pregnancy, labour and postpartum, 2) to define putative mechanisms that regulate their
expression and/or activity, and the contribution of MMPs to inflammatory pathways within this
tissue.
I hypothesized that throughout gestation, there is an increase in myometrial MMP and a
decrease in TIMP expression /activity in preparation for two major events: 1) labour contractions
Chapter 1: Introduction and Literature Review
23
to expel the fetus and 2) subsequent uterine remodeling during PP involution. I also speculate that
mechanical stretch of the uterine walls by the growing fetus can regulate the expression and
activity of myometrial MMPs and TIMPs.
1.6 Specific Aims and Objectives
1.6.1 Aim 1: To characterize the expression pattern of myometrial MMPs and TIMPs throughout
pregnancy, labour and postpartum.
Due to a lack of pregnant human uterine tissue, I aimed to characterize the gene/protein
expression of certain MMPs/TIMPs in vivo using an animal (rat) model of gestation and term
labour. It was hypothesized that the gene and protein expression/activity would increase towards
late gestation and culminate during the early postpartum period. It is speculated that in addition
to myometrial smooth muscle cells, infiltrating leukocytes would also be the source of MMP
expression. To test this, myometrial tissues were collected from pregnant (gestational day (GD)
6, 8, 10, 12, 14, 15, 17, 19, 21, 22), labouring (GD23) and postpartum (1PP and 4PP) rats. Real-
Time Polymerase Chain Reaction (RT-PCR) was used to quantify changes in MMP gene
expression; Western blot analysis was used to validate and quantify protein expression. This study
specifically focused on studying the collagenases (MMP-1, 8, 13), gelatinases (MMP-2, 9),
stromelysins (MMP-3, 10, 11), matrilysin (MMP-7), metalloelastase (MMP-12) and TIMP-1, 2,
3, and 4 mRNA expression. For protein analysis, focus was placed on 1) the expression of MMP-
8 which preferentially cleaves collagen I, a major component of the uterine interstitial ECM; 2)
MMP-7 known to be active in rat uterine tissue during TL and PP; 3) the major stromelysins
MMP-3 and MMP-11; and 4) MMP-12 known to be highly expressed by macrophages [31, 78,
145, 146]. The activity of MMP-2 and -9 throughout gestation was also studied by gelatin
Chapter 1: Introduction and Literature Review
24
zymography and temporal/spatial localization of MMPs in rat myometrial tissue was studied using
immunohistochemistry, in situ zymography, and immunofluorescence of leukocyte-specific
markers.
1.6.2 Investigate the in vivo regulation of MMP and TIMP expression by mechanical stretch.
Previous reports have suggested that mechanical stretch can influence gene/protein
expression of MMPs and TIMPs in other tissues [147, 148]. It has been previously shown by
colleagues in the Lye laboratory using a unilaterally pregnant rat model, that the gravid (pregnant)
uterine horn experiences greater changes (across gestation) in the expression of ECM components
compared to the non-gravid (empty) horn [35]. It is hypothesized that mechanical stretch from the
growing fetus upregulates the expression of myometrial MMPs compared to the empty horn.
Analysis of this well-established rat model, may reveal differences in the expression and activity
of major MMPs in the gravid and empty uterine horns in comparison with normal bilaterally
pregnant rats. Myometrial tissues were collected from GD 6, 12, 15, 17, 19, 21, 22, labouring
(GD23) and 1 day PP rats. Similar to Aim 1, RT-qPCR was used to quantify changes in MMP
gene expression, Western blot and gelatin zymography was used to validate and quantify protein
expression and activity. These experiments provide insight on the regulation of MMP expression
by in vivo biological mechanical stretch from the growing fetus.
1.6.3 Investigate the in vitro regulation of MMP and TIMP expression by mechanical stretch.
Although the in vivo unilaterally pregnant rat model provides insight on the regulation of
myometrial MMP expression, it does not provide confirmation whether mechanical stretch
directly regulates MMP expression. To investigate the sole effect of mechanical stretch – without
Chapter 1: Introduction and Literature Review
25
other potential regulatory factors such as signals from the fetus and placenta – an in vitro cell
model will be studied. It was recently shown by Lee et al. that media collected from stretched
myometrial cell line hTERT-HM 1) showed an increase in multiple pro-inflammatory cytokines
and chemokines, and 2) promoted an increase in permeability of human endothelial cells in culture
[17]. In addition, Loudon et al. observed that mechanical stretch of primary human myometrial
cells increased mRNA and protein levels of CXCL8 [149]. However, the role of MMPs was not
considered in these studies. It is hypothesized that applying static mechanical stretch would
simulate the stretch of the growing fetus and upregulate the expression of MMPs by myometrial
SMCs. To investigate the direct effect of static mechanical stretch on the synthesis and secretion
of MMPs/TIMPs in vitro, two different approaches were employed.
First, primary rat myocytes were enzymatically isolated from the uterine tissues. These
myocytes were mechanically stretched using a computer-driven in vitro stretch system (FX-5000,
Flexcell Int). Total RNA and protein were extracted from these cells and stretch-conditioned
media (SCM) or media conditioned by the non-stretched cells (NCM) were collected to compare
the gene/protein expression level of MMPs, TIMPs using RT-PCR and gelatin zymography
analysis, correspondingly. However, results from this in vitro model were inconclusive.
Secondly, primary human myometrial cells were enzymatically isolated and mechanically
stretched for 24 hours using the FX-5000 stretch system, and the expression of MMPs (both
mRNA and protein) as well as NCM/SCM were analyzed. Using human myometrial cells
produced from tissue biopsies instead of primary rat myometrial cells will better correlate the
findings from our animal studies for future human applications.
26
CHAPTER 2
MATERIALS AND METHODS
Chapter 2: Materials and Methods
27
2.1 INTRODUCTION
This chapter describes the materials and detailed methodologies used for the thesis
experiments. The buffers that were used such as phosphate buffered saline (PBS) and Hank’s
buffered salt solution (HBSS), were prepared and autoclaved in-house by the sterilization and
Media Prep department at the Lunenfeld-Tanenbaum Research Institute (LTRI) unless otherwise
specified.
2.2 RAT GESTATIONAL PROFILE OF MMP EXPRESSION
2.2.1 Bilaterally Pregnant Rat Animal Model of Gestation
The in vivo myometrial mRNA gestational expression profile of MMPs and TIMPs was
investigated using a bilaterally pregnant rat model of gestation, term labour (TL) and postpartum
(PP). Virgin female Wistar rats (12-15 weeks, 225-250g weight) and male Wistar rats (250-300g
weight) were purchased from Charles River Laboratories (St. Constance, QC, Canada) and housed
in the MaRS Toronto Medical Discovery Tower Animal Research Facility (Toronto, ON,
Canada). The research ethics board approved these animal studies (AUP #2379). Rats were
maintained on standard rat chow and water in a 12:12 hour light-dark cycle. The rats were mated
and the day when a vaginal plug was detected was considered day 1 of gestation. Animals were
euthanized by carbon dioxide inhalation and uterine samples were collected on gestational day
(GD) 6, 8, 10, 12, 14, 15, 17, 19, 21, 22, 23 (TL), 1 day PP and 4 day PP.
Chapter 2: Materials and Methods
28
2.2.2 Unilaterally Pregnant Rat Model of Gestation
The in vivo effect of mechanical stretch from the growing fetuses was investigated using
a unilateral horn pregnancy model. Virgin female Wistar rats were anesthetized and tubal ligation
was performed through a flank incision. This ensured that the animals would become pregnant in
only one uterine horn [150]. Prior to mating, animals were allowed to recover from surgery for at
least 7 days. Uterine tissues from the gravid and empty horns were collected separately on GD 6,
12, 15, 19, 21, 23L, and 1PP.
2.2.3 Tissue Collection and Preparation
Whole uteri were excised from the pregnant rats, and fat and blood vessels were carefully
removed.
For biochemical studies: Placentae and pups were removed from the pregnant uteri, the
myometrium was separated from the decidua basalis and decidua parietalis (endometrium) by
mechanical scraping on ice which we have previously shown removes the entire luminal
epithelium and the majority of the uterine stroma [151]. Tissue was rinsed in ice-cold PBS
(Sigma-Aldrich Canada Co., Oakville, ON, Canada) and flash frozen in liquid nitrogen.
For immunohistochemical, immunofluorescence and in situ zymography analysis: The intact
uterine horns were placed in ice-cold PBS, cut into 3-10-mm segments using a scalpel blade and
fixed immediately in 10% neutral-buffered formalin (NBF, VWR International, Mississauga, ON,
Canada) solution at 4˚C for 24 hours or overnight in zinc buffered fixative (ZBF; 100mM Tris
buffer pH 7.4, 3mM calcium acetate, 27mM zinc acetate, 37mM zinc chloride; see Table 2.2
[14;17]) while shaking at RT. Following fixation, the whole uteri were rinsed with PBS overnight.
NBF-fixed tissue were dehydrated in 70%, 80%, 90%, 95%, 100% ethanol series for 30 minutes
Chapter 2: Materials and Methods
29
each, cleared in xylene three times for 15 minutes, heated in paraffin wax three times for 30
minutes and embedded into paraffin blocks. ZBF-fixed tissue were dehydrated in 70%, 80%, 90%
and 100% (twice) ethanol baths for one hour each, cleared in xylene three times for 15 minutes,
heated in paraffin wax three times for 30 minutes and embedded into paraffin blocks.
2.2.4 Real-Time Polymerase Chain Reaction (RT-PCR) Analysis of mRNA expression
The frozen myometrium was homogenized using the TissueLyser II (Qiagen Inc.,
Mississauga, ON, Canada) to isolate total RNA using Qiagen RNeasy Universal Mini kit (Qiagen
Inc.). Total myometrial RNA was reverse transcribed using the iScript supermix (Bio-Rad
Laboratories (Canada) Ltd., Mississauga, ON, Canada) to cDNA (1µg of RNA in 20µL reaction).
A primer mastermix (2.5µL of Sigma Scientific SYBR green, 1µL of RNase-free water, and
0.5µL of 3µM forward and reverse primers) was combined with 1µL of the 5 ng/µL cDNA
product for a final volume of 5 µL per well in a 384-well PCR plate. The plate was then subjected
to Real-Time PCR using the CFX384 system (Bio-Rad). Transcript levels of collagenases (MMP-
1, 8, 13), gelatinases (MMP-2, 9), stromelysins (MMP-3, 10, 11), matrilysin (MMP-7),
metalloelastase (MMP-12) and TIMP-1, 2, 3, 4 were examined using set of specific primers
designed using free NCBI Primer Blast software and produced by Eurofins Genomics (Eurofins
MWG Operon LLC, Huntsville, AL, USA), (see Table 2.1).
Chapter 2: Materials and Methods
30
Table 2.1 Primer pair information for Rat (Rattus Norvegicus) genes examined using RT-PCR
† Genes excluded from statistical analysis; either not detected or n < 4 after exclusion.
Abbreviation Name Accession
Number Primers (5’-3’)
Amplicon Size
(base pairs)
MMP-1† Interstitial /Fibroblast
Collagenase NM_001134530.1
F: ACGCAGATTTAGCCTCCGAA
R: TGACTTGGTAATGGGTTGCC 97
MMP-8 Neutrophil Collagenase NM_022221.1
F: GGAGTGTGCCATCAACCCTGACC
R:
ACCATGGTCTCTTGAGACGAAAGCA
86
MMP-13 Collagenase 3 NM_133530.1 F: GGCTTAGATGTGACTGGCAAA R: CATTTGAGTGTTCGAGGGAAA
113
MMP-2 Gelatinase A NM_031054.2 F: TGGCGGACAGTGACACCACG
R: TGGGGCCTCGTACACGGCAT 105
MMP-9 Gelatinase B NM_031055.1 F: TTCTCTGGGCGCAAAATGTGGGT
R: ACGCGGGAGAAGTCCGGTGA 114
MMP-3 Stromelysin 1 NM_133523.3 F: AGATCCATGGAAGGCGTCGTGT R: AGGAAACCACTTCAGTGCGCCA
136
MMP-10 Stromelysin 2 NM_133514.1 F: TGCTGCTGTGCTTTCCGAT
R: AGCAAGATCCATGGTTGAGTGG 80
MMP-11 Stromelysin 3 NM_012980.2 F: TGCTGCTTTCCAGGATGCTGAGG
R: AAGTCGGGACCTATGGGTCGAGG 120
MMP-7 Matrilysin (PUMP-1) NM_012864.2 F: CCTGTTCCGCATTGTGTGTC R: TAATTCTGCGCCTGTTCCCA
102
MMP-12 Macrophage Metalloelastase NM_053963.2 F: TCTCTGGGCTTCCCTGCATCTGT
R: TCCTGCCTCACATCGTACCTCCA 116
TIMP-1 Tissue Inhibitor of
Metalloproteinase 1 NM_053819.1
F: CTGCCTGCAGCTTCCTGGTTCC
R: AGGGAAACACTGTGCACACCCCA 105
TIMP-2 Tissue Inhibitor of
Metalloproteinase 2 NM_021989.2
F: AGATCACACGCTGCCCTATG
R: TGGTGCCCATTGATGCTCTT 97
TIMP-3 Tissue Inhibitor of
Metalloproteinase 3 NM_012886.2
F: TGCTGACAGGGCGCGTGTATGA
R: CCTTGCGCTGGGACAGTGTGAG 93
TIMP-4 Tissue Inhibitor of
Metalloproteinase 4 NM_ 001109393.1
F: TTGCTATGCAGTGCCGTGTA
R: TGGGCCTGGTACCCATAGAG 93
IGF1R Insulin-like Growth Factor 1
Receptor NM_000875.4
F: GCATCTGATCATTGCTCTGC
R: GCCCAATCTGCTGTTATTCC 103
PPIA Peptidylprolyl Isomerase A
(Cyclophilin A) NM_017101.1
F: TATCTGCACTGCCAAGACTGA
R: CCACAATGCTCATGCCTTCTTTCA 80
PDGF-A Platelet-derived Growth Factor
Alpha NM_012801.1
F: AGCGACTGGCTCGAAGTC
R: CTCCAAGGCATCCTCAGC 89
TBP TATA Box-Binding Protein NM_0001004198 F: AGAACAATCCAGACTAGCAGCA
R: GGGAACTTCACATCACAGCTC 120
Chapter 2: Materials and Methods
31
Following RT-qPCR, a dissociation curve was constructed by increasing temperature from
65°C to 95°C for detection of PCR product specificity. In addition, a no-template control (H2O
instead of cDNA) was analyzed for possible contamination in the master-mix. A cycle threshold
(Ct) value was recorded for each sample. The Ct value is defined as the number of amplification
cycles required for detection of a fluorescent signal (SYBR green) that exceeds background levels.
Ct values are inversely proportional to mRNA levels within each sample. PCR reactions were set
up in technical triplicates and the mean of the 3 Ct values was calculated by the software (CFX
Manager, Bio-Rad). A comparative Ct method (∆∆Ct method) was applied to the raw Ct values
to find a relative gene expression. The expression levels of MMPs and TIMPs were normalized
to the geometric mean of three housekeeping genes for bilaterally pregnant rat samples:
cyclophilin/peptidylprolyl isomerase A (PPIA), platelet-derived growth factor alpha (PDGF-A),
and TATA box-binding protein (TBP). For unilaterally pregnant animals’ MMP and TIMP gene
expression was normalized to the three housekeeping genes PPIA, PDGF-A and insulin-like
growth factor 1 receptor (IGFR1). All housekeeping genes used exhibited stable mRNA levels
throughout gestation. Results were displayed as fold-change relative to GD6 (bilaterally pregnant
rats) or relative to a corresponding GD6 in the empty horn (unilaterally pregnant rats) within each
experimental run.
2.2.5. Gelatin Zymography and Western Blot Analysis of Protein Expression
Total protein was extracted from frozen myometrial tissue homogenized using a bicine
salt lysis buffer. The homogenate was centrifuged at 20,800 g for 15 minutes at 4⁰C. The
supernatant was collected and protein concentration was determined using a Pierce BCA protein
assay kit (Thermo Fisher Scientific Inc., Waltham, MA, USA). For Western blot analysis of
Chapter 2: Materials and Methods
32
MMP-8, MMP-7, MMP-3, and MMP-11 protein expression, 30 µg (for MMP-8 analysis) or 70
µg of total protein (for MMP-7, 3 & 11 analysis) were added to sample buffer (NuPAGE LDS 4x
Sample Buffer, Novex) with β-merceptoethanol solution (Sigma-Aldrich) and heated for 10
minutes at 95⁰C. The protein was then loaded on 12% bis-acrylamide electrophoresis gels and ran
for 2 hours at 100V at room temperature with 1x Tris-Glycine SDS running buffer diluted from
the 10x stock (Wisent Inc., St-Bruno, QC, Canada). Following gel electrophoresis, proteins were
transferred onto PVDF membranes (0.2 µm Trans-Blot® Turbo™ Midi PVDF Transfer Packs
(Bio-Rad), using the Trans-Blot® Turbo™ Transfer System (Bio-Rad). Membranes were quickly
washed with TBS-T, blocked in 5% non-fat milk for 1 hour at room temperature, and incubated
with primary antibodies (Table 2.2) overnight at 4⁰C with gentle shaking. Next, membranes were
washed 3 times 5 minutes in TBS-T prior to incubation with HRP-biotinylated secondary antibody
(Table 2.2) for 1 hour with gentle shaking at room temperature. Membranes were washed 3 times
for 5 minutes in TBS-T and then developed with Luminata Crescendo Western HRP substrate
(Millipore (Canada) Ltd., Etobicoke, ON, Canada) or SuperSignal West Femto Chemiluminescent
Substrate (Thermo Fisher Scientific Inc.), depending on the intensity of the signal. Images were
taken using the VersaDoc™ Imaging System (Bio-Rad) and analysed using Image Lab software
(Bio-Rad). Protein expression levels were normalized to the calcium-binding protein calponin
used as the housekeeping protein, and expressed relative to GD6.
Chapter 2: Materials and Methods
33
Table 2.2 Information of antibodies used for Rat-specific experiments.
Western Blot (WB), Immunohistochemistry (IHC), Immunofluorescence (IF)
For analysis of enzymatic gelatinase activity, gelatin zymography was applied: 50 µg of
total protein from myometrial tissue homogenates were added to sample buffer (1:2, Novex, Life
Technologies Inc., Burlington, ON, Canada) prior to loading onto Novex pre-cast 12% tris-
glycine gelatin gels (Novex, Life Technologies Inc.). Gel electrophoresis was run for
approximately 4 hours at 110V at 4⁰C (to prevent denaturation of gelatinases) with 1x Novex
Tris-Glycine SDS running buffer (Life Technologies Inc.) using the Novex X-Cell II Mini Cell
system (Life Technologies Inc.). Following electrophoresis, gels were incubated for 30 minutes
in 1x renaturing buffer (Novex) to remove SDS and renature the gelatinases and then for 30
minutes in 1x developing buffer (Novex) with gentle shaking at room temperature. Next gels were
incubated in developing buffer overnight at 37⁰C. Gels were then washed 3 times with double
Target Host Company Used for Method Antibody Type Dilution
MMP-9 Mouse Millipore IHC Primary 1:200, 1:200
MMP-8 Rabbit Abcam WB Primary 1:500
MMP-3 Rabbit Abcam WB Primary 1:500
MMP-11 Rabbit Abcam WB, IHC Primary 1:500, 1:150
MMP-7 Rabbit Abcam WB, IHC primary 1:200, 1:150
MMP-12 Rabbit Abcam WB primary 1:1000
Calponin Mouse Sigma WB Primary 1:1000
CD45 Mouse Bio Legend IF Primary 1:200
CD68 Mouse AbD Serotec IF Primary 1:200
Anti-mouse-HRP Sheep GE Healthcare WB Secondary 1:2000
Anti-rabbit-HRP Donkey GE Healthcare WB Secondary 1:2000
Anti-mouse
biotinylated
Goat Vector IHC Secondary 1:300
Anti-rabbit
biotinylated
Goat Vector IHC Secondary 1:200
Alexa 546 anti-
mouse
Donkey Life Technologies IF Secondary 1:200
Chapter 2: Materials and Methods
34
deionized water (ddH2O, Milli-Q, Millipore (Canada) Ltd.) to remove excess developing buffer
prior to staining with Simply Blue stain (Novex) for 1 hour with gentle shaking at room
temperature. Gels were rinsed with ddH2O to clearly see the contrast between the blue-stained gel
and gelatinase activity (white bands). Images were taken using the VersaDoc™ Imaging System
(Bio-Rad) and analysed using Image Lab software (Bio-Rad). Gelatinase activity levels were
calculated relative to GD6.
2.2.6 Localization of Myometrial MMPs by immunohistochemistry
Paraffin embedded formalin-fixed rat uteri were sectioned at 5 µm. Sections were baked
at 37⁰C overnight, deparaffinized and rehydrated in xylene, 100%, 95%, 80%, and 70% ethanol
baths for 5 minutes each and quenched with 3% H2O2 in methanol for 20 minutes. Slides were
washed 3 times with PBS and antigen retrieval was performed by microwaving the slides in
DAKO (Burlington, ON, Canada) Target Retrieval Solution (pH 9, diluted 1:10 in ddH2O). Slides
were first microwaved at power level 6 for 5 minutes in a closed container and then left to cool
on ice for 20 minutes. The microwaving process was repeated but at power level 6 for 3 minutes
in an open container and then cooled on ice for 15 minutes. Sections were washed three times for
5 minutes with PBS and isolated on the glass slide (Fisher Scientific, Ottawa, ON, Canada) using
a wax pen (DAKO). Additional permeabilization was performed using 0.01% Triton X-100
(Sigma-Aldrich) diluted in PBS for 10 minutes. Slides were then blocked for 20 minutes at room
temperature using protein blocking solution (DAKO, 1:1 diluted in PBS) and incubated with
primary antibody (Table 2.2) for MMP-9, MMP-7 and MMP-11 – rabbit IgG (1:200, Santa Cruz
Biotechnology, Inc., Dallas, TX, USA) was used as the negative control – diluted in a PBS
solution (1/3 DAKO antibody diluent, 2/3 PBS--) at 4⁰C overnight in a covered humidified box.
Chapter 2: Materials and Methods
35
The following day, sections were washed three times with PBS and incubated with
biotinylated secondary anti-rabbit antibody (diluted in PBS, Table 2.2) for 1 hour at room
temperature in a humidified box followed by incubation with streptavidin-HRP solution (DAKO)
for 1 hour at room temperature. Sections were then washed three times with PBS and developed
with a DAB kit (DAKO), counterstained with Gill’s No.1 Accustain® Hematoxylin (Sigma-
Aldrich), and were mounted with Surgipath Micromount® mounting media (Leica Microsystems
Inc., Concord, ON, Canada). For the assessment of staining intensity, myometrial cells from each
of the two sets of tissues were observed on the Olympus BX61 Motorized Microscope and
MicroSuite™ system (Olympus America Inc., Melville, New York, USA). A minimum of five
fields were examined for each gestational day and uterine horn for each set of tissue, and
representative tissue sections were photographed with a Olympus DP72 Microscope Digital
Camera (Olympus America Inc.).
