MECHANISM OF DOPAMINE-MEDIATED ACTIVATION
OF BK CHANNELS
IN HUMAN CORONARY ARTERY SMOOTH MUSCLE CELLS
A Dissertation
submitted to the Faculty of the
Graduate School of Arts and Sciences
of Georgetown University
in partial fulfillment of the requirements for the
degree of
Doctor of Philosophy in Physiology and Biophysics
By
Aruna Ramachandran Natarajan, M.D.
Washington D.C.
October 31 2008
ii
MECHANISM OF DOPAMINE-MEDIATED ACTIVATION OF BK
CHANNELS
IN HUMAN CORONARY ARTERY SMOOTH MUSCLE CELLS
Aruna Ramachandran Natarajan, M.D.
Dissertation Advisor: Pedro A. Jose, Professor, M.D., Ph.D.
ABSTRACT
Coronary artery disease (CAD) is an important cause of morbidity and mortality
worldwide and is associated with a sustained increase in vascular tone. Large
conductance, voltage-dependent and calcium-activated potassium (K) channels, or BK
channels determine membrane electrical activity in human coronary artery smooth
muscle cells (HCASMCs). Their activation leads to hyperpolarization, a decrease in
coronary vascular tone and vasorelaxation. Dopamine, via the D1-like receptors,
activates K channels, and may play a role in CAD. Dopamine has been shown to
activate BK channels or ATP-sensitive K channels in previous studies in porcine
coronary myocytes. The effects of dopamine receptor activation on K channels in
human coronary artery smooth muscle cells (HCASMCs) are not known. Further,
there are two D1-like receptors, D1R and D5R. We hypothesize that the specific D1-
iii
like receptor involved in K channel activation is the D5R, that the specific K channel it
activates is the BK channel and that the downstream cell signaling mechanisms
mediating this effect in HCASMCs involve the cyclic GMP-related protein kinase
(PKG). K channel responses to D1-like receptor agonists and antagonists were
characterized and studied by cell-attached patch-clamp in HCASMCs in the presence
and absence of the PKG antagonist KT 5823. In the absence of known ligands selective
for D1R or D5R, the D1-like receptor involved was identified by using sequence-
specific antisense (AS) oligonucleotides against human D1R or D5R; scrambled (Scr)
oligonucleotides and non-transfected cells served as controls. D1-like receptor agonists
activated BK channels in all groups except in those transfected with D5R As
oligonucleotides, and non-transfected cells pretreated with KT 5823. These data
suggest that dopamine activation of BK channels in HCASMCs is mediated by the
D5R, via PKG. This is the first study to demonstrate differential D1-like receptor
regulation of vascular smooth muscle function and identifies a novel receptor and
signaling mechanism, which could be targeted to ameliorate the course of CAD.
Key words: Dopamine, D5R, vascular, BK channels, coronary
iv
I dedicate this work to the children and families I am
honored to serve, who inspire me every day with their
patience, courage and fortitude.
v
ACKNOWLEDGMENTS
• Pedro A. Jose, MD, PhD, my research mentor and thesis advisor for inspiring
this work and for his generous, brilliant and dedicated commitment to my
education.
• Richard E. White, PhD, for welcoming me in his laboratory and sharing
expertise, space, materials and insightful advice in the design and conduct of
the electrophysiological experiments.
• Gui Chun Han, MD, PhD, for her willing hands-on assistance in the use of the
microscope, for sharing her patch-clamp expertise with me, and for her true and
valued friendship.
• Stefano A. Vicini, PhD for his enthusiastic support of the project, hands-on
assistance with electrophysiological experiments, and advice on the
presentation of figures and graphs.
• Susan E. Mulroney, PhD , for her faith, support, encouragement and critical
help with preparation of the document.
• Maria Armando, PhD for reviewing the drafts of figures and dissertation and
for teaching me how to write.
• The faculty of the Department of Physiology and Biophysics, Georgetown
University for support and encouragement
• Pei-Ying Yu, MD, for helping me generate the original hypothesis and teaching
me to perform protein expression studies.
• Shi-You Chen, PhD for helping me design the transfection experiments.
• Van Anthony Villar, MD, PhD and John E. Jones, PhD for helping with the
RNA expression studies and for painstakingly reviewing the drafts.
• Prit Mohinder Gill, PhD for teaching me the Real-Time PCR method
vi
• Xiao-Yan Wang, MD, PhD for sharing the D1R and D5R antibodies and her
expertise in protein expression studies
• Mustafa I. Dajani, B.S. for help with preparation of the dissertation and figures
• Mentored Clinical Research Scholar Program Award, RR 17613, NCRR, NIH,
DHSS
• Mr. David Rosenfeld for his generous contribution for cardiovascular
research.
• David B. Nelson, MD, MSc, and the 3rd
Annual Pediatric Gala for financial
support
• All members of Dr. Jose’s laboratory at Georgetown University, and all
members of Dr. White’s laboratory at the Medical College of Georgia for their
willing assistance and comraderie
• Gabriel J. Hauser, MD, MBA, Shirley Bronson, Administrator, and all
members of the Pediatric Critical Care team at Georgetown University Hospital
for their faith and encouragement
• And finally, I owe a special “thank you” to my husband, Rajiv N.Sheth, and my
parents Bama and R. Natarajan for their patient love and understanding during
this challenging endeavour
vii
TABLE OF CONTENTS Page
ABSTRACT……………………………………………………………………... ii
ACKNOWLEDGMENTS……………………………………………………… iv
TABLE OF CONTENTS ……………………………………………………… vi
LIST OF FIGURES AND TABLES …………………………………………... x
LIST OF ABBREVIATIONS ………………………………………………… xv
INTRODUCTION………………………………………………………………. 1
Chapter 1. The Coronary Circulation…………………………………………. 4
1.1 Vascular Tone ……………………………………………………………. 5
1.2 The Physiology and Pathophysiology of Coronary Circulation ………… 11
1.3 Clinical Implications of Endothelial Dysfunction……………………….. 13
1.4 Current Therapies for Coronary Artery Disease (CAD)…………………. 14
1.5 Molecular and Cellular Mechanisms of Vascular Smooth Muscle
Relaxation………………………………………………………………... 18
Chapter 2. The BKCa Channel………………………………………………….. 20
2.1 Resting Membrane Potential in VSMCs and the Concept of the Ion
Channel…………………………………………………………………... 21
2.2 K Channels in VSMCs…………………………………………………… 24
2.3 BKCa Channels: Properties and Functions……………………………….. 27
2.4 Structure of the BKCa Channel and Molecular Correlates………………... 28
viii
2.5 BKCa channels in the Vasculature: stimulation and inhibition…………… 30
2.6 Molecular Mechanisms of BKCa Channel Activation and Clinical
Implications……………………………………………………………… 32
Chapter 3. The Dopamine Receptors…………………………………………. 35
3.1 Dopamine………………………………………………………………... 36
3.2 Dopamine Receptors and Intracellular Signaling………………………... 37
3.3 Dopamine Receptor Signaling and Ion Channels in the CNS……………. 41
3.4 Extraneural Dopamine Receptors: Distribution and
Physiological Effects…………………………………………………….. 42
Chapter 4. BKCa Channel Stimulation………………………………………… 48
4.1 Exogenous and Endogenous Stimulants of the BKCa channels and their
Signaling Pathways……………………………………………………… 49
4.3 Dopamine and BKCa Channels: Review of Literature…………………… 53
4.4 Rationale…………………………………………………………………. 55
Chapter 5. Hypothesis and Specific Aims…………………………………….. 60
Chapter 6. Methods…………………………………………………………….. 61
6.1 Cell Culture……………………………………………………………… 62
6.2 Dopamine Receptor Expression Studies………………………………… 63
6.3 Dopamine Receptor Gene Silencing by RNA Interference……………... 65
6.4 Patch-Clamp Studies…………………………………………………….. 68
6.5 Cell- Attached Voltage-Clamp Experiments…………………………….. 72
Chapter 7. Results……………………………………………………………… 79
ix
7.1 D1R and D5R Receptor Expression Studies……………………………… 80
7.2 Characterization of the Ion Channel in HCASMCs as the BKCa Channel… 91
7.3 D1-like receptor-mediated effects on BKca channels in HCASMCs………. 97
7.4 Studies in AS and Scr oligonucleotide-transfected HCASMCs…………. 102
7.5 Effects of D1-like receptor activation on Open Time of the channels,
conductance and resting membrane potential in HCASMCs……………. 108
7.6 Studies of Intracellular Signaling………………………………………... 115
Chapter 8. Discussion……………………………………………………………120
8.1 Summary of Observations………………………………………………. 121
8.2 Novel Findings and Discussion…………………………………………. 126
Chapter 9. Summary…………………………………………………………… 134
BIBLIOGRAPHY………………………………………………………………. 140
x
LIST OF FIGURES Page
1A. Schematic diagram of long and cross section of a blood vessel……… 9
1B. Structure of the BKCa channel………………………………………… 29
1C. Predicted protein structure of the D1 like receptor……………………. 40
1D. Proposed mechanism of dopamine receptor-mediated stimulation of
BKCa channels in HCASMCs………………………………………….. 59
2A. Schematic depiction of cell configurations used in electrophysiological
studies………………………………………………………………….. 69
2B. Differential interference contrast microscopy of the cell-attached patch
in HCASMCs treated with PBS-EDTA for 90-120 seconds…………… 70
3A. D1R and D5R mRNA expression by RT-PCR…………………………. 81
3B. D1R and D5R mRNA expression by quantitative RT-PCR……………. 82
4A. Differential interference contrast microscopic images of non-transfected
HCASMCs and HCASMCs transfected with D1R AS and Scr
oligonucleotides………………………………………………………. 84
4B. D1R protein expression in cells transfected with D1R AS and Scr
Oligonucleotides………………………………………………………… 85
4C. D5R protein expression in cells transfected with D1R AS and Scr
Oligonucleotides……………………………………………………….. 86
5A. Differential interference contrast microscopic images of non-transfected
xi
HCASMCs and confocal microscopic images of HCASMCs transfected
with D5R AS and Scr oligonucleotides………………………………… 88
5B. D5R protein expression in cells transfected with D5R AS and Scr
oligonucleotides…………………………………………………….. 89
5C. D1R protein expression in cells transfected with D5R AS and Scr
oligonucleotides…………………………………………………….. 90
6A. Whole cell electrophysiological tracings in a single HCASMC in
response to application of increasing voltage and after treatment
with 300 nmol/L Iberiotoxin………………………………………. 93
6B. Complete current-voltage relationship for steady state outward current in
HCASMCs, n = 3……………………………………………………… 94
6C. Electrophysiological tracings in the cell-attached, followed by inside-out
configuration in a HCASMC showing a Ca++
activated channel
followed by response to 1 mmol/L TEA……………………………… 95
6D. Probability of opening (NPo) of the BKCa channel in response to increased
levels of ‘intracellular’ calcium, and 1 mmol/L TEA, n =3…………. 96
7A. Electrophysiological tracings in the cell-attached configuration in a
non transfected HCASMC showing response to 1µmol/L fenoldopam,
followed by10 µmol/L SCH 23390………………………………… 98
7B. Bar graphs of NPo of BKCa channels in non-transfected HCASMCs in
response to fenoldopam, followed by SCH 23390, n = 9 ………….. 99
7C. Electrophysiological tracings in the cell-attached configuration in a non
xii
transfected HCASMC pretreated with SCH 23390, followed by 1and 10
µmol/L fenoldopam…………………………………………………. 100
7D. Bar graphs of NPo of BKCa channels in HCASMCs in response to SCH
23390, followed by fenoldopam, n =3………………………………. 101
8A. Electrophysiological tracings in the cell-attached configuration
in a HCASMC transfected with D1R Scr oligonucleotides showing
response to 1 and 10µmol/L fenoldopam and SKF 81297, followed by
10 µmol/L SCH 23390............................................................................ 103
8B. Bar graphs of the NPo of BKCa channel response to D1-like receptor agonists
and antagonist in HCASMCs transfected with D1R Scr oligonucleotides,
n = 5 …………………………………………………………………… 104
8C. Electrophysiological tracings in the cell-attached configuration in a
HCASMC transfected with D5R Scr oligonucleotides in response to 1
and 10 µmol/L fenoldopam followed by SKF 81297 and 10 µmol/L SCH
23390, n = 5…………………………………………………………… 105
8D. Bar graphs of NPo of BKCa channels in response to D1-like receptor agonists
and antagonist in HCASMCs transfected with D5R Scr oligonucleotides,
n = 5…………………………………………………………………… 106
9A. Electrophysiological tracings in the cell-attached configuration in a
HCASMC transfected with D1R AS oligonucleotides in response to 1
and 10 µmol/L fenoldopam followed by SKF 81297, dopamine and
10 µmol/L SCH 23390………………………………………………… 110
xiii
9B. Bar graphs of NPo of BKCa channel response to D1-like receptor
agonists,antagonists and dopamine in HCASMCs transfected with
D1R AS oligonucleotides, n = 5…………………………………… 111
9C. Electrophysiological tracings in the cell-attached configuration in a
HCASMC transfected with D5R As oligonucleotides in response to 1
and10 µmol/L fenoldopam followed by SKF 81297, dopamine and
mol/L SCH 23390…………………………………………………… 112
9D. Bar graphs of NPo of BKCa channels in response to D1-like receptor agonists,
antagonists and dopamine in HCASMCs transfected with D5R As
oligonucleotides……………………………………………………… 113
9E. Inside-out configuration of HCASMC transfected with D5R As
oligonucleotides to demonstrate the presence of a Ca++
-activated
channel………………………………………………………………. 114
10A. Cell-attached voltage clamp recordings in non-transfected HCASMC
pretreated with PKG antagonists KT 5823, in response to addition of
D1-like receptor agonists and dopamine……………………………… 116
10B. Bar graphs of NPo of BKCa channels in HCASMCs pretreated with PKG
antagonist KT 5823 and then treated with D1-like receptor agonists and
dopamine………………………………………………………………. 117
10C. Cell-attached voltage clamp recordings in a non-transfected HCASMC
pretreated with PKA antagonist KT 5720, in response to addition of
D1- like receptor agonists and subsequent addition of PKG antagonist
xiv
KT 5823………………………………………………………………. 118
10D. Bar graphs of NPo of BKCa channels in HCASMCs pretreated with
PKA antagonist KT 5720 and then treated with D1–like receptor
agonists with subsequent addition of PKG antagonist KT 5823…….. 119
11. Mechanism of activation of BKCa channels in HCASMC: proposed
cAMP and cAMP-independent mechanisms mediated by the D5R……. 138
LIST OF TABLES Page
1. Endogenous Coronary Vasodilators………………………………… 10
2. Molecular Mechanisms of Coronary Hyperemia…………………….. 17
3. The Vascular K Channels……………………………………………. 26
4. BK Channel Activity in Disease States……………………………….. 34
xv
LIST OF ABBREVIATIONS
ACE Angiotensin Converting Enzyme
AKT v-akt murine thymoma viral oncogene homolog 1 (Protein
Kinase B , PKB)
As Antisense
BKCa Big K, Maxi-K, Voltage-sensitive calcium-activated K channels
[Ca++
] i Intracellular Calcium
CAD Coronary Artery Disease
CASMCs Coronary artery smooth muscle cells
CHD Coronary Heart Disease
CO2 Carbon Dioxide
cAMP Cyclic adenosine monophosphate
cGMP Cyclic guanosine monophosphate
D1R D1 receptor
D5R D5 receptor
DARPP-32 dopamine- and cyclic AMP-regulated phosphoprotein
DSS Dahl salt-sensitive rat
EDHF Endothelium derived hyperpolarization factor
GPCR G protein-coupled receptors
H Hydrogen
xvi
HCASMCs Human coronary artery smooth muscle cells
HEK human embryonic kidney
IBTx Iberiotoxin
IK Intermediate Potassium
K Potassium
KATP channels ATP-sensitive potassium channels
Kir2 Inward rectifier potassium channels
KT 5720 (9R,10S,12S)-2,3,9,10,11,12-Hexahydro-10-hydroxy-9-
methyl-1-oxo-9,12-epoxy-1H-diindolo[1,2,3-fg:3',2',1'-
kl]pyrrolo[3,4-i][1,6]benzodiazocine-10-carboxylic acid
KT 5823 9-methoxy-9-methoxycarbonyl-8-methyl-2,3,9,10-
tetrahydro-8,11-epoxy-1H,8H,11H-2,7b-11a
triazadibenzo(a,g)cycloocta(cde)-trinden-1-one
Kv Voltage dependent K channels
L-DOPA 3, 4-dihydroxy-L-phenylalanine
mV millivolt
mΩ milliohm
Na, K-ATPase Sodium-Potassium ATPase
NHE sodium/hydrogen exchanger
NMDA N-methyl-D-aspartic acid
nNOS neuronal Nitric Oxide Synthase
pA picoampere
xvii
PGE2 Prostaglandin E2
PGI2 Prostaglandin I2, Prostacycline
PI 3-kinase Phosphoinositide 3-kinase
PIP2 Phosphatidylinositol 4, 5-bisphosphate
PKA Protein kinase A
PKC Protein Kinase C
PKG Protein Kinase G
PLC Phospholipase C
PP1 protein phosphatase 1
PP2A Protein phosphatase 2A
q-RT PCR Quantitative Real-time Polymerase Chain Reaction
Rp-8CPT-cAMPs (Rp)-8-(parachlorophenylthio) adenosine
(3',5'-cyclic monophosphorothioate)
RT-PCR Reverse Transcriptase Polymerase Chain Reaction
RyR Ryanodine receptor
Scr Scrambled
SHR Spontaneously hypertensive rat
SK Small Potassium
TEA Tetraethyl ammonium
TM transmembrane
VDCC Voltage dependent calcium channels
VSMCs Vascular smooth muscle cells
1
Introduction
2
Essential hypertension affects a billion people worldwide and is an important
cause of coronary artery disease (CAD) and stroke, with resulting significant mortality
and morbidity. While strategies for the treatment of hypertension, including diuretics,
beta adrenergic receptor blockers, and vasodilators are well established, their efficacy
in decreasing the incidence and progression of CAD remain limited by the inexorable
course of the disease.
Hypertension is widely believed to occur in association with, or as a
consequence of increased vasomotor tone. Factors known to decrease vasomotor tone
are used in the therapy of hypertension. However, once CAD sets in, its course is
relentless and difficult to reverse.
Hence it behoves us to study the molecular and cellular mechanisms which
contribute to the occurrence of increased and decreased vascular tone, specifically in
the coronary and cerebral circulations, which are commonly affected in chronic
hypertension, with important clinical implications. A better understanding of the
mechanisms involved in vasoconstriction and vasorelaxation will help us understand
the aberrations that occur in hypertension, leading to the innovation of newer,
mechanism-based vasorelaxant therapies to limit the complications of hypertension.
Dopamine, an edogenous neurotransmitter and precursor of epinephrine and
norepinephrine is widely used as a pharmacological inotrope to enhance cardiac
contractility and function. While physiological circulating levels of dopamine are low,
the paracrine effects of renal dopamine on sodium transport and renal vascular tone
have been well described. Abnormalities in paracrine dopamine-mediated cell
3
signaling are implicated in the pathophysiology of salt-sensitive hypertension. While
genetic variants predisposing individuals to CAD have been described in the literature,
there is no single gene defect attributed to the development of this common and
potentially fatal condition, with or without hypertension. By studying basic
mechanisms involved in the maintenance of coronary arterial tone, this reseach aims to
elucidate signaling mechanisms that involve the dopamine receptor in
hyperpolarization or relaxation of the vascular smooth muscle cell with consequent
vasodilatation and potential powerful therapeutic implications.
4
Chapter 1.
The Coronary Circulation
5
1.1 Vascular Tone
Ever since William Harvey described the circulation of blood in his 1628
treatise, ‘De Motu Cordis’,1 the complex mechanisms by which blood vessels dilate or
constrict to maintain the milieu interior continue to challenge physiologists and
clinicians. The word ‘tone’ refers to the resting state of tension, as in the tone of a
guitar string. The expression ‘vascular tone’ refers to the inherent property of blood
vessels that is unrelated to neural, humoral or metabolic factors by which they maintain
their internal diameter and serve as a reservoir and as a passage for the flow of
circulating volume. Increased tone causes resistance to blood flow especially in small
or ‘resistance’ arteries with a lumen diameter of 100-300 µm.2 Resistance arteries exist
physiologically in a partially constricted state, from which they constrict further or
dilate in response to the perfusion needs of the tissue or organ. A major physiological
stimulus for vasoconstriction is intravascular pressure, also referred to as myogenic
tone.2 Inherent contractility of blood vessels in mammals was observed and reported in
the literature as early as 1852.4 In 1902, Bayliss demonstrated profound vasodilatation
of the hind limb vasculature of a dog following aortic transection that he purported to
be too rapid to be attributed to dilatation induced by products of metabolic activity.5
Despite Bayliss’ seminal observation, the role played by metabolic and neurohumoral
factors in vessel tone continued to be the focus of interest until Folkow demonstrated
that pressure-dependent vascular tone in denervated vessels is important in
autoregulation. 6,7
6
In the 1950s and 1960s, studies of whole organ perfusion and isolated vascular
and non-vascular muscle strips confirmed the existence of pressure-dependent tone in
small resistance arteries and arterioles. Many innovative methods to study the
microcirculation have since been introduced. The molecular and cellular mechanisms
influencing vascular smooth muscle tone have been elucidated over the past three
decades with the discovery of ion channels and the development of
electrophysiological methods such as the patch-clamp technique.8 This technique
measures the ionic shifts of electrical charge which alter membrane potential and cause
contraction or relaxation of the individual smooth muscle cell leading to
vasoconstriction and vasodilation respectively. Vasoconstriction occurs when
depolarization of the cell membrane opens voltage-gated calcium channels to facilitate
the entry of calcium into the cell, causing smooth muscle contraction. Increased local
levels of intracellular calcium simultaneously stimulate potassium efflux via membrane
pores such as BKCa channels, which limit further voltage-gated calcium entry and
hyperpolarize the cell membrane, causing vasodilatation. In this fashion, ion channels
modulate vascular myogenic tone.9,10
All arteries, including the coronary artery, consist of an adventitial layer (tunica
adventitia), a smooth muscle layer (tunica media) and an endothelial layer (tunica
media) (Figure 1). The tunica media contains vascular smooth muscle cells that
influence vascular resistance and consequently, blood flow. It is more robust in the
artery than the vein; arteries have greater resistances and generate higher mean arterial
7
pressures than veins. Arteries remain in a contracted state, induced by neurohumoral
factors such as catecholamines which represent a primary survival mechanism to
maintain blood pressure, unless acted upon by dilatory forces to relax and increase
their luminal diameters to facilitate tissue perfusion. These dilatory forces are active
under physiological conditions. Thus the adaptation of circulatory supply to end-organ
needs may be viewed as a delicate balance of endogenous vasoconstrictor and
vasodilator influences, acting in concert to regulate blood supply. This balance is
critical for coronary circulatory adaptation to changing needs, as is shown in Table 1
and will be discussed later in this chapter. Vascular resistance is also necessary to limit
wall tension which would otherwise damage blood vessels during periods of increased
flow. This auto-regulatory mechanism becomes pathological in diseases such as long-
standing hypertension, leading to coronary artery disease (CAD) and stroke.
Vasodilatation is necessary to maintain physiological blood flow to vital
organs, specifically the pulmonary, coronary, cerebral and renal circulations. Regional
circulation is adapted to the unique hemodynamic features and requirements of the
organ to be perfused. For example, the pulmonary circulation is adapted to receive all
of the cardiac output and to transmit it in a short time by its relatively low vascular
tone and low basal vascular resistance.11
This study was aimed to elucidate the
molecular mechanisms underlying coronary vasodilatation, aberrations in which could
lead to ischemic heart disease, myocardial infarction, cardiomyopathy, and progressive
loss of cardiovascular function resulting in death.
8
Figure 1A. Schematic diagram of long and cross section of a blood
vessel showing the relationship of the tunica media (vascular smooth muscle) to the
tunica externa (adventitia) and intima (endothelium). Contraction of vascular smooth
muscle cells leads to decreased vessel diameter and can result in hypertension and
coronary or cerebral vasoconstriction.
Lumen
Tunica Media
(Smooth Muscle cells)
Endothelium
Tunica
Externa
(Adventitia)
9
Table 1. Endogenous Coronary Vasoregulators
Neurohumoral
Epinephrine Norepinephrine Angiotensin II
Vasoconstrictors Vasodilators
Endothelial Endothelial Neurohumoral Myocardial
Endothelin Dopamine Serotonine ADP Histamine
Nitric Oxide Prostacyclin L-arginine
Adenosine
10
1.2 The Physiology and Pathophysiology of
Coronary Circulation
The heart tissue has high metabolic demands and a rich microcirculation that
depends on perfusion pressure and metabolic activity. During cardiac systole,
ventricular contraction prevents the formation of a transmural pressure gradient. Hence
most coronary flow occurs towards the end of diastole when the myocardium relaxes.
Perfusion of the heart is set by coronary vascular tone and limited by diastolic
pressure. Progressive frictional loss and decreasing vessel diameter contribute to an
increase in vascular resistance as blood flows “downstream”.12
Most coronary vascular
resistance resides within the smallest arteries and arterioles where high pressure
gradients are needed to maintain flow. 13-15
Under normal conditions, the heart extracts
most of the oxygen supplied by the coronary circulation16
and residual venous oxygen
levels are low. It follows that oxygen delivery to the heart is largely limited by blood
flow and there is little redundancy in the system.17
Further, collateral circulation is
inadequate to transmit blood to the extensive capillary network supplying the heart in
the event of a major structural (obstructive) or functional (vasospastic) reduction in
coronary blood flow. Despite the paucity of built-in safety mechanisms, the heart is
able to function effectively and continuously in a wide variety of physiological
situations of increased myocardial oxygen demand (e.g., exercise or pregnancy)
because of adaptations in vascular tone.
11
The coronary circulation is richly supplied with sympathetic nerves that are
activated by stress to cause vasoconstriction. Simultaneously, stress or metabolic
activity leads to dramatic increases in coronary blood flow in response to increases in
CO2, lactic acid, K+, pyruvate, prostaglandins, H
+ and adenosine, maintaining a balance
between the demands created by metabolic activity or stress, and blood supply. Indeed,
adenosine, produced by the myocardium in response to decreased perfusion, dilates
coronary arteries by stimulating K channels by a specific adenosine receptor subtype-
mediated effect,18
and is recognized as the most prominent coronary vasodilator in
humans.19
Even small decreases in coronary blood flow lead to relative coronary
insufficiency, which may be mild, immediate and self-limited by vasodilatation; or
severe, prolonged and sustained leading to irreversible myocardial ischemia. For
example, during non-critical coronary stenosis, arteriolar vasodilatation decreases
microvascular resistance to maintain flow.20,21
Severe stenosis exhausts autoregulatory
vasodilatation; microvascular resistance cannot further decrease and myocardial
ischemia ensues. Vasomotor mechanisms influencing vascular tone have an impact on
coronary flow reserve, which is an important predictor of outcome after cardiovascular
events. The concept of coronary flow reserve is used to predict the development of
coronary insufficiency after percutaneous coronary intervention for CAD.22
12
1.3. Clinical Implications of Endothelial
Dysfunction
Over the centuries, the occurrence and/or relentless course of vascular diseases
such as essential hypertension have been attributed to a sustained increase in vascular
tone, the relief of which could potentially lead to lasting cure. Sixty percent of patients
with essential hypertension are inadequately treated despite all current therapies,
falling short of the ‘Healthy People’ goal of fifty percent for 2010.23
Stroke and CAD
occurring independently or as sequelae to hypertension represent a major cause of
morbidity and mortality worldwide.24
The Framingham Heart Study showed that
higher systolic and diastolic pressures increase the risk of occurrence of coronary
events and mortality from CAD.25
Arterial smooth muscle contraction or dilatation is influenced by the
endothelium 26
which plays an important role in modulating vascular tone and blood
flow by releasing vasodilators and vasoconctrictors. The most prominent and well
known endothelial-derived vasodilator is nitric oxide27
which is induced by
nitrovasodilators.28
Cardiovascular risk factors such as chronic hypertension lead to endothelial
dysfunction due to shear-induced injury to the endothelium, and vascular smooth
muscle cell proliferation even in the absence of atherosclerotic lesions.29
Continued
endothelial dysfunction in conditions such as long standing hypertension, 30,31
aging32
13
or diabetes mellitus33
leads to CAD. The inexorable course of CAD is attributed to
inflammation34
and consequent impaired vasodilator mechanisms.35,36
Endothelial dysfunction, per se, is reversible since drugs used to treat
hypertension, such as angiotensin converting enzyme (ACE) inhibitors, angiotensin
receptor blockers, statins, and antioxidant agents do ameliorate its course.35
However,
endothelial dysfunction, if prolonged and sustained, leads to impaired vascular smooth
muscle relaxation, vasoconstriction, and resulting CAD, which progresses relentlessly
to coronary heart disease (CHD).
1.4. Current Therapies for CAD
The current modalities of therapy for CAD range from vasodilator drugs and
complicated and extensive revascularizing surgery to stents and other prosthetic
devices to maintain vessel patency.37
Elucidation of the mechanisms of regulation of
coronary blood flow have yielded current medical therapies to improve coronary blood
flow in acute coronary syndromes and chronic CHD. These include beta-blockers,
nitrates, lipid-lowering agents, antiplatelet and fibrinolytic drugs. Coronary
vasodilators such as dopamine and its analogs, and endothelin receptor antagonists
have also been studied extensively in animal and human cultured cells and isolated
arteries.38-40
However, while endothelin receptor antagonists such as bosentan have
been shown to improve coronary perfusion in patients with stable CAD, non-selective
14
dopamine receptor subtype agonists such as ibopamine, although established in vitro as
coronary vasodilators, have been disappointing in clinical trials.41
Ibopamine is a non-
selective dopamine receptor agonist, acting on the postjunctional D1-like and the
predominantly prejunctional D2-like receptors: the stimulation of the latter leads to
sympathetic vasoconstriction. Identification of specific dopamine receptor subtypes
that mediate vasodilatation would yield novel targets that can be stimulated by
dopamine to cause vasodilatation.
An understanding of the mechanism of intrinsic myogenic coronary
vasodilatation is also essential in order to devise new targets for therapy to limit the
course of CAD before or after coronary angioplasty or bypass procedures. Over a
million people in the United States underwent coronary angioplasty for CHD in 2003
as per the NHLBI Report: Diseases and Conditions Index published in Jan 2006. More
than half of patients who undergo angioplasty need reintervention 25 years after
surgery.42
Patients are not always benefited from coronary artery bypass graft
surgery.43
Surgical procedures traumatize blood vessels and predispose them to spasm
or stenosis. After percutaneous coronary intervention or bypass graft surgery,
restenosis occurs and may even be accelerated,44,45
with associated morbidity and
mortality. Thus the therapy used to treat the disease could lead to more severe
recurrence.
In the presence of endothelial dysfunction, the intrinsic tone of vascular smooth
muscle cells (VSMCs) is a key determinant of coronary blood flow.46
Several studies
suggest that in the presence of CAD or its risk factors associated with endothelial
15
dysfunction, such as diabetes, VSMC relaxation due to hyperpolarization by the
opening of ion channels such as the BKCa channel plays an increasingly important role
in maintaining coronary circulation.47-49
The attacks of unstable angina experienced by older people represent transient
increases in VSMC tone which are reversed by vasodilatation. Such reversals of
coronary arterial tone in CAD could maintain the improvement wrought by
percutaneous coronary intervention to dilate constricted or blocked coronary arteries.
The molecular basis of coronary hyperemia in response to occlusion has been studied
in the murine heart, and multiple mechanisms are implicated 50
as shown in Table 2.
Most of these are endothelial-derived, and are the target for locally applied coronary
vasodilators. However, information on exogenous and endogenous agents that directly
affect vascular smooth muscle tone and their effects on vasodilatory BKCa channels are
limited in humans.
In this study, I have elucidated the inherent endothelium-independent
mechanisms of vasorelaxation of human coronary artery smooth muscle cells
(HCASMCs), which may help identify targets for new modalities of therapy for CAD.
16
Table 2. Molecular Mechanisms of Coronary Hyperemia in an
Ischemic Murine Heart Model
Vasodilator
Likely mechanism
Adenosine A2A adenosine receptor
Ischemic period
KATP channels
EDHF
5-10 sec
NO + KATP channels sustained
Mechanosensitive flow/shear stress NO
prolonged NO + KATP channels
NO + KATP channels
17
1.5 Molecular and Cellular Mechanisms of Vascular
Smooth Muscle Relaxation: The BKCa channel
The use of patch-clamp electrophysiological techniques to study ion channels
has enhanced our understanding of molecular mechanisms underlying vasodilatation.
Ion channels are membrane proteins that allow specific ions to pass through them. Ion
movement alters the resting membrane potential of the cell and generates an action
potential, which is a necessary prerequisite for all cellular excitatory mechanisms from
bladder control to vascular reactivity.
Potassium (K) channels, which are activated by voltage, intracellular calcium,
([Ca++
]i), G-proteins and ATP are the major channels for the transmembrane flux of
ions. Ca2+
-activated K channels have been classified into 2 groups based upon their
relative conductances: Big K, Maxi-K (BKCa), and KCa which include Intermediate
(IKCa) and Small (SKCa) channels. IKCa and SKCa channels have much lower
conductances for K compared to BKCa channels, and have relatively modest
hyperpolarizing effects.
BKCa channels are expressed in the endothelium51
and VSMCs and are
important in maintaining vascular patency. BKCa channels have been implicated in
vasorelaxation in response to endothelial derived factors such as nitric oxide (NO) and
EDHF, which is as yet unidentified. Indeed, differences in coronary artery diameter are
attributed to differential expression and /or activation of these specific channels.52
18
BKCa channels are ubiquitous and have roles in innate immunity, as heme-
binding proteins, and as protective agents against ischemic cell death in cardiac
myocytes.53
Elucidation of the pathways involved in their activation in different tissues
may have far-reaching mechanistic, diagnostic and therapeutic implications, including
but not limited to coronary vasodilatation.
19
Chapter 2.
The BKCa Channel
20
2.1 Resting Membrane Potential in VSMCs and the
Concept of the Ion Channel
A cell derives its electrical properties mainly from the electrical properties of
its membrane. The membrane in turn acquires its properties from its lipids and proteins
such as ion channels and transporters. Ions move across the channels or ‘pores’ in the
membrane in response to electrical potential differences-- much as objects move up or
down with gravitational potential. The story of ion channels began in 1791, when
Luigi Galvani published his fundamental work, De Viribus Electricitatis in Motu
Musculari Commentarius54
on animal electricity based on ten years of his observations
of muscle-nerve preparations. He reported that:
1. Electrical stimulus (of a nerve) led to muscle contraction; and
2. After continued stimulus, a ‘refractory’ period followed, and a rest from the
stimulus was needed to restore the response.
He went on to demonstrate the propagation of action potential and to theorize that
biological tissues existed in a state of ‘disequilibrium’, i.e., at rest, the tissue could
respond to external stimuli by generating electrical signals which resulted from
accumulation of positive and negative charges on external and internal surfaces of the
muscle or nerve fiber, which he compared to the inside and outside of a Leiden jar with
an insulated material coating the conducting surface between the two surfaces. The
insulation had small holes or pores, through which aqueous channels would conduct
21
the flow of electrical charge.55
The concept of biological membranes being rendered
electrically active by the presence of channels was born. Bernstein developed several
theories of electrical excitability, and in 1896, with his student Vassily Tschagovetz, he
applied the electrolytic theory of Walther Nernst (which related the voltage of a cell to
its properties) to biological systems. He hypothesized that K+ selectivity of excitable
membranes was responsible for the movement of K+ ions across the membrane which
generated and maintained the resting membrane potential.56,57
Subsequently, the
introduction of voltage-clamp methodology, wherein membrane voltage was controlled
and the transmembrane current required to maintain that voltage was measured, helped
identify the key variable that controlled the opening and closing of those ion channels
which are gated by voltage alone. Hodgkins and Huxley 58
showed that biological
membranes were activated by passive transmembrane ionic fluxes in response to
electrochemical gradients and suggested the presence of aqueous channels through
which the ions traveled in living cells. Their work implicated ionic movement as the
basis for nerve conduction for which they received the Nobel Prize in 1963.
To understand the movement of specific ions across membranes, single
channels must be studied. Isolated single channel recordings posed several technical
challenges: mammalian cells were small and difficult to patch, the intracellular and
extracellular environment needed to be controlled and finally, a very small area of the
membrane needed to be isolated, which called for fine precision instruments. These
hurdles were overcome by the patch-clamp technique introduced by Neher and
Sakman.8 The patch-clamp technique is a special voltage clamp method to resolve
22
currents flowing through single ion channels. It simplified whole cell recordings of
very small cells (such as mammalian cells) which could not be easily penetrated with
electrodes.59
Single channel recordings were further facilitated by using the cell-
attached patch technique. The presence of ambient noise in biological systems
rendered currents of up to 100 pA in strength, which were much larger than any current
generated by ion flow through a single channel and would hence mask currents flowing
through single ion channels. In the cell-attached technique, smooth, fire-polished
pipettes with 3-5 mΩ resistance were positioned on the cell membrane to produce a
tight ‘giga-seal’ which isolated the area of the pipette’s attachment on the membrane
physically and electrically from the rest of the membrane and thus eliminated
background noise. This technique helped electrophysiologists in obtaining reliable
single channel recordings in the cell-attached and inside-out (I/O) configurations.60
The
cell-attached configuration facilitated the study of cellular signal transduction
pathways that mediate channel opening in mammalian cells.
Cell membranes are composed of proteins and phospholipids, with the lipids
acting as insulators that prevent the transmission of electrical charge and create a
potential difference between the inside and the outside of the cell. This potential
difference is also called ‘transmembrane potential’ which in most living cells is less
than 100 mV, typically 30-90 mV with the intracellular potential being ‘negative’ with
respect to the extracellular potential. The membrane potential is a major determinant of
vascular tone especially in resistance vessels which are the sites for autoregulation of
blood flow to organs and tissues. The membrane potential of vascular smooth muscle
23
depends on its permeability to several ions like K+, Na
+, Ca
2+ and Cl
-, of which K is
implicated as the main player, for the following reasons:
1. The membrane is most permeable to K relative to the other ions;
2. Blockade of K conductance leads to membrane depolarization and
generates electrical activity in resting arterial smooth muscle.61
This is not
seen when other ion conductances, such as sodium channels, are blocked;
and
3. Activation of K channels causes pronounced hyperpolarization and
inhibition of contractile force which leads to relaxation of VSMCs.
2.2 K Channels in VSMCs
Ionic currents occur in all cells, including VSCMCs and are most influenced by
K channel opening.62
Five types of K channels are described in arterial smooth
muscle: 1) voltage dependent (Kv,), 2) Ca2+
-dependent large conductance (BKCa), 3)
Ca2+
-dependent small conductance (KCa), 4) ATP-dependent K (KATP), and 5) inward
rectifier K (Kir2), the properties and functional significance of which are summarized in
Table 3.
As can be seen in the table, K channels are ubiquitous in distribution and cause
outward hyperpolarizing currents. They are generally activated by depolarization and
their inhibition is cited as the pathophysiological mechanism in a wide variety of
24
vascular responses, such as hypoxic pulmonary vasoconstriction, Ang II mediated
vasoconstriction, vascular restenosis, hypertension and coronary spasm. While all K
channels have been recognized independently, or in concert, as profoundly influencing
adaptive and pathological mechanisms of vasoconstriction and vasodilatation, the BKCa
channel mediates the effects of the most powerful coronary vasodilator (adenosine) and
its inhibition mediates the effect of the most powerful vasoconstrictor (Ang II).
Of all the K channels, the BKCa channel is the most abundant channel in human
coronary artery myocytes,63
(estimated to be 4 channels/µm2 from cell-attached patch
clamp studies). Its high conductance for K+ ions and high density of expression render
it an important player in the setting and maintenance of resting membrane potential of
coronary smooth muscle.64
Thus the BKCa channel, by enhancing K+ efflux from the
cell maintains the low intracellular K+
levels and the high extracellular K+
levels
leading to the generation of a negative intracellular potential with a transmembrane
potential of -40 mV in coronary VSMCs, 65
maintaining the cell in a hyperpolarized
state, and the vessel in a dilated state.
In vascular diseases characterized by increased tone, or vasoconstriction, such
as hypertension, cerebrovascular disease and CAD (See Table 3), the BKCa channel
and other K channels could serve as therapeutic targets.
25
Table 3. The Vascular K Channels
Channel
Type
Site Activators Inhibitors Functions Clinical
Effects
BKCa
Large
conductance
(200-300ps)
All VSMCs
All excitable
tissues
EXCEPT
Heart
Depolarization
[Ca2+
]i
Ryanodine
sensitive Ca
release
TEA </= 1
mmol/L
Charybdotoxin
Limit
depolarization
Outward
hyperpolarizing
currents
Stimulation
Coronary
vasodilation
Inhibition:
Ang II effects
KCa
Small (1-15
pS) and
intermediate
(20-60 pS)
conductance
Lymphocyte
srbcs,
fibroblasts,
proliferating
VSMCs,
endothelium,
airway
epithelia
Apamin Triarylmethane
(TRAM)
IC7043
TRAM 34
(trail for sickle
cell anemia)
Generate
endothelial-
derived
hyperpolarizing
factor 66
Stimulation:
Endothelial
dependent
NO
independent
vasodilatation
Inhibition:
Vascular
myogenic
response 67
Kv
Small and
large
conductance
Coronary,
cerebral,
mesenteric,
renal
Depolarization
Intracellular
ATP
Time
4-
aminopyridine
TEA(>10mmol/
L)
[Ca2+
]i, Ba, Mg
Set potential
Limit
vasoconstriction
Inhibition:
Hypoxic
pulmonary
vasoconstriction
KATP
(SUR2, Kir
6.0 are
subunits)
Ubiquitous ADP, insulin,
stress,
hypoxia,
acidosis, high
lactate, insulin
Low levels of
ATP,cromakali
m,
glybenclamide,
calcineurin,
Ang II,
vasopression,
endothelin, β
agonists 68
Maintains
membrane
potential
Glucose uptake
in skeletal 69
muscle
Stimulation :
Vasoplegia of
septic shock 70
SUR 2 mouse
knockouts:
Hypertension
and coronary
vasospasm
Kir Small
diameter
cerebral,
mesenteric,
coronary
arterioles
Hyperpolarizat
ion
Increased
extracellular
K+
Adenosine
Low levels of
barium, cesium
Unaffected by
other K channel
blockers71
Determines
resting potential
of arterioles
Outward current
at positive
membrane
potentials
Stimulation:
Extracellular K+
induced
vasodilatation
Hypoxia -
induced
vasodilatation
26
2.3 BKCa channel: Properties and Functions
Calcium flow into cells triggers many events such as release of calcium from
intracellular depots, activation of second messenger systems and opening of ion
channels. Gardos was the first to report that efflux of K+ ions through the membranes
of human red blood cells could be inhibited by lowering [Ca2+
]i with calcium chelating
agents.72
This observation implied that K channels were sensitive to the level of
[Ca2+
]i. The first identification of an ionic current in response to increased [Ca2+
]i was
made in 1970.73
First described in 1982 in skeletal muscle membrane preparations, BKCa
channels are defined by their high-conductance (226 pS in 0.1M KCl) specifically for
K+ (greater than 6, 10 and 200 times the conductance for sodium, rubidium and cesium
respectively).74,75
The BKCa channels differ from other K channels in that their
activation is under dual control: they are independently activated by an increase in
membrane potential (depolarization) or an increase in [Ca2+
]i.76
Physiological
processes such as muscle contraction, neurosecretion, chromaffin cell activation and
auditory hair cell tuning are triggered by an increase in [Ca2+
]i. BKCa channels serve as
a negative feedback mechanism, whereby they open in response to increased [Ca2+
]i
and/or voltage, and facilitate the efflux of K which leads to a decrease in voltage and
closure of voltage-dependent calcium channels (VDCCs) with which BKCa channels
functionally colocalize to exert their effects.77
The channel presents a reliable model to
27
test various endogenous and exogenous stimulants and inhibitors which could affect
vascular tone, to elucidate mechanisms of vasoconstriction and vassodilatation.