2.2.7 Localization of Myometrial MMP expression and activity by in situ zymography
ZBF-fixed, paraffin-embedded whole uteri were sectioned at 5 µm, baked at 37⁰C for 1
hour (to adhere the sections onto glass slides), deparaffinized and rehydrated in xylene, 100%,
95%, 80%, and 70% ethanol for 5 minutes each. Sections were then incubated with fluorescent
substrates: DQ gelatin, collagen I, or collagen IV (Life Technologies Inc.) in a reaction buffer
(1/50 dilution) for 2 hours at 37⁰C in a humidified box. For a negative control (NEG) sections
were pre-incubated for 1 hour at 37⁰C with 0.02M EDTA and 0.02M EDTA + substrate for 2
hours at 37 ⁰C. Following incubation with the fluorescent substrates, sections were post-fixed in
a 4% NBF solution for 5 min, washed three times for 5 min with PBS, counterstained with DAPI
Chapter 2: Materials and Methods
36
(1:1000, Sigma-Aldrich) for 10 min, and mounted with a coverslip using Immu-Mount mounting
media (Thermo Fisher Scientific Inc.).
2.2.8 Localization of Leukocyte MMP expression and activity by in situ zymography
Immunolocalization of MMP expression by leukocytes and specifically macrophages was
defined using a mouse anti-CD45 (leukocyte common antigen) and anti-CD68 (macrophage-
specific marker) specific antibodies. Immediately following incubation with DQ gelatin, collagen
I or collagen IV fluorescent substrates and 4% NBF post-fixation for in situ zymography, sections
were blocked using a protein blocking solution (DAKO) for 1 hour at room temperature, then
incubated with primary anti-CD45 (BioLegend, San Diego, CA, USA) and anti-CD68 (AbD
Serotec, Bio-Rad, Raleigh, NC, USA) antibody overnight at 4⁰C in a humidified box. Sections
were washed three times for 5 minutes with PBS, cell nuclei were counter-stained using DAPI
(1:1000) in conjunction with the secondary antibody (donkey anti-mouse Alexa Fluor 546, Life
Technologies Inc.) for 1 hour at room temperature. Slides were washed once with PBS and
mounted with a coverslip using Immu-Mount mounting media (Thermo Fisher Scientific Inc.).
Images for regular and in situ zymography were taken using a spinning disc confocal Leica
DMI6000 B Inverted Microscope for Biomedical Research system (Leica Microsystems Inc.) and
the Volocity (Version 6.3) 3D Image Analysis software (PerkinElmer, R&D, Woodbridge, ON,
Canada).
Chapter 2: Materials and Methods
37
2.3 EFFECT OF IN VITRO MECHANICAL STRETCH ON MMP EXPRESSION
2.3.1 In vitro primary human myometrial cell model of mechanical stretch
In addition to rat primary myometrial cells I used human primary myometrial cells to
investigate the direct effect of static mechanical stretch on MMP/TIMP expression and secretion.
Tissue biopsies were acquired from term-not-in-labour women undergoing elective caesarian
section and enzymatically digested. The uterine sample was placed in HBSS++ containing 1x Pen-
Strep-AmpB (Lonza, VWR International) and 50 µg/mL of Normocin™ (InvivoGen, San Diego,
CA, USA), and brought to a biological safety cabinet. Any remaining fat and blood vessels were
carefully excised and the sample was rinsed with fresh HBSS++. The sample was then cut into
approximately 1mm x 2mm pieces, washed 3 times for 5 minutes with HBSS and 5mL of warm
enzyme mix were added, transferred to a 50mL tube (Greiner Bio-One, VWR International), and
incubated in a water bath (37⁰C) for 1 hour. Following 1 hour of enzymatic digestion, 5mL of
dissociation mix were added (to stop digestion) and the tissue solution was pipetted, passed
through a 100µm metal cell strainer, and the collected primary cells were placed on ice. The
leftover tissue was put into a clean 50mL tube and 5mL of fresh warm enzyme mix was added.
The tissue was again incubated for 1 hour in a 37⁰C water bath; the enzymatic digestion was
repeated 4 times or until all of the uterine tissue was digested.
The collected cell suspension was centrifuged for 15 minutes at 250 g at 4⁰C. The
supernatant was aspirated and the pellet was resuspended in 5mL fresh 10% FBS DMEM (with
Pen-Strep-AmpB and Normocin) and the cell suspension was passed through a 23G needle. Cells
were counted using the CASY Cell Counter and analyzer system (Roche Innovatis AG, Roche
Diagnostics, Laval, QC, Canada), plated into 10 cm diameter tissue culture dishes with 10% FBS
DMEM and left to grow in a 5% CO2, 37⁰C incubator. Cells were washed daily with HBSS-- (with
Chapter 2: Materials and Methods
38
Pen-Strep-AmpB and Normocin) and DMEM was changed. Once the plates were 90-100%
confluent, cells were harvested by trypsinization with 0.5% Trypsin-EDTA (Gibco®, Life
Technologies Inc.). Cells were collected into 15mL tubes (Greiner Bio-One, VWR International)
and centrifuged at 180 g for 5 minutes at 4⁰C to pellet the cells and the supernatant was aspirated.
Fresh warm 20% FBS DMEM were then added to resuspend the pellet and cells were passaged.
At passage 4, 200,000 cells in 3mL/well were plated onto collagen I-coated 6-well Flexcell
plates (Flexcell International Corp.) and allowed to grow until 75-80% confluency. When
confluent, cells were serum starved for 24 hours with 5mL/well of serum-free DMEM with a
insulin-transferrin-selenium-sodium pyruvate supplement (ITS-A, Life Technologies Inc.) and
subjected to a static mechanical stretch using a computer-driven in vitro stretch system (FX-5000,
Flexcell International Corp.) in a 5% CO2, 37⁰C incubator for 24 hours at 25% elongation, or
were stretched for 24 hours and then left for another 24 hours without stretch to simulate
postpartum relaxation following pregnancy (total of 48 hours). Control plates were left un-
stretched in the same incubator to provide similar environmental conditions.
2.3.2 Assessment of cell viability following in vitro static mechanical stretch
The assessment of cell viability following static stretch and/or additional 24 hours of
relaxation was employed using propidium iodide (PI) and fluorescein diacetate (FDA) staining
(Sigma-Aldrich). The principle behind this method is that FDA is taken up by live cells, and the
non-fluorescent dye is converted to the green fluorescent fluorescein metabolite. Whereas PI is a
nuclear staining dye that can pass through permeated cell membranes of dead cells and intercalates
with DNA to fluoresce red [152]. Immediately after stretch, cells were washed twice and then
stained with PI and FDA by incubating with 1mL of PBS, 500µL of FDA (20µg/mL) and 150µL
Chapter 2: Materials and Methods
39
of PI (20µg/mL) for 3 minutes at room temperature. The solution was aspirated and the flexible
membranes of the Flexcell plate containing the stained cells were carefully cut out with a blade
and immediately mounted onto a glass slide (Fisher Scientific) without mounting media. The
slides were viewed and images were taken immediately using a spinning disc confocal microscope
Leica DMI6000 B Inverted Microscope for Biomedical Research system (Leica Microsystems
Inc.) and the Volocity 3D Image Analysis software (PerkinElmer, R&D) at 100x and 200x
magnification.
2.3.3 Characterization of primary human myometrial cells by immunocytochemistry
To characterize the origin of enzymatically isolated cells, a small aliquot of the cell
suspension (~100-1000 cells) at passage 0, 1, 2, 4, 6 and 8 was plated onto sterile microscope
cover glass (22x30, Fisher Scientific) and left to attach in the 37⁰C incubator overnight. Cells
were washed twice in PBS, fixed in 4% PFA (diluted in PBS) for 20 minutes. Plates were rinsed
once for 5 minutes with PBS and stored in the 4⁰C fridge for at least 24 hours until further
processing. Next, coverslips were rinsed with fresh PBS, permeabilized with PBS-T (250µL of
Tween-20 in 500mL of PBS--) for 15 minutes, then washed with PBS and blocked in 5% FBS
blocking solution (46.5mL of PBS, 2.5mL of FBS, 1mL of donkey serum) for 30 minutes at
room temperature. Next, coverslips were transferred to a plate covered in aluminum foil,
outlined with a wax pen (DAKO), the primary antibody (diluted in blocking solution) was
applied (150-200µL per coverslip) and incubated overnight at 4⁰C (Table 2.3). Following
incubation, coverslips were washed twice with PBS-T and incubated with secondary antibody
(table 2.2) for 1 hour at room termperature in the covered plate. Coverslips were washed again
with PBS-T, incubated for 10 minutes with DAPI (1:1000 diluted in PBS--) and carefully
Chapter 2: Materials and Methods
40
mounted with Shandon Immu-Mount™ (Thermo Fisher Scientific Inc.) onto glass slides. Images
were taken using a spinning disc confocal microscope Leica DMI6000 B Inverted Microscope
for Biomedical Research system (Leica Microsystems Inc.) and the Volocity 3D Image Analysis
software (PerkinElmer, R&D) at 100x and 200x magnification.
Table 2.3 Information of antibodies used for immunocytochemistry
2.3.4 Sample collection, preparation and RT-PCR analysis of mRNA expression
Similarly as section 2.4.2, non-stretched (NSM) and stretched (SCM) conditioned media
was collected and stored at -20⁰C, total RNA was isolated using TRIzol and purified using
RNeasy MinElute Cleanup kit. Purified RNA was stored at -80⁰C or reverse transcribed to
cDNA and analyzed using RT-qPCR (see section 2.2.3). Changes in human MMPs and TIMPs
mRNA expression were examined using a specifically designed set of primers (Eurofins
Genomics, Table 2.4). Expression levels were normalized to the geometric mean of three human
housekeeping genes: cytochrome C-1 (CYC1), glyceraldehyde 3-phosphate dehydrogenase
(GAPDH), and TATA box-binding protein (TBP).
Target Host Company Antibody Type Dilution
Smooth Muscle Actin (SMA) Mouse DAKO Primary 1:50
H-Caldesmon Mouse Sigma Primary 1:50
Desmin Goat Santa Cruz Primary 1:75
Vimentin Goat Santa Cruz primary 1:50
Mouse IgG1 (negative control) Mouse DAKO Primary 1:200
Goat IgG1 (negative control) Goat Santa Cruz Primary 1:200
Alexa 488 anti-mouse Donkey Life Technologies Secondary 1:300
Alexa 546 anti-goat Donkey Life Technologies Secondary 1:200
Chapter 2: Materials and Methods
41
Table 2.4 Primer pair information for Human (Homo sapien) genes examined using RT-PCR
† Genes excluded from statistical analysis; either not detected or n < 4 after exclusion
‡ Primers designed based on human MMP primer sequences from [153]
Abbreviation Name Accession
Number Primers (5’-3’)
Amplicon Size
(base pairs)
MMP-1‡ Interstitial /Fibroblast
Collagenase NM_002421.3
F: CTGGCCACAACTGCCAAATG
R: CTGTCCCTGAACAGCCCAGTACTTA 103
MMP-8† Neutrophil Collagenase NM_002424.2 F: AAAGCCTCGCTGTGGAGTG
R: CTGTAGGTCAAGTTAGTGCGTTCC 87
MMP-13†‡ Collagenase 3 NM_002427.3 F: TGGTCCAGGAGATGAAGACC
R: TCCTCGGAGACTGGTAATGG 97
MMP-2‡ Gelatinase A NM_004530.5 F: TCTCCTGACATTGACCTTGGC
R: CAAGGTGCTGGCTGAGTAGATC 303
MMP-9†‡ Gelatinase B NM_004994.2 F: TTGACAGCGACAAGAAGTGG
R: GCCATTCACGTCGTCCTTAT 179
MMP-3‡ Stromelysin 1 NM_002422.3 F: ATTCCATGGAGCCAGGCTTTC
R: CATTTGGGTCAAACTCCAACTGTG 138
MMP-10 Stromelysin 2 NM_002425.2 F: GCCTCTACTGAGGAACCCCT
R: TGGCATCGAAGGACAAAGCA 94
MMP-11 Stromelysin 3 NM_005940.3 F: GCCGCCTCTACTGGAAGTTT
R: GCACAGCCAAGAAGTCAGG 87
MMP-7‡ Matrilysin (PUMP-1) NM_002423.3 F: CAGGAAACACGCTGGCTCAT
R: AGACTGCTACCATCCGTCCA 97
MMP-12† Macrophage Metalloelastase NM_002426.4 F: GGAGACCCAAAAGAGAACCA
R: CCACGGTAGTGACAGCATCA 97
TIMP-1 Tissue Inhibitor of
Metalloproteinase 1 NM_003254.2
F: GCTCCTCCAAGGCTCTGAAA
R: GCAGGATTCAGGCTATCTGGG 113
TIMP-2 Tissue Inhibitor of Metalloproteinase 2
NM_003255.4 F: TTCCCTCCCTCAAAGACTGA
R: CAAAGCCACCTACCTCCAAA 120
TIMP-3† Tissue Inhibitor of
Metalloproteinase 3 NM_000362.4
F: ACCTGCCTTGCTTTGTGACT
R: GGCGTAGTGTTTGGACTGGT 95
TIMP-4† Tissue Inhibitor of Metalloproteinase 4
NM_003256.3 F: TGTGGCTCTTTCCGTCTTTC
R: GACCTCTGTTTCCCTGCCTA 101
CYC1 Cytochrome C-1 NM_001916.4 F: CAGATAGCCAAGGATGTGTG
R: CATCATCAACATCTTGAGCC 93
GAPDH Glyceraldehyde
3-Phosphate Dehydrogenase NM_002046.5
F: AGATCATCAGCAATGCCTCC
R: CATGAGTCCTCCCACGATAC 92
TBP TATA Box-Binding Protein NM_003194.4 F: CCACAGCTCTTCCACTCACA
R: CTGCGGTACAATCCCAGAAC 138
Chapter 2: Materials and Methods
42
2.3.5 Analysis of conditioned media for secreted MMPs and TIMPs’ protein expression using
human Luminex assays
The Bio-Plex Pro™ Human 9-plex MMP (MMP-1, 2, 3, 7, 8, 9, 10, 12, and 13) and 4-
plex TIMP (TIMP-1-4) Luminex assays (Bio-Rad) were used to assess MMP secretion in NSM
and SCM. This assay allows for simultaneous detection of multiple analytes within a sample in
one well of a 96-well plate, through the use of magnetic beads coupled to individual monoclonal
antibodies specific for the analytes of interest. The Bio-Plex® system then detects and quantifies
the specific targets based on the spectral signatures (bead region) assigned to the magnetic beads
(xMAP Technology, Luminex Corporation, USA) and the amount of fluorescent signal from the
biotin-labeled detection antibodies and fluorescent streptavidin reporter complex bound to the
analytes in each sample.
Five milliliters of the NSM and SCM were analyzed for MMP/TIMP protein expression.
Prior to use, the frozen media was slowly defrosted at 4⁰C to prevent degradation of enzymes
and kit reagents were also brought to room temperature. Secreted MMP and TIMP protein
concentrations in the CM were assessed in 50 µL of the undiluted NSM and SCM samples with
0.5% BSA (in duplicate). The assays were performed according to the provided instruction
manuals. The plates were washed with the Hydroflex™ microplate washer (Tecan Group Ltd.,
Switzerland) and data acquisition was performed and analyzed using a Bio-Plex® 200 system
and Bio-Plex Manager™ 5.0 software (Bio-Rad).
Chapter 2: Materials and Methods
43
2.3.6 In vitro model of mechanical stretch using primary rat myometrial cells
The direct effect of static mechanical stretch on the synthesis and secretion of
MMPs/TIMPs by myometrial SMCs in vitro was also investigated using a primary rat myometrial
cell model. Virgin female Wistar rats (12-15 weeks, 225-250g weight) were purchased from
Charles River Laboratories (Wilmington, MA) and housed in the MaRS Toronto Medical
Discovery Tower Animal Research Facility (Toronto, ON). They were maintained on standard rat
chow and water in a 12:12 hour light-dark cycle. The rats were subcutaneously injected with 50µg
of 17β-estradiol 24 hours prior to tissue collection.
Rats were euthanized by CO2 inhalation and whole uteri were collected and placed in
HBSS++ (with calcium and magnesium) supplemented with 1.25mL of Penicillin-Streptomycin-
Amphotericin B (Pen-Strep-AmpB) (Lonza BioWhittaker™, VWR International). Uteri were
placed inside a biological safety cabinet, rinsed with fresh HBSS++ (with Pen-Strep-AmpB), fat
and blood vessels were removed. The uteri were then cut into approximately 1mm-thick rings into
a 125mL Erlenmeyer flask and washed 3 times for 5 minutes with HBSS—(without calcium and
magnesium). Myocytes were enzymatically isolated by collagenase digestion: 10 ml of warm
enzyme mix were added and incubated with gentle shaking at 37⁰C for one hour. 10 mL of
dissociation mix were added to the flask and the mixture was pipetted 30 times to mechanically
disrupt the tissue. Next the entire solution was passed through a cell strainer (pore size 40 µm) to
separate the isolated myometrial cells and incompletely digested tissue. The strained cells were
placed on ice and 10mL of fresh warm enzyme mix were added to the incompletely digested
tissue. The flask was incubated with gentle agitation at 37⁰C for 30 minutes and the process was
repeated until all tissue was digested (5-6 times).
Chapter 2: Materials and Methods
44
The collected cells were then centrifuged for 15 minutes at 4⁰C and 250 g, and the
supernatant was discarded. Cell pellets were resuspended with warm 10% FBS in high glucose
Dulbecco’s Modified Eagle Medium (DMEM, Gibco®, Life Technologies Inc.) and strained
through a 70µm cell strainer (BD Falcon™, BD Biosciences, Mississauga, ON, Canada). To
separate fibroblasts from primary rat myocytes, the cell suspension was plated on 15cm plastic
plates (~20 mL/plate) and incubated at 37⁰C for 30 minutes. Myocytes were collected, stained to
check their viability using 0.4% Trypan Blue solution (Lonza BioWhittaker™, VWR
International), counted using a hemocytometer (50µL of Trypan Blue and 50µL of cell
suspension) and plated on collagen I-coated 6-well Flexcell (Flexcell International Corp.,
Burlington, NC, USA) plates (2.2 million cells per well) with 3mL of DMEM. Cells were cultured
for 2-3 days until 75-80% confluent, then serum starved for 24 hours with 5mL of serum-free
DMEM with ITS-A (Life Technologies Inc.). Primary myocytes underwent a static mechanical
stretch for 2, 8, and 24 hours (25% elongation) using a computer-driven in vitro stretch system
(FX-5000, Flexcell International Corp.) in a 5% CO2, 37⁰C incubator. Control non-stretched
plates were left in the same incubator to provide similar environmental conditions.
2.3.7 Sample collection from rat culture plates, preparation and RT-PCR analysis of mRNA
expression
After 2, 8, and 24 hours media conditioned by non-stretched (NSM) and stretched
(SCM) cells were collected and plates were washed twice with ice-cold PBS. 1mL (per 3 wells
of the sample treatment) of TRIzol (Life Technologies Inc.) was added to 3 wells, cells were
scraped with cell scrapers (Sarstedt Inc., Montreal, QC, Canada) and TRIzol mix was
transferred to a 1.5mL tubes. Similar to Section 2.3.4, total RNA was isolated, reverse
Chapter 2: Materials and Methods
45
transcribed to cDNA, and subjected to RT-qPCR analysis using the same primers as the in vivo
study (Table 2.1).
2.5 STATISTICAL ANALYSIS
For gestational profiles of the bilaterally pregnant rat model, analysis of statistically
significant differences between groups was performed on the natural log (ln) transformation of
the normalized data (relative to a corresponding GD6), unless otherwise stated, using one-way
ANOVA with the Newman-Keuls post-hoc test for multiple comparisons. Specifically for
samples collected from the unilaterally pregnant rat model, unless otherwise stated, statistical
analysis was performed on the normalized data (relative to a corresponding GD6e) using Two-
way ANOVA with Bonferroni’s post-hoc test for multiple comparisons. For in vitro studies,
statistical analysis was performed on the fold-change data (relative to a corresponding 24 hours
not-stretched sample) using one-way ANOVA and Newman-Keuls multiple comparisons test.
The level of significance was set at p<0.05 (*), p<0.01 (**) and p<0.001 (***). Significant
outliers within each data set were determined by the Grubb’s test (GraphPad Software, Inc., CA,
USA) and removed from analysis. All statistical analyses were performed using GraphPad
Prism version 5.0 (GraphPad Software, Inc.).
46
CHAPTER 3
RESULTS
Chapter 3: Results
47
CHAPTER 3 - RESULTS
3.1 INTRODUCTION
It is widely accepted that pregnancy is associated with changes in the cellular
characteristics and the extracellular composition of the uterus [14, 35, 82]. As it has been
previously reported, uterine SMCs in the myometrium and activated infiltrating immune cells can
produce extracellular matrix-degrading MMPs before TL and during the PP period [30, 31, 78,
82, 139]. This can result in restricted collagenolysis and can affect the function of cellular barriers
due to the broad variety of MMP substrates available in the uterus [30, 78, 99, 134, 136]. The
increasingly recognized role of MMPs as activators and regulators of inflammatory pathways
suggests their potential role as key immunoregulatory enzymes in reproductive tissues,
specifically in the myometrium [31, 75, 78, 82, 99, 124]. Therefore, we hypothesize that during
late pregnancy, the expression and activity of myometrial MMPs increases in preparation for two
major events: 1) term labour and 2) PP uterine involution. Our aim was to 1) characterize the
myometrial expression of MMPs and TIMPs during pregnancy, TL and PP, 2) define putative
mechanisms that regulate their expression and/or activity. Our findings will contribute to defining
the involvement of MMPs in inflammatory pathways within uterine tissue and will provide insight
on the mechanism responsible for labour induction.
Chapter 3: Results
48
3.2 GESTATIONAL REGULATION OF MMP GENE EXPRESSION IN THE RAT
MYOMETRIUM
Gestational regulation of MMP gene expression was assessed using two rat models of
pregnancy. Six sets of rat myometrial tissue were collected from bilaterally pregnant rats
throughout gestation (GD6, 8, 10, 12, 14, 15, 17, 19, 21, 22), during active term labour (GD23),
and the PP period (1PP and 4PP). In addition, four sets of rat myometrial tissue were collected
from both the empty (e) and gravid (g) uterine horns throughout gestation (GD6, 12, 15, 17, 19,
21, 23, 1PP) from unilaterally pregnant rats. mRNA levels of ten specific soluble MMPs and four
TIMPs was analyzed using RT-qPCR and normalized against three housekeeping genes: PPIA,
PDGF-A, and TBP or IGF1R (for bilaterally or unilaterally pregnant samples respectively) .
Specific focus was placed on analysing gestational changes in mRNA expression observed for
collagenases (MMP-1, 8, 13), gelatinases (MMP-2, 9), stromelysins (MMP-3, 10, 11), matrilysin
(MMP-7), metalloelastase (MMP-12) and TIMP-1, 2, 3, 4. The results acquired from RT-qPCR
analysis were expressed as a fold-change relative to GD6 (early gestation) to picture the change
in MMPs’ mRNA expression throughout gestation; data for MMP-1 was excluded due to the low
expression of mRNA transcripts observed (Ct values > 33). Statistical analysis for the bilaterally
pregnant tissues was performed on the non-transformed relative expression data (determined with
the computed ΔΔCT method) using one-way ANOVA and the Newman-Keuls multiple
comparisons test. Statistical analysis for the bilaterally pregnant tissues was performed on the
transformed relative fold-change data (relative to GD6e) using two-way ANOVA and
Bonferroni’s multiple comparisons test.