2.4. Structure of the BKCa Channel and Molecular
Correlates
Despite being coded for by a single gene, Slowpoke78
which is evolutionarily
conserved with 50% similarity in amino acid sequence between Drosophila and
humans, BKCa channels exhibit great diversity in properties in different tissues and cell
types. The functions of BKCa channels vary widely among cells and tissues, and under
different hormonal environments due to alternative splicing, association with specific
regulatory subunits and differences in phosphorylation status.79
The degree of
sensitivity of the BKCa channel to [Ca2+
]i is specific for every cell type in which it is
expressed based on the function it subserves. The BKCa channel consists of a pore-
forming α subunit and a regulatory β subunit: the latter confers upon the channel its
property of extreme sensitivity to increased levels of [Ca2+
]i (Figure 1B). An
abundance of the β subunit enhances channel opening in response to lower levels of
[Ca2+
]i. In the coronary VSMC, almost all α units cosegregate with β subunits: thus it
demonstrates exquisite adaptive vasodilator potential in response to changes in [Ca2+
]i.
Loss of function of the β subunit alters signal transduction pathways which lead to
altered vasoregulation.80,81
28
COOHCOOH
Figure 1B. Structure of the BKCa channel
Similar to other types of ion channels, BKCa channels consist of two distinct subunits,
pore-forming (α) and regulatory (β) , which are arranged in a 1:1 stoichiometry. The C-
terminus (COOH) of the α subunit consists of a regulator for conductance of K, or the
RCK domain and multiple phosphorylation sites for cAMP and cGMP-dependent
protein kinases PKC and tyrosine kinase. K channel blockers, such as iberiotoxin,
charybdotoxin, and quarternary ammonium compounds, such as tetraethylammonium
(TEA) and tetrabutyl ammonium (TBA) act on the pore-forming subunit (α) to block
the channel.
29
2.5 BKCa channels in the Vasculature: Stimulation
and Inhibition
Smooth muscle cell BKCa channels act as cell rheostats: their stimulation leads
to hyperpolarization and vasodilatation while their inhibition leads to depolarization
and vasoconstriction with profound effects on vascular tone and blood pressure.
Stimulation or inhibition of these channels depends on the status of the cell, and
exposure to endogenous and exogenous agents.
Resistance arteries respond to an elevation in intravascular pressure by a graded
membrane depolarization, elevation in [Ca2+
]i and vasoconstriction, which is dependent
on the increased calcium entry through voltage-dependent calcium channels.82
Maintenance of arterial tone depends upon a complex interplay of increasing and
decreasing levels of [Ca2+
]i. A number of negative feedback mechanisms are linked to
the increase in VSMC [Ca2+
]i, including the activation of BKCa channels.83
BKCa channel expression is abundant in animal 84
and HCAMSCs.63
Opening of
BKCa channels is necessary to maintain the patency of the coronary arteries.47
BKCa
channels are also expressed in the endothelium and VSMCs. However, endothelial
BKCa channels are activated at more positive potentials and are less sensitive to [Ca2+
]i
than those located in VSMCs. 85,86
BKCa channels decrease vascular tone causing vasorelaxation in diverse
tissues.87
For example, in cerebral artery myocytes, localized and brief elevations in
30
[Ca2+
]i (also known as calcium sparks) activate BKCa channels, which play an
important role as a negative feedback element in the regulation of pressure-induced
vasoconstriction.88
Inhibition of BKCa channels by iberiotoxin induces a membrane
depolarization89
, followed by an elevation of [Ca2+
]i and vasoconstriction that is
resistant to VSMC relaxants.90,91
BKCa channels show variable responses to ligands
depending on the receptor of activation and the specific signal transduction pathway
that is stimulated. For instance, BKCa channels are stimulated by angiotensin II acting
via the AT2 receptor resulting in vasodilatation and are inhibited by angiotensin II
acting via the AT1 receptor resulting in vasoconstriction.92
Several vasodilatory agents have been shown to activate BKCa channels in
HCASMCs by increasing cyclic AMP (cAMP), e.g., adenosine, β-adrenergic agents,
prostaglandin E2,93
estrogens94
and calcitonin gene-related peptide. Their signal
transduction mechanisms have been described 62, 95
in various biological systems,
including epicardial arteries.96
Inhibitors of BKCa channels have been described in
several vascular systems, including the mesenteric vasculature.97
31
2.6 Molecular Mechanisms of BKCa Channel
Activation and Clinical Implications
Recent research on the mechanism of activation of the BKCa channel and the
elucidation of the functional importance of its various subunits has revealed the
association of BKCa channels with many disease states (Table 4). Therapeutic agents
and endogenous transmitters that implicate BKCa channels in the pathophysiology of
diseases and target them for therapies are being reported at a rapid rate, mainly in the
area of neuroprotection in ischemic brain injury.98,99
Increased or decreased BKCa channel activity is implicated in the
pathophysiology of a broad spectrum of vascular diseases. An intercellular matrix
protein, metalloproteinase (MMP-2) dilates vessels in inferior vena caval preparations
from Sprague-Dawley rats and its effect is inhibited in iberiotoxin-treated veins,
suggesting that MMP-2-induced smooth muscle hyperpolarization resulting from
activation of BKCa channels may be the pathogenetic mechanism in varicose veins.100
Similarly, in experimental cirrhosis, bile acids are known to enhance BKCa channel
activity that leads to vasodilatation.101
BKCa channels are implicated in the vasoplegia
seen in sepsis, and in the hypotension and coronary vasodilatation that occur in
response to certain medications such as midazolam and propofol.102, 103
The identification of molecular partners to the BKCa channel has increased the
scope and clinical implications of our understanding of the mechanisms by which the
32
BKCa channel affects cellular function 104
, and by which its inhibition may cause
disease.
33
Table 4. BKCa Channel Activity in Diseases States
Disease Channel Gene
Expression/Manipulation
References
Hypertension MaxiKβ1
Decreased 105
Increased
coronary
artery reactivity
with old age
MaxiKα1
MaxiKβ1
Decreased 106, 107
Epilepsy with
paroxysmal
dyskinesia
Regulator of
conductance for
K+
(RCK) domain of
the BKca channel
Decreased due to a
missense mutation
108
Incontinence,
bladder
dysfunction,
erectile
dysfunction
MaxiKα1
Gene deletion
109, 110
Mild hypertension
Increased
response to
vasoactive
agonists
MaxiKβ1
Gene deletion
111, 112
Cerebellar
dysfunction
Deafness
MaxiKα
Gene deletion
113, 114
34
Chapter 3.
The Dopamine Receptors
35
“The D1 receptor will provide a fruitful ground for many scientists in the coming years.
Pure biochemists will attempt to isolate, purify and sequence the molecule itself.
Functional biochemists will study the mechanisms whereby the receptor regulates
adenylate cyclase activity. Physiologists will attempt to study the consequences of
stimulating the receptor in either the brain or in peripheral tissues. Animal
behavioralists will attempt to understand how the receptor participates in the
generation of animal response to dopaminergic drugs (both agonists and antagonists).
Finally, it remains to be determined if any novel therapeutic agents targeted towards
the D1 receptor will become commercially viable compounds.” 115
Kebabian, 1998
3.1 Dopamine
Dopamine is an important endogenous neurotransmitter in the mammalian
brain and is involved in motor coordination, affective and cognitive functions and
neuroendocrine control.116
It also serves as a precursor of epinephrine and
norepinephrine in the central and peripheral nervous system. Synthesized in the
neurons from tyrosine, dopamine affects varied physiological processes in the central
and peripheral nervous system such as cognition, gait, motor coordination, memory,
behavior, grooming and autonomic responses to stress by its effects on specific
dopamine receptors. Its role in the central nervous system (CNS) has been extensively
studied, and has yielded therapeutic benefit in diseases such as Parkinson’s disease,117,
118 Tourette’s syndrome
119 and schizophrenia.
120,121
36
Apart from the brain, dopamine is synthesized, independent of nervous
innervation, in the proximal tubule of the kidney,122
the jejunum, 123
alveolar Type II
cells in the lung, 124
the lymph nodes,125
thymus and spleen.126
Mammalian dopamine
receptors are also described outside the CNS in the adrenal gland,127
blood vessels,128,
129 carotid body,
130 intestines,
131 parathyroid gland,
132 heart,
133 kidney
134 and urinary
tract.135
Renal dopamine plays a paracrine role in sodium excretion: abnormalities in
renal dopamine synthesis or post-receptor signaling pathways leading to sodium
reabsorption have been implicated in essential and salt-sensitive hypertension in
animals and humans.122, 136
Locally produced dopamine helps alveolar fluid clearance
in the lung,124
regulates ion transport122, 123, 137,
138,
139
and motility140
in the
gastrointestinal tract, and downregulates regulatory T-cell function in circulating
lymphocytes.141, 142
3.2 Dopamine Receptors and Intracellular Signaling
Biochemical evidence that dopamine stimulates adenylate cyclase and
intracellular cyclic AMP (cAMP) was initially obtained in 1972 in the retina143
and rat
neostriatum.144
In 1976, Kebanian and Calne reported the presence of two dopamine
receptor superfamilies, the D1 receptor subtype which stimulates adenylate cyclase,
and the D2 receptor subtype, which does not. 145
Five dopamine receptor subtypes have
since been identified as belonging to the D1-like subfamily (D1R and D5R), or the D2-
like subfamily (D2R, D3R and D4R) based on whether their activation either stimulates
37
(D1-like, including D1R and D5R), or inhibits (D2-like, including D2R, D3R and D4R)
the synthesis of cAMP. 122, 136, 146-148
Studies of dopamine-receptor-mediated signaling pathways have established
the autocrine and paracrine physiological effects of dopamine in modulating renal,
adrenal and gastrointestinal function to regulate sodium balance and blood
pressure.122,136,147-150
The five dopamine receptors belong to the α-group of the
rhodopsin family of G protein-coupled receptors (GPCRs): class A, family A or family
1.151,152
They are genetically distinct from one another and are expressed differentially
in different tissues and organs. In the CNS the D1 and D2 receptors are more widely
expressed than D3, D4 and D5 receptors.153
D1-like receptor signaling is mediated
mainly by the heterotrimeric G proteins Gαs and Gαolf, which cause sequential activation
of adenylyl cyclase, cAMP-dependent protein kinase (PKA), and the protein-
phosphatase-1 inhibitor DARPP-32, which leads to increased phosphorylation of many
receptors, enzymes, ion channels and transcription factors, modulating their function.
The D1-like receptor also signals via cAMP-independent and phospholipase C (PLC)-
dependent154
mobilization of [Ca2+
]i.155
D2-like receptor signaling occurs via the
heterotrimeric pertussis-toxin sensitive G-proteins Gαi and Gαo which act via their Gα
subunits to decrease adenylyl cyclase. The D2-like receptors also induce liberation of
Gβγ subunits which regulate many more effectors such as ion channels, phospholipases,
protein kinases and receptor tyrosine kinases. 146-149
The D5R (called the D1B in the rat) was cloned in 1991.156
Similar to other
GPCRs, the D1R and D5R receptors are characterized by the absence of introns in their
38
coding regions. The D1R and D5R are highly similar (80%) in their transmembrane
(TM) domains, and share classic ligand-binding characteristics. (Figure 1C.) However,
they differ in the sequence characteristics of the third intracellular loop and carboxy
terminus. While loops 1 and 2 are highly conserved, the external loop between TM4
and TM5 is shorter in the D1R (27 amino acids) than the D5R (41 amino acids). There
is currently no known agonist that is selective for the D1R versus the D5R; however
dopamine has ten times the affinity for the D5R compared to the D1R 157, 158
There is some selective effect of the antagonist butaclamol in inhibiting the
D1R versus the D5R, but it is not sufficient to distinguish between the two.157
More
recently, a selective D5R antagonist, PM436 159
has been described, but is not yet
commercially available.
39
Figure 1C. Predicted Structure of D1R versus D5R
.
D1R and D5R are 80% homologous. They differ only in the length of the 3rd
intracellular loop between transmembrane (TM) domain 4 and TM5 (27 amino acids
for D1R versus 40 amino acids for D5R) and the sequence of the carboxy terminus.
40
The D5R has certain characteristics which suggest that it may have ‘constitutive
activity’.158,160
1. HEK 293 cells transfected with D5R have HIGHER adenylyl cyclase activity
and a GREATER increase in intracellular cAMP in response to maximal
stimulation of adenylyl cyclase compared to those expressing the D1R 158
2. HEK 293 cells transfected with D5R exhibit GREATER affinity of binding to
D1-like receptor antagonists compared to those transfected with D1R158
3. D5R transfected HEK cells exhibit an increased agonist-independent activity
increasing basal adenylyl cyclase over time when compared with the D1R
transfected HEK cells.158
3.3 Dopamine Receptor Signaling and Ion Channels
in the CNS
In the CNS, D1-like receptor activation of PKA increases the phosphorylation
of numerous voltage- and ligand-gated ion channels155
by various combinations of
direct PKA catalyzed phosphorylation of channel subunits and DARPP-32-mediated
inhibition of Protein Phosphatase 1 (PP1). For example, there are at least five potential
PKA phosphorylation sites in the LI-II region of the pore-forming α-subunit of
voltage-gated Na+ channels
161 and activation of DARPP-32 also decreases PP1-
catalyzed dephosphorylation at Ser 573. Enhanced phosphorylation at Ser 573
41
decreases Na+
currents by decreasing the open probability of the channel. 162-166
D1R
also acts via PKA to decrease K+ currents through several types of inwardly rectifying
K channels. It increases L-type Ca, and decreases N and P/Q type Ca2+
channel
activity. 167
3.4 Extraneural Dopamine Receptors: Distribution
and Physiological Effects
Serum circulating levels of dopamine (30 pmol/L) are too low to stimulate its
own receptors. However, nanomolar concontrations of dopamine can be generated in
extraneural sites such as the proximal tubule of the kidney (30 nmol/L) 168
and the
jejunum 169
where it is synthesized from circulating L-DOPA, and exerts autocrine and
paracrine effects in maintaining sodium balance. Although dopamine receptor subtypes
have organ and tissue specific expression patterns, they may be co-expressed in certain
cell types of the same organs such as the kidney, intestines and blood vessels. 170
Of
the peripheral effects of dopamine, renal effects have been best elucidated.
42
3.4.1 Renal Dopamine Receptors
All of the dopamine receptor subtypes are expressed in the kidney.170
Dopamine receptors are differentially expressed along the nephron, and their activation
leads to inhibition of the sodium pump (Na, K-ATPase) and many sodium transporters,
such as the Sodium Hydrogen Exchangers (NHE) 1 and 3, which result in the
inhibition of sodium reabsorption and enhancement of natriuresis. The inability to
excrete a salt load, resulting in salt-sensitive hypertension in rodents (spontaneously
hypertensive rat (SHR) and Dahl salt-sensitive rat (DSS)) and humans is attributed to
the uncoupling of the D1-like receptor from its G-protein effector complex, a receptor-
specific, and site-specific (mainly in the proximal tubule and the medullary thick
ascending limb) 122, 138, 148-150, 170, 171
occurrence. This has been validated in studies of
D1R and D5R knockout mice, both of which are hypertensive. 171,172
3.4.2 Gut Dopamine Receptors
Dopamine receptors are present throughout the mammalian gastrointestinal
tract.123, 131, 136, 137, 173
Dopamine, produced in the jejunum, stimulates sodium
absorption via D2-like receptors, 116
while it inhibits sodium absorption in the salt-
loaded state via D1-like receptors. 123, 136, 137, 174, 175, 176
The uncoupling of the D1 –like
receptor from its G-protein effector complex in the small intestine leads to increased
salt absorption in rodents177
which may contribute to salt-sensitive hypertension if
renal mechanisms for sodium excretion are simultaneously impaired.
43
3.4.3 Cardiac Dopamine Receptors
The cardiac effects of dopamine are mainly mediated by activation of α and β-
adrenergic receptors, in addition to dopaminergic receptors. High serum levels of
dopamine (>100 µmol/L, achieved by infusions of 10-20 µg/Kg/min) increase blood
pressure in humans by activation of α (high levels) and β (intermediate levels)
adrenergic receptors with inotropic and vasoconstrictor effects. Low dose infusions of
1-3 µg/Kg/min stimulate the dopaminergic receptors and have been shown to enhance
renal and gastrointestinal blood flow by causing vasodilatation.178
Low doses of
dopamine are also reported to increase myocardial contractility and cardiac output
without changes in heart rate. 179
There is considerable inter-individual variability in
the serum levels achieved at these low doses, and so its vascular effects can be
unpredictable, which explains the lack of efficacy in improving renal function at
‘dopaminergic’ doses.180
While D1-like receptors are expressed in the rodent and
human heart, 181, 182, 183
the effects of low circulating levels of dopamine acting on
cardiac dopamine receptors is unknown. The expression of these receptors in the heart
is not different between normotensive and In hypertensive rats. Dopamine receptor
(D1-like and D2-like) agonists have not been shown to improve the outcome in patients
with congestive heart failure. 184, 185
44
3.4. Vascular Dopamine Receptors
The D1-like receptors are localized to the postjunctional tunica media of
systemic arteries.129, 170, 186
They increase adenylyl cyclase activity and cAMP
production to cause direct vasodilatation. The D2-like receptors are predominantly
associated with sympathetic neuroeffector junctions: stimulation of these receptors
indirectly leads to vasodilatation by the inhibition of sympathetic vasoconstrictor tone.
The localization of vascular dopamine receptors has been studied extensively by
immunohistochemistry in pial (brain), renal and mesenteric artery branches of different
sizes, using anti-dopamine receptor antibodies.187
Systemic arteries including renal and
mesenteric arteries express post-junctional D1-like (D1 and D5 receptors), and
prejunctional D2-like (D2, D3 and D4) receptors.187-191
The D5R is more robustly
expressed than the D1R in the tunica media of arteries by immunohistochemical
staining.186,187
In the pulmonary circulation, dopamine D1-like receptors are located primarily
in the tunica intima (endothelium) with less robust expression in the tunica media;
dopamine receptors mediate pulmonary vascular tone by endothelium-dependent
(60%) and -independent (40%) mechanisms.192
Significantly, no dopamine receptors
are identified in the endothelium in systemic vasculature.
45
3.4.5 Dopamine’s effects on BKCa channels in the vasculature:
Mechanism
Dopamine has been shown to activate BKCa channels in various vascular
systems. Dopamine acts as a coronary vasodilator in porcine CASMCs, via D1- like
receptors.193
D1-like receptor agonists activate BKCa channels by cAMP-mediated
stimulation of PKG 193
which itself has been shown to directly activate the BKCa
channel.194
A recent study reports the occurrence of D1-like receptor-mediated
stimulation of the KATP channel in porcine CASMCs, acting via PKA.195
The functional and biochemical effects of D1-like receptor heterogeneity are
difficult to assess. Since circulating levels of dopamine are low (picomolar range)
compared to the affinity for dopamine for its receptors (nanomolar range) but 10 times
greater for D5R than D1R, the presence of the constitutively active D5R, may suggest a
role for this receptor in BKCa channel activation and resulting inhibition of coronary
vascular tone. Some of the intracellular signaling effects of D1R versus D5R lend
credence to this idea.
D1R stimulation increases phospholipase C-β (PLC-β) activity and
consequently PKC,154,196,197
which is a known inhibitor of BKca channels.198,199
while
D5R stimulation decreases PLC activity.200
As PLC enhances the breakdown of PIP2,
the inhibitory effect of D5R on PLC should result in an increase in PIP2, which
stimulates the ryanodine receptor (RyR). 201-205
Stimulation of the RyR leads to
46
localized, transient increases in [Ca2+
]i , which are referred to as calcium sparks:
calcium sparks lead to BKCa channel activation.206
47
Chapter 4.
BKCa Channel Stimulation
48
4.1 Exogenous and Endogenous Stimulants of the
BKCa Channel and their Signaling Pathways
Several exogenous and endogenous vasodilators activate BKCa channels in
VSMCs, specifically CASMCs in dogs, pigs, horses and humans. The BKCa channel is
the predominant K channel in myocytes from human coronary arteries. 63
4.1.1 Female sex hormones
Estrogen hyperpolarizes CASMCs by enhancing K conductance 207
and is a
powerful coronary vasodilator by endothelium-independent 208,209
activation of the
BKCa channel in coronary myocytes.210
cGMP is increased by 17β-estradiol in
VSMCs.211
More recently, the effect of estrogen (specifically17β-estradiol) on BKCa
channel activation in HCASMCs has been shown to be mediated by neuronal nitric
oxide synthase (nNOS), generating nitric oxide which stimulates the BKCa channel by
phophatidylinositol-3 kinase (PI3-kinase)-AKT (Protein Kinase B) signaling
pathways.212
Progesterone has been shown to inhibit BKCa channels even in the presence of a
BKCa channel activator NS 1619 in Xenopus oocytes, expressing BKCa channels. While
estrogens activate BKCa channels in this system, their effects could be reversed by
49
adding progesterone. Progesterone also inhibited Kv channels213
: these observations
could explain the opposing effects of estrogen and progesterone in causing
vasodilatation and vasoconstriction respectively.
4.1.2 Nitric oxide (NO), a potent vasodilator, activates BKCa channels in
different blood vessels by different mechanisms, such as cGMP-mediated signaling in
the rat aorta214
and via the generation of calcium sparks in rat cerebral arteries.192
In
human coronary arterioles, NO has also been reported to interact with the superoxide
anion to inhibit BKCa channels which leads to a decrease in hyperpolarization-induced
vasodilatation.216
The effect of NO on vascular tone varies depending on the species
and the nature of the vessel (resistance versus conduit).
4.1.3 Testosterone has been shown to activate BKCa channels and KATP channels
in myocytes isolated from human corpus cavernosum217
by cell-attached patch clamp
studies and whole cell electrophysiology studies which demonstrate the large-
conductance outward K current. This confirms that the molecular mechanism
underlying penile erection, which results from vasodilatation involves activation of the
BKCa channel by testosterone.
50
4.1.5 Carbon monoxide (CO) has been identified as an activator of BKCa
channels in several vascular systems including cerebral micro arterioles,218
human
endothelial cells219
and the mesenteric vasculature.220
CO acts by increasing cGMP that
leads to decreased tone in smooth muscles, including VSMCs.221, 222
Heme oxygenase
functions as an oxygen sensor and generates CO during normoxia, which activates
BKCa channels. A decrease in CO during tissue hypoxia leads to the inhibition of BKCa
channels and depolarization due to the activation of oxygen sensors such as the carotid
body.223, 224
In contrast, CO limits pulmonary vasoconstriction in response to hypoxia
by activating BKCa channels.225
Thus CO is an important autoregulatory vessel-specific
mediator of vascular and cellular responses to hypoxia. Its effects on the BKCa channel
have recently been attributed to a specific calcium-sensing domain in the BKCa
channel.226
4.1.6 Epoxides of arachidonic acid have been shown to activate BKCa
channels directly and indirectly to produce vasodilatation in porcine and canine
coronary arteries.227
Eicosanoids cause renal afferent arteriolar dilatation by stimulating
BKCa channels. This effect occurs via protein phosphatase 2A (PP2A)-mediated
dephosphorylation of the channel, 228
that is known to result in its activation.229
51
4.1.7 Prostaglandins (PG) such as PGE2 activate BKCa channels in HCASMCs
by a PKG-dependent mechanism.93
The vasorelaxant effect of prostaglandins on
murine neurovascular tone also involves the interaction of BKCa channel with heme
oxygenase.230
4.1.8 Integrins and fibronectin in the extracellular matrix activate BKca
channels, correlating the structure of vessels with their vasodilatory functional
properties.231
4.1.9 Stimulation of the µ receptors by opioids leads to activation of
BKCa channels in bovine adrenal medullary chromaffin cells, by a G protein-
independent and phosphatase-independent signaling mechanism.232
4.2.0 Effects of other agents on BKCa channels Antioxidants and
lipooxygenase inhibitors such as nordihydroguairetic acid activate BKCa channels in
porcine CASMCs. 233
Nitrovasodilators activate BKCa channels in the mesenteric
arterial tree. 234
Angiotensin II mediates vasodilatation via the AT2 receptor by
activation of BKCa channels.92
BKCa channels are activated by ligands and signal
transduction mechanisms that are unique to each organ or tissue system.
52
4.3 Dopamine and BKCa channels: Review of the
Literature
The effects of BKCa channel activation on vascular tone vary depending on the
location and diameter of the vessels involved. The threshold for BKCa channel
activation is higher in conduit vessels compared to resistance vessels, related to an
increased calcium sensitivity of the channel in smaller vessels. In the microcirculation,
an increase in the threshold of activation of the BKCa channel contributes to its
important role in negative feedback mechanisms to counteract stretch and agonist-
induced vasoconstriction, rather than in the maintenance the vessel in the ‘open’ state
at baseline. Dopamine is known to dilate smaller resistance vessels to enhance tissue
perfusion by inhibiting the KIR channel, mediated by the D2-like receptor in the
adventitia. Dopamine-receptor-BKCa channel pathways identified thus far are described
below.
4.3.1 Rodent Studies
Dopamine receptor agonists have been shown to activate BKCa channels in rat
pituitary lactotrophs.235
Low dose dopamine has been shown to stimulate prolactin secretion in a model of
pituitary lactotrophs by activating BKCa channels.236
In another study, this effect is
53
shown to be mediated by the D2 receptor, acting by coupling to the G-protein, and by
G-protein independent signaling pathways.237
4.3.2 Dopamine Stimulation of Vascular BKCa channels
Dopamine has been shown to activate BKCa channels in various vascular
systems Dopamine acts as a coronary vasodilator in porcine CASMCs by its agonist
effects on the D1- like receptors.193
D1-like receptor agonists cause activation of BKCa
channels by cAMP-mediated cross-activation of PKG193
which itself been shown to
directly activate the BKCa channel.194
Cross activation of PKG by cAMP in the activation of the BKCa channel by D1-like
receptor agonists was confirmed by biochemical and electrophysiological studies in
smooth muscle cells, including porcine CASMCs.238, 239
Drugs that increased cAMP
such as dopamine, forskolin and isoproterenol were shown to activate the channel;
treatment with the PKG inhibitor KT 5823, prevented the activation of the BKCa
channel in response to the same drugs.
A recent study reported the stimulatory effects of dopamine on KATP channels
also in porcine CASMCs but via PKA which conflicts with the previously cited article.
In this study, porcine CASMCs were studied by voltage clamp at -50mV in whole cell
and cell-attached configurations, demonstrating a 4 fold increase in KATP channel
activation in response to dopamine and a 3-fold activation with D1- like receptor
agonists such as SKF 38393 and cAMP stimulants such as forskolin. .195
54
Properties of the BKCa channels vary across species. For example, BKCa
channels need not necessarily be activated by the same hormones across species. Thus,
in contrast to myocytes from ovine, porcine or human arteries, BKCa channels of rat
coronary myocytes do not respond to estrogen.52
4.4 Rationale
Coronary vascular tone plays an important role in the progression of CAD.
CASMCs have abundant expression of the hyperpolarizing BKCa channels that cause
vasorelaxation and regulate vascular tone. The ability of low doses of dopamine to
dilate a vascular bed depends on the relative abundance of the different dopamine
receptor subtypes which varies from organ to organ, for example renal effects are
greater than mesenteric effects which are greater than effects on the coronary artery.240
Dopamine causes systemic vasodilatation by stimulating the post-junctional D1-
like receptors. D1-like and D2-like receptors can interact to regulate vascular tone. D2-
like receptors may be pre- or post-junctional. When sympathetic nerve activity is
increased, 241,242
pre-junctional D2-like receptors mediate renal vasodilatation in
humans by inhibiting norepinephrine release 243,244
while post junctional D2-like
receptors mediate vasodilation by blocking Ca2+
channels and opening K+
channels.67,245-247
In isolated rat mesenteric vessels, the postjunctional D3R, one of the
D2-like receptors, is vasodilatory, and also enhances the vasodilatory effect of D1-like
receptor stimulation.189
In contrast, in conditions like salt loading with decreased
55
sympathetic nerve activity, stimulation of post-junctional D2-like receptors can cause
vasoconstriction. 248-253
Thus the effects of D2-like receptor stimulation depend on the
activity of the sympathetic nervous system 254
and it is difficult to winnow out the
specific postjunctional pathways involved in D2-like receptor-mediated vasodilatation.
Hence, I sought to specify the D1-like receptor (D1R versus D5R) involved in
vasodilatation.
The reason for the differing pathways of D1-like receptor signaling in activating
K channels in porcine CASMCs reported in the literature may lie in the experimental
method used, such as culture conditions: freshly harvested cells 193
versus cells grown
for 6-8 days in culture.195
Although D1R and D5R share similar expression patterns in
the vasculature,128
D1-like receptor expression may be affected by culture conditions.
For example, the opossum kidney (OK) expresses both D1R and D5R, but the
commercially available OK cell line does not express the D5R.255
Human and rodent
renal proximal tubule cells 256, 257
in primary culture or after immortalization continue
to express both D5R and D1R. The expression of one or both D1-like receptors may be
important in determining the functional characteristics of the cell.
While there are similarities in the signal transduction of D1R and D5R (both
stimulate adenylyl cyclase activity), there are also differences. Previous reports 154,
196,197,258,259 indicate that a D1-like receptor stimulates PLC activity that increases PKC.
PLC activity can be increased by D1R via PKA-mediated stimulation of PKC197, 260,261
and also by PKA-independent pathways. 262
56
In VSMCs, a phorbol ester which activates PKC stimulates D1R-mediated
cAMP production263
but inhibits the effect of D5R.264
These observations suggest the
existence of unique intracellular signaling pathways for D1R and D5R, even though
they share the same ligands and exert similar effects on some cell functions such as
sodium transport in the gut and kidney.265,266
The identity of the specific K channel(s) involved and the specific receptor(s)
and pathway(s) involved in D1-like receptor effects on the vasculature remain
controversial.193,195
It is known, however, that in contrast to the D2-like receptors which
inhibit adenylyl cyclase, the D1-like receptors activate adenylyl cyclase and cAMP
which activates K channels in renal,267,268
mesenteric,269
pulmonary,270
cerebrovascular
271and coronary arteries,
82 among others. cAMP-independent pathways may also be
involved in the activation of K channels.
Activation of BKCa channels is involved in the relaxation of several different
types of smooth muscle by physiological and pharmacological agents that elevate
cAMP or cGMP.191,272
BKCa channels maintain basal relaxation of smooth muscle cells
from larger coronary arteries, which contract when these channels are blocked with
Iberiotoxin (IBTx),248
while microvascular BKCa channels, that have a higher threshold
of Ca2+
levels for activation, serve as an important negative feedback mechanism after
stretch-induced vasoconstriction. 214, 273
Early studies demonstrated antagonistic actions of cAMP and cGMP in most
tissues except in VSMCs wherein they were both reported to mediate vasodilatation. 274
PKG has been shown to be the major player in vascular and other smooth muscle
57
relaxation.275
Several studies have demonstrated that cyclic-AMP cross-activation of
PKG, rather than PKA mediates the BKCa channel stimulation that leads to
vasodilatation in response to various ligands such as estrogen in porcine CASMCs,
prostaglandin I2 (PGI2) in porcine retinal pericytes, 276
forskolin (an adenylyl cyclase
stimulant) in rodent pulmonary artery smooth muscle cells 277
and PGE2 in
HCASMCs.93
Based on this background we hypothesize that D5R and not the D1R mediates
BKCa channel activation in HCASMCs in response to D1-like receptor stimulation by a
mechanism that involves PKG and not PKA. We designed experiments to answer the
following questions:
• Do HCASMCs in culture express D1R and D5R mRNA and protein ?
• Which K channel is activated by D1-like receptor activation: the KATP
channel or the BKCa channel?
• Which D1- like receptor activates the K channel?
• What are the signaling pathways mediating D1-like receptor effects?
• Is cross activation of PKG by cAMP the mechanism underlying the
activation of K channels?
58
Figure 1D. Proposed Mechanism of Dopamine Receptor-mediated
Stimulation of BKCa Channels in HCASMCs.
D1-like receptor agonists are known to stimulate BKCa channels in porcine coronary
artery smooth muscle cells. We propose that in HCASMCs, BKCa channel activation
occurs via activation of the D5R and not the D1R. The second messenger cAMP acts
via PKG to stimulate BKCa channels.
K+
D5
D1
D1-like receptor agonistscAMP
PKG
HCASMC
K+
D5
D1
D1-like receptor agonistscAMP
PKG
HCASMC
59
Chapter 5. Hypothesis
We will test the hypothesis that the D5R and not the D1R mediates BKCa channel
activation in HCASMCs in response to D1-like receptor stimulation by a mechanism
that involves PKG and not PKA. Five specific aims will test this hypothesis and to
answer the questions posed in Chapter 4.
5.1 Specific Aims
1. To demonstrate and compare the expression of D1R and D5R in HCASMCs in
culture
2. To identify and characterize the predominant K channel in HCASMCs by
whole cell electrophysiology
3. To study the effect of dopaminergic agonists on BKCa channels, in HCASMCs
in culture by patch-clamp electrophysiological techniques
4. To identify, in HCASMCs in culture, the D1-like receptor (D1R versus D5R)
mediating the BKCa channel response to D1-like receptor stimulation, by
selective downregulation of D1R and D5R expression
5. To identify the signaling pathway involved in D1-like receptor-mediated
activation of BKCa channels in HCASMCs.
60
Chapter 6.
Methods
61
6.1. Cell Culture
Cryopreserved HCASMCs from a 33 year old Hispanic female donor and all
culture media were purchased from Clonetics (Cambrex Bioscience, Walkersville,
MD). Cells (passage 3-4) were cultured in Smooth Muscle Cell Basal Medium
(SmBm2) supplemented with growth factors (SMGM-2 quots/500 ml medium)
containing human epidermal growth factor (hEGF) , 0.5 ml, insulin 0.5 ml, human
fibroblast growth factor (hFGF-B) 1 ml (manufacturer’s proprietary concentrations of
all factors), fetal bovine serum (FBS) 25 ml and gentamicin/amphotericin (GA-1000)
(manufacturer’s proprietary concentration) 0.5 ml in an incubator at 37oC with 10%
CO2. When the cells were 75-90% confluent, they were treated with 0.25% Trypsin-
EDTA for 2 minutes; the reaction was stopped by adding cold (4oC) Trypsin
Neutralizing Solution (Clonetics Cat CC 5034, Cambrex Biosciences, Walkersville,
MD). The cells were sub-cultured onto gelatin-coated-autoclaved cover slips (5 cover
slips per 15 mm dish) for patch-clamp experiments, which were performed 24 hrs after
seeding. The cells were grown in 60 mm dishes seeded at 3,500 cell/cm2 to 80%
confluence for RNA and protein expression studies. All experiments were performed
in short-term cultured cells (passage 3-5) from the same donor, as VSMCs may
dedifferentiate and their function may be altered with long-term culture. 212
62
6.2. Dopamine Receptor Expression Studies
6.2.1 D1-like receptor mRNA expression in HCASMCs in culture
Total RNA was extracted from HCASMCs grown to 80% confluence, using an
RNeasy kit (Qiagen) and electrophoretically separated on a 2% agarose gel to confirm
the presence of tRNA and rRNA bands. RT-PCR was performed on total RNA with
SuperScript™ III First-Strand Synthesis (Invitrogen Life Technologies), using the
following reaction mixture: 2 x reaction mix 15 µl, RNA 1 µg, Superscript III RT/Taq
1 µl, forward and reverse primers for D1R and D5R, and 11 µL of deionized H2O to
make a final reaction mixture of 30 µL, and thermal cycler settings as follows : 55oC
for 30 min, denaturing temperature of 94oC for 2 min, followed by 30 cycles of 94
oC
for 15 sec, annealing temperature of 58oC for 30 sec and amplification at 68
oC for 1
min. This was followed by an elongation step of one cycle at 68oC for 5 min. The
following primers located within the coding region of the respective D1-like receptors
(Integrated DNA Technologies), were used
Receptor Nucleotide
(GENEBANK Primers Position Transcript Size
Accession No.)
D1R F: CCTGTTTCCTATCGCTGCTC 80-99
(NM_000794) 491 bp
R: TGAGGCTGGAGTCACAGTTG 552-571
D5R F: GACGGTGAACATCAGCAATG 1551-1570
(NM_000798) 212 bp
R: CCCAGACAGACTCAGCAACA 1743-1762
63
Real-time PCR for D1R and D5R mRNA was performed on ABI Prism 7700 (ABI,
Foster City, CA) using the following primers
Nucleotide
Receptor Primers Position
D1R F: TCTCCAAGGAGTGCAATCTG 1141-1161
R: ATGGGTTGGATCTTCTCCAG 1111-1131
D5R F: AGCTGCCTACATCCACATGA 1220-1240
R: TCCCAGACAGACTCAGCAAC 1347-1367
GAPDH primers were obtained from Clontech.
Real-time quantitative PCR (qPCR) was performed in triplicate, using SYBR
Green PCR Master Mix (ABI, CA). Relative amounts of D1R and D5R mRNA were
normalized by GAPDH and calculated from threshold cycle numbers (CT, ie. 2-
∆∆CT).
278
6.2.2 Protein Expression
D1R protein expression was determined in whole cell lysates from 80%
confluent HCASMCs (Passage 4-5) by immunoblotting using polyclonal D1R antibody
(anti-rabbit 1:300 primary, one hr and 1:5000, secondary for 3 hr). 279, 280
D5R protein
expression was similarly determined as for D1R protein except for the use of a
polyclonal anti-D5R rabbit antiglobulin (1:300, primary, one hour) and a goat anti-
64
rabbit secondary antibody conjugated with horseradish peroxidase (1:5000, secondary
for 3 hr).
The polyclonal D5R antibody was raised against the peptide
CRSSAACAPDTSLR and affinity-purified in our laboratory. The peptide has 100%
sequence identity with human D5R (NP000789.1, aa272-285), 71% with mouse D5R
(AAA16844.1) and 64% with rat D5R (EDL 99998.1), respectively. Immunoblotting of
whole kidney homogenates with the D5R antibody showed a 55 kDa band in D5+/+
but
not in D5-/-
mice. Immunostaining of kidney sections showed strong positive signals in
D5+/+
mice that were not seen when the antibody was blocked by pre-adsorption with
the immunizing peptide or when applied to D5-/-
mouse kidney sections. These studies
confirmed the specificity of the D5R antibody (data not shown).
6.3 Dopamine Receptor Gene Silencing by RNA
Interference
6.3.1 Transient Transfection of HCASMC with D1R Scr, D1R As,
D5RScr and D5R As oligonucleotides tagged with cy3™ red fluorescence.
As oligonucleotides were designed from published data 281
while the sequences
for the Scr oligonucleotides were obtained by using the Genscript website
http://www.genscript.com
65
Receptor
(GENBANK Primers Transcript
Range
Accession No.)
D1R As 5-/5Cy3/ATGGCAGAGGTGTTCAGAGTCCTCAT-3
(X55760) 277-294
Scr 5-/5Cy3/GCTGTTATGGAC ACGACTGAATTGGC-3
D5R As 5-/5Cy3/CAGCATTTCGGGCTGGACTGCAGGGT-3
(M 7349) 136-161
Src 5-/5Cy3/GCGCTGCGAATGGTCTGAGGATTCCG-3
100 nmol/L oligonucleotides were ordered from Integrated DNA Technologies, Inc.
Transfections were performed as follows: HCASMCs were grown to 80%
confluence in serum-free medium in 60 mm dishes. Fifty nmol/L oligonucleotides
(D1R As, D1R Scr, D5R As, and D5R Scr) diluted 1:1000 in serum-free medium
(OPTIMEM) were incubated with Lipofectamine diluted 1:10 in serum-free medium
(OPTIMEM) for 20–30 min and added to the cells and incubated overnight after which
the medium was exchanged for complete growth medium. Protein expression studies
were performed after 24 hr. The operator was blinded to the identity of the
oligonucleotides used for transfection.
66
6.3.2 Confirmation of receptor protein downregulation
By Confocal Microscopy
Because the oligonucleotides used were tagged with cy3™ red, all transfected
cells demonstrated red fluorescence, and were thus identified for electrophysiological
experiments.
By Immunoblot
Immunoblots were performed with D1R and D5R antibodies on extracts of cells
transfected with D1R and D5R Scr and As oligonucleotides non- transfected cells were
used as controls. Protein expression of D1R was compared in cells transfected with
D1R As and D1R Scr oligonucleotides while D5R expression was compared in cells
transfected with D5R As and D5R Scr oligonucleotides. We also examined D1R
expression in D5R (Scr and As)-transfected cells and D5R expression in D1R (Scr and
As)-transfected cells to confirm the specificity of downregulation; D1R and D5R
protein share 49% similarity in amino acid sequence and 80% similarity in their
putative transmembrane domains.
Uniformity of protein loading and membrane transfer were determined by
immunoblotting for human β-actin. The intensity of bands in the respective groups was
quantified using SCION software.
67
6.4 Patch Clamp Studies
Figure 2A. represents a schematic depiction of the configuration of whole cell
perforated patch, cell-attached patch and inside-out patch. While the whole cell
perforated patch permits recording current at different voltages, the cell-attached patch
facilitates the study of a single ion channel, and the inside-out configuration offers the
facility of studying the effect of changes in the intracellular milieu by changing the
composition of the bath solution. Figure 2B. shows the configuration of the cell-
attached patch on a single HCASMC as visualized by differential interference contrast
microscopy. The pipette is placed on the cell membrane, and recordings are made after
establishment of an adequate ‘seal’.
68
Figure 2A.
Schematic diagram of various patch clamp recording configurations. A gigaseal is
formed by gentle suction when the pipette touches the cell, allowing cell-attached
patch recording; whole-cell (perforated) patch is created by the addition of
amphotericin B to the pipette solution or by entle suction; inside-out excised patch is
obtained by gently lifting up the pipette and pulling away from the cell.
SuctionSuction
Cell-attached patch Whole-cell patch
Inside-out patch
Amphotericin
SuctionSuction
Cell-attached patch Whole-cell patch
Inside-out patch
Amphotericin
69
Figure 2B.
Differential interference contrast microscopy image of the cell-attached patch. The
pipette of 3-5 mΩ resistance generated a seal of 1 gigaΩ resistance; a single channel
electrophysiological tracing was obtained and BKCa channel responses to voltage
clamp, and the effects of the serial addition of drugs to the extracellular solution were
recorded.
Pipette Tip
70
6.4.1 Characterization of the BKCa Channel by Whole Cell
Electrophysiology in Non-transfected HCASMCs (n = 3) to
demonstrate the properties of the K channel were performed using the perforated patch.
Ionic currents were recorded at 33 ± 0.5 oC using the whole-cell patch clamp
technique55
with the Axopatch 200B amplifier. The pCLAMP 10.0 software
application was used for analysis. Pipettes with tip resistance of 2-3 mΩ were filled
with solution of the following composition (mmol/L): KCL, 140; ATP (Mg salt) 4;
EGTA, 5; MgCl2, 1; HEPES, 10; pH 7.4 (adjusted with KOH). Amphotericin
(solubilized: SIGMA, A9528) was added to the solution in a concentration of 0.5
mg/ml. Amphotericin is a polyene antibiotic which forms ‘pores’ or channels in
cholesterol or ergosterol-containing membranes which are 9 times more permeable to
monovalent cations (Na+, K
+) than Cl
- anions, but exclude multivalent cations such as
Ca++
or Mg++
. Cell capacitance was measured and compensated. Series resistance was
compensated 60-80%. The external solution (Tyrode’s) contained (mmol/L): NaCl,
137; KCl 5.4; CaCl2, 2; HEPES, 10; MgCl2, 1; Glucose, 10; (pH= 7.4, NaOH). Current-
voltage (IV) curves were generated at voltages from -40 mV to +50 mV based on an
average of 3 whole cell recordings.
71
6.4.2 Treatment with IBTx
IBTx is a specific inhibitor of BKCa channels. In order to characterize the
channel in HCASMCs IBTx (300 nmol/L) was added to the extracellular bath solution,
and recordings of whole cell currents were obtained after incubation with the drug for
about 5 min.
6.4.3 Studies in the excised patch (I/O) configuration to
demonstrate calcium sensitivity
HCASMCs were studied in the I/O configuration. Exposure of the cytoplasmic side of
the membrane to higher concentrations of calcium (Ca2+
=10-4
mol/L) in the
extracellular bath solution was followed by changing the extracellular solution to 1
mmol/L Tetraethyl Ammonium (TEA) which, at this concentration, specifically
inhibits the BKCa channel. 282
6.5 Cell-attached Voltage-clamp Experiments
6.5.1 Method
Experiments were conducted in cells (passage 3-4) in a recording chamber
containing the following solution (mmol/L): 140 KCl, 10 MgCl2, 0.1 CaCl2, 10
HEPES, and 30 glucose (pH 7.4; 22–25°C), also known as ‘high K+ solution’ to
72
enhance the regulation of patch-membrane voltage by the patch-clamp amplifier and to
yield accurate measurements of the current flowing across the patch. Cover slips were
placed in the chamber of a phase contrast microscope, treated with high K+ solution
and contractility of the cells was confirmed by direct microscopy. Contractile cells
were identified for cell-attached experiments. All experiments were performed at 33oC.