Chapter 3: Results
49
3.2.1 Myometrial MMP mRNA expression in the bilaterally pregnant rat model
mRNA levels of the well-studied class of soluble MMPs, the gelatinases (MMP-2&9),
determined by RT-qPCR were relatively stable throughout bilaterally pregnant rat gestation and
labour, with an increase in mRNA expression 1 day PP (Figure 3.1). Furthermore, MMP-2 mRNA
levels were consistently high throughout gestation (Ct values approximately 22-25) and were
upregulated 2-3-fold in the PP period (Ct values approximately 20-22) supporting a role of MMP-
2 in tissue remodeling 1) to accommodate the growing fetus and 2) for PP involution. In contrast,
mRNA levels for MMP-9 were lowly expressed throughout gestation as depicted by Ct values of
approximately 31-33. Similarly, mRNA levels of the collagenases (MMP-8&13) and two
stromelysins (MMP-3&10) were low throughout gestation compared to a sharp increase observed
1 day PP compared to GD6.
Most interesting is that the myometrial gene expression of MMP-7 (Figure 3.4) in
bilaterally pregnant rats was very low throughout gestation (GD6-GD21) but was dramatically
upregulated in the term rat myometrium (GD22, 200-fold increase) and further increased in the
labouring myometrium at GD23 (350-fold increase). Importantly, MMP-7 remained elevated 1
day PP (150-fold increase) and 4 day PP (20-fold increase). The drastic changes observed for
MMP-7 gene expression at term on GD22 could reflect a role for MMP-7 during the preparation
of the uterus for the active labouring process. The continuous expression of mRNA during GD23
and 1PP supports the role of this enzyme in tissue remodeling to support active labour contractions
and involution for transitioning the uterus back to a pre-pregnant state. Similar to MMP-7, MMP-
11 (stromelysin-3) exhibited sustained elevation of transcript levels during term, active labour and
PP which may indicate that this specific stromelysin is also important for promoting the labour
process and PP involution alongside MMP-7. Both genes displayed very similar gestational
Chapter 3: Results
50
profiles; however, only changes for MMP-7 were found to be significant during labour. Whereas
mRNA levels for MMP-12 were significantly elevated during GD22, they immediately decreased
during active labour (GD23) – suggesting the existence of a protective mechanism stabilizing the
myometrium during active labour contractions – and was again induced during the PP period.
This may suggest the observed changes to MMP-12 gene expression is contributed by immune
cells infiltrating the myometrium prior to labour and during PP involution.
Evidently, all MMPs studied experienced a significant increase in mRNA expression 1
day PP (1PP), and this highest level of mRNA expression validates their role for promoting tissue
remodeling during PP involution. In regards to their endogenous tissue inhibitors, TIMP-1 and
TIMP-2 gene expression was elevated at mid-gestation compared to the PP period, whereas TIMP-
3 and TIMP-4 expression was constant during gestation but elevated during the PP period (Figure
3.5). This correlates with the suggested role of TIMP-1 and TIMP-2 in suppressing MMP activity
during pregnancy whereas TIMP-3 and TIMP-4 may play more of a role in regulating tissue
remodeling in the PP period.
Chapter 3: Results
51
Figure 3.1: Gestational expression of Gelatinases’ mRNA in bilaterally pregnant, laboring
and postpartum (PP) rat myometrium.
Transcript levels of MMP-2 (A) and MMP-9 (B) were both significantly upregulated in the rat
myometrium during 1PP and 4PP compared to the rest of gestation supporting their role in PP
involution. mRNA expression was normalized to three housekeeping genes, Cyclophilin A
(PPIA), platelet-derived growth factor A (PDGF-A), and TATA-binding protein (TBP). Statistical
analysis (one-way ANOVA and the Newman-Keuls multiple comparisons test) was performed on
the ln-transformed data and are presented as fold-changes relative to a corresponding GD6 within
each run. The bars represent mean±SEM (n=5-6/GD). Bars with different letters are statistically
different from each other. p<0.001.
Chapter 3: Results
52
Figure 3.2: Gestational expression of Collagenases’ mRNA in bilaterally pregnant, laboring
and postpartum rat myometrium.
Transcript levels of Collagenases: MMP-8 (A) and MMP-13 (B) were both highly upregulated in
the rat myometrium during 1PP compared to the rest of gestation supporting their role for
promoting tissue remodeling in PP involution. mRNA expression was normalized to three
housekeeping genes, PPIA, PDGF-A, and TBP. Statistical analysis (one-way ANOVA and the
Newman-Keuls multiple comparisons test) was performed on the ln-transformed data and are
presented as fold-changes relative to a corresponding GD6 within each run. The bars represent
mean±SEM (n=5-6/GD). Bars with different letters are statistically different from each other.
p<0.001.
Chapter 3: Results
53
Figure 3.3: Gestational expression of Stromelysins’ mRNA in bilaterally pregnant, laboring
and postpartum rat myometrium.
Transcript levels of MMP-3 (A), MMP-10 (B) and MMP-11 (C) were significantly upregulated in
the rat myometrium during 1PP compared to the rest of gestation supporting their role their role
in PP involution. mRNA expression was normalized to three housekeeping genes, PPIA, PDGF-
A, and TBP. Statistical analysis (one-way ANOVA and the Newman-Keuls multiple comparisons
test) was performed on the ln-transformed data and are presented as fold-changes relative to a
corresponding GD6 within each run. The bars represent mean±SEM (n=5-6/GD). Bars with
different letters are statistically different from each other. p<0.001.
Chapter 3: Results
54
Figure 3.4: Gestational expression of Matrilysin (MMP-7) and Macrophage
Metalloelastase’s (MMP-12) mRNA in bilaterally pregnant, laboring and postpartum rat
myometrium. Transcript levels of MMP-7 (A) was induced in the rat myometrium during late gestation (GD22),
further increased during term labour (GD23), and remained elevated during the PP period. MMP-
12 (B) expression was induced during GD22, decreased during active labour (GD23) but
increased during the PP period. mRNA expression was normalized to three housekeeping genes,
PPIA, PDGF-A, and TBP. Statistical analysis (one-way ANOVA and the Newman-Keuls multiple
comparisons test) was performed on the ln-transformed data and are presented as fold-changes
relative to a corresponding GD6 within each run. The bars represent mean±SEM (n=5/GD). Bars
with different letters are statistically different from each other. p<0.001.
Chapter 3: Results
55
Figure 3.5: Gestational expression of TIMP mRNA in bilaterally pregnant, laboring and
postpartum rat myometrium.
mRNA expression of TIMP-1 (A) and TIMP-2 (B) remained constant throughout gestation while
transcript levels of TIMP-3 (C) and TIMP-4 (D) increased during the PP period. mRNA
expression was normalized to three housekeeping genes, PPIA, PDGF-A, and TBP. Statistical
analysis (one-way ANOVA and the Newman-Keuls multiple comparisons test) was performed on
the ln-transformed data and are presented as fold-changes relative to a corresponding GD6 within
each run. The bars represent mean±SEM (n=5/GD). Bars with different letters are statistically
different from each other. TIMP-1&2 p<0.01, TIMP-3&4 p<0.001
Chapter 3: Results
56
Chapter 3: Results
57
Figure 3.6: Comparative characteristics of MMP and TIMP gene expression in the
pregnant, term labour, and postpartum rat myometrium. A) Relative gene expression of stromelysins (MMP-10,3 & 11), B) matrilysin (MMP-7) and
metalloelastase (MMP-12), C) collagenases (MMP-8 & 13), D) gelatinases (MMP-2 & 9), and
E) TIMPs (TIMP-1-4). Normalized expression of mRNA levels (as calculated by the ΔΔCT
method) were expressed as a fold-change relative to MMP-10’s (lowest expression among all
MMPs and TIMPs) gene expression on GD6, which was chosen as a calibrator for a
comparative study.
Chapter 3: Results
58
Total mRNA expression throughout gestation, TL and PP for MMPs and TIMPs was
further analyzed in a comparative study. The normalized expression calculated by the ΔΔCT
method (Bio-Rad CFX Manager software) were compared to visualize the relative gestational
changes of the MMPs and TIMPs genes studied (Figure 3.6). MMP-10’s gene expression was
lowest among all MMP and TIMP therefore MMP-10’s expression on GD6 was chosen as a
calibrator. The data were analyzed and grouped by MMP classes and revealed that all (the
stromelysins, matrilysin, metalloelastase, and collagenases) exhibited low mRNA abundance
throughout gestation. In contrast, the gelatinases were highly expressed throughout gestation
relative to other MMP subgroups, especially MMP-2, showing at least a 200-fold relative
expression compared to MMP-10. Relative to MMP-10, the other stromelysins (MMP-3 & 11),
collagenases and gelatinases showed the highest increase 1PP (at least 350-fold), whereas MMP-
7 and MMP-12 show weaker increases in mRNA on 1PP (150-fold). Furthermore MMP-7
displayed the highest level of gene expression (at least 550-fold relative expression) during active
TL compared to all MMPs and TIMPs analyzed. This comparative study further suggests the
abundance of MMP mRNA is MMP-specific during TL to regulate myometrial function, and all
MMPs are upregulated in the PP period to promote post-labour remodeling of the uterus.
Interestingly, the TIMPs’ mRNA levels were also highly expressed compared to the
majority of MMPs (except for the gelatinases) throughout gestation, supporting their involvement
in regulating MMP activity. TIMP-2 exhibited the highest level of TIMP expression throughout
gestation, while TIMP-1 & 3 had a similar pattern of expression similar to that of the gelatinases.
These findings support the inhibitory role of TIMP-2 for the majority of MMPs, and potential
interaction between TIMP-1 & 3 with MMP-2 & 9 to form inhibitory complexes in the rat
myometrium throughout gestation. Importantly, TIMP-3 & 4 were highly upregulated PP (450-
fold), suggesting their role in regulating uterine involution.
Chapter 3: Results
59
3.2.2 Myometrial MMP mRNA expression in the unilaterally pregnant rat model
To assess the effect of biological uterine stretch on the expression of MMPs/TIMPs in
vivo, a unilaterally pregnant rat model was used (in collaboration with Dr. O. Shynlova).
Myometrial tissues from empty (non-pregnant) and gravid (pregnant) uterine horns were collected
at different gestational days. Gene expression was normalized to three housekeeping genes (PPIA,
PDGF-A, and IGFR1) and expressed as fold-changes relative to a GD6 empty (e) horn sample.
As expected, gene expression of all MMPs was very low in the empty horn myometrium during
gestation and term labour. Analysis of the full spectrum of specific soluble MMPs in the gravid
uterine horn (described above for bilaterally pregnant rats) showed a very similar expression
profile during pregnancy, labour and the PP involution period. There were no statistically
significant differences (by Bonferroni’s multiple comparisons test) in mRNA expression between
the empty and gravid horn during gestation and active labour (GD23) of the gelatinases (MMP-2
and 9) and the majority of the MMPs studied (MMP-3, 8, 10, 11, 12).
However, MMP-3, 8, 9, 10, and 12 all exhibited a significantly higher expression of
transcript levels in the gravid horn compared to the empty horn on 1 day PP (Figure 3.7-3.9). A
dramatic increase in mRNA expression of the stromelysin MMP-11 was observed in both the
empty and gravid horns 24 hours after term labour, possibly indicating that expression of this gene
during the PP period was regulated by hormonal changes rather than by the release of mechanical
stretch of the uterus after the expelling of the fetuses. Furthermore, the upregulation of certain
MMP mRNA 1 day PP specifically in the gravid horn and not the empty shows a correlation with
remodeling the pregnant tissue back to a non-pregnant state.
Chapter 3: Results
60
Figure 3.7: Expression of Gelatinases MMP-2 (A) and MMP-9 (B) genes in the myometrium
of unilaterally pregnant rats during gestation, term labour and postpartum. Transcript levels in empty (white bars) and gravid (gray bars) uterine horns were normalized to
three housekeeping genes, PPIA, PDGF-A and IGFR1 levels and expressed in fold-changes
relative to a GD6 empty sample. The bars represent meanSEM (n=3-4/GD). Statistical analysis
was performed on the natural log-transformed data using two-way ANOVA and the Bonferroni’s
multiple comparisons test. A significant difference between the gravid and empty horn of the same
gestational day is indicated by *** (p<0.001). Gestational days with different letters (gravid horn)
or Greek symbols (empty horn) are statistically different from each other within the respective
horns; p<0.05. Gestational days without letters or Greek symbols are not statistically different
from each other by two-way ANOVA.
Chapter 3: Results
61
Figure 3.8: Expression of Stromelysins MMP-3 (A), MMP-10 (B) and MMP-11 (C) genes in
the myometrium of unilaterally pregnant rats during gestation, term labour and
postpartum.
Transcript levels in empty (white bars) and gravid (gray bars) uterine horns were normalized to
three housekeeping genes, PPIA, PDGF-A, and TBP and expressed in fold-changes relative to a
GD6 empty sample. The bars represent meanSEM (n=3-4/GD). Statistical analysis was
performed on the relative fold-change data using two-way ANOVA and the Bonferroni’s multiple
comparisons test. A significant difference between gravid and empty horn of the same gestational
day is indicated by *** (p<0.001). Gestational days with different letters (gravid horn) or Greek
symbols (empty horn) are statistically different from each other within the respective horns;
p<0.05. Gestational days without letters or Greek symbols are not statistically different from each
other by two-way ANOVA.
Chapter 3: Results
62
Figure 3.9: Expression of Collagenase (MMP-8, A), Matrilysin (MMP-7, B) and
Metalloelastase (MMP-12, C) genes in the myometrium of unilaterally pregnant rats during
gestation, term labour and postpartum.
Transcript levels in empty (white bars) and gravid (gray bars) uterine horns were normalized to
three housekeeping genes (PPIA, PDGF-A, and TBP) expressed in fold-changes relative to a GD6
empty sample. The bars represent meanSEM (n=3-4/GD). Statistical analysis was performed on
the relative fold-change data (MMP-3&7) or ln-transformed data (MMP-12) using two-way
ANOVA and the Bonferroni’s multiple comparisons test. A significant difference between gravid
and empty horn of the same gestational day is indicated by *(p<0.05), ** (p<0.01), ***
(p<0.001). Gestational days with different letters (gravid horn) or Greek symbols (empty horn)
are statistically different from each other within the respective horns; p<0.05. Gestational days
without letters or Greek symbols are not statistically different from each other by two-way
ANOVA.
Chapter 3: Results
63
Interestingly, in the case of MMP-7, we observed upregulation of mRNA in the gravid
(pregnant) horn as compared to the empty horn during GD23, suggesting an effect of either
mechanical stretch or the presence of the fetal/placental unit on MMP-7’s transcript levels (Figure
3.9). More specifically, the induction of uterine contractions during labour and the removal of
mechanical stretch after expelling of fetuses may be involved with the upregulation of MMP-7.
This phenomenon was also observed for MMP-12, which also displayed higher mRNA levels
within the gravid horn during late gestation in addition to TL and PP – beginning from GD19 –
compared to the empty horn, suggesting a correlation between MMP-12 mRNA expression and
myometrial transition to a contractile phenotype in preparation for active TL. On the contrary, we
also detected a significant upregulation of MMP-7 in the empty uterine horn during active labour
contractions suggesting mechanical stretch is not the sole regulator of gene expression. These
findings support the hypothesis of 1) MMPs having a dual role in the myometrium as key
regulators of tissue remodeling during labour and PP involution and 2) different regulatory
mechanisms exists in the transcriptional activation of different MMP genes.
Chapter 3: Results
64
3.3 GESTATIONAL REGULATION OF MMP PROTEIN EXPRESSION IN THE RAT
MYOMETRIUM
3.3.1 Western blot analysis of MMP levels and gelatin zymography of the myometrial tissue from
bilaterally pregnant rats
To investigate whether the upregulated expression of mRNA transcripts resulted in the
production and secretion of MMPs by the myometrium, gestational changes in protein levels were
further assessed by WB. Specific interest was on the well-studied gelatinases (MMP-2&9), the
collagenase (MMP-8), the major stromelysins (MMP-3&11), and the uterine matrilysin (MMP-
7) to identify any correlation between mRNA gestational changes with protein expression.
Statistical analysis was performed on the ln-transformed relative fold-change data using one-way
ANOVA and Newman-Keuls multiple comparisons test.
MMP-8 is a major collagenase known to be secreted mainly by neutrophils and has a high
affinity for fibrillar collagen I, a major component of the uterine ECM. MMP-8 protein expression
was highly expressed with no significant changes throughout gestation, TL, and PP. This,
however, did not correlate with transcript levels that exhibited a dramatic increase 1 day PP.
Chapter 3: Results
65
Figure 3.10: Protein levels of Collagenase MMP-8 in the rat myometrium throughout
gestation, labour and post-partum. Representative Western blots (A) and densitometric analysis of Neutrophil Collagenase (B,
MMP-8) protein expression levels were normalized to Calponin. Statistical analysis (one-way
ANOVA) was performed on the ln-transformed data and are presented as fold-changes relative to
a corresponding GD6 within each run. Bar graphs showing the meanSEM (n=4/GD). Any
differences between gestational days were not found to be statistically significant by one-way
ANOVA.
Chapter 3: Results
66
Figure 3.11: Protein levels of Stromelysins in the rat myometrium throughout gestation,
labour and postpartum. Representative Western blots (A) and densitometric analysis of Stromelysins (B, MMP-3 and C,
MMP-11). MMP protein expression levels were normalized to Calponin. Statistical analysis (one-
way ANOVA and Newman-Keuls multiple comparisons test) was performed on the ln-
transformed data and are presented as fold-changes relative to a corresponding GD6 within each
run. Bar graphs showing the meanSEM (n=4/GD). Bars with different letters are statistically
different from each other (MMP-11 p<0.01). Gestational days without letters are not statistically
different from each other by one-way ANOVA.
Chapter 3: Results
67
Figure 3.12: Protein levels of Matrilysin and Metalloelastase in the rat myometrium
throughout gestation, labour and post-partum. Representative Western blots (A) and densitometric analysis of Matrilysin (B, MMP-7) and
Metalloelastase (C, MMP-12). MMP protein expression levels were normalized to Calponin.
Statistical analysis (one-way ANOVA and Newman-Keuls multiple comparisons test) was
performed on the ln-transformed data and are presented as fold-changes relative to a
corresponding GD6 within each run. Bar graphs showing the meanSEM (n=4/GD). Bars with
different letters are statistically different from each other (MMP-7 p<0.001 and MMP-12 p<0.05).
Gestational days without letters are not statistically different from each other by one-way
ANOVA.
Chapter 3: Results
68
Stromelysins, known to cleave a variety of ECM substrates, mRNA levels were
dramatically upregulated during PP involution, however, the protein immunoblot analysis of the
major stromelysin MMP-3 showed stable protein levels throughout gestation, labour and PP. On
the contrary, active stromelysin MMP-11 protein showed a dramatic upregulation at late gestation
(starting from GD17) and a significant increase in protein expression on GD23, as compared to
early gestation. The gestational profile for protein expression of MMP-7 and MMP-12 were also
analyzed using WB analysis. MMP-7 (29 kDa) was significantly upregulated on GD23 (Figure
3.12) and depicts a similar pattern as transcript levels of MMP-7 (Figure 3.4). MMP-12 was highly
and relatively stable expressed throughout gestation, with a slight increase in protein expression
in the early PP period (Figure 3.12). This MMP-12 protein expression pattern was different to
MMP-12 gene, which was increased 150-fold on GD22 (Figure 3.4) but this upregulation was not
seen at the protein level. The observed increase in protein levels of MMP-7 and MMP-11 on
GD23 suggest their involvement in tissue remodeling of the myometrium to promote labour
contractions.
Protein activity observed for active MMP-2 using gelatin zymography (Figure 3.13)
showed a significant induction at 1 day PP, a profile similar to the expression of MMP-2 gene.
Active MMP-9 protein activity detected by gelatin zymography was very low and could not be
accurately analysed.
Chapter 3: Results
69
Figure 3.13: Representative Gelatin Zymography (A) and Densitometric analysis (B), (C).
Gelatinase activity of total protein (50µg/well) in rat myometrial tissues throughout gestation,
labour and postpartum (visualized as light bands and presented as fold-change relative to a
corresponding GD6). MMP-2 activity is observed predominantly at 68 kDa (latent pro-form) and
62 kDa (active form). MMP-9 at 92 kDa (latent pro-form) and 87 kDa (active form) was very low
throughout gestation MMP-9 was observed in the decidua conditioned media used as a positive
control (+ve). (B) Densitometric analysis of the gelatin zymography; bars represent the relative
density of MMP-2. The results shown are the mean±SEM (n=4/GD). Statistical analysis (one-
way ANOVA and Newman-Keuls multiple comparisons test) was performed on the fold-change
data. Significant differences between gestational days were indicated by different letters (pro-
MMP-2 p<0.01 and active MMP-2 p<0.001).
Chapter 3: Results
70
3.3.2 Western blot analysis of MMP levels and gelatin zymography of the myometrial tissue from
unilaterally pregnant rats
We examined whether the differences in MMP-7 mRNA expression between the empty
and gravid horn observed during GD23 and 1PP, resulted in similar changes in protein levels.
Visually, there were no differences in MMP-7 protein expression between the gravid and empty
horns during labour and 1PP. Yet statistical analysis (two-way ANOVA and Bonferroni’s multiple
comparisons test) revealed that MMP-7 protein expression in the gravid horn was statistically
significantly different from the empty horn. This phenomenon is due to the inexplicable dramatic
decrease in the expression of the housekeeping protein calponin (that we used as a loading control)
in the gravid horn myometrium 1 day PP (Figure 3.14). Furthermore, calponin was only detectable
in three of the four data sets for gravid 1PP thus the only optical density detected for 1PP was
applied to the remaining three data sets for normalization. This decrease in expression was also
observed in the bilaterally pregnant rat model (Figure 3.10-12), however, for unknown reason,
the down-regulation was more dramatic in the unilaterally pregnant model. Interestingly, this
correlates with Brodt-Eppley and Myatt, who also used calponin for normalization and detected
a slightly lower expression of calponin during early PP in the bilaterally pregnant rat myometrium
[154].
Surprisingly, immunoblot analysis of MMP-12 protein expression revealed an increase in
active MMP-12 expression (not detected in the bilaterally pregnant myometrium) within the
gravid horn compared to the empty horn (Figure 3.14). These results further confirm that MMP
expression is not exclusively regulated by mechanical stretch of the rat myometrium, but rather
other mechanisms, potentially endocrine factors or activated leukocytes (known sources of MMP
secretion) might also be responsible for the difference in MMP expression within the empty and
Chapter 3: Results
71
gravid uterine horns [78, 85]. For instance, the PP MMP-12 could be secreted by infiltrating
macrophages [20, 30, 82].
Gelatin zymography revealed a similar expression profile between pro-MMP-2 protein
and MMP-2 mRNA throughout gestation, depicting no differences between the empty and gravid
uterine horns (Figure 3.15). In contrast, starting from early gestation until term active MMP-2
was higher in the empty horn compared to the gravid horn. This suggests that during gestation
and labour, MMP-2 activity in the gravid horn is suppressed by the presence of fetal/placental
unit and it is activated during PP for the remodeling/involution process, when the fetuses are
expelled. We speculate that in the empty horn, this suppression is absent due to a lack of factors
produced by placenta and/or fetus.