Glass Pipettes (Cat No 64-0817, OD 1.5 mm, ID 1.16) were pulled using a
pipette puller, Model P-2000, Sutter Instrument Co., Novato, CA and polished using a
pipette polisher, Narishge Scientific Instrument Lab, Tokyo, Japan.
Cells were treated with cell detachment solution, HyQTase; 0.5 mmol/L EDTA
in PBS (Hyclone, Logan, Utah) was used at 4oC because at that temperature the cells
detach easily. Cells were treated with PBS-EDTA for 90 sec. Then the drug was
pipetted off the cells gently and the cells were rinsed repeatedly with high K+ solution.
After about 20 min, when the cells were observed to ‘round’ up; small, round, bright
cells were chosen for patching. The pipettes were placed on the round cell as shown in
Figure 2B to create a high resistance ‘gigaseal’. To facilitate consistent formation of
gigaseals, freshly pulled pipettes were used, and used only once.60
The interior of the
pipette was thus isolated from the surrounding extracellular solution and no current
leaked across. The high seal resistance also prevented thermal movement of the
charges in the conducting pathways of the seal, which minimized the ‘noise’ in the
recording. These gigaseals were obtained routinely after application of gentle suction.
The presence of a good seal minimized the ‘noise’ from current leakage and decreased
the fraction of undetected current.60
73
The activity of single K channels was recorded (using the pCLAMP 9.0 and
10.0 software applications, Axon Instruments) in cell-attached patches by filling the
patch pipette (3 mΩ resistance) with Ringer solution (mmol/L): 110 NaCl, 5 KCl, 1
MgCl2, 2 CaCl2 and 10 HEPES, and generation of 1 gigaohm seal on an intact cell.
Voltage across the patch was controlled by clamping the cell at 0 mV with the high-
concentration K+ extracellular (bath) solution (1 ml). In experiments recording K
channel activity of inside-out patches, the bathing solution exposed to the cytoplasmic
surface of the membrane had the same high K+ solution described above, while the
pipette solution had the same 140 mmol/L K+ solution described above to set the
equilibrium constant for K (EK) to 0 mV. Cells that demonstrated high conductance,
voltage-stimulated channels characterized previously as BKCa channels were treated
with the partial D1-like receptor agonist, fenoldopam and the full D1-like receptor
agonist, SKF 81297, and dopamine, and channel activity was recorded, with voltage-
clamp of + 40mV about 15-20 minutes after addition of the drug.
Currents were filtered at 1 kHz and digitized at 10 kHz. Average channel
activity (expressed as number of channels x NPo) in patches with multiple BKCa
channels was determined by
where Po is the single-channel open-state probability, T is the duration of the
recording, tj is the duration of j =1,2, ... n channel openings, J is the number of
74
channels open for duration tj, and N is the maximal number of simultaneous channel
openings observed when Po was high. 272
NPo calculations were based on 10–15 sec continuous recording during periods
of stable channel activity. NPo calculations were performed using the Fetchan
program or pCLAMP 10.0 to identify the 10 pA channel, and track the number of
channel opening events. Although channel activity was observed at a variety of
membrane potentials, most single-channel data were analyzed at a potential of 40 mV,
where BKCa channel openings are better distinguished from other channel species to
enable more accurate statistical analysis.277
6.5.2 Drug Treatments
All drugs were freshly prepared from stock solutions in a dark environment.
Drugs diluted in the bath solution were added gently at the desired concentration to the
recording chamber containing 1 ml bath solution, using a pipette. Average period of
incubation with drugs in a dark environment at room temperature was 10-15 min. The
D1-like receptor partial agonist fenoldopam mesylate (1 and 10 µmol/L), D1- like
receptor full agonist SKF 81297 (1 and 10 µmol/L) and the native ligand dopamine (1
and 10 µmol/L) were added to 1 ml Ringer’s solution in the bath. Recordings were
made 15 min after addition of each drug with a voltage clamp of + 40 mV. Recordings
were not taken during periods of incubation with the drug to conserve disc space. All
drugs were added consecutively to the same cell and recordings taken from the same
75
cell. Once decisive BKCa channel stimulation was obtained after addition of a drug,
higher doses or more potent agonists were not added, as profound channel activation
leads to membrane instability which could disrupt the seal, and would preempt
successful study of the effect of subsequent addition of the D1-like receptor antagonist
in the cell-attached configuration. After BKCa channel stimulation, the D1-like receptor
antagonist SCH 23390 (10 µmol/L) was added to the bath, recordings were taken 15-
20 min after incubation. The selectivity of the dopaminergic antagonist SCH 23390 for
D1-like receptors is roughly 1000 times higher than for D2- like receptors.157
After the
BKCa channel was inhibited, an I/O patch was obtained on the same cell, enhanced
BKCa channel activation was recorded immediately on exposure to the ‘intracellular’
bath solution with high calcium (Ca2+
=10-4
mol/L) and inhibition was demonstrated as
soon as I/O solution (Ca2+
=10-9
mol/L) was perfused into the bath proving calcium-
sensitivity of the channel.
6.5.3 Patch-clamp Studies in Transfected HCASMCs
Cells were studied 3-6 hr after transfection. Cells transfected with
oligonucleotides tagged with cy-3 red demonstrated red fluorescence and were selected
for patching. The operator was blinded to the identity of the cells being patched. BKCa
channel activation in HCASMCs transfected with D1R and D5R As and Scr
oligonucleotides was studied after treatment with D1-like receptor agonists as
described above.
76
6.5.4. I/O experiments were performed as described previously and the
response to a lower concentration of calcium in the I/O solution was studied in cells
transfected with D1R As and D5R As oligonucleotides. This experiment was needed to
rule out a seal on a membrane vesicle that has no ion channels and to confirm the
presence of active calcium-sensitive BKCa channels in the patch if there was no
response in the D1R or D5R As-treated HCASMCs.
6.5.5. Effects of PKA and PKG Inhibition on Stimulation of
BKCa Channels by D1-like Receptor Agonists
Studies of intracellular signaling pathways were performed using the KT group
of drugs, which competitively inhibit ATP binding to the kinase catalytic site in vitro
and exhibit dose-related specificity for the kinase PKG versus PKA.283
Non-transfected
HCASMCs were pretreated with 300 nmol/L PKG inhibitor KT5823 (SIGMA) for 30
min. D1-like receptor agonists were then added serially to the recording chamber in the
presence of KT5823, as described previously.
In the next series of experiments, non-transfected HCASMCs were treated with
fenoldopam (1 µmol/L) to activate the BKCa channel. Subsequently the cells were
incubated with the PKA inhibitor KT5720 (SIGMA) (300 nmol/L) for 20-30 min. The
77
cells were then treated with the PKG inhibitor KT5823 (300 nmol/L) and BKCa channel
activity was recorded after 20 min of incubation.
6.5.6 Statistical Analysis
Data are expressed as mean ± standard error of the mean (SEM). Comparison between
two groups was performed using Student’s t-test and one-way ANOVA for multiple
comparisons with post-hoc Tukey’s test. P<0.05 was considered significant.
78
Chapter 7.
Results
79
7.1. D1R and D5R Expression studies
Expression of D1R and D5R mRNA in HCASMC (P4) was demonstrated by
RT-PCR (Figure 3A); agarose gel electrophoresis showed single bands representing
D1R (418 bp) and D5R (212 bp) respectively. As the PCR products were obtained after
40 cycles, the gene product was not in the linear portion of the amplification curve,
although equal quantities of RNA (1µg) was loaded, and integrity of RNA loading was
confirmed by GAPDH expression.
D5R mRNA expression was 7-fold higher than D1R mRNA expression determined by
qRT-PCR (Figure 3B) and using GAPDH as control.
80
Figure 3A.
2% agarose gel electrophoresis of RT-PCR products of D1R (492 bp) and D5R (212
bp) mRNA from HCASMCs (Passage 4) M = Marker (100 bp)
100 bp
400 bp
M D1R D5R
81
Figure 3B.
qRT-PCR was used to quantify mRNA levels for D1R and D5R. The relative amounts
of D1R and D5R were normalized to GAPDH, and calculated from threshold cycle
numbers (2 -ΔΔCT
= 7.07± 0.08, Mean ± S.E.M., n = 3 observations). D5R mRNA
expression was 7-fold greater than D1R mRNA expression in HCASMC. (*P<0.05,
paired t-test)
D1R D5R0
2
4
6
8
Fo
ld
Dif
fere
nc
e
in m
RN
A/G
AP
DH
*
82
7.1.1 Confirmation of transfection and effects on receptor protein
expression
Non-transfected HCASMCs (Figure 4A), HCASMCs transfected with cy-3 red
-tagged D1R Antisense (AS) (center) and D1R Scrambled (Scr) (right) oligonucleotides
were identified by epifluorescence microscopy for patch-clamp experiments.
Immunoblotting of non-transfected HCASMC lysates (control) with D1R
antibody revealed distinct band at ≈ 60 kDa (Figure 4B), consistent with published
data.260 The expression of D1R was significantly (P<0.05) decreased in HCASMCs
transfected with D1R AS oligonucleotides compared to non-transfected controls and
cells transfected with D1R Scr oligonucleotides (Figure 4B). The D1R AS
oligonucleotides were specific to the D1R because D5R expression was unchanged in
cells transfected with D1R AS oligonucleotides (Figure 4C).
83
Figure 4A.
Representative differential interference contrast microscopic images of non-
transfected HCASMCs (left) and HCASMCs transfected with D1R As (center) or Scr
(right) oligonucleotides tagged with cy-3 red fluorescence. Red fluorescent cells were
identified for electrophysiological experiments.
HCASMC
(Non-transfected)D1R As D1R Scr
10 µm 10 µm
10 µm
10 µm
10 µm
84
Figure 4B.
D1R protein (≈60 kDa) was significantly decreased in cells transfected with D1R
antisense (As) oligonucleotides compared to non-transfected and D1R scrambled (Scr)
transfected cells, as determined by immunoblotting with the polyclonal D1R antibody.
n = 4 blots. *P< 0.05 by one-way ANOVA followed by Tukey’s test.
D1R
/Acti
n E
xp
ress
ion
(% o
f co
ntr
ol)
Control D1R As D1R Scr0
20
40
60
80
100
120
*
As
- 38 kDa
- 50 kDa
β Actin
co
ntr
ol
D1R
Scr
- 38 kDa
- 50 kDa
D1R
/Acti
n E
xp
ress
ion
(% o
f co
ntr
ol)
Control D1R As D1R Scr0
20
40
60
80
100
120
*
As
- 38 kDa
- 50 kDa
β Actin
co
ntr
ol
D1R
Scr
- 38 kDa
- 50 kDa
D1R
/Acti
n E
xp
ress
ion
(% o
f co
ntr
ol)
Control D1R As D1R Scr0
20
40
60
80
100
120
*
Control D1R As D1R Scr0
20
40
60
80
100
120
*
As
- 38 kDa
- 50 kDa
β Actin
co
ntr
ol
D1R
Scr
- 38 kDa
- 50 kDaA
s- 38 kDa
- 50 kDa
β Actin
co
ntr
ol
D1R
Scr
- 38 kDa
- 50 kDa
85
Figure 4C.
D5R protein expression (≈ 50 kDa) was NOT significantly decreased in HCASMCs
transfected with D1R As and D1R Scr oligonucleotides compared to non-transfected
controls. Bands were quantified against human β actin. n = 4 blots.
co
ntr
ol
D5R
- 38 kDa
As
Sc
r
- 50 kDa
β Actin
co
ntr
ol
D5R
- 38 kDa
As
Sc
r
- 50 kDa
β Actin
0
20
40
60
80
100
120
D5R
/Acti
n E
xp
ress
ion
(% o
f co
ntr
ol)
Control D1R As D1R Scr
86
Non-transfected HCASMCs (Figure 5A), HCASMCs transfected with cy-3 red -tagged
D5R As (center) and D5R Scr (right) oligonucleotides were also identified by
epifluorescence microscopy for patch-clamp experiments. The efficiency of
transfection with D1R and D5R Scr and As oligonucleotides was 83.4% ± 3% (n = 84
transfections) as assessed by two independent, blinded observers.
Immunoblotting of non-transfected HCASMC lysates (control) with D5R
antibody revealed distinct band at ≈ 55 kDa. The expression of D5R in HCASMCs
transfected with D5R As oligonucleotides was significantly (P<0.05) decreased
compared to non-transfected controls and cells transfected with D5R Scr
oligonucleotides (n = 4) (Figure 5B). A decreased density of the 55 kDa band in D5R
As transfected cells is associated with a lack of increase in cAMP in response to the
D1-like receptor agonist fenoldopam in human renal proximal tubule cells.233
D1R
expression was unchanged in cells transfected with D5R As oligonucleotides (Figure
5C), confirming specificity of transfection.
87
Figure 5A.
Representative differential interference contrast microscopic images of non-
transfected HCASMCs (left) and HCASMCs transfected with D5R As (center) or Scr
(right) oligonucleotides tagged with cy-3 red fluorescence. Red fluorescent cells were
identified for electrophysiological experiments.
HCASMC
(Non-transfected)D5R As D5R Scr
10 µm
88
Figure 5B.
D5R protein (≈ 50 kDa) was significantly decreased in cells transfected with D5R
antisense (As) oligonucleotides compared to non-transfected and D1R scrambled (Scr)
transfected cells by immunoblotting with the polyclonal D1R antibody. n = 4 blots *P<
0.05 by one-way ANOVA followed by Tukey’s test
0
20
40
60
80
100
120
*
D5R
/Acti
n E
xp
ress
ion
(% o
f co
ntr
ol)
Control D5R As D5R Scr
co
ntr
ol
As
Scr
D5R
β Actin - 38 kDa
- 50 kDa
0
20
40
60
80
100
120
*
D5R
/Acti
n E
xp
ress
ion
(% o
f co
ntr
ol)
Control D5R As D5R Scr
co
ntr
ol
As
Scr
D5R
β Actin - 38 kDa
- 50 kDa
89
Figure 5C.
D1R protein expression (≈60 kDa) was NOT significantly decreased in HCASMCs
transfected with D5R As and D5R Scr oligonucleotides compared to controls. Bands
were quantified against human β-actin. n = 4 blots
D1Rc
on
tro
l
- 38 kDa
As
Scr
- 50 kDa
β- Actin
D1R
/Acti
n E
xp
ress
ion
(% o
f co
ntr
ol)
0
20
40
60
80
100
120
Control D5R As D5R Scr
D1Rc
on
tro
l
- 38 kDa
As
Scr
- 50 kDa
β- Actin
D1R
/Acti
n E
xp
ress
ion
(% o
f co
ntr
ol)
0
20
40
60
80
100
120
Control D5R As D5R Scr
90
7.2 Characterization of the Ion Channel as the BKCa
Channel in HCASMCs
The voltage-sensitivity of the predominant channel in a single HCASMC using
the perforated-patch technique (Figure 6A) was determined. Whole-cell steady-state K+
outward currents increased in response to incremental 200 ms voltage steps of 10 mV
from a holding potential of -60 mV while an attenuated response was obtained when
the cell was treated with 100 nmol/L IBTx, a highly selective inhibitor of BKCa
channels. 81
The current-voltage (IV) relationship in the whole-cell configuration in
HCASMCs was plotted from a holding potential of -60 mV. Figure 6B shows outward
currents generated at -40 mV from the holding potential; the currents increased with
application of 10 mV voltage pulses lasting 200 milliseconds each up to +50 mV,
without inactivation between pulses. IBTX attenuated this response between the -10
mV and +50 mV depolarization potential steps. (P < 0.05, paired t-test, n=3) This
pharmacological and kinetic profile implicated the BKCa channel as the main
conducting channel for outward currents in HCASMCs in response to the application
of depolarizing voltage, consistent with previous studies. 62
91
7.2.1 Inside-out Configuration
In the cell-attached configuration minimal channel opening was observed.
(NPo=0.0005±0.005, +40 mV, n=4 patches) (Figure 6C) Excision of the patch into the
inside-out (I/O) configuration which exposed the ‘intracellular’ membrane to higher
calcium concentrations (10-4
mol/L compared to 10-9
mol/L) led to a 100-fold increase
in the opening of large amplitude (10 pA) channels (NPo=0.451+/- 0.003, n=4
patches), while exposing the cytoplasmic surface of the patch to 1 mmol/L
tetraethylammonium (TEA), a specific inhibitor of BKCa channels at this concentration,
decreased channel opening to baseline levels within 2 min . TEA inhibits BKCa channel
activity by blocking its pore-forming α subunit (Figure 2B) on the intracellular aspect
of the membrane which is exposed to the 1 mmol/L TEA in the bath solution in the
(I/O) configuration. Thus significant activation of BKCa channel on exposure to
increased levels of calcium was observed. NPo increased from 0.001±0.001 to
1.1887± 0.1 (P<0.05, n=4) (Figure 6D). The channel was inhibited by TEA at 1
mmol/L. Taken together, these properties identify this channel as the BKCa channel.63,95
92
Figure 6A.
Left, outward currents were measured in response to a series of 200-ms voltage steps
of 10 mV each from a holding potential of -60 mV, as illustrated by a control whole
cell electrophysiological tracing of a single HCASMC. Top Right, currents generated
from -40 mV to +50 mV are shown. Bottom Right, treatment with 100 nmol/L
iberiotoxin (IBTx), a highly specific blocker of BKCa channels, reduced outward
currents compared to controls between -10mV and +50 mV.
100 pA
50 ms
Control IBTx (100 nmol/L)
- 60 mV
- 50 mV- 40 mV
+ 50 mV
100 pA
50 ms
Control IBTx (100 nmol/L)
- 60 mV
- 50 mV- 40 mV
+ 50 mV
100 pA
50 ms
Control IBTx (100 nmol/L)
- 60 mV
- 50 mV- 40 mV
+ 50 mV
- 60 mV
- 50 mV- 40 mV
+ 50 mV
93
Figure 6B.
Complete current-voltage relationship for steady-state outward current recorded from a
single HCASMC (holding potential -60 mV) was plotted. The addition of 100nM IBTx
reduced outward currents from -10 mV to +50 mV. n = 3 cells. *P<0.05, paired t-test
for current at each voltage.
Cu
rren
t (p
A)
*
94
Figure 6C.
BKCa channel is a Ca2+
-activated potassium channel in HCASMCs. Recordings from
the same membrane patch in the cell-attached configuration (100 nmol/L Ca2+
, +40
mV; top), after excision as an inside-out patch (100 mmol/L Ca2+, + 40 mV; center)
and 2 minutes after treatment with 1 mmol/L TEA (+ 40 mV, bottom), which abolished
channel activity. Upward deflections are channel openings from the channel closed
state (dashed line). Larger amplitude currents (~ 20 pA) represent double channel
openings.
inside-out
(Ca2+= 10-4 mol/L)
+ 1 mmol/L TEA
control
(Ca2+= 10-9 mol/L)
10 pA
200 ms
10 pA
200 ms
95
Figure 6D.
Bar graphs of the effect of ‘intracellular’ Ca++
on BKCa channel opening. Inside-out
patch (and increased ‘intracellular’ Ca++
) increased NPo in HCASMCs compared to
the cell-attached configuration (control). The subsequent addition of TEA (1 mmol/L),
a specific inhibitor of the BKCa channel at this concentration, decreased channel
opening to control levels.
( n = 4, + 40 mV, *P< 0.05 vs others, one-way ANOVA followed by Tukey’s test)
0
0.5
1
1.5
control inside-out 1 mmol/L TEA
*
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
0
0.5
1
1.5
control inside-out 1 mmol/L TEA
*
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
96
7.3 D1-like Receptor-mediated Effects on BKCa
Channels in HCASMCs
7.3.1 Cell-attached patches of non-transfected HCASMCs (Figure
7A) were characterized by large amplitude (10 pA) current at baseline
(NPo=0.0225±0.005, n=9 patches), which exhibited increased channel activity 5 min
after treatment with the partial D1-like receptor agonist, fenoldopam (1 µmol/L)
(NPo=0.4965±0.119392, n=9 patches) and reversal of stimulation 5 min after treatment
with the D1-like receptor antagonist, SCH 23390 (10 µmol/L) (NPo=0.0157±0.005)
(Figure 7B ). On average, the D1-like receptor agonist increased BKCa channel opening
by 20-fold in non-transfected HCASMC. These findings were consistent with
published findings in porcine coronary artery smooth muscle cells. 193
7.3.2 Pretreatment of non-transfected HCASMCs with 10
µmol/L SCH 23390 (D1-like receptor antagonist) for 5 min (Figure 7C) with
subsequent addition of fenoldopam (1 and 10 µmol/L) did not increase BKCa channel
activity and NPo (Figure 7D).
97
Figure7A.
Recordings from the same membrane patch in the cell-attached configuration in a non-
transfected HCASMC before (top, control) and after (middle) exposure to 1 mmol/L
fenoldopam (partial D1-like receptor agonist). The subsequent addition of 10 mmol/L
SCH 23390 (SCH) (D1-like receptor antagonist) reversed the stimulatory effect of
fenoldopam ( bottom). Upward deflections are channel openings from the channel
closed state. Larger deflections reflect double channel openings.
inside-out
(Ca2+= 10-4 mol/L)
+ 1 mmol/L TEA
control
(Ca2+= 10-9 mol/L)
10 pA
200 ms
10 pA
200 ms
98
Figure 7B.
Bar graphs of the effect of fenoldopam on BKCa channel opening. Fenoldopam (1
mmol/L) increased BKCa channel opening in HCASMCs compared to vehicle. The
subsequent addition of 10 mmol/L SCH 23390 decreased channel opening to
pretreatment levels (+ 40 mV; n = 9, *P < 0.05 vs others, one-way ANOVA followed
by Tukey’s test).
0
0.5
1
1.5
control inside-out 1 mmol/L TEA
*
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
0
0.5
1
1.5
control inside-out 1 mmol/L TEA
*
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
99
Figure 7C.
BKCa channel opening in a non-transfected HCASMC (control, top) was unchanged
with 10 µmol/L SCH 23390 (SCH). Subsequent treatment with fenoldopam (1 and 10
µmol/L) failed to open the BKCa channels. n = 3 cells.
control
+ SCH 23390 (10 µmol/L)
+ fenoldopam
(1 µmol/L)
+ fenoldopam
(10 µmol/L)
10 pA
200 ms
10 pA
200 ms
100
Figure 7D.
Bar graphs of the effect of SCH 23390 (SCH) and SCH plus 1 and 10 µmol/L
fenoldopam of BKCa channel opening (n = 3) compared to control non-transfected
cells.
0
0.001
0.003
0.005
0.007
0.009
control SCH fenoldopam1 µmol/L
fenoldopam10 µmol/L
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
ne
l (N
Po
)
0
0.001
0.003
0.005
0.007
0.009
control SCH fenoldopam1 µmol/L
fenoldopam10 µmol/L
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
ne
l (N
Po
)
101
7.4 Studies in As and Scr Oligonucleotide-
transfected HCASMCs
HCASMCs transfected with D1R Scr oligonucleotides had a significant dose-
dependent increase in BKCa channel with fenoldopam treatment. BKCa channel opening
increased from a baseline of NPo=0.011±0.005 to NPo=0.0182±0.0038 with 1 µmol/L
fenoldopam (partial D1-like receptor agonist) and 0.1502±0.052 with 10 µmol/L
fenoldopam. BKCa channel opening increased further to 0.489±0.25 with the addition
of 1 µmol/L SKF 81297 (full agonist D1-like receptor agonist) and to 0.5475±0.3 with
the addition of 10 µmol/L SKF 81297 (Figures 8A and 8B).
HCASMCs transfected with D5R Scr oligonucleotides (Figure 8C and 8D) also
demonstrated a dose-dependent activation of BKCa channels from a baseline NPo of
0.04±0.002 which increased progressively with the serial addition of fenoldopam at 1
and 10 µmol/L to 0.25±0.065 and 0.48±0.127, respectively. The addition of the full D1-
like receptor agonist SKF 81297 at 1 and 10 µmol/L to the same cell further increased
the NPo to 0.57±0.149 and 0.61±0.112, while subsequent addition of 10 µmol/L
dopamine increased NPo to 0.91928±0.001. This effect was abolished by the addition
of the D1-like receptor antagonist SCH 23390.
102
Figure 8A.
Recordings from the same membrane patch in the cell-attached configuration of a
single HCASMC transfected with D1R Scr oligonucleotides 5-10 min after serial
addition of increasing doses of the partial D1-like receptor agonist, fenoldopam (1 and
10 µmol/L) and full D1-like receptor agonist, SKF 81297 (10 µmol/L) showed
progressive stimulation of the BKCa channel. The subsequent addition of the D1-like
receptor antagonist SCH 23390 (10 µmol/L), decreased channel opening to
pretreatment levels. Upward deflections are channel openings from the channel closed
state (dashed line). Deflections of ~20 pA amplitude represent simultaneous double
channel opening.
control
+ fenoldopam(1 µmol/L)
+ SKF 81297 (10 µmol/L)
+ SCH 23390 (10 µmol/L)
10 pA
200 ms
+ fenoldopam(10 µmol/L)
103
Figure 8B.
Serial treatments with the partial D1-like receptor agonist, fenoldopam (1 and 10
mmol/L) and the full D1-like receptor agonist, SKF 81297 (1 and 10 mmol/L)
increased BKCa channel opening in HCASMCs transfected with D1R Scr
oligonucleotides. The subsequent addition of SCH 23390 (10 mmol/L) decreased
channel opening to pretreatment levels (*P< 0.05, versus others, one-way ANOVA,
Tukey’s test, n = 5).
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
ne
l (N
Po
)
control
fenoldopam
(µmol/L)
SKF
(µmol/L)
10 101 1 10
SCH
(µmol/L)
*
**
0
0.2
0.4
0.6
0.8
1.0
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
ne
l (N
Po
)
control
fenoldopam
(µmol/L)
SKF
(µmol/L)
10 101 1 10
SCH
(µmol/L)
*
**
0
0.2
0.4
0.6
0.8
1.0
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
ne
l (N
Po
)
control
fenoldopam
(µmol/L)
SKF
(µmol/L)
10 101 1 10
SCH
(µmol/L)
*
**
0
0.2
0.4
0.6
0.8
1.0
104
Figure 8C.
Electrophysiological tracings from the same membrane patch in the cell-attached
configuration of a single HCASMC transfected with D5R Scr oligonucleotides, 5-10
min after serial addition of increasing doses of fenoldopam, SKF 81297 (1 and 10
µmol/L), and dopamine (100 µmol/L) led to progressive stimulation of the BKCa
channel. The subsequent addition of SCH 23390 (10 µmol/L) decreased channel
opening to pretreatment levels. Upward deflections are channel openings from the
channel closed state (dashed line) Deflections of ~20 pA amplitude represent
simultaneous double channel opening.
control
+ fenoldopam (10 µmol/L)
+ SKF 81297 (1 µmol/L)
+ fenoldopam (1 µmol/L)
+ SKF 81297 (10 µmol/L)
+ dopamine (100 µmol/L)
+ SCH 23390 (10 µmol/L)
10 pA
200 ms
10 pA
200 ms
105
Figure 8D.
Bar graphs of the effect of the partial D1-like receptor agonist fenoldopam (1 and 10
µmol/L), and the partial D1-like receptor agonist SKF 81297 (1 and 10 µmol/L) and
dopamine (100 µmol/L) resulted in a concentration-dependent increase in BKCa
channel opening in HCASMCs transfected with D5R Scr oligonucleotides. The
subsequent addition of the D1-like receptor antagonist SCH 23390 decreased channel
opening to pretreatment levels. (*P<0.05 versus others, one way ANOVA, Tukey’s
test, n = 5 cells)
SKF
(µmol/L)
fenoldopam
(µmol/L)
control 1 10 101 100
DA(µmol/L)
SCH
(µmol/L)
100
0.2
0.4
0.6
0.8
1.0
*
** *
*
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
SKF
(µmol/L)
fenoldopam
(µmol/L)
control 1 10 101 100
DA(µmol/L)
SCH
(µmol/L)
100
0.2
0.4
0.6
0.8
1.0
*
** *
*
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
106
In HCASMCs transfected with D1R As oligonucleotides, serial treatment with
fenoldopam and SKF 81297 also led to progressive activation of the BKCa channel,
from an NPo of 0.012±0.006 to the maximally stimulated NPo of 0.27983±0.063 with
10 µmol/L of SKF 81297 (n=5 cells): these effects were reversed by the addition of the
D1-like receptor antagonist SCH 23390. (Figures 9A and 9B)
In contrast to all the above groups, in HCASMCs where D5R expression was
decreased by D5R As oligonucleotide transfection, the D1-like receptor agonists were
ineffective (Figures 9C and 9D) in stimulating BKCa channels. The basal NPo in these
cells was 0.00493±0.005, n=5, + 40 mV, suggesting that there still was some channel
activity at baseline. However, in contrast to other groups of cells, NPo of the BKCa
channel was not increased with serial administration of increasing concentrations of
D1-like receptor agonists or even by subsequent administration of up to 100 µmol/L
dopamine (Figures 9C and 9D). NPo after sequential treatment with all drugs remained
at 0.00124±0.0003 (n=5, +40 mV). Channel opening decreased to very low levels,
lower than controls after treatment with the antagonist SCH 23390 (10 µmol/L),
probably because of a greater blockade of D1-like receptors (Please note that D5R As
oligonucleotides decreased D5R expression by 50% only). The inability of dopamine
and the D1-like receptors to increase BKCa channel was not caused by a non-responsive
cell because in these D5R As transfected cells, calcium-stimulated channel could still
be demonstrated in excised inside-out patches, identified as the BKCa channel by its
(Figure 8E) amplitude (10pA) and its immediate inhibition by changing the
107
concentration of calcium in the bath which exposed the ‘intracellular’ surface of the
membrane to (10-9
mol/L Ca++
) from the original solution (10-4
mol/L Ca++
).
7.5 Effects of D1–like Receptor Stimulation on
Open Time of the Channel, Conductance and
Resting Membrane Potential (R.M.P) in Non-
transfected and Transfected HCASMCs
In all the experiments, there was no change in the amplitude of the current (≈
10 pA) at constant voltage in response to D1-like receptor agonists, including the D5R
As-transfected cells. As current amplitude remained the same in all
electrophysiological tracings before and after treatment with the D1-like receptor
agonists in transfected and non-transfected cells, it is likely that channel conductance
remained the same. The D5R As-transfected cells demonstrated an absence of increased
channel opening, but the current amplitude flowing across the open channels remained
constant at ≈ 10 pA, indicating that the decrease in D5R expression affected activation
of the channel by preventing an increase in NPo, but did not affect the properties of the
channel in conducting current, when open.
108
Resting membrane potential (R.M.P.) was controlled precisely in every
experiment and did not change. In the cell-attached patch, the R.M.P. was artificially
set at 0 mV, by immersing the cells in high K+
(140mmol/L) solution. By ‘zeroing’ out
the R.M.P., we could control patch Vm very precisely using the amplifier.
An evaluation of representative electrophysiological tracings in nontransfected
and transfected cells did not reveal a significant difference in the open time (or time the
channel stayed open) comparing controls to cells treated with D1- like receptor agonists
and antagonists, using pCLAMP 10.0 software. In contrast, the number of ‘open’
events in unit time, given by the NPo and calculated in all cells tested was increased
significantly compared to controls in non-transfecteed cells in response to D1-like
receptor agonists and dopamine. NPo also increased significantly in all transfected
cells, except those in which D5R protein expression was decreased by
D5R As oligonucleotide transfection.
Therefore we conclude that the D5R is necessary for activation and increase in
the frequency of BKCa channel opening in response to D1–like receptor aonists and
dopamine, but its downregulation does not affect channel conductance or the open time
of the channel.
109
Figure 9A.
Recordings from the same membrane patch in the cell-attached configuration of a
single HCASMC transfected with D1R As oligonucleotides; 5-10 min after serial
addition of increasing doses of fenoldopam, SKF 81297 (1 and 10 µmol/L) led to
progressive stimulation of the BKCa channel. The subsequent addition of the D1-like
receptor antagonist SCH 23390 (10 µmol/L) decreased channel opening to
pretreatment levels. Upward deflections are channel openings from the channel closed
state (dashed line). Deflections of ~20 pA amplitude represent simultaneous double
channel opening.
control
+ fenoldopam (10 µmol/L)
+ fenoldopam (1 µmol/L)
+ SKF 81297 (1 µmol/L)
+ SKF 81297 (10 µmol/L)
10 pA
200 ms
+ SCH 23390 (10 µmol/L)
110
Figure 9B.
Bar graphs of the effect of the partial D1- like receptor agonist fenoldopam (1 and 10
µmol/L) and the full D1-like receptor agonist SKF 81297 (1 and 10 µmol/L) resulted in
a dose-dependently increased in BKCa channel opening in HCASMCs transfected with
D1R As oligonucleotides. The subsequent addition of the D1-like receptor antagonist
SCH 23390 (10 µmol/L), decreased channel opening to pretreatment levels. (*P<0.05
versus others, one way ANOVA, Tukey’s test, n = 5).
SKF
(µmol/L)
0
0.1
0.2
0.3
0.4
0.5
control
fenoldopam
(µmol/L)
10 101 1 10
SCH(µmol/L)
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
* **
*
SKF
(µmol/L)
0
0.1
0.2
0.3
0.4
0.5
control
fenoldopam
(µmol/L)
10 101 1 10
SCH(µmol/L)
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
* **
*
SKF
(µmol/L)
0
0.1
0.2
0.3
0.4
0.5
control
fenoldopam
(µmol/L)
10 101 1 10
SCH(µmol/L)
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
* **
*
111
Figure 9C.
Recordings from the same membrane patch in the cell-attached configuration of a
single HCASMC transfected with D5R As oligonucleotides, 5-10 min after the serial
addition of fenoldopam (1 and 10 mmol/L), SKF (1 and 10 mmol/L), dopamine (10
and 100 mmol/L) and 5 min after treatment with SCH 23390 (10 mmol/L). Tracings
are representative of 10-15 seconds of continuous activity. Upward deflections are
channel openings from the channel closed state (dashed line). Small amplitude
channels represent other cationic channels in the patch.
control
+ fenoldopam (10 µmol/L)
+ SKF 81297 (1 µmol/L)
+ fenoldopam (1 µmol/L)
+ SKF 81297 (10 µmol/L)
+ dopamine (100 µmol/L)
+ SCH 23390 (10 µmol/L)
+ dopamine (10 µmol/L)
10 pA
200 ms
112
Figure 9D
Bar graphs of the effect of the partial D1- like receptor agonist fenoldopam (1 and 10
µmol/L), the full D1–like receptor agonist SKF 81297 (1 and 10 µmol/L) and dopamine
(10 and 100 µmol/L) did not stimulate BKCa channel opening in HCASMCs
transfected with D5R As oligonucleotides (+ 40 mV; n = 5). The subsequent treatment
with SCH (10 µmol/L) decreased channel opening compared to controls.
0
0.005
0.01
0.015
0.02
0.025
0.03
fenoldopam
(µmol/L)
SKF
(µmol/L)
DA
(µmol/L)
10 101 1 100 10control
SCH(µmol/L)
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
0
0.005
0.01
0.015
0.02
0.025
0.03
fenoldopam
(µmol/L)
SKF
(µmol/L)
DA
(µmol/L)
10 101 1 100 10control
SCH(µmol/L)
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
0
0.005
0.01
0.015
0.02
0.025
0.03
fenoldopam
(µmol/L)
SKF
(µmol/L)
DA
(µmol/L)
10 101 1 100 10control
SCH(µmol/L)
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
0
0.005
0.01
0.015
0.02
0.025
0.03
fenoldopam
(µmol/L)
SKF
(µmol/L)
DA
(µmol/L)
10 101 1 100 10control
SCH(µmol/L)
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
0
0.005
0.01
0.015
0.02
0.025
0.03
fenoldopam
(µmol/L)
SKF
(µmol/L)
DA
(µmol/L)
10 101 1 100 10control
SCH(µmol/L)
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
113
Figure 9E.
Ca2+
-activated potassium channel (BKCa) activity is present in a HCASMC transfected
with D5R As oligonucleotides. Recordings from the same membrane patch in the cell-
attached configuration. (10-9 mol/L Ca2+
; + 40 mV; left), after excision into the
inside-out I/O configuration (10-4 mol/L Ca2+
; + 40 mV; center) and after treatment
with I/O solution (10-7
mol/L Ca2+
; + 40 mV; right) Upward deflections are channel
openings from the channel closed state (dashed line).
(Ca2+ =10-4 mol/L)
control
I/O solution
(Ca2+ =10-7 mol/L)
I/O patch10 pA
200 ms
10 pA
200 ms
114
7.6 Studies of Intracellular Signaling
7.6.1 Role of PKG
Fenoldopam-induced activation of BKCa channels in non-transfected
HCASMCs was prevented by blocking PKG with KT 5823 (300 nmol/L). Figures 10A
and 10B show that pretreatment of HCASMCs with KT 5823 attenuated BKCa channel
response to D1-like receptor stimulation, that was observed only with dopamine (10
and 100 µmol/L). Since BKCa channel activation did not occur with high doses of the
specific D1-like receptor SKF 81297, the activation by dopamine may have resulted
from activation of either the D2-like receptors (by a non-PKG mediated effect, vide
infra) or the adrenergic receptors which are known to activate BKCa channels.284
7.6.2 Role of PKA
Fenoldopam-induced activaton of BKCa channels in non-transfected HCASMC
persisted when the cells were further incubated for 20 minutes with 300 nmol/L KT
5720, an inhibitor of PKA in 6/6 cells tested. However, when the cells were
subsequently treated with the specific PKG inhibitor, KT 5823 (300nmol/L), the
activation of BKCa channels was abrogated, indicating that the activation pathway
involved PKG, which was a critical determinant of activation of the channel in
response to the D1-like receptor agonist (Figure 10C and 10D).
115
Figure 10A.
Electrophysiological tracings from the same membrane patch in the cell-attached
configuration in HCASMCs treated for 30 min with the PKG inhibitor KT 5823 (300
nmol/L) followed by exposure to fenoldopam (1 and 10 µmol/L) SKF 81297 (1 and 10
µmol/L) and dopamine (10 and 100 µmol/L). BKCa channels were stimulated by
dopamine. Upward deflections are channel openings from the channel closed state
(dashed line). 20 pA currents represent simultaneous channel openings.
KT 5823 (300 nmol/L)
10 pA
200 ms
10 pA
200 ms
+ fenoldopam (10 µmol/L)
+ SKF 81297 (1 µmol/L)
+ SKF 81297 (10 µmol/L)
+ dopamine (100 µmol/L)
+ dopamine (10 µmol/L)
116
Figure 10B.
Bar graphs of the effect of fenoldopam (10 µmol/L) and SKF 81297 (1 and 10 µmol/L)
on BKCa channel in cells pretreated with 300 nmol/L KT 5823. The D1-like receptor
agonists (fenoldopam and SKF 81297) were unable to stimulate BKCa channel opening.
In contrast, dopamine (10 and 100 µmol/L) stimulated the channel. This could be
interpreted to indicate that dopamine receptors other than D5Rs can open BKCa
channels, e.g., D2-like receptors. (*P< 0.001 versus others, one-way ANOVA, Tukey’s
test, n = 6)
* *
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1.0
Pro
ba
bilit
y o
f O
pen
ing
of
BK
ch
an
nel (N
Po
)
KT5823
(300nmol/L)fenoldopam
(µmol/L)
SKF(µmol/L)
101 1 100
DA(µmol/L)
10 10
* *
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1.0
Pro
ba
bilit
y o
f O
pen
ing
of
BK
ch
an
nel (N
Po
)
KT5823
(300nmol/L)fenoldopam
(µmol/L)
SKF(µmol/L)
101 1 100
DA(µmol/L)
10 10
117
Figure 10C.
Electrophysiological recordings of BKCa channel activity from the same membrane
patch in the cell-attached configuration of untreated controls, after treatment with
fenoldopam (1 µmol/L) for 5 minutes, and after serial incubation with the PKA
inhibitor KT 5720 (300 nmol/L) for 20 minutes, and the PKG inhibitor KT 5823 (300
nmol/L) for 20 minutes. Upward deflections are channel openings from the channel
closed state (dashed line).
control
fenoldopam
+ KT5720 (300 nmol/L)
fenoldopam+ KT5720
+ KT5823 (300 nmol/L)
fenoldopam
(1 µmol/L)
10 pA
200 ms
10 pA
200 ms
118
Figure 10D.
Bar graphs of the effect of treatment of HCASMCs with PKA inhibitor KT 5720 (300
nmol/L) and PKG inhibitor KT 5823 (300 nmol/L) . KT 5720 did not prevent D1- like
receptor- mediated stimulation of the BKCa channel. However, the subsequent addition
of PKG inhibitor KT 5823 (300 nmol/L) decreased channel opening to pretreatment
levels. (*P< 0.05 versus others, one-way ANOVA, Tukey’s test) n = 6 cells
* *
0
0.1
0.2
0.3
0.4
0.5
0.6
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
KT5823(300 nmol/L)
fenoldopam (10 µmol/L)
KT5720(300 nmol/L)
control
* *
0
0.1
0.2
0.3
0.4
0.5
0.6
Pro
ba
bilit
y o
f O
pen
ing
of
BK
Ca
ch
an
nel (N
Po
)
KT5823(300 nmol/L)
fenoldopam (10 µmol/L)
KT5720(300 nmol/L)
control
119
Chapter 8.
Discussion
120
8.1 Summary of Observations
D5R mRNA expression was more robust than D1R mRNA expression by
quantitative RT-PCR, normalized to GAPDH in HCASMCs in culture, consistent with
previous work in the rodent renal microvasculature wherein D1BR (equivalent to D5R
in humans) mRNA expression was 2-3 times greater than D1AR (equivalent to D1R in
humans) mRNA expression. 266
Consistent with previous reports, BKCa channels expressed in HCASMCs
transmitted large (10 pA) hyperpolarizing currents and displayed high conductance of
100-250 pS in symmetrical potassium gradients170
that were sensitive to voltage in the
whole cell configuration. They were also activated by increased ‘intracellular’ calcium
and inhibited by 1mmol/L TEA in the I/O configuration. These features matched the
profile of the BKCa channel, consistent with published research. 94
The activation of BKCa channels occurred in 9/9 non-transfected HCASMCs
studied in the cell-attached configuration in response to 1 µmol/L fenoldopam, similar
to the findings in published studies of porcine coronary artery smooth muscle cells. 170
The role of the D1-like receptor in mediating this response was confirmed by the
inhibition of BKCa channel opening with subsequent addition of the specific D1–like
receptor antagonist SCH 23390. Pretreatment of HCASMCs with SCH 23390 also
prevented the activation of BKCa channels in response to subsequent treatment with
1µmol/L and 10µmol/L fenoldopam. Treatment of HCASMCs with SCH 23390
seemed to decrease channel opening compared to untreated controls. However, the
121
decrease did not attain statistical significance. The baseline opening of BKCa channels
in our experimental system is likely lower than in vivo, where tonic sympathetic
stimulation leads to increases in cytosolic calcium, which would activate the BKCa
channels. In contrast, our experiments were conducted in a milieu of relatively lower
calcium levels, and hence channel opening (NPo) is generally low in isolated cells,
accounting for a smaller magnitude of change with SCH 23390, and thus less power to
attain statistical significance.
We speculate that the D1-like receptor may be active at baseline, even without
addition of an exogenous agonist, suggesting some constitutive activity of these
receptors. One could speculate that low levels of endogenous dopamine, (perhaps
conveyed by dopaminergic nerves)285
may be present even in isolated VSMCs.
Constitutive activity of the D5R has been suggested in in vitro studies of HEK cells
transfected with the D5R.158
We speculate that in the presence of tonic sympathetic
influences that increase vascular tone, a baseline, constitutive vasodilatory effect may
be provided by BKCa channel activation via the D1-like receptors. Our observations
support this notion: with the exception of one whole cell recording, every cell showed
decreased channel opening after treatment with SCH 23390 compared to untreated
controls. These observation needs to be validated further with adequate power, by
testing more cells.
The transfection of HCASMCs with oligonucleotides tagged with cy3 red with
a high efficiency of transfection, as detected by red fluorescence by an independent and
blinded observer was validated repeatedly. D1R and D5R receptor protein have very
122
similar structures (Figure 1C). By blotting the D5R As-transfected HCASMC lysates
for D1R and vice versa, we confirmed the absence of non-specific receptor
downregulation. Although specific receptor expression was decreased by only about
50% in As oligonucleotide-transfected cells, a functional difference in
electrophysiological properties was observed, probably because of the absence of
dopamine ‘spare’ receptors.286
These data also raise the interesting possibility of a
likely ‘critical threshold’ of D5R expression, at which the cascade of intracellular
events to activate BKCa channels is set into motion: in As oligonucleotide-transfected
cells, the decrease in receptor protein below this threshold abrogated the BKCa channel
activation in response to stimulants.