Chapter 3: Results
72
Figure 3.14: Protein levels of Matrilysin and Macrophage Metalloelastase in the unilaterally
pregnant rat myometrium throughout gestation, labour and postpartum. Representative Western blots (A) and densitometric analysis of Matrilysin (B, MMP-7) and
MMP-12 (C, pro-MMP-12 and D, active MMP-12). MMP protein expression levels were
normalized to Calponin and expressed as fold-change relative to a GD12 empty horn (e) sample.
Bar graphs showing the meanSEM (n=4/GD). Statistical analysis was performed on the relative
fold-change data using two-way ANOVA and the Bonferroni’s multiple comparisons test. A
significant difference between the gravid and empty horn of the same gestational day is indicated
by *** (p<0.001). Gestational days with different letters (gravid horn) or Greek symbols (empty
horn) are statistically different from each other within the respective horns; p<0.05. Gestational
days without letters or Greek symbols are not statistically different from each other by two-way
ANOVA.
Chapter 3: Results
73
Figure 3.15: Representative Gelatin Zymography (A) and Densitometric analysis (B), (C).
Gelatinase activity of total protein (50µg/well) in unilaterally pregnant rats presented as empty
(e) vs. gravid (g) (visualized as light bands). Densitometric analysis was presented as fold-change
relative to the GD6 empty horn (6e). MMP-2 activity is observed predominantly at 68 kDa (latent
pro-form) and 62 kDa (active form). MMP-9 at 92 kDa (latent pro-form) and 87 KDa (active
form) was undetectable throughout gestation similar to the bilaterally pregnant rats. (B)
Densitometric analysis of the gelatin zymography; bars represent the relative density of MMP-2.
The results shown are the mean±SEM (n=4/GD). Statistical analysis was performed on the
relative fold-change data using two-way ANOVA and the Bonferroni’s multiple comparisons test.
A significant difference between the gravid and empty horn of the same gestational day is
indicated by *(p<0.05), ** (p<0.01), and *** (p<0.001). Gestational days with different Greek
symbols are statistically different from each other within the empty horn; p<0.05. Gestational
days without letters or Greek symbols are not statistically different from each other by two-way
ANOVA.
Chapter 3: Results
74
3.4 TEMPORAL AND SPATIAL LOCALIZATION OF MMPs IN THE RAT
MYOMETRIUM
3.4.1 Tissue localization of MMP in the rat myometrium by immunohistochemistry
Temporal localization of MMP proteins was first assessed in formalin-fixed and paraffin-
embedded tissue sections collected during mid-gestation (GD15), late gestation (GD21), term
labouring (GD23) and 1 day PP using antibodies specific to MMP-7 (Figure 3.16), MMP-9
(Figure 3.17), and MMP-11 (Figure 3.18). MMPs were localized to both longitudinal (LM) and
circular (CM) myometrial layers throughout gestation. We noticed a difference in the spatial
localization of MMPs: during mid-and late-gestation myometrial MMP expression was
predominantly intracellular within the perinuclear region of SMCs, however during TL and PP
involution there was a shift to extracellular localization.
Interestingly, MMP-7 and 9 were highly expressed at term (GD21) and during labour
(GD23) but only MMP-7 remained elevated PP. Immunostaining results suggests that MMP-9
protein is expressed within the rat myometrium during gestation although the enzyme is not active
(as revealed by gelatin zymography, Figure 3.13). MMP-11 expression was seen primarily
intracellular throughout gestation with highest extracellular levels during 1PP. Altogether we
observed that intracellular and extracellular MMP protein expression in the rat uterus is increased
as gestation progresses towards term labour and peaked during PP involution. In addition, MMP
expression was not only observed in myometrial SMCs but very often much stronger staining was
detected in cells morphologically distinct from SMCs – suggestive of infiltrating immune cells –
localized especially around myometrial blood vessels and in the vascular plexus, the area between
longitudinal and circular myometrial layers.
Chapter 3: Results
75
Figure 3.16: Temporal and spatial localization of MMP-7 in pregnant, labouring and
postpartum rat uterus.
Tissue sections from GD 15, GD21, labouring (GD23), and 1 day PP (1PP) rat uteri were
immunostained for MMP-7 (brown immunostain) and counterstained with haematoxylin. Positive
immunostaining was observed in both the circular myometrial layer (CM), longitudinal
myometrial layer (LM) and decidua (Dec) throughout gestation. Single cell staining (red arrow)
is suggestive of MMP-7 expression by infiltrating immune cells while perinuclear staining
suggests expression by SMCs. Intracellular and extracellular expression of MMP-7 increased
drastically in GD23 and 1PP animals. No staining was detected in the negative control slide (1PP)
using rabbit IgG. Magnification: 100x
Chapter 3: Results
76
Figure 3.17: Temporal and spatial localization of MMP-9 in pregnant, labouring and
postpartum rat uterus.
Tissue sections from GD 15, GD21, labouring (GD23), and 1 day PP (1PP) rat uteri were
immunostained for MMP-9 (brown immunostain) and counterstained with haematoxylin. Positive
immunostaining for MMP-9 was observed in the longitudinal myometrial layer (LM), the circular
myometrial layer (CM), and the decidua throughout gestation. Expression was predominantly
perinuclear during mid and late gestation (GD15, GD21) and PP by smooth muscle cells.
Increased extracellular expression of MMP-9 was primarily observed in the LM during labour,
with some expression present in non-SMC cells (red arrow) suggestive of infiltrating immune
cells. MMP-9 expression began to decrease in PP animals. No staining was detected in the
negative control slide (GD23) using rabbit IgG. Magnification: 100x
Chapter 3: Results
77
Figure 3.18: Temporal and spatial localization of MMP-11 in pregnant, labouring and
postpartum rat uterus.
Tissue sections from GD 15, GD21, labouring (GD23), and 1 day PP (1PP) rat uteri were
immunostained for MMP-11 (brown immunostain) and counterstained with haematoxylin.
Positive immunostaining was observed in both the circular myometrial layer (CM), longitudinal
myometrial layer (LM) and decidua (Dec) throughout gestation. Expression was predominantly
perinuclear in SMCs and present in non-SMC single cells (red arrow) suggestive of infiltrating
immune cells. Some extracellular expression of MMP-11 was observed in the LM during late
gestation and labour, and further increased in the CM during GD23 and 1PP. No staining was
detected in the negative control slide (GD23) using rabbit IgG. Magnification: 100x
Chapter 3: Results
78
3.4.1 Tissue localization of MMP activity in the rat myometrium by in situ zymography
Spatial distribution/localization of MMP enzymatic activity was performed using in situ
zymography with different ECM substrates (Figure 3.19). Four sets of rat uteri were collected at
GD15, 21, 22, 23 and 1 day PP, fixed in a zinc-buffered fixative and paraffin-embedded. This
methodology was adapted from Hadler-Olsen et al., who reported that zinc fixation and paraffin
embedding was able to preserve tissue morphology and enzymatic activity better than that of
frozen sections [155]. Tissue localization of MMP activity was detected in the uterine sections
incubated with fluorescent substrates (1) DQ-gelatin, (2) DQ-type I collagen and (3) DQ-type IV
collagen. These substrates were chosen based on a study by Gonzales et al. that reported these
three ECM proteins are actively degraded by major MMPs in mice [102, 156]. Increased
fluorescence indicated increased gelatin and collagen degradation by MMPs. To verify that the
observed fluorescence is due to protease activity, negative control sections were pre-incubated
with buffer containing 10 mM EDTA to inhibit MMPs which was followed by substrate
application.
Chapter 3: Results
79
Figure 3.19: Representative images for in situ zymography using fluorescent MMP
substrates: DQ gelatin (second column), DQ collagen type I (third column) and DQ collagen
type IV (right column) for tissue localization of MMP activity.
Increased green fluorescence (increased gelatin, collagen I and IV degradation) was localized
intracellularly to the perinuclear region of the myometrial cytoplasm during late gestation
(D21&22) and term labour (D23), however during 1 day PP (1PP) fluorescence was mostly
detected extracellularly in the myometrial parenchyma. Sections were pre-incubated with 0.02M
EDTA for 1 hour, then incubated with EDTA+substrate as the negative control (EDTA+gelatin)
of fluorescence. Slides were counter-stained with DAPI (nuclear staining). Magnification: 100x
Chapter 3: Results
80
In situ zymography indicated high levels of MMP activity for gelatin and collagen I
degradation were localized to the perinuclear region of individual myometrial SMCs at term
(GD22) and during labour (GD23). Importantly, MMP activity was highly upregulated in the
myometrial parenchyma on 1 day PP as shown by increased fluorescence, depicting degradation
of gelatin, collagen I and collagen IV. Similar to Immunohistochemical analysis, numerous single
cells morphologically different from SMCs were also observed in myometrial tissue in a close
proximity to blood vessels. We speculated that in addition to SMCs, immune cells may also be a
source of MMP expression. This hypothesis was tested by performing immunofluorescent
staining for CD45 (leukocyte common antigen) and CD68 (macrophage marker) immediately
following in situ zymography.
CD45 immunofluorescent staining in combination with in situ zymography depicted co-
expression of CD45 (red fluorescence) and protease activity (green fluorescence – gelatin
degradation) by activated immune cells (Figure 3.20). These data support the notion that
infiltrated leukocytes within the myometrium expresses MMPs either to aid in their migration by
increasing EC permeability, or to remodel the myometrium to promote the labouring process and
PP involution. Specific subgroup of leukocytes, CD68+ macrophages, have been previously
shown to infiltrate into uterine tissues (myometrium and decidua) before TL and during PP
involution [20, 28]. Further investigation of immunofluorescent co-staining for CD68 and in situ
zymography indicated that macrophages are one of the leukocytes responsible for myometrial
MMP expression. Importantly, macrophages show expression of gelatin, collagen I and collagen
IV-degrading proteases as seen by co-staining of green (protease activity) and red fluorescence
(CD68). (Figure 3.21-23), which suggests that they are partially responsible for total MMP gene
and/or protein expression detected in myometrium.
Chapter 3: Results
81
Figure 3.20: Gelatinase activity of rat myometrium and tissue leukocytes during late
gestation (GD21, 22), term labour (D23) and postpartum (1PP).
Representative images showing co-localization of in situ gelatin zymography (green) and
immunofluorescence of the leukocyte common antigen CD45 (red). Co-immunostaining indicates
that leukocytes (arrows) recruited into the myometrium during gestation, labour, and PP expressed
gelatinases along with smooth muscle cells. Slides were counter-stained with DAPI (blue nuclear
staining). Images were acquired using Volocity software and a spinning-disc confocal microscope
at 400x magnification.
Chapter 3: Results
82
Figure 3.21: Representative images from in situ gelatin zymography and CD68
immunofluorescence.
Co-immunostaining for CD68 (red) following in situ zymography indicated that macrophages
(arrows) infiltrated into the myometrium also expressed gelatinases along with smooth muscle
cells. Slides were counter-stained with DAPI (blue nuclear staining). Images were acquired using
Volocity software and a spinning-disc confocal microscope at 400x (GD15 and GD21) and 600x
(GD23 and 1PP) magnification.
Chapter 3: Results
83
Figure 3.22: Representative images from in situ collagen I zymography and CD68
immunofluorescence.
Co-immunostaining for CD68 (red) following in situ zymography indicated that macrophages
(arrows) infiltrated into the myometrium also expressed collagen I-degrading enzymes along with
smooth muscle cells. Slides were counter-stained with DAPI (blue nuclear staining). Images were
acquired using Volocity software and a spinning-disc confocal microscope at 400x magnification.
Chapter 3: Results
84
Figure 3.23: Representative images from in situ collagen IV zymography and CD68
immunofluorescence.
Co-immunostaining for CD68 (red) following in situ zymography indicated that macrophages
(arrows) infiltrated into the myometrium also expressed collagen IV-degrading enzymes along
with smooth muscle cells. Slides were counter-stained with DAPI (blue nuclear staining). Images
were acquired using Volocity software and a spinning-disc confocal microscope at 400x
magnification.
Chapter 3: Results
85
3.5 IN VITRO PRIMARY CELL MODEL OF MECHANICAL STRETCH
3.5.1 In vitro primary rat myometrial cell model of mechanical stretch
Numerous studies indicate that MMP expression and activity is regulated by mechanical
stretch in different cell types [157-160]. To examine the direct effect of mechanical stimuli on the
expression of MMPs, we developed an in vitro culture system using primary myometrial cells.
Primary myocytes were enzymatically isolated from 10 uteri collected from virgin estrogenized
rats and plated on 6-well flexplates coated with collagen I (n=3). The number of isolated cells
differed significantly between 3 consecutive cell cultures. To simulate biological mechanical
stretch of the uterine horn by growing fetus, primary myometrial cells were artificially stretched
for 2, 8 and 24 hours (25% elongation) and the expression of different MMPs and TIMPs was
analyzed using specific rat primers. Stretch- related changes in mRNA expression were minimal
and the expression was highly variable between three cultures, possibly due to a difference in
characteristics of the isolated primary cells.
We also studied the activity of the protein secreted by those cells into the SCM. We found
that protein expression of secreted MMP-7 and MMP-11 were undetectable in the collected NCM
and SCM when compared with an in vivo rat myometrial GD15 sample as positive control. Pro-
and active-MMP-2 (69 and 62 kDa) and active MMP-9 (84kDa) were detected by zymography,
however, there was no effect of stretch (S) compared to non-stretch (NS) on protein expression
and activity (data not shown). Thus as an alternative approach, the effect of in vitro static
mechanical stretch on MMP expression was assessed using a primary human myometrial cell
culture model.
Chapter 3: Results
86
3.5.2 In vitro primary human myometrial cell model of mechanical stretch
Human primary myometrial cells enzymatically isolated from term non-labouring tissue
biopsies were characterized by immunofluorescent cytochemistry (ICC) to assess their phenotype
at passage 0, 1, 2 and 4. ICC assessment suggests that cultured primary myometrial cells are
myofibroblasts characterized by the co-expression of fibroblastic (Vimentin) and smooth muscle
(Desmin, SMA, and H-Caldesmon) differentiation markers (Figure 3.24).
Figure 3.24: Representative immunocytochemical fluorescent images of primary human
myometrial cells at passage 0, 2 and 4.
Cells were characterized for expression of differentiation markers for fibroblasts and smooth
muscle cells. Primary myometrial cells were plated directly after enzymatic isolation (passage 0),
and following the 2nd and 4th passages; they expressed markers for differentiated fibroblasts
(Vimentin) and some (arrows) expressed markers for differentiated smooth muscle cells (Desmin,
Smooth Muscle Actin, H-Caldesmon). Images were acquired using Velocity software and a
spinning-disc confocal microscope at 200x magnification.
Chapter 3: Results
87
As seen in Figure 3.23, cells enzymatically isolated from pregnant human uterine tissue at
passage 0 are primarily fibroblasts expressing Vimentin, with some cells expressing smooth
muscle differentiation markers. Following the 1st (not shown) and 2nd passage, these cultured
myometrial cells begin to increasingly differentiate towards a myofibroblast phenotype by up-
regulating SMA and H-Caldesmon expression, while still retaining expression of the fibroblast
marker Vimentin. By passage 4, the majority of cells in culture were myofibroblasts, by
simultaneously expressing of Vimentin, Desmin, SMA and H-Caldesmon. Since this in vitro
primary human cell culture model is phenotypically variable from cells present in the in vivo
environment, I suggest that these cells may behave differently in response to static mechanical
stretch.
After the 4th passage, approximately 200,000 myometrial cells were plated on collagen I-
coated 6-well flex (containing flexible membranes) plates (Flexcell Inc., n=4) and left to grow to
confluency (75-80%) prior to serum starvation for 24 hours. Immediately following serum
starvation, static mechanical stretch (25% elongation) was applied to the flex plates for 24 hours
(24h S) or 24 hours of stretch followed by 24 hours of relaxation (24h S + 24h R). For both groups
(S and S+R) there were non-stretched cells incubated for the same time interval (24h NS and 48h
NS). Cell viability after stretch and stretch with relaxation was assessed using PI-FDA staining
and confirmed that stretch did not induce cell death since there was no significant increase in PI-
positive cells after stretch as compared to static non-stretched cells (Figure 3.25).
Chapter 3: Results
88
Figure 3.25: Representative images from assessment of cell viability following mechanical
stretch of primary human myometrial cells.
The assessment of cell viability following 24 hours static stretch and additional 24 hours for
relaxation, was employed using propidium iodide (PI) and fluorescein diacetate (FDA) staining.
FDA (green) revealed live cells while PI (red) revealed cell death. There was minimal strain of
static mechanical stretch on the cell viability. Images were acquired using the Volocity software
and a spinning-disc confocal microscope at 200x magnification.
Chapter 3: Results
89
3.5.3 In vitro mechanical stretch does not influence myometrial MMPs gene expression
Total RNA was extracted from the myometrial cells collected with TRIzol® (Life
Technologies) and the mRNA was reversed transcribed to cDNA for RT-qPCR analysis. The
entire set of MMPs and TIMPs was assessed using human primers (similar to section 3.2),
however, only MMP-1, 2, 3, 11 and TIMP-1 & 2 were expressed (Ct values ≤ 33) by cultured
primary human myometrial cells (Figure 3.26-3.28). The data suggests that there was no
significant effect of stretch on MMP-1, 2, 3, 11 and TIMP-1 & 2 mRNA expression. Additionally,
it was observed that 24 hour static mechanical stretch followed by an additional 24 hours in culture
without stretch (to simulate the relaxation observed in the PP period) modified mRNA expression
for MMP-1, 2, 3 and 11 as compared to cells stretched for 24 hours. However, this trend was
similar for both non-stretched and stretch plates, indicating that there is an indirect effect of time
in culture rather than stretch. We also noticed that in non-stretched myometrial cultures MMP-1,
and MMP-3 exhibited a decrease in mRNA expression, while MMP-2, MMP-11 and TIMP-2
exhibited an increase after being in culture for 48 hours as compared to 24 hours group.
Chapter 3: Results
90
Figure 3.26: Expression changes in mRNA levels of MMPs as an effect of in vitro static
mechanical stretch of primary human myometrial cells.
Transcript levels of MMP-1 (A) and MMP-2 (B) expressed by 24 hour non-stretched (24h NS),
24 hour stretched (24h S), 48 hour non-stretched (48h NS) and 24 hour stretch + 24 hour relaxation
(24h S + 24h R), were normalized to three housekeeping genes, TATA-binding protein (TBP),
cytochrome C1 (CYC1), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and expressed as
fold-change relative to 24 hours Non-Stretch. The bars represent mean±SEM (n=3-4 at each time
point). Statistical analysis (one-way ANOVA and Newman-Keuls multiple comparisons test) was
performed on the relative fold-change data. Significant differences between gestational days are
indicated by asterisks, * (p<0.05), ** (p<0.01).
Chapter 3: Results
91
Figure 3.27: Expression changes in mRNA levels of MMPs as an effect of in vitro static
mechanical stretch of primary human myometrial cells.
Transcript levels of MMP-3 (A) and MMP-11 (B) expressed by 24 hour non-stretched (24h NS),
24 hour stretched (24h S), 48 hour non-stretched (48h NS) and 24 hour stretch + 24 hour relaxation
(24h S + 24h R), were normalized to three housekeeping genes, TATA-binding protein (TBP),
cytochrome C1 (CYC1), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and expressed as
fold-change relative to 24 hours Non-Stretch. The bars represent mean±SEM (n=3-4 at each time
point). Statistical analysis (one-way ANOVA and Newman-Keuls multiple comparisons test) was
performed on the relative fold-change data.Significant differences between gestational days are
indicated by asterisks, * (p<0.05), ** (p<0.01), and *** (p<0.001).
Chapter 3: Results
92
Figure 3.28: Expression changes in mRNA levels of TIMPs as an effect of in vitro static
mechanical stretch of primary human myometrial cells.
Transcript levels of TIMP-1 (A) and TIMP-2 (B) expressed by 24 hour non-stretched (24h NS),
24 hour stretched (24h S), 48 hour non-stretched (48h NS) and 24 hour stretch + 24 hour relaxation
(24h S + 24h R), were normalized to three housekeeping genes, TATA-binding protein (TBP),
cytochrome C1 (CYC1), glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and expressed as
fold-changes relative to 24 hours Non-Stretch. The bars represent mean±SEM (n=3-4 at each time
point). Statistical analysis (one-way ANOVA and Newman-Keuls multiple comparisons test) was
performed on the relative fold-change data. Significant differences between gestational days are
indicated by asterisks, * (p<0.05).
Chapter 3: Results
93
3.5.4 Secreted myometrial MMPs proteins detected by Luminex assay
The undiluted NSM and SCM were screened by the Bio-Plex Pro™ Human MMP and
TIMP Luminex assays (Bio-Rad) and MMP-1, 2, 3, & 10 and TIMP-1 & 2 were detected. For the
analysis, some calculated MMP/TIMP concentrations were excluded if detection values were
extrapolated below the lowest concentration of the standard curve. In addition, if some values
were extrapolated beyond the highest concentration of the standard curve, that particular data
point was assigned the value of the highest standard concentration. Based on the aforementioned
criteria, secreted MMPs/TIMPs that were detected in less than four of NSM/SCM data sets were
excluded from further analysis. Therefore only MMP-1 & 2 and TIMP 1 & 2 underwent statistical
analysis (Figure 3.29).
Cultured primary human myometrial cells secreted MMP-1 (105-8400 pg/mL), MMP-2
(1220-33,000 pg/mL), TIMP-1 (3600-18,000 pg/mL) and TIMP-2 (11,500-19,500 pg/mL) in the
NSM and SCM. Importantly, there was no effect of static mechanical stretch, and only secreted
MMP-2 levels exhibited a 10-fold increase after culturing for 48 hours as compared to 24 hours
incubation in serum-free media. This further suggests that in vitro culture conditions can influence
the expression of MMPs and the underlying mechanisms that regulate myometrial MMP
expression and secretion need to be further elucidated.
Chapter 3: Results
94
Figure 3.29: Changes in MMP and TIMP protein secretion primary human myometrial cells
as an effect of in vitro mechanical stretch.
Changes in protein secretions detected in the conditioned medium of myometrial cell culture
collected from non-stretched and stretched flex plates after 24 hours and 48 hours of incubation.
The bars represent mean±SEM (n=4-5 at each time point) expressed in fold-change relative to 24
hours Non-Stretch Conditioned Medium (NSM). Statistical analysis (one-way ANOVA and
Newman-Keuls multiple comparisons test) was performed on the relative fold-change data.
Significant differences between gestational days are indicated by asterisks, * (p<0.05).
95
CHAPTER 4
DISCUSSION
Chapter 4: Discussion
96
4.1 GESTATIONAL REGULATION OF MMP GENE AND PROTEIN EXPRESSION IN
THE RAT MYOMETRIUM
My results show that: 1) throughout gestation the majority of myometrial MMP genes
displayed low and stable expression that was highly upregulated PP. 2) Myometrial MMP-7
(matrilysin), MMP-11 (stromelysin-3), and MMP-12 (macrophage metalloelastase) genes and
proteins were induced at term. Particularly, on GD22 (term) MMP-7, MMP-12, and MMP-11
showed 200-fold, 150-fold and 15-fold increase respectively compared to early gestation (GD6),
which remained elevated during TL and PP. 3) Gelatin, collagen I, and collagen IV-degradation
mediated by MMP activity in the pregnant, labouring and PP myometrium can be attributed to
two cell types: myometrial SMCs and resident leukocytes (specifically CD68+ macrophages).
These in vivo results suggest a dual role for myometrial MMPs in regulating processes involved
in 1) promoting TL and 2) PP uterine involution.
During late gestation and TL the expression of certain MMP genes was significantly
different between gravid and non-gravid (empty) uterine horns of unilaterally pregnant rats. This
difference suggests that in vivo mechanical stretch or the presence of the fetus and/or placenta
may play a role in regulating MMP expression. To examine the potential regulatory role of
mechanical stretch, I performed in vitro studies using primary myometrial SMCs in combination
with Flexcell stretch system. My data indicate that there is not a direct effect of static mechanical
stretch on both MMP gene and secreted protein expression by human myometrial cells.
4.1.1 The Role of MMPs during Gestation, Term Labour, and Postpartum Involution
The myometrium undergoes dramatic changes in its cellular phenotypes and ECM
composition throughout pregnancy, TL and PP. During gestation, specific molecular mechanisms
Chapter 4: Discussion
97
must exist to regulate myometrial ECM remodeling to accommodate the growing fetus in a
quiescent environment, and yet be able to activate labour contractions at term [20, 35, 37].
Following parturition, the uterus is remodeled to a pre-pregnant state, which is accompanied by a
dramatic reduction in size which primarily involves rapid and extensive MMP-mediated ECM
degradation and cessation of cellular hypertrophy [31, 32, 35, 161, 162]. MMP activity during PP
involution has been studied extensively in rodents, undeniably correlating it with the dramatic
regeneration of uterine tissue including neo-angiogenesis, ECM transformation and modulation
of cellular phenotype [17, 29, 30, 34, 35]. MMP-7 was first identified by Woessner et al. due to
its high expression in the early PP rat uterus, whereas MMP-13 collagenase activity was also
recognized for its role in uterine involution [145, 161, 163-166]. However, little is known about
the role of other myometrial MMPs during gestation, active TL or PP.
Throughout gestation, myometrial SMCs change their phenotype from hyperplastic
(proliferative) to hypertrophic (or synthetic). Both stages of myometrial growth are associated
with ECM modifications to accommodate the increase in SMC number and size [49]. Therefore,
the major structural component of the uterine ECM, fibrillar collagen, must be constantly
reorganized for pregnancy maintenance [35]. Comparative analysis of overall MMP gene
expression (Figure 3.6) indicates that the collagenases (MMP-8&13) and gelatinases, especially
MMP-2, were highly (yet relatively stable) expressed throughout pregnancy with mRNA levels
being 100-300 fold higher in comparison to the lowest expressed MMP-10. In addition, the results
obtained from gelatin zymography indicate that throughout gestation, MMP-2 is constantly active,
whereas western blot analysis revealed persisting high levels of MMP-8 protein expression
(Figure 3.10), suggestive of restricted collagenolysis. Compared to the other collagenases MMP-
1 & 13, MMP-8 is known to preferentially cleave collagen type I, the most abundant collagen
type in the uterus [76]. Through speculation, it is plausible that similar to keratinocytes [167, 168],
Chapter 4: Discussion
98
when SMCs proliferate or expand in size, their cell-surface collagen integrin receptors (such as
α2β1) come into contact with the surrounding collagen I molecules, which may induce
intracellular signaling and increase expression of MMP-8. These findings point to the role of both
collagenases and gelatinases, in the modification of the ECM environment during pregnancy to
increase elasticity of the myometrium. This action is necessary to accommodate the growing
fetus/es, in which the collagenases would cleave fibrillar collagens into fragments that would be
denatured into gelatin. Furthermore, the gelatinases would then degrade gelatin into small peptide
fragments for rapid removal by the infiltrating immune cells possibly macrophages [162].
Although MMP-9 was highly expressed throughout gestation (Figure 3.6), MMP-9 protein
activity was not detected by gelatin zymography. This phenomenon has been previously reported,
suggesting that mRNA and protein abundances in cells correlate poorly due to different post-
transcriptional intracellular regulatory mechanisms, for instance microRNA (miRNA) can either
upregulate or silence gene expression [169-171]. The silencing is mediated by miRNA binding to
mRNA by complimentary alignment to 1) inhibit protein translation or 2) induce mRNA
degradation via RISC (RNA induced silencing complex) [172]. Several studies have revealed a
variety of miRNAs that target MMP mRNA, either by upregulating gelatinase expression (i.e.
miR-29b directly targets MMP-2) to directly promote cell proliferation and migration, or by
down-regulating gelatinase expression (miR-9 negatively modulates MMP-2 and -9 expression
indirectly by targeting their upstream NF-κB1 signaling) [171, 173-175]. It is also plausible to
speculate that MMP-9 function during TL is species- or tissue-specific, as was previously shown
by Roh et al. on the lack of progesterone-mediated suppression of MMP-9 production by human
myometrial cells, the effect that was previously observed in cultured rabbit cervical fibroblasts
[31].
Chapter 4: Discussion
99
My zymography results are in concordance with preceding data by Yin et al., which
reported prominent active and pro-form of MMP-2 and less intense MMP-9 bands in uterine tissue
homogenate from pregnant rats at mid-gestation (GD12) and late gestation (GD19). Unlike our
experiments that were done solely on the myometrium throughout rat gestation, they detected
weak MMP-9 activity in the uterine tissue, possibly due to the presence of the decidua, which was
not separated from the myometrium in their study [139]. In contrast, our immunohistochemical
examination of pregnant rat uterus detected prominent myometrial MMP-9 protein expression
(probably in its pro-MMP form). During late gestation (GD21) MMP-9 expression was localised
mostly intracellular, particularly in the perinuclear region of myocytes (i.e. in the endoplasmic
reticulum and Golgi bodies), but increased extracellularly during active TL (Figure 3.17). This
confirmed previous results by Roh et al. that reported in vivo expression of MMP-9 by SMCs,
interstitial fibroblasts and inflammatory cells in the term non-labouring and labouring human
myometrium samples [31].
My analysis revealed generally steady levels of MMPs-7, 11 and 12 genes throughout
gestation with upregulation at term. This profile correlates well with the second switch in the
myometrial phenotype during late gestation from synthetic to contractile [15] to support the
synchronized contractions of labour [34]. The stromelysins (MMP-3, 10, 11) and the related
MMPs (MMP-7 & 12) are capable of degrading elastin, cell adhesion molecules, proteoglycans,
fibronectin and components of the BM, laminin and collagen type IV [54, 99], which can modify
the ECM structural environment for active labour contractions. Although uterine MMP-7 was first
identified during PP involution [54, 161, 166], these findings – in which a strong correlation was
observed between gene and protein expression – suggest functionality of this enzyme during late
gestation and TL. In addition, active MMP-11 protein also showed a dramatic upregulation at late
gestation and active TL, as compared to the early gestation which corresponds well with its gene
Chapter 4: Discussion
100
expression (Figure 3.11). Protein expression for MMP-7, 11 & 12, and especially enzymatic
activity of the major gelatinase MMP-2 were all dramatically upregulated during PP, consistent
with their involvement in uterine involution and ECM remodeling resulting in reduced uterine
size. Additionally, due to the upregulation of CX-43 protein observed during TL to promote SMC
contractility, the ability of MMP-7 to degrade these junction proteins suggests its possible role in
controlling SMC connectivity after birth [176].
Similar to the temporal and spatial localization of MMP-9, MMP-7 & 11 proteins were
expressed by SMCs in both the longitudinal and circular myometrial layers. Their expression was
predominantly intracellular (in the perinuclear region) during mid and late-gestation, however, s
shift to extracellular MMP-7 protein localization occurred earlier during labour compared to
MMP-11 and was upregulated PP. Remarkably, positive staining indicated that MMP-9, MMP-7
and MMP-11 proteins were expressed not only by uterine myocytes but also by single cells
morphologically distinct from SMCs, localizing outside the muscle bundles. In accordance with
numerous publications, it is speculated that those cells are activated leukocytes recruited to the
myometrium to express pro-inflammatory cytokines and chemokines [11, 133]. Previous studies
have identified that macrophages were the predominant immune cells in the myometrium during
late gestation, TL and PP [11, 20, 62]. Consistent with these findings, our lab has previously
reported induction of MCP-1 (CCL2, chemokine involved in macrophage migration), and
confirmed an influx of CD68+ macrophages before and during TL in the rat myometrium [22].
Uterine leukocytes, especially macrophages can support active labour contractions by secreting
cytokines like IL-1β, IL-6, and TNF-α to promote the induction of CAPs [63]. Infiltrating
leukocytes are themselves known sources of MMPs, and additional MMPs produced by other
cells can further promote leukocyte migration into inflamed tissue [67, 75, 78]. In situ
zymography analysis suggests that uterine matrix remodeling by SMCs and leukocytes is MMP-
Chapter 4: Discussion
101
mediated as seen by degradation of fluorescent-labelled gelatin, collagen I, and collagen IV
substrates, known to be actively cleaved by MMPs [76]. This suggests that the increase in MMP
production by the rat myometrium correlates with leukocyte infiltration to promote term labour
and PP involution. Therefore, myometrial ECM degradation may actually be a combined result
of MMP secretion by both myometrial cells and infiltrating peripheral or resident leukocytes.
The role of MMP-11 in the myometrium, is not well defined. Previous studies have
indicated that MMP-11 can regulate BM stability and levels of fibronectin, collagen IV, and
laminin (BM components) in the ECM [76, 177, 178]. I speculate that the substantial increase in
MMP-11 during active labour (GD23) suggests a role in degrading BM surrounding individual
SMCs to increase SMC connectivity for coordinated myometrial contractions, and to facilitate
leukocyte migration within the myometrium [34, 35, 78, 178]. MMP-11 has also been described
to readily cleave α1-proteinase inhibitor (also known as α1-antitrypsin) that predominantly
inhibits neutrophil elastase (NE)-mediated degradation of ECM components, and α2-
macroglobulin – a general proteinase inhibitor that induces MMP removal by endocytosis [68,
179-181]. Based on the literature, MMP-11 can potentially maintain proteolytic activity of other
MMPs by preventing their inhibition during late gestation, TL and PP. Conversely, MMP-12
protein levels were also highly expressed throughout gestation and were further upregulated in
the rat myometrium PP (Figure 3.12). MMP-12 is expressed primarily by macrophages and is
important for their migration [78]. Previous reports have indicated an increase in the
monocyte/macrophage population in the rat and mouse myometrium prior to term, that remained
elevated during TL and PP. This sustained elevation suggests that in addition to myometrial SMCs
or fibroblasts (as skin-derived myofibroblasts/fibroblasts have been previously shown to be a
source of MMP-12), resident or infiltrating immune cells might be responsible for the observed
Chapter 4: Discussion
102
MMP-12 expression – especially higher mRNA levels within the gravid horn (compared to the
empty horn) during late gestation [20, 26, 182].
Analysis of TIMP expression in the rat myometrium (Figure 3.5 and 3.6) provides
potential explanation of the constant low expression and activity of MMPs throughout gestation.
Comparative analysis revealed that TIMP-2 exhibited the highest expression level from all TIMPs,
while TIMP-1 and TIMP-3 were also highly expressed throughout gestation, and their expression
pattern was similar to the gelatinases. This pattern of TIMP protein expression is similar to our
lab’s recent results in the human vagina [183]. It is known that TIMP-1 and TIMP-2 can form
specific complex with MMP-9 and MMP-2 (via their C-terminus), respectively, and further
interact with other MMPs via their N-terminus to potentially prevent their activation [107, 108].
These findings support the inhibitory role of TIMP-2 for the majority of MMPs, and the potential
interaction between TIMP-1 & 3 with MMP-2 & 9 to form inhibitory complexes in the rat
myometrium throughout gestation. Interestingly, a recent study that sought to compare the total
myometrial transcript repertoire between term and spontaneous TL (in humans) by high-
throughput RNA sequencing reported that TIMP-1 was the gene most highly upregulated in
association with labour [184]. Furthermore, in regards to the PP period, TIMP-3 & 4’s gene
expressions were highly upregulated (450-fold) suggesting their role in regulating PP involution
(Figure 3.5 and 3.6). Apart from MMP inhibition/activation, TIMPs are also known to have other
biological functions which include regulation of cell proliferation, migration, angiogenesis and
apoptosis. Since TIMP-3 has been observed to have pro-apoptotic function, while TIMP-4 is anti-
apoptotic, this correlates with the observed increase in expression for these two TIMPs during PP,
which may promote apoptosis of hypertrophied SMC and stimulate new cell growth and
regeneration respectively [69, 109, 114-117].
Chapter 4: Discussion
103
It has been previously reported that MMP-mediated degradation of ECM components can
result in biologically active peptides. Interestingly, these particular chemoattractive peptides can
originate from ECM components – such as elastin, laminin and fibronectin – that are known to be
cleavable substrates for MMP-7, 11 & 12. Elastin abundance is vital for the elastic recoil of the
uterine tissue and provides resilience when exposed to external stimuli. This property of elastin is
important in the reproductive tract to accommodate its enormous expansion in pregnancy [35].
However, elastin degradation can result in the generation of elastin-derived peptides with
chemotactic properties for monocyte recruitment [185]. MMP-12 indirectly promotes additional
elastin destruction by degrading the serine proteinase inhibitor α1-antitrypsin (which potentiates
NE activity) [179, 186]. Cleavage of the laminin α5 chain results in a chemotactic peptide that
has been shown to recruit leukocytes and induce MMP-9 production, both in vitro and in vivo
[187]. MMP-9-mediated hydrolysis of collagen can also result in a chemotactic fragment (Pro-
Gly-Pro) that is homologous to the major chemoattractant for neutrophils CXCL1/GROα/KC and
can activate the CXCL1 receptor to induce neutrophil chemotaxis in airway inflammation [78,
127, 188]. Moreover, fibronectin and hyaluronan fragments have been shown to stimulate
macrophage cytokine and chemokine production [189, 190]. Fibronectin fragments have also
been observed to stimulate transendothelial migration of HIV-1 infected leukocytes by
upregulating the expression of TNF-α which induces the expression of adhesion molecules like
selectins, ICAMs and VCAM-1 [191, 192]. This correlates with previous in vitro studies in our
lab that observed an upregulation of ICAM-1 in response to mechanical human myometrial
stretch-induced cytokines, which promoted leukocyte transendothelial migration [64]. Apart from
increasing chemoattraction, MMP-7 has also been shown to actively cleave VE-cadherin – one of
the junctional proteins that maintains vascular barrier function [193]. These findings additionally
Chapter 4: Discussion
104
suggest the MMP-specific production observed during late gestation and TL promotes leukocyte
recruitment and infiltration by upregulating chemotaxis and vascular EC permeability.
4.1.2 The Role of MMPs in Uterine Inflammation: Mutual Regulation
Labour and PP involution-associated pathways – which includes ECM remodeling – are
known to be largely stimulated by the expression of cytokines secreted by myometrial cells and
the active release of cytokines and growth factors already present in the ECM [194, 195]. It is
anticipated that the influx of leukocytes further amplifies the inflammatory signal to induce
parturition and PP involution through the release of leukocyte-derived cytokines (such as IL-1β
and TNF-α) and MMPs [17, 22, 29, 63, 64, 196]. Not surprisingly, monocytes/macrophages have
been identified to have the ability to secrete all soluble MMPs that were studied – MMP-1, 2, 3,
7, 8, 9, 10, 11, 12, and 13, as well as the four TIMPs [197]. Neutrophils, however, have been
reported to primarily secrete MMP-8, MMP-9 and MMP-12 [127, 196, 198]. Several cytokines
(i.e. TNF-α, and IL-1β) and growth factors (i.e. IGF-1 and TGF-β) have been previously shown
to regulate transcriptional activation of MMP genes in a variety of cells including
monocytes/macrophages in atherosclerotic plaques, glomerular mesangial cells, and the human
colonic epithelium [197, 199, 200]. Binding of cytokines and growth factors to their cell-surface
receptors results in upregulation of intracellular signaling (such as the mitogen-activated protein
kinases (MAPK) and NF-κB pathways) inducing MMP expression [200-203]. More importantly,
although these pro-inflammatory cytokines and growth factors can regulate MMP expression,
MMPs can also regulate their bioavailability by cleavage of their binding proteins [71, 204, 205].
As previously mentioned, MMP-mediated cleavage of ECM peptides can result in the
formation of chemotactic gradients, but can also regulate cytokine and chemokine release [67, 75,
78]. TNF-α is a potent pro-inflammatory cytokine that can be expressed as a membrane-bound
Chapter 4: Discussion
105
protein on the surface of macrophages, or secreted and bound to fibronectin and laminin [203,
206, 207]. MMP-mediated cleavage (especially MMP-7 and MMP-3) releases active TNF-α to
generate a chemoattractive gradient for macrophage recruitment and induce expression of labour-
associated genes (like prostaglandins) in the myometrium [208-210]. Another potent pro-
inflammatory cytokine IL-1β, can also be activated by MMP-mediated cleavage of its precursor
via MMP-2, 3 and 9. Interestingly, MMP-3 can degrade active IL-1β therefore suggesting a dual
role for MMPs in cytokine regulation [211]. Similar to MMP-3 inactivation of IL-1β, MMP-
mediated cleavage of CCL7 (by MMP-2) and MCP-1 (by MMP-1, -3 and -13) results in a
truncated peptide that is unable to bind to the CC chemokine receptor. MMP-9 processing of
mature chemokine IL-8/CXCL8 has been reported to result in a more effective chemoattractant
for neutrophil recruitment [127]. Furthermore, previous studies have reported that MMP-null
mice displayed diminished leukocyte infiltration into the targeted tissue – such as MMP-7
knockout demonstrated impaired neutrophil efflux into the alveolar space due to the lack of MMP-
7 mediated shedding of syndecan-1 and release of CXCL1 to generate a chemotactic gradient
[124]. These findings suggest that MMPs identified in the rat myometrium show a possible
involvement in the regulation of cytokine and chemokine bioavailability and activity. This further
reinforces the role of MMPs in regulating leukocyte migration and leukocyte-mediated
inflammation.
The family of insulin-like growth factors, in particular IGF-1 and IGF-II are known to
stimulate cell proliferation, collagen synthesis, and muscle growth/regeneration, therefore making
their bioavailability important to assist PP uterine involution to a non-pregnant state [212-214].
The IGF-signaling system is tightly regulated by IGFBPs which prevent IGF-1 and IGF-II from
binding to the IGF-1 receptor [194, 215]. MMP-7-mediated cleavage of IGFBP-5 is capable of
liberating IGF-II to function as an autocrine myofibroblast growth factor [215]. Interestingly,
Chapter 4: Discussion
106
Shynlova et al. previously reported an increase in IGF-1, IGFBP-5 and the IGF-1 receptor in the
rat myometrium during TL and PP involution [37]. In accordance, the observed increase in MMP-
7 can conceivably suggests a potential role for this enzyme in upregulating IGF-1 signaling in the
myometrium. Another growth factor, TGF-β is secreted in its inactive form which can be
associated with the interstitial ECM through latent TGF-β binding proteins (LTBPs) [194, 216-
218]. Active TGF-β can also bind to collagen IV, fibronectin and heparin-sulfate proteoglycans
(HSPGs). MMP-mediated release of TGF-β bound to ECM components results in a potent
chemoattractant for monocytes and macrophages, and further stimulates their expression of bFGF
and TNF-α [204]. These reports together with the data provide evidence to support that MMP
expression in the PP rat myometrium mediates ECM remodeling and also promotes tissue
regeneration through the liberation of growth factors.
4.1.3 Regulation of Myometrial MMP Expression: Potential Mechanisms
Yin et al. had previously reported that stretch of myometrium strips isolated from virgin
rats was associated with an increase in gelatinase expression and activity, which was further
enhanced following hormonal treatment with 17-β estradiol and progesterone. This study
suggested that MMP expression could be regulated by mechanical stretch of the uterine walls by
growing fetuses [139]. As a result, a unilaterally pregnant rat model was employed to thoroughly
investigate the potential mechanisms of myometrial MMP activation [35]. It was observed that
mRNA levels of MMP-7, 11 and 12 in the gravid uterine horn was greater during labour as
compared to the empty uterine horn, however, protein levels did not exhibit similar differences.
Furthermore, gelatin zymography revealed a stable expression profile for pro-MMP-2 protein
throughout gestation, which depicts no differences between empty and gravid uterine horns
(Figure 3.13). Surprisingly, starting from early gestation until term, active MMP-2 was higher in
Chapter 4: Discussion
107
the empty horn compared to the gravid horn. Based on my results from bilaterally pregnant rats,
which exhibited dramatic increase in activated MMP-2 during PP (when the fetus is expelled),
these findings suggest that during gestation and labour, MMP-2 activity in the gravid horn is
suppressed by the presence of fetal/placental units (possibly inhibins or TGF-β capable of down-
regulating MMP expression) while this suppression is absent in the empty uterine horn [219].
It can be speculated that since MMP expression can be cytokine-mediated, the observed
difference in gene expression is a result of activation by cytokines derived from infiltrating
leukocytes, the placenta, and fetal membranes present in the gravid horn [10, 20, 78, 197, 200,
220, 221]. In accordance, the mRNA expression of MMP-3, 8 and 11 was also dramatically
upregulated in the gravid uterine horn 24 hours after the delivery of the fetus due to tissue
remodeling during PP involution; and was not stretch-dependent [17, 22, 29, 33, 35, 64, 82].
Additionally, active MMP-12 protein was greatly detected in the gravid horn (compared to the
empty horn) of the PP uterus, which may indicate the presence of MMP-secreting immune cells
[78]. These findings suggest that mechanical stretch may not play a direct role in the regulation
of MMP expression, but rather is regulated by factors from the fetal/placental units.
One of the possible molecular mechanisms of MMP gene regulation before labour is the
activator protein (AP)-1 family of transcription factors (Jun and Fos) that are known to
transcriptionally activate a variety of myometrial genes involved in the labouring process [222,
223]. Previous studies found that many ECM, CAPs, MMPs and TIMPs genes contain AP-1 sites
in their promoter regions [223, 224]. In particular, all the MMPs that were highly regulated in the
rat myometrium contained the AP-1 promoter region – MMP-9, 7, 12 and 11 (AP-1-like region)
[74]. It was also reported that mRNA levels of cFos, FosB and JunB transcription factors are
increased in the rat myometrium during TL, implicating their role in regulating parturition [223,
225]. I suggest that at term, upregulated myometrial AP-1 proteins that promote the expression of
Chapter 4: Discussion
108
ECM components, CAPs, and cytokines, can also influence the expression of certain MMPs. The
direct mechanism is currently unknown; however, given that IL-1β and TNF-α is expressed in the
labouring myometrium and can stimulate AP-1 transcriptional activity, it can be speculated that
myometrial MMPs might be regulated by cytokine-mediated induction of AP-1 transcription
factors [17, 74, 226, 227].