BKCa channel activity was demonstrable in the As oligonucleotide-transfected
cells at baseline, indicating the membrane contained the channel, and that the channel
conducted current. This was further confirmed subsequently by experiments in the I/O
configuration which demonstrated the presence of a calcium-sensitive channel. Its
activation in response to D1-like receptor agonists, however, was abrogated in cells
transfected with D5R As oligonucleotides but not with D1R As oligonucleotides. These
findings obviated the need for us to experiment with other gene silencing methods such
as small inhibitory RNA (siRNA) or small hairpin RNA (shRNA). The decreased level
of BKCa channel activity in the D5R As oligonucleotide-transfected cells but not in the
D1R As oligonucleotide-transfected cells indicate constitutive activity of the D5R and
that the decreased BKCa channel activity in SCH 23390-treated cells is due to inhibition
of constitutively active D5R. Thus, BKCa channels may remain in the ‘open’ state at
123
baseline, which may be important in maintaining vessel patency, as vessels constrict
when BKCa channels are blocked. 272
While channel opening was minimal in untreated
cells, these experiments were performed in a ‘high K’ (140 mmol/L) environment in
order to artificially set the equilibrium potential at 0mV, to facilitate accurate control
of Vm using the voltage amplifier. It is likely that BKCa channels are more active at
baseline in HCASMCs in vivo than in our experimental system. Further these channels
do contribute to ‘baseline’ vasodilatation: iberiotoxin, a specific blocker of BKCa
channels has been shown to ‘contract’ coronary arteries.248
D5R protein expression that was similar to nontransfected controls was
demonstrated in HCASMCs transfected with D5R Scr oligonucleotides and with D1R
Scr and D1R As oligonucleotides. In these cells, intact D5R expression was associated
with an increase in channel activity in response to D1-like receptor agonists similar to
that seen in non-transfected controls. Thus the process of transfection using
lipofectamine did not impair the ability of D1- like receptor agonists and dopamine to
maximally stimulate the BKCa channel, although higher concentrations of agonists were
required to achieve comparable responses as had been observed in non-transfected
cells with the partial agonist fenoldopam. Thus, in non-transfected cells, there was a
25-fold increase in the probability of BKCa channel opening (NPo) in response to
1µmol/L fenoldopam, compared to controls, which was not demonstrated consistently
in transfected cells. In D5R Scr-transfected cells, a 100-fold increase in NPo was seen
with 10 µmol/L fenoldopam compared to controls. A similar 100-fold increase in NPo
in response to 10 µmol/L fenoldopam was also observed with in D1R As and Scr
124
transfected cells. These observations in D1AS transfected cells suggested that intact
D1R expression was not necessary for BKCa channel activation.
No activation of BKCa channels was obtained in HCASMCs with
downregulated D5R protein expression due to D5R As oligonucleotide transfection
even on treatment with increasing concentrations of fenoldopam and SKF 81297 and
up to 100 µmol/L dopamine. The absence of activation of BKCa channels in response to
dopamine even at concentrations at which non-specific activation, such as adrenergic
receptor activation may occur, as mentioned previously, indicate that the presence of
an intact D5R is essential for a critical step in the activation of the channel, perhaps in
the generation of calcium sparks by cAMP-independent mechanisms. This is highly
speculative, and needs to be investigated in future experiments examining other cell
signaling pathways of D5R.
In all cells studied, the presence of a calcium-sensitive channel in the patch
was confirmed by I/O configuration at the end of the drug treatments. Thus the absence
of activation of channels in D5R As-transfected cells could only be attributed to the
absence of activation of those cell signaling pathways that were triggered by the
activation of the D5R by D1-like receptor agonists.
Pretreatment of HCASMCs with a PKG inhibitor, KT 5823 prevented
activation of BKCa channels by partial and full D1- like receptor agonists. We inferred
that D1-like receptor-mediated pathways included PKG and not PKA, as PKA
inhibition with KT 5720 did not inhibit BKCa channel activation in response to
fenoldopam.
125
However, increased activity of BKCa channels was seen when the cells
pretreated with the PKG inhibitor were treated with dopamine (10 and 100 µmol/L),
suggesting that other non-specific receptors whose stimulation leads to BKCa channel
activation, such as adrenergic receptors, may have been stimulated by the high doses of
dopamine. These observations need to be validated using adrenergic blocking agents
such as propranolol, which have been shown to be ineffective in blocking dopamine-
mediated BKCa channel activationin porcine coronary artery smooth muscle cells, when
dopamine at a concentration of 10µmol/L were used.170
8.2. Novel Findings and Discussion
This is the first study to demonstrate differential effects of D1R and D5R on
vascular function. We have confirmed that D5R is more abundant than D1R in
HCASMCs. We conclude that the D5R, rather than D1R, mediates vasodilatation.
The identification of the specific D1–like receptor subtype involved in this
critical function has teleological, physiological and clinical significance.
The D1R, but not the D5R is a known inhibitor of Na+, K-ATPase, an essential
protein found in all living cells. By pumping 3 molecules of sodium out of the cell in
exchange for 2 molecules of potassium, Na+, K-ATPase controls the intracellular
sodium concentration, keeping it lower than extracellular sodium concentrations.
More abundant expression of D5R, together with its known higher affinity for
dopamine and D1-like receptor agonists, suggests that dopamine is more likely to
126
stimulate the D5R, rather than the D1R in VSMCs. Thus D1R- mediated inhibition of
Na+, K-ATPase leading to increased intracellular sodium, activation of sodium/calcium
exchange, and resulting increased levels of intracellular calcium, would be less likely,
if not unlikely. This phenomenon would impact vascular tone profoundly. Increased
intracellular calcium with resulting increased vascular smooth muscle contractility and
vasoconstriction would not occur.
On the other hand, if the D5R were preferentially activated, as we suggest,
BKCa channels would be activated which would lead to vasodilatation and would be
necessary to counter the potential vasoconstrictor role of tonic sympathetic influences.
This mechanism could also explain the hypertension observed in D5 knockout mice,
which has thus far been attributed to an increase in sympathetic tone: we submit that
enhanced intrinsic vascular tone due to D1R stimulation in the absence of D5R may
also contribute to hypertension.
This study has shown that the channel stimulated by the D1-like receptor,
specifically the D5R is the BKCa channel, consistent with the previously reported study
in porcine CASMCs by Han et al.170
However, these observations conflict with the
report of Kawano et al172 who observed activation of KATP channels, rather than BKCa
channels in porcine CASMCs in response to dopamine and D1-like receptor agonists in
patch-clamp experiments. The studies of Kawano et al were conducted in calcium-free
intra and extra-cellular solutions, which also contained the calcium-chelating agent
EGTA. Thus there was no calcium in the intra and extracellular environment. Given
the exquisite calcium-sensitivity of the BKCa channel, this could explain why BKCa
127
channels (which are calcium-activated) were not observed. Further Han et al (1999)
193
used myocytes in primary culture freshly isolated from the main branch of the left
anterior descending coronary artery while HCASMC used in our study were harvested
from the main coronary artery: Kawano et al.,195 did not specify the branch of the
porcine coronary artery where the cells were obtained; this could influence the type
and abundance of demonstrable K channels which change with changing diameter of
blood vessels. For example, the density of inward rectifier channels (Kir2) increases as
the diameter of the vessel decreases. 287
The sensitivity of the BKCa channel to
increasing intracellular calcium levels is also enhanced in smaller resistance vessels,
such as arteriolar smooth muscle, compared to conduit arteries.288
The observations of
Kawano et al195
may also be attributed to the fact that the cells studied had been in
culture for 6-10 days; vascular smooth muscle cells may dedifferentiate and develop a
secretory phenotype with long-term culture. The cells in our study and in Han et al’s
study, were studied in freshly harvested cells in an early passage (P3-4).
The observations in our study have also identified a novel mechanism of cross
activation of PKG by cAMP. cAMP is the second messenger in dopamine-mediated
cellular responses.289
Intracellular cAMP, if artificially increased by the addition of a
membrane-permeable analog, CPT-cyclic AMP to the recording chamber has been
shown to increase BKCa channel activity in the porcine CASMCs, establishing it as the
second messenger in BKCa channel activation.193
However, most studies do not show
direct activation of the channel by physiological levels of cAMP, or by cGMP 290
128
cAMP/cGMP effects are mediated by protein kinases, such as PKA and/or
PKG as evidenced by the following observations. The direct application of PKG
activates the BKCa channel by modulating its calcium and voltage sensitivity. Although
BKCa channel gating is attributed mainly to cAMP-independent phsphorylation of the
channel in neuroendocrine cells,291
and to PKA in neurons 292
and retinal glial cells,293
it has not been shown to stimulate BKCa channel activity in porcine coronary arteries.239
Previous research has shown that cAMP dependent vasodilators had no effect in PKG-
deficient vascular smooth muscle cells which demonstrated full expression of PKA:
however addition of purified PKG decreased intracellular Ca2+
in vascular myocytes 294
and
restored the vasorelaxation in response to cAMP.295
PKG’s critical role in
vasorelaxation may be attributed to its critical role in BKCa channel activation by the
D1-like receptor.
This conclusion is supported by previous research demonstrating the effects of
PKG stimulation on the BKCa channel activity but not channel conductance leading to a
shift of the relationship between voltage and probability of opening of the channel
(NPo), so that channel activity is higher at a given voltage.290
We observed similar
effects with D1-like receptor agonists in all HCASMCs but the D5R As transfected
cells. However, the voltage-sensitivity of the BKCa channel, given by the slope of the
voltage-activation curve is not altered by PKG, nor indeed by D1-like receptor
agonists and dopamine in our experiments. PKG has been reported to decrease
channel-closed time constants and increase channel-open time constants,296
in a study
performed using bovine tracheal smooth muscle cells and not VSMCs. A detailed
129
characterization of these effects in VSMCs is currently lacking. The observations in
this study did not corroborate the increase in open-time constants attributed to PKG
effects and will need further examination. It would be fair to conclude that most, if not
all of previously described PKG effects on BKCa channel kinetics seem to be mirrored
by the effects of D1-like receptor agonists on BKCa channel opening in our study,
lending credence to our submission that PKG is the likely mediator of the BKCa
channel response to D1-like receptor agonists
We found that inhibiting PKA did not prevent activation of the BKCa channel
by the D1-like receptor agonist fenoldopam, which is consistent with the porcine study.
In fact, we observed that the addidtion of the PKA inhibitor KT 5720 seemed to
increase fenoldopam-induced activation of the BKCa channel, in some, but not all of the
cells tested. While our observations did not attain statistical significance in the relative
increase in NPo in response to PKA inhibition, it may be that PKA and PKG actually
work in opposition to one another in the D1-like receptor-mediated pathway of BKCa
channel stimulation. This is highly speculative, and further experiments must be
performed to validate this observation.
The β1 subunit of the BKCa channel, the only one found in smooth muscle297 and
an important player in vasoregulation111
has a phosophorylation site for PKG.298
Thus
it is likely that PKG mediates the stimulation of the channel. However, we were able to
activate the channel in HCASMC with high doses of dopamine (10 and 100 µmol/L)
even in the presence of the PKG inhibitor, suggesting that an alternate receptor and /or
pathway was activated. D2-like receptors may be expressed in these cells: post-
130
junctional effects of the D2R have been reported in sympathetic neurons to activate a
calcium-sensitive channel of small conductance (SKCa), but there are no reports of
electrophysiological evidence of activation of BKCa channels by D2- like receptor
agonists: they may activate BKCa channels by a pathway that does not involve PKG.
Another explanation for our observations could be that, at the high concentrations of
dopamine used, adrenergic receptors which are known to activate BKCa channels284
were activated.
BKCa channel activation with D1-like receptor agonists was prevented by
pretreatment with the PKG inhibitor KT 5823. BKCa channel activation in HCASMCs
in response to D1-like receptor agonists was also reversed by PKG inhibition with KT
5823. On the other hand, treatment of HCASMCs with the PKA inhibitor KT 5720 did
not reverse the activation of BKCa channels by D1- like receptor agonists. Thus PKG,
but not PKA is a player in activation of the BKca channel in HCASMCs. These data
suggest that BKCa channel activation in response to D1- like receptor agonists occurs
via cAMP- stimulated cross activation of PKG, rather than activation of PKA.
These data are consistent with the previous porcine study193
and with studies
describing the effects of other ligands in HCASMCs.
KT 5720 with a Ki of about 60nM for PKA inhibition 282
has certain limitations
of specificity, and variation in Ki with changes in intracellular ATP levels.299
This
concern has been addressed in previous studies where a more specific inhibitor of
PKA, Rp-8-pCPT-cAMPs300,
has been shown to demonstrate similar effects on BKCa
channels in porcine CASMCs 193
as we now demonstrate with KT 5720 in HCASMCs.
131
Vascular myocytes are a rich source of PKG, and phosphorylation of the BKCa
channel by PKG activates it to regulate vascular tone.194,234
PKG levels are decreased
in human coronary arteries after balloon angioplasty which also exhibit decreased
vasodilatory properties301
leading to phenotypic modulation and a predisposition for
restenosis.302
These findings support the notion that PKG has a role in mediating the
activation of BKCa channels to enhance vasodilatation and/or limit depolarization and
vasoconstriction.
All our experiments were performed in cells from the same donor, a 33 year old
female, in order for us to be able to compare the effects of our pharmacological and
molecular interventions in similar cells. Intrinsic properties of vascular smooth muscle
may vary between species and within species. While our study has relevance as the
first study in humans, similar experiments need to be performed using different donors
from both genders, different races and at different ages to further understand these
molecular mechanisms, so that conclusions drawn from our observations may be
universally applicable to a heterogenous general population. Thus there are limitations
to our findings, germane to the experimental method used.
In conclusion, our observations may have important implications in our
understanding of the mechanisms underlying the maintenance and regulation of
vascular tone. The D5R, in constitutively causing vasodilatation by stimulating BKca
channels, maintains vascular patency in the face of ongoing sympathetic influences
that tend to cause vasoconstriction. Thus they may play a critical role in maintaining
the balance between vasoconstriction and vasodilatation at baseline, and in response to
132
exogenous and endogenous stimuli.In the coronary circulation, this phenomenon likely
represents a powerful survival mechanism to ensure adequate perfusion to the
myocardium.
Our observations have bearing on the pathogenesis of hypertension and
coronary artery disease, both of which could be viewed as a consequence of a failure of
intrinsic vasodilatation. In animals and humans D5R missense mutations are associated
with hypertension that has been attributed to an increase in vascular tone. More
recently, unpublished observations in our laboratory suggest that D5 R knockout mice
(-/-) are hypertensive, but also have larger hearts even before the onset of hypertensive.
We speculate that this observation may be related to chronic ischemia due to a defect
in coronary vasodilatation, and are currently performing experiments to test this
hypothesis. No associations have been identified thus far between variations in the
gene sequence of the D1R gene and hypertension: while the D1R knockout mice are
hypertensive, no cardiac phenotype has been characterized in these mice. Our
experiments with D5R knockout mice will corroborate our findings, if ischemic heart
disease is identified in these mice prior to the onset of hypertension.
133
Chapter 9.
Summary
134
This work has demonstrated D1R and D5R mRNA and protein expression in
HCASMCs in culture. D5R mRNA expression was more abundant by quantitative
RT-PCR.
Whole cell electrophysiological studies have demonstrated that a large
conductance, voltage-sensitive channel, inhibited by 300 nmol/L IBTx, was the
predominant K channel in HCASMCs, which was thus characterized as the BKCa
channel. Studies in the cell-attached configuration have demonstrated activation of
the BKCa channel by fenoldopam, SKF 81297 and dopamine in HCASMCs. The
calcium sensitivity of the channel and inhibition by 1mmol/L TEA was
demonstrated in inside-out experiments in non transfected and transfected cells
confirming its identity as the BKca channel.
Transfection of HCASMCs with D1R As oligonucleotides did not affect
the stimulation of the BKCa channel by fenoldopam, SKF 81297 or dopamine.
Transfection of HCASMCs with D5R Scr oligonucleotides also did not hinder
BKCa channel opening in response to D1-like receptor agonists. In contrast,
downregulation of D5R receptor protein expression by about 50% using specific As
oligonucleotides completely abrogated the BKCa channel response to partial
(fenoldopam) and full (SKF-81297) D1- like receptor agonists, and also to the non-
specific agonist dopamine in 5/5 cells tested. In every cell, subsequent inside-out
experiments confirmed the presence of the calcium-sensitive channel in the patch.
Thus we conclude that the D5R mediates BKCa channel stimulation in response to
D1-like receptor agonists.
135
Dopamine D5R-channel signal transduction pathways were dissected
further using this model. There may be more than one pathway involved. In these
preliminary experiments, we have observed that PKG increased BKCa channel
activity by a direct effect mediated by D5R-induced activation of cAMP-cross-
activation of PKG. Inhibition of PKA with KT 5720 pretreatment did not prevent
activation of BKCa channels by fenoldopam in non-transfected HCASMCs.
Pretreatment of non-transfected HCASMCs with KT 5823, which is a specific
inhibtor of PKG, prevented the BKCa channel response to D1-like receptor agonists,
but not to dopamine at doses at which non-specific receptor (such as adrenergic
receptor ) activation could occur and is known to activate BKCa channels.
In porcine coronary arteries, the effect of estrogen and dopamine on
vasodilatory BKCa channels has been shown to be mediated by cyclic AMP-
mediated cross activation of PKG. Similar effects have been reported in response to
cAMP in the pulmonary arteries in rodents, cAMP-stimulating agents such as
forskolin, isoproterenol and dopamine in porcine coronary artery cells,
prostaglandins (PGE2) in HCASMCs and prostacycline (PGI2) in porcine retinal
pericytes. Our results suggest that in HCASMCs, the D5R mediates BKCa channel
opening by a PKG dependent pathway, and as we know from previous studies that
D1-like receptors increase cAMP in the cell which acts as the second messenger,
cross activation of PKG by cAMP may be the mechanism involved.
CAD is a major cause of mortality and morbidity occurring independently or in
136
association with essential hypertension. Intrinsic smooth muscle mechanisms of
vasodilatation must be elucidated and targeted to alleviate the clinical
complications arising from vasoconstriction such as angina. Thus our study
highlights a promising area of future investigation.
The further elucidation of the signaling pathway in which the D5R, and not the
D1R participates to activate the BKCa channel is the logical next step in our
investigation. As both D1R and D5R increase cAMP, there may be a pathway that is
cAMP independent, which we can study by intracellular assays. The alternative
pathway is depicted in Figure 11 as a proposed signal transduction pathway.
137
Figure 11. Potential Signal Transduction Pathway of BKCa
Channel Stimulation via the D5R
The BKCa channel is activated by stimulation of the D5R and not the D1R via
stimulation of PKG by cAMP, the second messenger for dopamine-mediated receptor
signaling. Hypotheses for other pathways of activation of BKCa channels , unique to the
D5R by cAMP-independent pathways such as
1. Increasing PIP2 activity by inhibition of PLC which inhibts PIP2
2. Direct stimulation of the BKCa channel by PIP2
3. Stimulation of the ryanodine receptor (RyR) by PIP2 and consequent
generation of calcium sparks which activate the BKCa channel
D5
HCASMC
cAMP
PKA
PKG
PLC PIP2
Ca++
K+
RyR
D5
HCASMC
cAMP
PKA
PKG
PLC PIP2
Ca++
K+
RyR
138
Studies of D5R knockout mice, currently generated in our laboratory, will help
establish the critical role of the D5R in vasodilatation in a dynamic in vivo model.
Continuous EKG recordings on these mice will be performed, to test for the occurrence
of ischemia at baseline, in response to increased myocardial demand, such as exercise,
or in response to sympathetic vasoconstriction secondary to stressful stimuli.
The recent introduction of specific D5R stimulants in an experimental setting,
may pave the way for testing their vasodilatory potential. These specific stimulants are
not commercially available thus far. However, the course of CAD may be ameliorated
by exploring such therapies in the future, which increase BKCa channel opening by
selectively stimulating the D5R which activates it.
139
BIBLIOGRAPHY
1. Harvey,W. Exercitatio Anatomica de Motu Cordis et Sanguinins in Animalibus
Frankfurt, 1628
2. Mulvany MJ, Aalkjaer C. Structure and function of small arteries. Physiol Rev.
70: 921-971, 1990
3. Baez S. Bayliss response in the microcirculation. FASEB J. 27: 1410–1415,
1968
4. Jones TW. Discovery that the veins of the bat’s wing (which are furnished with
valves) are endowed with rhythmical contractility, and that the onward flow of
blood is accelerated by each contraction. Proc R Soc Lond B Biol. Sci. CXLII:
131–136, 1852
5. Bayliss WM. On the local reaction of the arterial wall to changes of internal
pressure. J Physiol. 28: 228–231, 1902
6. Folkow B. Intravascular pressure as a factor regulating the tone of the small
vessels. Acta Physiol. Scand. 17: 289–310, 1949
7. Folkow B. A study of the factors influencing the tone of denervated blood
vessels performed at various pressures. Acta Physiol Scand. 27: 99–117, 1952
8. Neher E, Sakmann B. Single-channel currents recorded from membrane of
denervated frog muscle fibres. Nature. 260: 799–802, 1976
140
9. Nelson MT, Cheng H, Rubart M, Santana LF, Bonev AD, Knot HJ, Lederer
WJ. Relaxation of arterial smooth muscle by calcium sparks. Science. 270:
633-637, 1995
10. Wier WG, ter Keurs HE, Marban E, Gao WD, Balke CW. Ca2+
‘sparks’ and
waves in intact ventricular muscle resolved by confocal imaging. Circ Res. 81:
462–469, 1997
11. West JG. In Respiratory Physiology: The Essentials (8th
edition) Lippincott
Williams and Wilkins, p8, 2008
12. Chilian WM, Layne SM, Klausner EC, Eastham CL, Marcus ML.
Redistribution of coronary microvascular resistance produced by dipyridamole.