4.2 CHANGES OF MYOMETRIAL MMPs ARE NOT AN EFFECT OF MECHANICAL
STRETCH (IN VITRO PRIMARY CELL MODEL)
Results from the in vivo experiments using isolated rat myocytes did not allow us to
conclude whether myometrial MMP expression is regulated by mechanical stretch. However, this
contradicts the previously observed increase in gelatinases as a result of mechanically stretch rat
myometrial strips [139]. Particularly, cyclic mechanical stretch of reproductive cells in vitro
resulted in augmented expression of MMP-1 in both cultured human uterine cervical fibroblasts
cells and human decidual cells [147, 228]. To further investigate the potential mechanical
regulation of MMP expression, in vitro stretch experiments were performed using primary human
myometrial cells. Overall, the in vitro experiments using primary human cells are consistent with
the results from the in vivo rat studies, and indicated that there was no effect of static mechanical
stretch on MMP-1, 2, 3, 11 and TIMP-1&2 gene expression. Additionally, the analysis of secreted
MMP and TIMP proteins within the conditioned media demonstrated that in vitro mechanical
stretch also had no significant effect on MMP secretion by primary human myometrial cells.
However, 24 hour static mechanical stretch that was followed by an additional 24 hours of
relaxation (mimicking the release of stretch in the PP period following labour) resulted in a change
in mRNA expression for human MMP-1, 2, 3 and 11.
Chapter 4: Discussion
109
One possible explanation for this observation is that prolonged serum-starvation (72 hours
in total) – media containing ITS-A (Life Technologies Inc.) supplement instead of FBS – may
influence the expression of multiple MMPs. In addition, our in vitro results contradict the findings
of Zhao et al., who previously reported that cyclic stretch augmented MMP-1 production in
human uterine SMCs [229]. I noticed that the recorded increase in MMP expression in other
cultured primary uterine cells – human decidua, cervical fibroblasts, and myometrial SMCs –
were always a result of cyclic mechanical stretch, while our study employed static mechanical
stretch to simulate continuous stretch by the growing fetus during pregnancy [17, 64, 147, 228,
229]. It is suggestive that our model of biologic static stretch mimics a quiescent pregnancy
environment and was not able to stimulate MMPs, while cyclic stretch, which simulates active
labour contractions, might show direct effect on MMP expression. Based on these findings, the
mechanisms that regulate myometrium MMPs need to be further elucidated.
4.3 CONCLUSION: A PROPOSED MODEL FOR THE ROLE OF MYOMETRIAL
MMPS DURING LATE GESTATION, TERM LABOUR, AND POSTPARTUM
INVOLUTION
In summary, the main findings from the in vivo studies using the bilaterally pregnant rat
model clearly suggests two distinct roles for MMPs within the myometrium. Expression of
specific MMPs by myometrial SMCs is 1) constantly expressed throughout gestation to remodel
the ECM and to increase elasticity of the tissue to accommodate the growing fetus, and 2)
upregulated during late gestation to promote leukocyte infiltration to support active labour
contractions. In addition, infiltrating leukocytes express MMPs to remodel the ECM and amplify
the inflammatory signal. MMP expression is further upregulated during the PP period to 1)
Chapter 4: Discussion
110
remodel the ECM back to a pre-pregnant state and 2) promote tissue regeneration following birth.
Based on our findings from characterizing the gestational profile of soluble MMP expression
within the rat myometrium, I propose the following model to explain the role of myometrial
MMPs (Figure 4.1).
Results from my studies suggest that expression/activity of specific MMPs (MMP-7, 11
and 12) may be important for mediating the transition from term to active labour. Therefore MMP-
7, 11 and 12 can act as potential targets for the development of novel therapeutic strategies for
prevention of PTL. For instance, instead of the use of a broad spectrum MMP inhibitor (i.e.
GM6001), an inhibitor specific to MMP-7, 11 or 12 may provide favourable outcomes for women
at risk for PTL – such as synthetic MMP Inhibitor II or III (Santa Cruz Biotechnology, Inc., Dallas,
Texas, USA). Moreover, in vitro static mechanical stretch (which resembles uterine stretch during
gestation) has no effect of MMP gene and protein expression in primary human myometrial cells.
Further studies must be performed to elucidate 1) the possible regulatory role of cyclic mechanical
stretch on the expression of the MMPs studied and 2) the functional role of myometrial MMPs.
Chapter 4: Discussion
111
Figure 4.1. Evidence-based model for the role of myometrial MMPs during labour and
postpartum involution.
Based on our data and previous studies in the literature, I suggest that near term, hormonal
changes and expression of pro-inflammatory cytokines 1) induces the secretion of multiple
MMPs by myometrial cells. 2) By degrading ECM components, myometrial MMPs would
increase leukocyte chemoattraction and vascular permeability to 3) facilitate peripheral
leukocyte recruitment and transendothelial migration into the uterine smooth muscle. Within the
myometrium, these activated leukocytes can secrete pro-inflammatory cytokines and MMPs to
4) amplify the inflammatory signal and promote the laboring process and 5) promote ECM
remodeling during postpartum involution to return the uterus back to a pre-pregnant state.
112
CHAPTER 5
FUTURE DIRECTIONS
Chapter 5: Future Directions
113
5.1 FUTURE DIRECTIONS
The major findings from the two in vivo rat models of pregnancy suggested the role of
MMPs during late gestation and TL is to regulate ECM remodeling to accommodate uterine
contractions and promote leukocyte infiltration, possibly by increasing vascular permeability. In
situ zymography revealed that CD45+ leukocytes in the myometrium, especially CD68+
macrophages expressed gelatin, collagen I and collagen IV-degrading enzymes (Figure 3.20-
3.23), consistent with MMP expression. To confirm our results, fluorescent immunohistochemical
studies should be performed for co-expression of markers of different immune cells (i.e. CD68,
NE, CD3 etc.) and MMP-specific antibodies to identify specific leukocyte populations expressing
MMPs. A previous study by Koscica et al. reported that the administration of broad-spectrum
MMP inhibitor GM6001 resulted in reduced rates of PTL in mice [140]. Therefore further animal
studies could be performed to characterize the MMP expression profile in the GM6001-mediated
PTL attenuation model (with PTL induced by RU-486 and LPS) and investigate the effect of more
specific MMP inhibitors – that would target specific MMP subgroups – on the rate of PTL.
Current results from both in vivo and in vitro models suggest that there is no effect of
mechanical stretch on MMPs expression. Zhao et al. however reported increased expression of
MMP-1 by primary human myometrial cells in response to cyclic mechanical stretch. Based on
the aforementioned in vitro studies, it is also possible that applying cyclic stretch – instead of or
following static stretch – to simulate active labour contractions may better induce expression of
the major MMPs studied (MMP-7 and MMP-11) to resemble the changes observed in the in vivo
rat models, and better define the regulation of MMP expression (by mechanical stretch) during
TL [147, 228, 229].
Chapter 5: Future Directions
114
It has been shown that hormones (estrogen and progesterone), pro-inflammatory
cytokines (i.e. IL-1β), growth factors (i.e. IGF-1), and cell-adhesion molecules (i.e. VCAM-1 with
LFA-1) affect MMP expression [31, 135, 230, 231]. Modification to the cell culture system by
treatment of myometrial cells with 1) mifepristone (the progesterone antagonist RU486) or 2)
cytokines and/or growth factors may allow for better understanding of MMP regulated expression
[64, 71, 85]. Alternatively, co-culture of myometrial cells (either hTERT-HM cell line or primary
myometrial cells) with other cells such as ECs and certain leukocytes populations (i.e. human
monocytic cell line THP-1), may reveal expression changes of MMPs in vitro that would better
simulate in vivo conditions (i.e. cellular interactions) and provide potential evidence of
upregulating MMPs to promote TL and PP involution.
We suggest that the major role of myometrial MMPs is to promote transendothelial
migration of leukocytes into the myometrium by upregulating vascular permeability – based on
the substrates that certain MMPs are able to cleave include BM components, gap junction and cell
adhesion proteins [67, 134, 193]. To investigate the functional role of myometrial MMPs on
endothelial cell permeability, a transendothelial permeability assay can be employed using the
human uterine microvascular endothelial cell line (hUtMVEC-Myo, Lonza, currently used in the
Lye lab) [64]. EC barrier function can be assessed by testing the ability of a fluorescein probe to
pass from the upper to lower chamber of the endothelium-covered inserts with/without the broad
spectrum MMP inhibitor GM6001, or MMP inhibitors more specific to MMP-7 and 11.
References
115
REFERENCS
1. Liu, L., H.L. Johnson, S. Cousens, J. Perin, S. Scott, J.E. Lawn, I. Rudan, H. Campbell,
R. Cibulskis, M. Li, C. Mathers, R.E. Black, W.H.O. Child Health Epidemiology
Reference Group of, and Unicef, Global, regional, and national causes of child
mortality: an updated systematic analysis for 2010 with time trends since 2000. Lancet,
2012. 379(9832): p. 2151-61.
2. Rush, R.W., M.J. Keirse, P. Howat, J.D. Baum, A.B. Anderson, and A.C. Turnbull,
Contribution of preterm delivery to perinatal mortality. Br Med J, 1976. 2(6042): p. 965-
8.
3. European Community collaborative study of outcome of pregnancy between 22 and 28
weeks' gestation. Working Group on the Very Low Birthweight Infant. Lancet, 1990.
336(8718): p. 782-4.
4. McCormick, M.C., The contribution of low birth weight to infant mortality and
childhood morbidity. N Engl J Med, 1985. 312(2): p. 82-90.
5. Shapiro-Mendoza, C.K. and E.M. Lackritz, Epidemiology of late and moderate preterm
birth. Semin Fetal Neonatal Med, 2012. 17(3): p. 120-5.
6. Goldenberg, R.L., J.D. Iams, J.F. Culhane, and R. Romero, Epidemiology and causes of
preterm birth. Lancet, 2008. 371(9606): p. 75-84.
7. Ward, R.M. and J.C. Beachy, Neonatal complications following preterm birth. BJOG:
An International Journal of Obstetrics & Gynaecology, 2003. 110 Suppl 20: p. 8-16.
8. Jabbour, H.N., K.J. Sales, R.D. Catalano, and J. Norman, Inflammatory pathways in
female reproductive health and disease. Reproduction, 2009. 138(6): p. 903-919.
9. Nelson, S.M., A.H. Khan, and J. Norman, Cervical and myometrial physiology and
preterm labor. Expert Rev. Obstet. Gynecol., 2007. 2(2): p. 179-192.
10. Thomson, A.J., J.F. Telfer, A. Young, S. Campbell, C.J. Stewart, I.T. Cameron, I.A.
Greer, and J.E. Norman, Leukocytes infiltrate the myometrium during human
parturition: further evidence that labour is an inflammatory process. Hum Reprod,
1999. 14(1): p. 229-36.
11. Osman, I., A. Young, M.A. Ledingham, A.J. Thomson, F. Jordan, I.A. Greer, and J.E.
Norman, Leukocyte density and pro-inflammatory cytokine expression in human fetal
membranes, decidua, cervix and myometrium before and during labour at term. Mol
Hum Reprod, 2003. 9(1): p. 41-5.
12. Sakamoto, Y., P. Moran, J.N. Bulmer, R.F. Searle, and S.C. Robson, Macrophages and
not granulocytes are involved in cervical ripening. J Reprod Immunol, 2005. 66(2): p.
161-73.
13. Romero, R., J. Espinoza, L.F. Goncalves, J.P. Kusanovic, L. Friel, and J.K. Nien,
Inflammation in preterm and term labour and delivery. Seminars in Fetal & Neonatal
Medicine, 2006. 11(5): p. 317-326.
References
116
14. Garfield, R.E., G. Saade, C. Buhimschi, I. Buhimschi, L. Shi, S.Q. Shi, and K. Chwalisz,
Control and assessment of the uterus and cervix during pregnancy and labour. Hum
Reprod Update, 1998. 4(5): p. 673-95.
15. Challis, J.R.G., S.G. Matthews, W. Gibb, and S.J. Lye, Endocrine and paracrine
regulation of birth at term and preterm. Endocr Rev, 2000. 21(5): p. 514-50.
16. Bokstrom, H., M. Brannstrom, M. Alexandersson, and A. Norstrom, Leukocyte
subpopulations in the human uterine cervical stroma at early and term pregnancy. Hum
Reprod, 1997. 12(3): p. 586-90.
17. Shynlova, O., Y.H. Lee, K. Srikhajon, and S.J. Lye, Physiologic uterine inflammation
and labor onset: integration of endocrine and mechanical signals. Reprod Sci, 2013.
20(2): p. 154-67.
18. Renthal, N.E., K.C. Williams, and C.R. Mendelson, MicroRNAs--mediators of
myometrial contractility during pregnancy and labour. Nat Rev Endocrinol, 2013. 9(7):
p. 391-401.
19. Mendelson, C.R., Minireview: fetal-maternal hormonal signaling in pregnancy and
labor. Mol Endocrinol, 2009. 23(7): p. 947-54.
20. Shynlova, O., T. Nedd-Roderique, Y. Li, A. Dorogin, and S.J. Lye, Myometrial immune
cells contribute to term parturition, preterm labour and post-partum involution in mice.
J Cell Mol Med, 2013. 17(1): p. 90-102.
21. Dong, X., C. Yu, O. Shynlova, J.R. Challis, P.S. Rennie, and S.J. Lye, p54nrb is a
transcriptional corepressor of the progesterone receptor that modulates transcription of
the labor-associated gene, connexin 43 (Gja1). Mol Endocrinol, 2009. 23(8): p. 1147-
60.
22. Shynlova, O., P. Tsui, A. Dorogin, and S.J. Lye, Monocyte chemoattractant protein-1
(CCL-2) integrates mechanical and endocrine signals that mediate term and preterm
labor. J Immunol, 2008. 181(2): p. 1470-9.
23. Chwalisz, K. and R.E. Garfield, Role of nitric oxide in the uterus and cervix:
implications for the management of labor. J Perinat Med, 1998. 26(6): p. 448-57.
24. Romero, R., O. Erez, and J. Espinoza, Intrauterine infection, preterm labor, and
cytokines. Journal of the Society for Gynecologic Investigation, 2005. 12(7): p. 463-465.
25. Osman, I., A. Young, F. Jordan, I.A. Greer, and J.E. Norman, Leukocyte density and
proinflammatory mediator expression in regional human fetal membranes and decidua
before and during labor at term. J Soc Gynecol Investig, 2006. 13(2): p. 97-103.
26. Hamilton, S., Y. Oomomian, G. Stephen, O. Shynlova, C.L. Tower, A. Garrod, S.J. Lye,
and R.L. Jones, Macrophages infiltrate the human and rat decidua during term and
preterm labor: evidence that decidual inflammation precedes labor. Biol Reprod, 2012.
86(2): p. 39.
27. Romero, R., F. Gotsch, M. Mazor, J. Espinoza, T. Chaiworapongsa, O. Erez, J.P.
Kusanovic, and S. Hassan, The preterm parturition syndrome. BJOG: An International
Journal of Obstetrics & Gynaecology, 2006. 113 Suppl 3: p. 17-42.
References
117
28. Shynlova, O., T. Nedd-Roderique, Y. Li, A. Dorogin, T. Nguyen, and S.J. Lye,
Infiltration of myeloid cells into decidua is a critical early event in the labour cascade
and post-partum uterine remodelling. J Cell Mol Med, 2013. 17(2): p. 311-24.
29. Shynlova, O., P. Tsui, S. Jaffer, and S.J. Lye, Integration of endocrine and mechanical
signals in the regulation of myometrial functions during pregnancy and labour. Eur J
Obstet Gynecol Reprod Biol, 2009. 144 Suppl 1: p. S2-10.
30. Hulboy, D.L., L.A. Rudolph, and L.M. Matrisian, Matrix metalloproteinases as
mediators of reproductive function. Mol Hum Reprod, 1997. 3(1): p. 27-45.
31. Roh, C.R., W.J. Oh, B.K. Yoon, and J.H. Lee, Up-regulation of matrix
metalloproteinase-9 in human myometrium during labour: a cytokine-mediated process
in uterine smooth muscle cells. Mol Hum Reprod, 2000. 6(1): p. 96-102.
32. Halme, J. and J.F. Woessner, Jr., Effect of progesterone on collagen breakdown and
tissue collagenolytic activity in the involuting rat uterus. J Endocrinol, 1975. 66(3): p.
357-62.
33. Hsu, K.F., H.A. Pan, Y.Y. Hsu, C.M. Wu, W.J. Chung, and S.C. Huang, Enhanced
myometrial autophagy in postpartum uterine involution. Taiwan J Obstet Gynecol, 2014.
53(3): p. 293-302.
34. Nishinaka, K. and Y. Fukuda, Changes in extracellular matrix materials in the uterine
myometrium of rats during pregnancy and postparturition. Acta Pathol Jpn, 1991. 41(2):
p. 122-32.
35. Shynlova, O., J.A. Mitchell, A. Tsampalieros, B.L. Langille, and S.J. Lye, Progesterone
and gravidity differentially regulate expression of extracellular matrix components in the
pregnant rat myometrium. Biol Reprod, 2004. 70(4): p. 986-92.
36. Walker, C.G., S. Meier, H. Hussein, S. McDougall, C.R. Burke, J.R. Roche, and M.D.
Mitchell, Modulation of the immune system during postpartum uterine inflammation.
Physiol Genomics, 2015. 47(4): p. 89-101.
37. Shynlova, O., P. Tsui, A. Dorogin, B.L. Langille, and S.J. Lye, Insulin-like growth
factors and their binding proteins define specific phases of myometrial differentiation
during pregnancy in the rat. Biol Reprod, 2007. 76(4): p. 571-8.
38. Jones, R.L., N.J. Hannan, T.J. Kaitu'u, J. Zhang, and L.A. Salamonsen, Identification of
chemokines important for leukocyte recruitment to the human endometrium at the times
of embryo implantation and menstruation. J Clin Endocrinol Metab, 2004. 89(12): p.
6155-67.
39. Kayisli, U.A., N.G. Mahutte, and A. Arici, Uterine chemokines in reproductive
physiology and pathology. Am J Reprod Immunol, 2002. 47(4): p. 213-21.
40. Christiaens, I., D.B. Zaragoza, L. Guilbert, S.A. Robertson, B.F. Mitchell, and D.M.
Olson, Inflammatory processes in preterm and term parturition. J Reprod Immunol,
2008. 79(1): p. 50-7.
41. Matsumoto, J., [Changes of the contraction of the circular and longitudinal muscles of
pregnant rat myometrium during pregnancy (author's transl)]. Nihon Sanka Fujinka
Gakkai Zasshi, 1980. 32(11): p. 1749-57.
References
118
42. Izumi, H., Changes in the mechanical properties of the longitudinal and circular muscle
tissues of the rat myometrium during gestation. Br J Pharmacol, 1985. 86(1): p. 247-57.
43. Weiss, S., T. Jaermann, P. Schmid, P. Staempfli, P. Boesiger, P. Niederer, R. Caduff,
and M. Bajka, Three-dimensional fiber architecture of the nonpregnant human uterus
determined ex vivo using magnetic resonance diffusion tensor imaging. Anat Rec A
Discov Mol Cell Evol Biol, 2006. 288(1): p. 84-90.
44. Aguilar, H.N. and B.F. Mitchell, Physiological pathways and molecular mechanisms
regulating uterine contractility. Hum Reprod Update, 2010. 16(6): p. 725-44.
45. Seki, T., I. Naito, T. Oohashi, Y. Sado, and Y. Ninomiya, Differential expression of type
IV collagen isoforms, alpha5(IV) and alpha6(IV) chains, in basement membranes
surrounding smooth muscle cells. Histochem Cell Biol, 1998. 110(4): p. 359-66.
46. Ross, R. and S.J. Klebanoff, The smooth muscle cell. I. In vivo synthesis of connective
tissue proteins. J Cell Biol, 1971. 50(1): p. 159-71.
47. Shynlova, O., M. Chow, and S.J. Lye, Expression and organization of basement
membranes and focal adhesion proteins in pregnant myometrium is regulated by uterine
stretch. Reprod Sci, 2009. 16(10): p. 960-9.
48. Shynlova, O., A. Oldenhof, A. Dorogin, Q. Xu, J. Mu, N. Nashman, and S.J. Lye,
Myometrial apoptosis: activation of the caspase cascade in the pregnant rat
myometrium at midgestation. Biol Reprod, 2006. 74(5): p. 839-49.
49. Shynlova, O., R. Kwong, and S.J. Lye, Mechanical stretch regulates hypertrophic
phenotype of the myometrium during pregnancy. Reproduction, 2010. 139(1): p. 247-53.
50. Shynlova, O., S.J. Williams, H. Draper, B.G. White, D.J. MacPhee, and S.J. Lye,
Uterine stretch regulates temporal and spatial expression of fibronectin protein and its
alpha 5 integrin receptor in myometrium of unilaterally pregnant rats. Biol Reprod,
2007. 77(5): p. 880-8.
51. Xu, C., A. Long, X. Fang, S.L. Wood, D.M. Slater, X. Ni, and D.M. Olson, Effects of
PGF2alpha on the expression of uterine activation proteins in pregnant human
myometrial cells from upper and lower segment. J Clin Endocrinol Metab, 2013. 98(7):
p. 2975-83.
52. Xie, N., L. Liu, Y. Li, C. Yu, S. Lam, O. Shynlova, M. Gleave, J.R. Challis, S. Lye, and
X. Dong, Expression and function of myometrial PSF suggest a role in progesterone
withdrawal and the initiation of labor. Mol Endocrinol, 2012. 26(8): p. 1370-9.
53. Hertelendy, F. and T. Zakar, Regulation of myometrial smooth muscle functions. Curr
Pharm Des, 2004. 10(20): p. 2499-517.
54. Bonnans, C., J. Chou, and Z. Werb, Remodelling the extracellular matrix in development
and disease. Nat Rev Mol Cell Biol, 2014. 15(12): p. 786-801.
55. Fullar, A., J. Dudas, L. Olah, P. Hollosi, Z. Papp, G. Sobel, K. Karaszi, S. Paku, K.
Baghy, and I. Kovalszky, Remodeling of extracellular matrix by normal and tumor-
associated fibroblasts promotes cervical cancer progression. BMC Cancer, 2015. 15(1):
p. 256.
References
119
56. Hynes, R.O., The extracellular matrix: not just pretty fibrils. Science, 2009. 326(5957):
p. 1216-9.
57. Tency, I., H. Verstraelen, I. Kroes, G. Holtappels, B. Verhasselt, M. Vaneechoutte, R.
Verhelst, and M. Temmerman, Imbalances between matrix metalloproteinases (MMPs)
and tissue inhibitor of metalloproteinases (TIMPs) in maternal serum during preterm
labor. PLoS One, 2012. 7(11): p. e49042.
58. Xu, P., N. Alfaidy, and J.R. Challis, Expression of matrix metalloproteinase (MMP)-2
and MMP-9 in human placenta and fetal membranes in relation to preterm and term
labor. J Clin Endocrinol Metab, 2002. 87(3): p. 1353-61.
59. Riemer, R.K. and M.A. Heymann, Regulation of uterine smooth muscle function during
gestation. Pediatr Res, 1998. 44(5): p. 615-27.
60. Granstrom, L., G. Ekman, U. Ulmsten, and A. Malmstrom, Changes in the connective
tissue of corpus and cervix uteri during ripening and labour in term pregnancy. Br J
Obstet Gynaecol, 1989. 96(10): p. 1198-202.
61. Garfield, R.E. and R.H. Hayashi, Appearance of gap junctions in the myometrium of
women during labor. Am J Obstet Gynecol, 1981. 140(3): p. 254-60.
62. Bollapragada, S., R. Youssef, F. Jordan, I. Greer, J. Norman, and S. Nelson, Term labor
is associated with a core inflammatory response in human fetal membranes,
myometrium, and cervix. Am J Obstet Gynecol, 2009. 200(1): p. 104 e1-11.
63. Gomez-Lopez, N., D. StLouis, M.A. Lehr, E.N. Sanchez-Rodriguez, and M. Arenas-
Hernandez, Immune cells in term and preterm labor. Cell Mol Immunol, 2014. 11(6): p.
571-81.
64. Lee, Y.H., O. Shynlova, and S.J. Lye, Stretch-induced human myometrial cytokines
enhance immune cell recruitment via endothelial activation. Cell Mol Immunol, 2015.
12(2): p. 231-42.
65. Tallant, C., A. Marrero, and F.X. Gomis-Ruth, Matrix metalloproteinases: fold and
function of their catalytic domains. Biochim Biophys Acta, 2010. 1803(1): p. 20-8.
66. Sternlicht, M.D. and Z. Werb, How matrix metalloproteinases regulate cell behavior.
Annu Rev Cell Dev Biol, 2001. 17: p. 463-516.
67. Van Lint, P. and C. Libert, Chemokine and cytokine processing by matrix
metalloproteinases and its effect on leukocyte migration and inflammation. J Leukoc
Biol, 2007. 82(6): p. 1375-81.
68. Murphy, G. and H. Nagase, Progress in matrix metalloproteinase research. Mol Aspects
Med, 2008. 29(5): p. 290-308.
69. Visse, R. and H. Nagase, Matrix metalloproteinases and tissue inhibitors of
metalloproteinases: structure, function, and biochemistry. Circ Res, 2003. 92(8): p. 827-
39.
70. Braundmeier, A.G. and R.A. Nowak, Cytokines regulate matrix metalloproteinases in
human uterine endometrial fibroblast cells through a mechanism that does not involve
increases in extracellular matrix metalloproteinase inducer. Am J Reprod Immunol,
2006. 56(3): p. 201-14.
References
120
71. Curry, T.E., Jr. and K.G. Osteen, Cyclic changes in the matrix metalloproteinase system
in the ovary and uterus. Biol Reprod, 2001. 64(5): p. 1285-96.
72. Braundmeier, A.G., A.T. Fazleabas, B.A. Lessey, H. Guo, B.P. Toole, and R.A. Nowak,
Extracellular matrix metalloproteinase inducer regulates metalloproteinases in human
uterine endometrium. J Clin Endocrinol Metab, 2006. 91(6): p. 2358-65.
73. Werb, Z., P. Tremble, and C.H. Damsky, Regulation of extracellular matrix degradation
by cell-extracellular matrix interactions. Cell Differ Dev, 1990. 32(3): p. 299-306.
74. Chakraborti, S., M. Mandal, S. Das, A. Mandal, and T. Chakraborti, Regulation of
matrix metalloproteinases: an overview. Mol Cell Biochem, 2003. 253(1-2): p. 269-85.
75. Parks, W.C., C.L. Wilson, and Y.S. Lopez-Boado, Matrix metalloproteinases as
modulators of inflammation and innate immunity. Nat Rev Immunol, 2004. 4(8): p. 617-
29.
76. Sbardella, D., G.F. Fasciglione, M. Gioia, C. Ciaccio, G.R. Tundo, S. Marini, and M.
Coletta, Human matrix metalloproteinases: an ubiquitarian class of enzymes involved in
several pathological processes. Mol Aspects Med, 2012. 33(2): p. 119-208.
77. Page-McCaw, A., A.J. Ewald, and Z. Werb, Matrix metalloproteinases and the
regulation of tissue remodelling. Nat Rev Mol Cell Biol, 2007. 8(3): p. 221-33.
78. Manicone, A.M. and J.K. McGuire, Matrix metalloproteinases as modulators of
inflammation. Semin Cell Dev Biol, 2008. 19(1): p. 34-41.
79. Rundhaug, J.E., Matrix metalloproteinases and angiogenesis. Journal of cellular and
molecular medicine, 2005. 9(2): p. 267-85.
80. Sela-Passwell, N., G. Rosenblum, T. Shoham, and I. Sagi, Structural and functional
bases for allosteric control of MMP activities: can it pave the path for selective
inhibition? Biochim Biophys Acta, 2010. 1803(1): p. 29-38.
81. Nagase, H. and J.F. Woessner, Jr., Matrix metalloproteinases. J Biol Chem, 1999.
274(31): p. 21491-4.
82. Fata, J.E., A.T. Ho, K.J. Leco, R.A. Moorehead, and R. Khokha, Cellular turnover and
extracellular matrix remodeling in female reproductive tissues: functions of
metalloproteinases and their inhibitors. Cell Mol Life Sci, 2000. 57(1): p. 77-95.
83. Yan, C. and D.D. Boyd, Regulation of matrix metalloproteinase gene expression. J Cell
Physiol, 2007. 211(1): p. 19-26.
84. Mignatti, P. and D.B. Rifkin, Biology and biochemistry of proteinases in tumor invasion.
Physiol Rev, 1993. 73(1): p. 161-95.
85. Denison, F.C., S.C. Riley, C.L. Elliott, R.W. Kelly, A.A. Calder, and H.O. Critchley,
The effect of mifepristone administration on leukocyte populations, matrix
metalloproteinases and inflammatory mediators in the first trimester cervix. Mol Hum
Reprod, 2000. 6(6): p. 541-8.
86. Huang, H.Y., Y. Wen, J.C. Irwin, J.S. Kruessel, Y.K. Soong, and M.L. Polan, Cytokine-
mediated regulation of 92-kilodalton type IV collagenase, tissue inhibitor or
metalloproteinase-1 (TIMP-1), and TIMP-3 messenger ribonucleic acid expression in
human endometrial stromal cells. J Clin Endocrinol Metab, 1998. 83(5): p. 1721-9.
References
121
87. Graham, C.H., I. Connelly, J.R. MacDougall, R.S. Kerbel, W.G. Stetler-Stevenson, and
P.K. Lala, Resistance of malignant trophoblast cells to both the anti-proliferative and
anti-invasive effects of transforming growth factor-beta. Exp Cell Res, 1994. 214(1): p.
93-9.
88. Tsukada, H. and T. Pourmotabbed, Unexpected crucial role of residue 272 in substrate
specificity of fibroblast collagenase. J Biol Chem, 2002. 277(30): p. 27378-84.
89. Fasciglione, G.F., M. Gioia, H. Tsukada, J. Liang, R. Iundusi, U. Tarantino, M. Coletta,
T. Pourmotabbed, and S. Marini, The collagenolytic action of MMP-1 is regulated by the
interaction between the catalytic domain and the hinge region. J Biol Inorg Chem, 2012.
17(4): p. 663-72.
90. McCawley, L.J. and L.M. Matrisian, Matrix metalloproteinases: they're not just for
matrix anymore! Curr Opin Cell Biol, 2001. 13(5): p. 534-40.
91. Takamoto, N., P.C. Leppert, and S.Y. Yu, Cell death and proliferation and its relation to
collagen degradation in uterine involution of rat. Connect Tissue Res, 1998. 37(3-4): p.
163-75.
92. Morgunova, E., A. Tuuttila, U. Bergmann, M. Isupov, Y. Lindqvist, G. Schneider, and
K. Tryggvason, Structure of human pro-matrix metalloproteinase-2: activation
mechanism revealed. Science, 1999. 284(5420): p. 1667-70.
93. Xu, X., Z. Chen, Y. Wang, L. Bonewald, and B. Steffensen, Inhibition of MMP-2
gelatinolysis by targeting exodomain-substrate interactions. Biochem J, 2007. 406(1): p.
147-55.
94. Vandooren, J., P.E. Van den Steen, and G. Opdenakker, Biochemistry and molecular
biology of gelatinase B or matrix metalloproteinase-9 (MMP-9): the next decade. Crit
Rev Biochem Mol Biol, 2013. 48(3): p. 222-72.
95. Nishida, Y., H. Miyamori, E.W. Thompson, T. Takino, Y. Endo, and H. Sato, Activation
of matrix metalloproteinase-2 (MMP-2) by membrane type 1 matrix metalloproteinase
through an artificial receptor for proMMP-2 generates active MMP-2. Cancer Res,
2008. 68(21): p. 9096-104.
96. Hofmann, U.B., J.R. Westphal, A.J. Zendman, J.C. Becker, D.J. Ruiter, and G.N. van
Muijen, Expression and activation of matrix metalloproteinase-2 (MMP-2) and its co-
localization with membrane-type 1 matrix metalloproteinase (MT1-MMP) correlate with
melanoma progression. J Pathol, 2000. 191(3): p. 245-56.
97. Van den Steen, P.E., B. Dubois, I. Nelissen, P.M. Rudd, R.A. Dwek, and G.
Opdenakker, Biochemistry and molecular biology of gelatinase B or matrix
metalloproteinase-9 (MMP-9). Crit Rev Biochem Mol Biol, 2002. 37(6): p. 375-536.
98. Sbardella, D., R. Inzitari, F. Iavarone, M. Gioia, S. Marini, F. Sciandra, M. Castagnola,
P.E. Van den Steen, G. Opdenakker, B. Giardina, A. Brancaccio, M. Coletta, and M.
Bozzi, Enzymatic processing by MMP-2 and MMP-9 of wild-type and mutated mouse
beta-dystroglycan. IUBMB Life, 2012. 64(12): p. 988-94.
99. Curry, T.E., Jr. and K.G. Osteen, The matrix metalloproteinase system: changes,
regulation, and impact throughout the ovarian and uterine reproductive cycle. Endocr
Rev, 2003. 24(4): p. 428-65.
References
122
100. Deady, L.D., W. Shen, S.A. Mosure, A.C. Spradling, and J. Sun, Matrix
metalloproteinase 2 is required for ovulation and corpus luteum formation in
Drosophila. PLoS Genet, 2015. 11(2): p. e1004989.
101. Wilhelm, S.M., D. Wunderlich, C.A. Maniglia, A.Z. Eisen, and G.I. Goldberg, Primary
structure and function of stromelysin/transin in cartilage matrix turnover. Matrix Suppl,
1992. 1: p. 37-44.
102. Nagase, H., R. Visse, and G. Murphy, Structure and function of matrix
metalloproteinases and TIMPs. Cardiovasc Res, 2006. 69(3): p. 562-73.
103. Pei, D. and S.J. Weiss, Furin-dependent intracellular activation of the human
stromelysin-3 zymogen. Nature, 1995. 375(6528): p. 244-7.
104. Ichikawa, Y., T. Ishikawa, N. Momiyama, M. Kamiyama, H. Sakurada, R. Matsuyama,
S. Hasegawa, T. Chishima, Y. Hamaguchi, S. Fujii, S. Saito, K. Kubota, S. Hasegawa,
H. Ike, S. Oki, and H. Shimada, Matrilysin (MMP-7) degrades VE-cadherin and
accelerates accumulation of beta-catenin in the nucleus of human umbilical vein
endothelial cells. Oncol Rep, 2006. 15(2): p. 311-5.
105. Buhler, L.A., R. Samara, E. Guzman, C.L. Wilson, L. Krizanac-Bengez, D. Janigro, and
D.W. Ethell, Matrix metalloproteinase-7 facilitates immune access to the CNS in
experimental autoimmune encephalomyelitis. BMC Neurosci, 2009. 10: p. 17.
106. Rechtman, M.P., J. Zhang, and L.A. Salamonsen, Effect of inhibition of matrix
metalloproteinases on endometrial decidualization and implantation in mated rats. J
Reprod Fertil, 1999. 117(1): p. 169-77.
107. Brew, K., D. Dinakarpandian, and H. Nagase, Tissue inhibitors of metalloproteinases:
evolution, structure and function. Biochim Biophys Acta, 2000. 1477(1-2): p. 267-83.
108. Brew, K. and H. Nagase, The tissue inhibitors of metalloproteinases (TIMPs): an
ancient family with structural and functional diversity. Biochim Biophys Acta, 2010.
1803(1): p. 55-71.
109. Stetler-Stevenson, W.G., Tissue inhibitors of metalloproteinases in cell signaling:
metalloproteinase-independent biological activities. Sci Signal, 2008. 1(27): p. re6.
110. Gomis-Ruth, F.X., K. Maskos, M. Betz, A. Bergner, R. Huber, K. Suzuki, N. Yoshida,
H. Nagase, K. Brew, G.P. Bourenkov, H. Bartunik, and W. Bode, Mechanism of
inhibition of the human matrix metalloproteinase stromelysin-1 by TIMP-1. Nature,
1997. 389(6646): p. 77-81.
111. Roderfeld, M., J. Graf, B. Giese, R. Salguero-Palacios, A. Tschuschner, G. Muller-
Newen, and E. Roeb, Latent MMP-9 is bound to TIMP-1 before secretion. Biol Chem,
2007. 388(11): p. 1227-34.
112. Bigg, H.F., C.J. Morrison, G.S. Butler, M.A. Bogoyevitch, Z. Wang, P.D. Soloway, and
C.M. Overall, Tissue inhibitor of metalloproteinases-4 inhibits but does not support the
activation of gelatinase A via efficient inhibition of membrane type 1-matrix
metalloproteinase. Cancer Res, 2001. 61(9): p. 3610-8.
113. Heath, J.K., J.J. Reynolds, and M.C. Meikle, Osteopetrotic (grey-lethal) bone produces
collagenase and TIMP in organ culture: regulation by vitamin A. Biochem Biophys Res
Commun, 1990. 168(3): p. 1171-6.
References
123
114. Ahonen, M., M. Poukkula, A.H. Baker, M. Kashiwagi, H. Nagase, J.E. Eriksson, and
V.M. Kahari, Tissue inhibitor of metalloproteinases-3 induces apoptosis in melanoma
cells by stabilization of death receptors. Oncogene, 2003. 22(14): p. 2121-34.
115. Guedez, L., L. Courtemanch, and M. Stetler-Stevenson, Tissue inhibitor of
metalloproteinase (TIMP)-1 induces differentiation and an antiapoptotic phenotype in
germinal center B cells. Blood, 1998. 92(4): p. 1342-9.
116. Koers-Wunrau, C., C. Wehmeyer, A. Hillmann, T. Pap, and B. Dankbar, Cell surface-
bound TIMP3 induces apoptosis in mesenchymal Cal78 cells through ligand-
independent activation of death receptor signaling and blockade of survival pathways.
PLoS One, 2013. 8(7): p. e70709.
117. Baker, A.H., A.B. Zaltsman, S.J. George, and A.C. Newby, Divergent effects of tissue
inhibitor of metalloproteinase-1, -2, or -3 overexpression on rat vascular smooth muscle
cell invasion, proliferation, and death in vitro. TIMP-3 promotes apoptosis. J Clin
Invest, 1998. 101(6): p. 1478-87.
118. Liu, X.W., M.M. Bernardo, R. Fridman, and H.R. Kim, Tissue inhibitor of
metalloproteinase-1 protects human breast epithelial cells against intrinsic apoptotic
cell death via the focal adhesion kinase/phosphatidylinositol 3-kinase and MAPK
signaling pathway. J Biol Chem, 2003. 278(41): p. 40364-72.
119. Liu, Z., X. Zhou, S.D. Shapiro, J.M. Shipley, S.S. Twining, L.A. Diaz, R.M. Senior, and
Z. Werb, The serpin alpha1-proteinase inhibitor is a critical substrate for gelatinase
B/MMP-9 in vivo. Cell, 2000. 102(5): p. 647-55.
120. Li, J., S. Kartha, S. Iasvovskaia, A. Tan, R.K. Bhat, J.M. Manaligod, K. Page, A.R.
Brasier, and M.B. Hershenson, Regulation of human airway epithelial cell IL-8
expression by MAP kinases. Am J Physiol Lung Cell Mol Physiol, 2002. 283(4): p.
L690-9.
121. McQuibban, G.A., G.S. Butler, J.H. Gong, L. Bendall, C. Power, I. Clark-Lewis, and
C.M. Overall, Matrix metalloproteinase activity inactivates the CXC chemokine stromal
cell-derived factor-1. J Biol Chem, 2001. 276(47): p. 43503-8.
122. McQuibban, G.A., J.H. Gong, E.M. Tam, C.A. McCulloch, I. Clark-Lewis, and C.M.
Overall, Inflammation dampened by gelatinase A cleavage of monocyte chemoattractant
protein-3. Science, 2000. 289(5482): p. 1202-6.
123. McQuibban, G.A., J.H. Gong, J.P. Wong, J.L. Wallace, I. Clark-Lewis, and C.M.
Overall, Matrix metalloproteinase processing of monocyte chemoattractant proteins
generates CC chemokine receptor antagonists with anti-inflammatory properties in vivo.
Blood, 2002. 100(4): p. 1160-7.
124. Li, Q., P.W. Park, C.L. Wilson, and W.C. Parks, Matrilysin shedding of syndecan-1
regulates chemokine mobilization and transepithelial efflux of neutrophils in acute lung
injury. Cell, 2002. 111(5): p. 635-46.
125. Park, K.H., T. Chaiworapongsa, Y.M. Kim, J. Espinoza, J. Yoshimatsu, S. Edwin, R.
Gomez, B.H. Yoon, and R. Romero, Matrix metalloproteinase 3 in parturition,
premature rupture of the membranes, and microbial invasion of the amniotic cavity. J
Perinat Med, 2003. 31(1): p. 12-22.
References
124
126. Overall, C.M., G.A. McQuibban, and I. Clark-Lewis, Discovery of chemokine substrates
for matrix metalloproteinases by exosite scanning: a new tool for degradomics. Biol
Chem, 2002. 383(7-8): p. 1059-66.
127. Van den Steen, P.E., P. Proost, A. Wuyts, J. Van Damme, and G. Opdenakker,
Neutrophil gelatinase B potentiates interleukin-8 tenfold by aminoterminal processing,
whereas it degrades CTAP-III, PF-4, and GRO-alpha and leaves RANTES and MCP-2
intact. Blood, 2000. 96(8): p. 2673-81.
128. D'Haese, A., A. Wuyts, C. Dillen, B. Dubois, A. Billiau, H. Heremans, J. Van Damme,
B. Arnold, and G. Opdenakker, In vivo neutrophil recruitment by granulocyte
chemotactic protein-2 is assisted by gelatinase B/MMP-9 in the mouse. J Interferon
Cytokine Res, 2000. 20(7): p. 667-74.
129. Dejana, E., Endothelial cell-cell junctions: happy together. Nat Rev Mol Cell Biol, 2004.
5(4): p. 261-70.
130. Bazzoni, G. and E. Dejana, Endothelial cell-to-cell junctions: molecular organization
and role in vascular homeostasis. Physiol Rev, 2004. 84(3): p. 869-901.
131. Muller, W.A., Leukocyte-endothelial-cell interactions in leukocyte transmigration and
the inflammatory response. Trends Immunol, 2003. 24(6): p. 327-34.
132. Johnson-Leger, C., M. Aurrand-Lions, and B.A. Imhof, The parting of the endothelium:
miracle, or simply a junctional affair? J Cell Sci, 2000. 113 ( Pt 6): p. 921-33.
133. Ledingham, M.A., A.J. Thomson, F. Jordan, A. Young, M. Crawford, and J.E. Norman,
Cell adhesion molecule expression in the cervix and myometrium during pregnancy and
parturition. Obstet Gynecol, 2001. 97(2): p. 235-42.
134. Aghajanian, A., E.S. Wittchen, M.J. Allingham, T.A. Garrett, and K. Burridge,
Endothelial cell junctions and the regulation of vascular permeability and leukocyte
transmigration. J Thromb Haemost, 2008. 6(9): p. 1453-60.
135. Deem, T.L. and J.M. Cook-Mills, Vascular cell adhesion molecule 1 (VCAM-1)
activation of endothelial cell matrix metalloproteinases: role of reactive oxygen species.
Blood, 2004. 104(8): p. 2385-93.
136. Kiran, M.S., R.I. Viji, S.V. Kumar, A.A. Prabhakaran, and P.R. Sudhakaran, Changes in
expression of VE-cadherin and MMPs in endothelial cells: Implications for
angiogenesis. Vasc Cell, 2011. 3(1): p. 6.
137. Liu, J., X. Jin, K.J. Liu, and W. Liu, Matrix metalloproteinase-2-mediated occludin
degradation and caveolin-1-mediated claudin-5 redistribution contribute to blood-brain
barrier damage in early ischemic stroke stage. J Neurosci, 2012. 32(9): p. 3044-57.
138. Zhao, Y.G., A.Z. Xiao, X.M. Cao, and C. Zhu, Expression of matrix metalloproteinase -
2, -9 and tissue inhibitors of metalloproteinase -1, -2, -3 mRNAs in rat uterus during
early pregnancy. Mol Reprod Dev, 2002. 62(2): p. 149-58.
139. Yin, Z., A.A. Sada, O.M. Reslan, N. Narula, and R.A. Khalil, Increased MMPs
expression and decreased contraction in the rat myometrium during pregnancy and in
response to prolonged stretch and sex hormones. Am J Physiol Endocrinol Metab, 2012.
303(1): p. E55-70.
References
125
140. Koscica, K.L., C.V. Ananth, J. Placido, and S.E. Reznik, The effect of a matrix
metalloproteinase inhibitor on inflammation-mediated preterm delivery. Am J Obstet
Gynecol, 2007. 196(6): p. 551 e1-3.
141. Iams, J.D., Current status of prematurity prevention. JAMA, 1989. 262(2): p. 265-6.
142. Tara, P.N. and S. Thornton, Current medical therapy in the prevention and treatment of
preterm labour. Semin Fetal Neonatal Med, 2004. 9(6): p. 481-9.
143. Xu, C., W. Liu, X. You, K. Leimert, X. Fang, S.L. Wood, D.M. Slater, Q. Sun, H. Gu,
D.M. Olson, and X. Ni, PGF2alpha modulates the output of chemokines and pro-
inflammatory cytokines in myometrial cells from term pregnant women through
divergent signaling pathways. Mol Hum Reprod, 2015.
144. O'Brien, W.F., The role of prostaglandins in labor and delivery. Clin Perinatol, 1995.
22(4): p. 973-84.
145. Wolf, K., P. Sandner, A. Kurtz, and W. Moll, Messenger ribonucleic acid levels of
collagenase (MMP-13) and matrilysin (MMP-7) in virgin, pregnant, and postpartum
uterus and cervix of rat. Endocrinology, 1996. 137(12): p. 5429-34.
146. Rosa, R.G., C.A. Tarsitano, S. Hyslop, A.T. Yamada, O.M. Toledo, and P.P. Joazeiro,
Temporal changes in matrix metalloproteinases, their inhibitors, and cathepsins in
mouse pubic symphysis during pregnancy and postpartum. Reprod Sci, 2011. 18(10): p.
963-77.
147. Yoshida, M., N. Sagawa, H. Itoh, S. Yura, M. Takemura, Y. Wada, T. Sato, A. Ito, and
S. Fujii, Prostaglandin F(2alpha), cytokines and cyclic mechanical stretch augment
matrix metalloproteinase-1 secretion from cultured human uterine cervical fibroblast
cells. Mol Hum Reprod, 2002. 8(7): p. 681-7.
148. Tang, Z., L. Yang, R. Xue, J. Zhang, Y. Wang, P.C. Chen, and K.L. Sung, Differential
expression of matrix metalloproteinases and tissue inhibitors of metalloproteinases in
anterior cruciate ligament and medial collateral ligament fibroblasts after a mechanical
injury: involvement of the p65 subunit of NF-kappaB. Wound Repair Regen, 2009.
17(5): p. 709-16.
149. Loudon, J.A., S.R. Sooranna, P.R. Bennett, and M.R. Johnson, Mechanical stretch of
human uterine smooth muscle cells increases IL-8 mRNA expression and peptide
synthesis. Mol Hum Reprod, 2004. 10(12): p. 895-9.
150. Ou, C.W., Z.Q. Chen, S. Qi, and S.J. Lye, Increased expression of the rat myometrial
oxytocin receptor messenger ribonucleic acid during labor requires both mechanical
and hormonal signals. Biol Reprod, 1998. 59(5): p. 1055-61.
151. Piersanti, M. and S.J. Lye, Increase in messenger ribonucleic acid encoding the
myometrial gap junction protein, connexin-43, requires protein synthesis and is
associated with increased expression of the activator protein-1, c-fos. Endocrinology,
1995. 136(8): p. 3571-8.
152. Boyd, V., O.M. Cholewa, and K.K. Papas, Limitations in the Use of Fluorescein
Diacetate/Propidium Iodide (FDA/PI) and Cell Permeable Nucleic Acid Stains for
Viability Measurements of Isolated Islets of Langerhans. Curr Trends Biotechnol Pharm,
2008. 2(2): p. 66-84.
References
126
153. Ito, T.K., G. Ishii, H. Chiba, and A. Ochiai, The VEGF angiogenic switch of fibroblasts
is regulated by MMP-7 from cancer cells. Oncogene, 2007. 26(51): p. 7194-203.
154. Brodt-Eppley, J. and L. Myatt, Changes in expression of contractile FP and relaxatory
EP2 receptors in pregnant rat myometrium during late gestation, at labor, and
postpartum. Biol Reprod, 1998. 59(4): p. 878-83.
155. Hadler-Olsen, E., P. Kanapathippillai, E. Berg, G. Svineng, J.O. Winberg, and L. Uhlin-
Hansen, Gelatin in situ zymography on fixed, paraffin-embedded tissue: zinc and ethanol
fixation preserve enzyme activity. J Histochem Cytochem, 2010. 58(1): p. 29-39.
156. Gonzalez, J.M., C.W. Franzke, F. Yang, R. Romero, and G. Girardi, Complement
activation triggers metalloproteinases release inducing cervical remodeling and preterm
birth in mice. Am J Pathol, 2011. 179(2): p. 838-49.
157. Wang, P., L. Yang, X. You, G.K. Singh, L. Zhang, Y. Yan, and K.L. Sung, Mechanical
stretch regulates the expression of matrix metalloproteinase in rheumatoid arthritis
fibroblast-like synoviocytes. Connect Tissue Res, 2009. 50(2): p. 98-109.
158. Reno, F., V. Traina, and M. Cannas, Mechanical stretching modulates growth direction
and MMP-9 release in human keratinocyte monolayer. Cell Adh Migr, 2009. 3(3): p.
239-42.
159. Haseneen, N.A., G.G. Vaday, S. Zucker, and H.D. Foda, Mechanical stretch induces
MMP-2 release and activation in lung endothelium: role of EMMPRIN. Am J Physiol
Lung Cell Mol Physiol, 2003. 284(3): p. L541-7.
160. Bu, S., Y. Zhu, C. Peng, X. Cai, C. Cao, H. Tan, J. Cheng, J. Zhang, J. Liu, H. Li, and K.
Wang, Simulated physiological stretch-induced proliferation of human bladder smooth
muscle cells is regulated by MMPs. Arch Biochem Biophys, 2014. 564: p. 197-202.
161. Woessner, J.F., Jr., Acid hydrolases of the rat uterus in relation to pregnancy, post-
partum involution and collagen breakdown. Biochem J, 1965. 97(3): p. 855-66.
162. Shimizu, K. and K. Maekawa, Collagen degradation in the mouse uterus during
postpartum involution: extracellular pathway. Acta Anat (Basel), 1983. 117(3): p. 257-
60.
163. Jeffrey, J.J. and J. Gross, Collagenase from rat uterus. Isolation and partial
characterization. Biochemistry, 1970. 9(2): p. 268-73.
164. Welgus, H.G., G.A. Grant, J.C. Sacchettini, W.T. Roswit, and J.J. Jeffrey, The
gelatinolytic activity of rat uterus collagenase. J Biol Chem, 1985. 260(25): p. 13601-6.
165. Abramson, S.R., G.E. Conner, H. Nagase, I. Neuhaus, and J.F. Woessner, Jr.,
Characterization of rat uterine matrilysin and its cDNA. Relationship to human pump-1
and activation of procollagenases. J Biol Chem, 1995. 270(27): p. 16016-22.
166. Woessner, J.F., Jr., Regulation of matrilysin in the rat uterus. Biochem Cell Biol, 1996.
74(6): p. 777-84.
167. Saarialho-Kere, U.K., S.O. Kovacs, A.P. Pentland, J.E. Olerud, H.G. Welgus, and W.C.
Parks, Cell-matrix interactions modulate interstitial collagenase expression by human
keratinocytes actively involved in wound healing. J Clin Invest, 1993. 92(6): p. 2858-66.
References
127
168. Pilcher, B.K., J.A. Dumin, B.D. Sudbeck, S.M. Krane, H.G. Welgus, and W.C. Parks,
The activity of collagenase-1 is required for keratinocyte migration on a type I collagen
matrix. J Cell Biol, 1997. 137(6): p. 1445-57.
169. Maier, T., M. Guell, and L. Serrano, Correlation of mRNA and protein in complex
biological samples. FEBS Lett, 2009. 583(24): p. 3966-73.
170. Vogel, C. and E.M. Marcotte, Insights into the regulation of protein abundance from
proteomic and transcriptomic analyses. Nature Reviews Genetics, 2012. 13(4): p. 227-
232.
171. Abba, M., N. Patil, and H. Allgayer, MicroRNAs in the Regulation of MMPs and
Metastasis. Cancers (Basel), 2014. 6(2): p. 625-45.
172. Valencia-Sanchez, M.A., J. Liu, G.J. Hannon, and R. Parker, Control of translation and
mRNA degradation by miRNAs and siRNAs. Genes Dev, 2006. 20(5): p. 515-24.
173. Liu, N., Q. Sun, J. Chen, J. Li, Y. Zeng, S. Zhai, P. Li, B. Wang, and X. Wang,
MicroRNA-9 suppresses uveal melanoma cell migration and invasion through the NF-
kappaB1 pathway. Oncol Rep, 2012. 28(3): p. 961-8.
174. Fang, J.H., H.C. Zhou, C. Zeng, J. Yang, Y. Liu, X. Huang, J.P. Zhang, X.Y. Guan, and
S.M. Zhuang, MicroRNA-29b suppresses tumor angiogenesis, invasion, and metastasis
by regulating matrix metalloproteinase 2 expression. Hepatology, 2011. 54(5): p. 1729-
40.
175. Li, L. and H. Li, Role of microRNA-mediated MMP regulation in the treatment and
diagnosis of malignant tumors. Cancer Biol Ther, 2013. 14(9): p. 796-805.
176. Lindsey, M.L., G.P. Escobar, R. Mukherjee, D.K. Goshorn, N.J. Sheats, J.A. Bruce, I.M.
Mains, J.K. Hendrick, K.W. Hewett, R.G. Gourdie, L.M. Matrisian, and F.G. Spinale,
Matrix metalloproteinase-7 affects connexin-43 levels, electrical conduction, and
survival after myocardial infarction. Circulation, 2006. 113(25): p. 2919-28.
177. Motrescu, E.R., S. Blaise, N. Etique, N. Messaddeq, M.P. Chenard, I. Stoll, C.
Tomasetto, and M.C. Rio, Matrix metalloproteinase-11/stromelysin-3 exhibits
collagenolytic function against collagen VI under normal and malignant conditions.
Oncogene, 2008. 27(49): p. 6347-55.
178. Bejarano, P.A., M.E. Noelken, K. Suzuki, B.G. Hudson, and H. Nagase, Degradation of
basement membranes by human matrix metalloproteinase 3 (stromelysin). Biochem J,
1988. 256(2): p. 413-9.
179. Hubbard, R.C., G. Fells, J. Gadek, S. Pacholok, J. Humes, and R.G. Crystal, Neutrophil
accumulation in the lung in alpha 1-antitrypsin deficiency. Spontaneous release of
leukotriene B4 by alveolar macrophages. J Clin Invest, 1991. 88(3): p. 891-7.
180. Faust, D., K. Raschke, S. Hormann, V. Milovic, and J. Stein, Regulation of alpha1-
proteinase inhibitor release by proinflammatory cytokines in human intestinal epithelial
cells. Clin Exp Immunol, 2002. 128(2): p. 279-84.
181. Pan, W., M. Arnone, M. Kendall, R.H. Grafstrom, S.P. Seitz, Z.R. Wasserman, and C.F.
Albright, Identification of peptide substrates for human MMP-11 (stromelysin-3) using
phage display. J Biol Chem, 2003. 278(30): p. 27820-7.
References
128
182. Manetti, M., S. Guiducci, E. Romano, S. Bellando-Randone, M.L. Conforti, L. Ibba-
Manneschi, and M. Matucci-Cerinic, Increased serum levels and tissue expression of
matrix metalloproteinase-12 in patients with systemic sclerosis: correlation with severity
of skin and pulmonary fibrosis and vascular damage. Ann Rheum Dis, 2012. 71(6): p.
1064-72.
183. Alarab, M., H. Kufaishi, S. Lye, H. Drutz, and O. Shynlova, Expression of extracellular
matrix-remodeling proteins is altered in vaginal tissue of premenopausal women with
severe pelvic organ prolapse. Reprod Sci, 2014. 21(6): p. 704-15.
184. Chan, Y.W., H.A. van den Berg, J.D. Moore, S. Quenby, and A.M. Blanks, Assessment
of myometrial transcriptome changes associated with spontaneous human labour by
high-throughput RNA-seq. Exp Physiol, 2014. 99(3): p. 510-24.
185. Senior, R.M., G.L. Griffin, and R.P. Mecham, Chemotactic activity of elastin-derived
peptides. J Clin Invest, 1980. 66(4): p. 859-62.
186. Owen, C.A., Roles for proteinases in the pathogenesis of chronic obstructive pulmonary
disease. Int J Chron Obstruct Pulmon Dis, 2008. 3(2): p. 253-68.
187. Adair-Kirk, T.L., J.J. Atkinson, T.J. Broekelmann, M. Doi, K. Tryggvason, J.H. Miner,
R.P. Mecham, and R.M. Senior, A site on laminin alpha 5, AQARSAASKVKVSMKF,
induces inflammatory cell production of matrix metalloproteinase-9 and chemotaxis. J
Immunol, 2003. 171(1): p. 398-406.
188. Weathington, N.M., A.H. van Houwelingen, B.D. Noerager, P.L. Jackson, A.D.
Kraneveld, F.S. Galin, G. Folkerts, F.P. Nijkamp, and J.E. Blalock, A novel peptide
CXCR ligand derived from extracellular matrix degradation during airway
inflammation. Nat Med, 2006. 12(3): p. 317-23.
189. Beezhold, D.H. and C. Personius, Fibronectin fragments stimulate tumor necrosis factor
secretion by human monocytes. J Leukoc Biol, 1992. 51(1): p. 59-64.
190. McKee, C.M., M.B. Penno, M. Cowman, M.D. Burdick, R.M. Strieter, C. Bao, and P.W.
Noble, Hyaluronan (HA) fragments induce chemokine gene expression in alveolar
macrophages. The role of HA size and CD44. J Clin Invest, 1996. 98(10): p. 2403-13.
191. Green, D.M., J. Trial, and H.H. Birdsall, TNF-alpha released by comigrating monocytes
promotes transendothelial migration of activated lymphocytes. J Immunol, 1998. 161(5):
p. 2481-9.
192. Birdsall, H.H., W.J. Porter, D.M. Green, J. Rubio, J. Trial, and R.D. Rossen, Impact of
fibronectin fragments on the transendothelial migration of HIV-infected leukocytes and
the development of subendothelial foci of infectious leukocytes. J Immunol, 2004.
173(4): p. 2746-54.
193. Ichikawa, Y., T. Ishikawa, N. Momiyama, M. Kamiyama, H. Sakurada, R. Matsuyama,
S. Hasegawa, T. Chishima, Y. Hamaguchi, S. Fujii, S. Saito, K. Kubota, H. Ike, S. Oki,
and H. Shimada, Matrilysin (MMP-7) degrades VE-cadherin and accelerates
accumulation of beta-catenin in the nucleus of human umbilical vein endothelial cells.
Oncol Rep, 2006. 15(2): p. 311-5.
194. Taipale, J. and J. Keski-Oja, Growth factors in the extracellular matrix. FASEB J, 1997.
11(1): p. 51-9.
References
129
195. Lamagna, C., M. Aurrand-Lions, and B.A. Imhof, Dual role of macrophages in tumor
growth and angiogenesis. J Leukoc Biol, 2006. 80(4): p. 705-13.
196. Bellac, C.L., A. Dufour, M.J. Krisinger, A. Loonchanta, A.E. Starr, U. Auf dem Keller,
P.F. Lange, V. Goebeler, R. Kappelhoff, G.S. Butler, L.D. Burtnick, E.M. Conway, C.R.
Roberts, and C.M. Overall, Macrophage matrix metalloproteinase-12 dampens
inflammation and neutrophil influx in arthritis. Cell Rep, 2014. 9(2): p. 618-32.
197. Newby, A.C., Metalloproteinase expression in monocytes and macrophages and its
relationship to atherosclerotic plaque instability. Arterioscler Thromb Vasc Biol, 2008.
28(12): p. 2108-14.
198. Lin, M., P. Jackson, A.M. Tester, E. Diaconu, C.M. Overall, J.E. Blalock, and E.
Pearlman, Matrix metalloproteinase-8 facilitates neutrophil migration through the
corneal stromal matrix by collagen degradation and production of the chemotactic
peptide Pro-Gly-Pro. Am J Pathol, 2008. 173(1): p. 144-53.
199. Pedersen, G., T. Saermark, T. Kirkegaard, and J. Brynskov, Spontaneous and cytokine
induced expression and activity of matrix metalloproteinases in human colonic
epithelium. Clin Exp Immunol, 2009. 155(2): p. 257-65.
200. Nee, L., N. Tuite, M.P. Ryan, and T. McMorrow, TNF-alpha and IL-1 beta-mediated
regulation of MMP-9 and TIMP-1 in human glomerular mesangial cells. Nephron Exp
Nephrol, 2007. 107(2): p. e73-86.
201. Saikali, Z., H. Setya, G. Singh, and S. Persad, Role of IGF-1/IGF-1R in regulation of
invasion in DU145 prostate cancer cells. Cancer Cell Int, 2008. 8: p. 10.
202. Krstic, J. and J.F. Santibanez, Transforming growth factor-beta and matrix
metalloproteinases: functional interactions in tumor stroma-infiltrating myeloid cells.
ScientificWorldJournal, 2014. 2014: p. 521754.
203. Vaday, G.G., R. Hershkoviz, M.A. Rahat, N. Lahat, L. Cahalon, and O. Lider,
Fibronectin-bound TNF-alpha stimulates monocyte matrix metalloproteinase-9
expression and regulates chemotaxis. J Leukoc Biol, 2000. 68(5): p. 737-47.
204. Rundhaug, J.E., Matrix metalloproteinases, angiogenesis, and cancer: commentary re:
A. C. Lockhart et al., Reduction of wound angiogenesis in patients treated with BMS-
275291, a broad spectrum matrix metalloproteinase inhibitor. Clin. Cancer Res., 9: 00-
00, 2003. Clin Cancer Res, 2003. 9(2): p. 551-4.
205. Foda, H.D. and S. Zucker, Matrix metalloproteinases in cancer invasion, metastasis and
angiogenesis. Drug Discov Today, 2001. 6(9): p. 478-482.
206. Pfeffer, K., Biological functions of tumor necrosis factor cytokines and their receptors.
Cytokine Growth Factor Rev, 2003. 14(3-4): p. 185-91.
207. Black, R.A., C.T. Rauch, C.J. Kozlosky, J.J. Peschon, J.L. Slack, M.F. Wolfson, B.J.
Castner, K.L. Stocking, P. Reddy, S. Srinivasan, N. Nelson, N. Boiani, K.A. Schooley,
M. Gerhart, R. Davis, J.N. Fitzner, R.S. Johnson, R.J. Paxton, C.J. March, and D.P.
Cerretti, A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha
from cells. Nature, 1997. 385(6618): p. 729-33.
208. Alexander, H.A., S.R. Sooranna, L. Myatt, and M.R. Johnson, Myometrial tumor
necrosis factor-alpha receptors increase with gestation and labor and modulate gene
References
130
expression through mitogen-activated kinase and nuclear factor-kappaB. Reprod Sci,
2012. 19(1): p. 43-54.
209. Haro, H., H.C. Crawford, B. Fingleton, K. Shinomiya, D.M. Spengler, and L.M.
Matrisian, Matrix metalloproteinase-7-dependent release of tumor necrosis factor-alpha
in a model of herniated disc resorption. J Clin Invest, 2000. 105(2): p. 143-50.
210. Haro, H., H.C. Crawford, B. Fingleton, J.R. MacDougall, K. Shinomiya, D.M. Spengler,
and L.M. Matrisian, Matrix metalloproteinase-3-dependent generation of a macrophage
chemoattractant in a model of herniated disc resorption. J Clin Invest, 2000. 105(2): p.
133-41.
211. Schonbeck, U., F. Mach, and P. Libby, Generation of biologically active IL-1 beta by
matrix metalloproteinases: a novel caspase-1-independent pathway of IL-1 beta
processing. J Immunol, 1998. 161(7): p. 3340-6.
212. Suh, D.Y., T.K. Hunt, and E.M. Spencer, Insulin-like growth factor-I reverses the
impairment of wound healing induced by corticosteroids in rats. Endocrinology, 1992.
131(5): p. 2399-403.
213. Florini, J.R., D.Z. Ewton, and S.A. Coolican, Growth hormone and the insulin-like
growth factor system in myogenesis. Endocr Rev, 1996. 17(5): p. 481-517.
214. Llewellyn, S., R. Fitzpatrick, D.A. Kenny, J. Patton, and D.C. Wathes, Endometrial
expression of the insulin-like growth factor system during uterine involution in the
postpartum dairy cow. Domest Anim Endocrinol, 2008. 34(4): p. 391-402.
215. Hemers, E., C. Duval, C. McCaig, M. Handley, G.J. Dockray, and A. Varro, Insulin-like
growth factor binding protein-5 is a target of matrix metalloproteinase-7: implications
for epithelial-mesenchymal signaling. Cancer Res, 2005. 65(16): p. 7363-9.
216. Sporn, M.B. and A.B. Roberts, Transforming growth factor-beta: recent progress and
new challenges. J Cell Biol, 1992. 119(5): p. 1017-21.
217. Taipale, J., J. Saharinen, K. Hedman, and J. Keski-Oja, Latent transforming growth
factor-beta 1 and its binding protein are components of extracellular matrix
microfibrils. J Histochem Cytochem, 1996. 44(8): p. 875-89.
218. Saharinen, J., J. Taipale, and J. Keski-Oja, Association of the small latent transforming
growth factor-beta with an eight cysteine repeat of its binding protein LTBP-1. EMBO J,
1996. 15(2): p. 245-53.
219. Jones, R.L., C. Stoikos, J.K. Findlay, and L.A. Salamonsen, TGF-beta superfamily
expression and actions in the endometrium and placenta. Reproduction, 2006. 132(2): p.
217-32.
220. Denison, F.C., R.W. Kelly, A.A. Calder, and S.C. Riley, Cytokine secretion by human
fetal membranes, decidua and placenta at term. Hum Reprod, 1998. 13(12): p. 3560-5.
221. Bowen, J.M., L. Chamley, J.A. Keelan, and M.D. Mitchell, Cytokines of the placenta
and extra-placental membranes: roles and regulation during human pregnancy and
parturition. Placenta, 2002. 23(4): p. 257-73.
References
131
222. Lim, R. and M. Lappas, Differential expression of AP-1 proteins in human myometrium
after spontaneous term labour onset. Eur J Obstet Gynecol Reprod Biol, 2014. 177: p.
100-5.
223. Mitchell, J.A. and S.J. Lye, Differential expression of activator protein-1 transcription
factors in pregnant rat myometrium. Biol Reprod, 2002. 67(1): p. 240-6.
224. Wu, X., H. Shen, L. Yu, M. Peng, W.S. Lai, and Y.L. Ding, Corticotropin-releasing
hormone activates connexin 43 via activator protein-1 transcription factor in human
myometrial smooth muscle cells. Am J Physiol Endocrinol Metab, 2007. 293(6): p.
E1789-94.
225. Shynlova, O.P., A.D. Oldenhof, M. Liu, L. Langille, and S.J. Lye, Regulation of c-fos
expression by static stretch in rat myometrial smooth muscle cells. Am J Obstet
Gynecol, 2002. 186(6): p. 1358-65.
226. Khanjani, S., V. Terzidou, M.R. Johnson, and P.R. Bennett, NFkappaB and AP-1 drive
human myometrial IL8 expression. Mediators Inflamm, 2012. 2012: p. 504952.
227. Lee, I.T., C.C. Lin, S.E. Cheng, L.D. Hsiao, Y.C. Hsiao, and C.M. Yang, TNF-alpha
induces cytosolic phospholipase A2 expression in human lung epithelial cells via
JNK1/2- and p38 MAPK-dependent AP-1 activation. PLoS One, 2013. 8(9): p. e72783.
228. Zhao, Y., K. Koga, Y. Osuga, G. Izumi, M. Takamura, M. Harada, T. Hirata, Y. Hirota,
O. Yoshino, S. Inoue, T. Fujii, and S. Kozuma, Cyclic stretch augments production of
neutrophil chemokines and matrix metalloproteinases-1 (MMP-1) from human decidual
cells, and the production was reduced by progesterone. Am J Reprod Immunol, 2013.
69(5): p. 454-62.
229. Zhao, Y., K. Koga, Y. Osuga, G. Izumi, M. Takamura, M. Harada, T. Hirata, Y. Hirota,
O. Yoshino, T. Fujii, and S. Kozuma, Cyclic stretch augments production of neutrophil
chemokines and matrix metalloproteinase-1 in human uterine smooth muscle cells. Am J
Reprod Immunol, 2013. 69(3): p. 240-7.
230. Zhang, M., Q. Zhou, Q.Q. Liang, C.G. Li, J.D. Holz, D. Tang, T.J. Sheu, T.F. Li, Q. Shi,
and Y.J. Wang, IGF-1 regulation of type II collagen and MMP-13 expression in rat
endplate chondrocytes via distinct signaling pathways. Osteoarthritis Cartilage, 2009.
17(1): p. 100-6.
231. Zhang, D., M. Bar-Eli, S. Meloche, and P. Brodt, Dual regulation of MMP-2 expression
by the type 1 insulin-like growth factor receptor: the phosphatidylinositol 3-kinase/Akt
and Raf/ERK pathways transmit opposing signals. J Biol Chem, 2004. 279(19): p.
19683-90.