Am J Physiol. 256: H383-390, 1989
13. Guyton AC, Hall JE. Overview of the circulation: medical physics of pressure,
flow, and resistance. In Guyton AC, Hall JE eds., Textbook of Medical
Physiology. Philadelphia, PA, USA. W.B. Saunders Company, 2005
14. Caro CG, Pedley TJ, Schroter RC, Seed WA. Flow in pipes and around objects.
In: Caro CG, Pedley TJ, Schroter RC, Seed WA eds., The Mechanics of the
Circulation. Oxford, UK. Oxford University Press, 1978
15. Zweifach BW. Quantitative studies of microcirculatory structure and function
II. Direct measurement of capillary pressure in splanchnic mesenteric vessels.
Circ Res. 34: 858–866, 1974
16. Berne R Regulation of coronary blood flow. Physiol Rev. 44: 1-29, 1964
141
17. Wolff CB. Normal cardiac output, oxygen delivery and oxygen extraction. Adv
Exp Med Biol. 599: 169-82, 2007
18. Sato A, Terata K, Miura H, Toyama K, Loberiza FR Jr, Hatoum OA, Saito T,
Sakuma I, Gutterman DD. Mechanism of vasodilation to adenosine in coronary
arterioles from patients with heart disease.Am J Physiol Heart Circ Physiol.
288:H1633-40, 2005
19. Mahaffey KW, Puma JA, Barbagelata NA, DiCarli MF, Leesar MA, Browne
KF, Eisenberg PR, Bolli R, Casas AC, Molina-Viamonte V, Orlandi C, Blevins
R, Gibbons RJ, Califf RM, Granger CB. Adenosine as an adjunct to
thrombolytic therapy for acute myocardial infarction: results of a multicenter,
randomized, placebo-controlled trial: the Acute Myocardial Infarction STudy of
ADenosine (AMISTAD) trial. J Am Coll Cardiol. 34: 1711-1720, 1999
20. Pacella JJ, Kameneva MV, Csikari M, Lu E, Villanueva FS. A novel
hydrodynamic approach to the treatment of coronary artery disease. Eur Heart
J. 27: 2362-2369, 2006
21. Gould KL, Lipscomb L. Effects of coronary stenoses on coronary flow reserve
and resistance. Am J Cardiol. 34: 48-55, 1974
22. Matsuo H, Watanabe S, Kadosaki T, Yamaki T, Tanaka S, Miyata S, Segawa
T, Matsuno Y, Tomita M, Fujiwara H. Validation of collateral fractional flow
reserve by myocardial perfusion imaging. Circulation. 105: 1060-1065, 2002
23. Chobanian AV, Bakris GL, Black HR, Cushman WC, Green LA, Izzo JL Jr,
Jones DW, Materson BJ, Oparil S, Wright JT Jr, Roccella EJ; National Heart,
142
Lung, and Blood Institute Joint National Committee on Prevention, Detection,
Evaluation, and Treatment of High Blood Pressure; National High Blood
Pressure Education Program Coordinating Committee. The Seventh Report of
the Joint National Committee on Prevention, Detection, Evaluation, and
Treatment of High Blood Pressure: the JNC 7 report. JAMA. 289: 2560-2572,
2003
24. Lloyd-Jones DM, Larson MG, Leip EP, Beiser A, D’Agostino RB, Kannel WB,
Murabito JM, Vasan RS, Benjamin EJ, Levy D, for the Framingham Heart
Study. Lifetime risk for developing congestive heart failure: the Framingham
Heart Study. Circulation. 106: 3068-3072, 2002
25. Wilson PW, D'Agostino RB, Levy D, Belanger AM, Silbershatz H, Kannel
WB. Prediction of coronary heart disease using risk factor categories.
Circulation. 97: 1837-1847, 1998
26. Furchgott RF, Zawadzki JV. The obligatory role of endothelial cells in the
relaxation of arterial smooth muscle by acetylcholine. Nature. 288: 373–376,
1980
27. Ignarro LJ, Napoli C. Novel features of nitric oxide, endothelial nitric oxide
synthase, and atherosclerosis. Curr Atheroscler Rep. 6: 281-387, 2004
28. Lieu HD, Shryock JC, von Mering GO, Gordi T, Blackburn B, Olmsted AW,
Belardinelli L, Kerensky RA. Regadenoson, a selective A2A adenosine
receptor agonist, causes dose-dependent increases in coronary blood flow
velocity in humans. J Nucl Cardiol. 14: 514-520, 2007
143
29. Behrendt D, Ganz P. Endothelial function. From vascular biology to clinical
applications. Am J Cardiol. 90: 40L-48L, 2004
30. Furumoto T, Saito N, Dong J, Mikami T, Fujii S, Kitabatake A. Association of
cardiovascular risk factors and endothelial dysfunction in Japanese
hypertensive patients: implications for early atherosclerosis. Hypertens Res. 25:
475-480, 2002
31. Zeiher AM, Drexler H, Wollschläger H, Just H. Endothelial dysfunction of the
coronary microvasculature is associated with coronary blood flow regulation in
patients with early atherosclerosis. Circulation. 84: 1984-1992, 1991
32. Davenport AP, Ashby MJ, Easton P, Ella S, Bedford J, Dickerson C, Nunez DJ,
Capper SJ, Brown MJ. A sensitive radioimmunoassay measuring endothelin-
like immunoreactivity in human plasma: comparison of levels in patients with
essential hypertension and normotensive control subjects. Clin Sci (Lond). 78:
261-264, 1990
33. Kirma C, Akcakoyun M, Esen AM, Barutcu I, Karakaya O, Saglam M, Kargin
R, Turkmen M, Boztosun B, Izgi A, Sonmez K. Relationship between
endothelial function and coronary risk factors in patients with stable coronary
artery disease. Circ J. 71: 698-702, 2007
34. Ross, R Atherosclerosis-An inflammatory disease N Engl J Med. 340: 115-126,
1999
144
35. Patti G, Melfi R, Di Sciascio G, The role of endothelial dysfunction in the
pathogenesis and in clinical practice of atherosclerosis. Current evidences
Recenti Prog Med. 96: 499-507, 2005
36. Kunz GA, Liang G, Cuculoski F, Gregg D, Vata KC, Shaw LK, Goldschmidt-
Clermont PJ, Dong C, Taylor DA, Peterson ED Circulating endothelial
progenitor cells predict coronary artery disease severity. Am Heart J. 152: 190-
195, 2006
37. Ramanath VS, Eagle KA. Evidence-based medical therapy of patients with
acute coronary syndromes.Am J Cardiovasc Drugs. 7: 95-116, 2007
38. Teisman AC, Buikema H, van Veldhuisen DJ, de Zeeuw D, van Gilst WH.
Direct vasodilating effects of the new dopaminergic agonist Z1046 in human
arteries. J Cardiovasc Pharmacol. 35: 581-585, 2000
39. Tobata D, Takao K, Mochizuki M, Nishimura R, Sasaki N. Effects of
dopamine, dobutamine, amrinone and milrinone on regional blood flow in
isoflurane anesthetized dogs. J Vet Med Sci. 66:1097-105, 2004
40. Gatot I, Abramov D, Tsodikov V, Yeshaaiahu M, Orman S, Gavriel A, Chorni
I, Tuvbin D, Tager S, Apelbom A. Should we give prophylactic renal-dose
dopamine after coronary artery bypass surgery? J Card Surg .19: 128-33, 2004
41. Chatterjee K, De Marco T. Role of nonglycosidic inotropic agents: indications,
ethics, and limitations. Med Clin North Am. 87: 391-418, 2003
145
42. Sabik JF 3rd, Blackstone EH, Gillinov AM, Smedira NG, Lytle BW.
Occurrence and risk factors for reintervention after coronary artery bypass
grafting. Circulation. 114: I-454-460, 2006
43. Gomes WJ, Buffolo E. Coronary stenting and inflammation: implications for
further surgical and medical treatment. Ann Thorac Surg. 81:1918-1925, 2006
44. Cashin WL, Sanmarco ME, Nessim SA, Blankenhorn DH. Accelerated
progression of atherosclerosis in coronary vessels with minimal lesions that are
bypassed. N Engl J Med. 311: 824-828, 1984
45. Bourassa MG, Lespérance J, Corbara F, Saltiel J, Campeau L.Progression of
obstructive coronary artery disease 5 to 7 years after aortocoronary bypass
surgery. Circulation. 58: I-100-106, 1987
46. Alioua A, Lu R, Kumar Y, Eghbali M, Kundu P, Toro L, Stefani E. Slo1
caveolin-binding motif, a mechanism of caveolin-1-Slo1 interaction regulating
Slo1 surface expression. J Biol Chem. 283: 4808-4817, 2008
47. Liu Y, Terata K, Chai Q, Li H, Kleinman LH, Gutterman DD. Peroxynitrite
inhibits Ca2+
-activated K+ channel activity in smooth muscle of human
coronary arterioles. Circ Res. 91: 1070-1076, 2002
48. Miura H, Wachtel RE, Liu Y, Loberiza FR Jr, Saito T, Miura M, Gutterman
DD. Flow-induced dilation of human coronary arterioles: important role of
Ca2+
-activated K+ channels. Circulation. 103: 1992-1998, 2001
146
49. Lu T, He T, Katusic ZS, Lee HC. Molecular mechanisms mediating inhibition
of human large conductance Ca2+-activated K+ channels by high glucose. Circ
Res. 99:607-16, 2006
50. Zatta AJ, Headrick JP. Mediators of coronary reactive hyperaemia in isolated
mouse heart. Br J Pharmacol. 144: 576-87, 2005
51. Sage SO and Marchenko SM. Potassium channels in cardiovascular biology.
Archer SL and Rusch NJ. Eds., Kluwer Academic/ Plenum Publishers, New
York, p 651-666, 2001
52. Wellman GC, Bonev AD, Nelson MT, Brayden JE. Gender differences in
coronary artery diameter involve estrogen, nitric oxide, and Ca2+
-dependent K+
channels. Circ Res. 79: 1024-1030, 1996
53. Sato T, Saito T, Saegusa N, Nakaya H. Mitochondrial Ca2+
-activated K+
channels in cardiac myocytes: a mechanism of the cardioprotective effect and
modulation by protein kinase A. Circulation. 111: 198–203, 2005
54. Galvani L. De viribus electricitatis in motu musculari commentarius. Bon Sci
Art Inst Acad Comm. 7: 363-418, 1791
55. Tommaso d’Aquino, Piccolino M, Luigi Galvani and animal electricity: two
centuries after the foundation of electrophysiology. Trends Neurosci. 20: 443-
448, 1997
56. Bernstein J Untersuchingenzurb Thermodynamik der bioelectrischen Strome.
Pflügers Arch. 92: 512-562, 1902
147
57. Bernstein J Elektrobiologie-Die Lehre von den electrischen Vorgangen im
Organismus auf moderner Grundlage dargestellt. Vieweg und Sohn,
Braunschweig, 1912
58. Hodgkin AL, Huxley AF. A Quantitative Description of Membrane Current
and its Application to Conduction and Excitation in Nerve. J Physiol. 117: 500-
544, 1952
59. The Axon Guide for Electrophysiology & Biophysics Laboratory Techniques
Ed. Rivka Sherman-Gold Axon Instruments Inc. p 14, 1993
60. Hamill OP, Marty A, Neher E, Sakmann B, Sigworth FJ. Improved patch-
clamp techniques for high-resolution current recording from cells and cell-free
membrane patches. Pflugers Arch. 391: 85–100, 1981
61. Hirst GDS, Edwards FR. Sympathetic neuroeffector transmission in arteries
and arterioles. Physiol Rev. 69: 546-604, 1989
62. Ghatta S, Nimmagadda D, Xu X, O'Rourke ST.Large-conductance, calcium-
activated potassium channels: structural and functional implications. Pharmacol
Ther. 110: 103-16, 2006
63. Gollasch M, Ried C, Bychkov R, Luft FC, Haller H. K+ currents in human
coronary artery vascular smooth muscle cells. Circ Res. 78: 676-688, 1996
64. Tanaka Y, Meera P, Song M, Knaus HG, Toro L Molecular constituents of
maxi KCa channels in human coronary smooth muscle: predominant α + β
subunit complexes. J Physiol. 502: 545-57, 1997
148
65. Trieschmann U, Isenberg G. Ca2+
-activated K+ channels contribute to the
resting potential of vascular myocytes. Ca2+
-sensitivity is increased by
intracellular Mg2+
ions. Pflugers Arch. 41: S183-184, 1989
66. Coleman HA, Tare M, Parkington HC. Endothelial potassium channels,
endothelium-dependent hyperpolarization and the regulation of vascular tone in
health and disease.Clin Exp Pharmacol Physiol. 31:641-9, 2004
67. Coleman HA, Parkington HC.Endothelin enhances activity of
mechanosensitive channels: a mechanism for ET augmentation of the myogenic
response. Cardiovasc Res. 76:197-8, 2007
68. Quayle JM, Nelson MT, Standen NB. ATP-sensitive and inwardly rectifying
potassium channels in smooth muscle. Physiol Rev. 77:1165-232, 1997
69. Seino S, Miki T.J Physiol. Gene targeting approach to clarification of ion
channel function: studies of Kir6.x null mice. 554:295-300, 2004
70. Buckley JF, Singer M, Clapp LH Role of KATP channels in sepsis..
Cardiovasc Res. 72:220-30, 2006
71. Park WS, Han J, Earm YE. Physiological role of inward rectifier K+ channels in
vascular smooth muscle cells. Pflugers Arch.:457:137-147. 2008
72. Gardos G. The function of calcium and potassium permeability of human
erythrocytes. Biochim. Biophys. Acta. 30: 653–654, 1958*
73. Meech RW. Intracellular calcium injection causes increased potassium
conductance in Aplysia nerve cells. Comp Biochem Physiol A. 42: 493-9, 1972
149
74. Blatz AL, Magleby KL. Ion conductance and selectivity of single calcium-
activated potassium channels in cultured rat muscle. J Gen Physiol. 84:1-23,
1984
75. Eisenman G, Latorre R, Miller C. Multi-ion conduction and selectivity in the
high-conductance Ca++
-activated K+ channel from skeletal muscle. Biophys J.
50: 1025-1034, 1986
76. Wu SN. Large-conductance Ca-activated channels: physiological roles and
pharmacology. Curr Med Chem. 10: 649-61, 2003
77. Prakriya M, Lingle CJ. BK channel activation by brief depolarizations requires
Ca2+
influx through L- and Q-type Ca2+
channels in rat chromaffin cells. J
Neurophysiol. 81: 2267-2278, 1999. Erratum in: J Neurophysiol. 82: 12, 1999
78. Pallanck L, Ganetzky B. Cloning and characterization of human and mouse
homologs of the Drosophila calcium-activated potassium channel gene,
slowpoke. Hum Mol Genet. 3: 1239-1243, 1994
79. Brayden JE. Potassium channels in vascular smooth muscle. Clin Exp
Pharmacol Physiol. 23: 1069-1076, 1996
80. Nieves-Cintrón M, Amberg GC, Nichols CB, Molkentin JD, Santana LF.
Activation of NFATc3 down-regulates the β1 subunit of large conductance,
calcium-activated K+ channels in arterial smooth muscle and contributes to
hypertension. J Biol Chem. 282: 3231-3240, 2007
81. Giangiacomo KM, Becker J, Garsky C, Felix JP, Priest BT, Schmalhofer W,
Garcia ML, Mullmann TJ. Revealing the molecular determinants of neurotoxin
150
specificity for calcium-activated versus voltage-dependent potassium channels.
Biochemistry. 46: 5358-5364, 2007
82. House SJ, Potier M, Bisaillon J, Singer HA, Trebak M. The non-excitable
smooth muscle: Calcium signaling and phenotypic switching during vascular
disease. Pflugers Arch. 456: 769-785, 2008
83. Pucovsky V, Bolton TB. Localisation, function and composition of primary
Ca2+
spark discharge region in isolated smooth muscle cells from guinea-pig
mesenteric arteries. Cell Calcium. 39: 113-129, 2006
84. Buljubasic N, Marijic J, Kampine JP, Bosnjak ZJ. Calcium-sensitive potassium
current in isolated canine coronary smooth muscle cells. Can J Physiol
Pharmacol. 72: 189-198, 1994
85. Nimigean CM, Magleby KL.The beta subunit increases the Ca2+
sensitivity of
large conductance Ca2+
-activated potassium channels by retaining the gating in
the bursting states. J Gen Physiol. 113: 425-440, 1999
86. Papassotiriou J, Köhler R, Prenen J, Krause H, Akbar M, Eggermont J, Paul M,
Distler A, Nilius B, Hoyer J. Endothelial K+ channel lacks the Ca
2+ sensitivity-
regulating beta subunit. FASEB J. 14: 885-894, 2000
87. Fan SF, Brink PR, Melman A, Christ GJ. An analysis of the Maxi-K+ (KCa)
channel in cultured human corporal smooth muscle cells. J Urol. 153: 818–825,
1995
151
88. Knot HJ, Standen NB, Nelson MT. Ryanodine receptors regulate arterial
diameter and wall [Ca2+
] in cerebral arteries of rat via Ca2+
-dependent K+
channels. J. Physiol. 508: 211-221, 1998
89. Galvez A, Gimenez-Gallego G, Reuben JP, Roy-Contancin L, Feigenbaum P,
Kaczorowski GJ, Garcia ML.. Purification and characterization of a unique,
potent, peptidyl probe for the high conductance calcium-activated potassium
channel from venom of the scorpion Buthus tamulus. J Biol Chem. 265: 11083-
11090, 1990
90. Nelson MT, Quayle JM. Physiological roles and properties of potassium
channels in arterial smooth muscle. Am J Physiol. 26: C799-822, 1995
91. Jaggar JH, Porter VA, Lederer WJ, Nelson MT. Calcium sparks in smooth
muscle. Am J Physiol Cell Physiol. 278: C235-C256, 2000
92. Dimitropoulou C, White RE, Fuchs L, Zhang H, Catravas JD, Carrier GO.
Angiotensin II relaxes microvessels via the AT2 receptor and Ca2+
-activated K+
(BKCa) channels. Hypertension 37: 301-307, 2001
93. Zhu S, Han G, White RE. PGE2 action in human coronary artery smooth
muscle: role of potassium channels and signaling cross-talk. J Vasc Res. 39:
477-88, 2002
94. White RE, Han G, Maunz M, Dimitropoulou C, El-Mowafy AM, Barlow RS,
Catravas JD, Snead C, Carrier GO, Zhu S, Yu X. Endothelium-independent
effect of estrogen on Ca2+
-activated K+ channels in human coronary artery
smooth muscle cells. Cardiovasc Res. 53: 650-661, 2002
152
95. Gupta S, Lozano-Cuenca J, Villalón CM, de Vries R, Garrelds IM, Avezaat CJ,
van Kats JP, Saxena PR, MaassenVanDenBrink A. Pharmacological
characterisation of capsaicin-induced relaxations in human and porcine isolated
arteries. Naunyn Schmiedebergs Arch Pharmacol. 375: 29-38, 2007
96. Cabell F, Weiss DS, Price JM. Inhibition of adenosine-induced coronary
vasodilation by block of large-conductance Ca2+
-activated K+ channels. Am J
Physiol. 267: H1455-1460, 1994
97. Cai B, Gong D, Pan Z, Liu Y, Qian H, Zhang Y, Jiao J, Lu Y, Yang B. Large-
conductance Ca2+
-activated K+ currents blocked and impaired by homocysteine
in human and rat mesenteric artery smooth muscle cells. Life Sci. 80: 2060-
2066, 2007
98. Gribkoff VK, Starrett JE Jr, Dworetzky SI, Hewawasam P, Boissard CG, Cook
DA, Frantz SW, Heman K, Hibbard JR, Huston K, Johnson G, Krishnan BS,
Kinney GG, Lombardo LA, Meanwell NA, Molinoff PB, Myers RA, Moon SL,
Ortiz A, Pajor L, Pieschl RL, Post-Munson DJ, Signor LJ, Srinivas N, Taber
MT, Thalody G, Trojnacki JT, Wiener H, Yeleswaram K, Yeola SW Targeting
acute ischemic stroke with a calcium-sensitive opener of maxi-K potassium
channels. Nat Med. 7: 471-477, 2001
99. Hewawasam P, Fan W, Knipe J, Moon SL, Boissard CG, Gribkoff VK, Starrett
JE. The synthesis and structure-activity relationships of 4-aryl-3-
aminoquinolin-2-ones: a new class of calcium-dependent, large conductance,
153
potassium (maxi-K) channel openers targeted for post-stroke neuroprotection.
Bioorg Med Chem Lett. 12: 1779-1783, 2002
100. Raffetto JD, Ross RL, Khalil RA. Matrix metalloproteinase 2-induced venous
dilation via hyperpolarization and activation of K+ channels: relevance to
varicose vein formation. J Vasc Surg. 45:373-80, 2007
101. Rodríguez-Vilarrupla A, Graupera M, Matei V, Bataller R, Abraldes JG, Bosch
J, García-Pagán JC. Large-conductance calcium-activated potassium channels
modulate vascular tone in experimental cirrhosis. Liver Int. 28: 566-573, 2008
102. Klockgether-Radke AP, Pawlowski P, Neumann P, Hellige G. Mechanisms
involved in the relaxing effect of midazolam on coronary arteries. Eur J
Anaesthesiol. 22: 135-139, 2005
103. Klockgether-Radke AP, Pawlowski P, Neumann P, Hellige G. Activation of the
K+ channel BKCa
is involved in the relaxing effect of propofol on coronary
arteries. Eur J Anaesthesiol. 21: 226-230, 2004
104. Lu R, Alioua A, Kumar Y, Eghbali M, Stefani E, Toro L. Maxi-K channel
partners: physiological impact. J Physiol. 570: 65-72, 2006
105. Amberg GC, Santana LF Downregulation of the BK channel beta1 subunit in
genetic hypertension. Circ Res. 93:965-71, 2003
106. Marijic J, Li Q, Song M, Nishimaru K, Stefani E, Toro L. Decreased
expression of voltage- and Ca(2+)-activated K(+) channels in coronary smooth
muscle during aging. Circ Res. 88:210-6, 2001
154
107. Nishimaru K, Eghbali M, Lu R, Marijic J, Stefani E, Toro L. Functional and
molecular evidence of MaxiK channel beta1 subunit decrease with coronary
artery ageing in the rat. J Physiol. 559:849-62, 2004
108. Du W, Bautista JF, Yang H, Diez-Sampedro A, You SA, Wang L, Kotagal P,
Lüders HO, Shi J, Cui J, Richerson GB, Wang QK. Calcium-sensitive
potassium channelopathy in human epilepsy and paroxysmal movement
disorder. Nat Genet. 37:733-8, 2005
109. Meredith AL, Thorneloe KS, Werner ME, Nelson MT, Aldrich RW. Overactive
bladder and incontinence in the absence of the BK large conductance Ca2+-
activated K+ channel. J Biol Chem. 279:36746-52, 2004
110. Werner ME, Zvara P, Meredith AL, Aldrich RW, Nelson MT. Erectile
dysfunction in mice lacking the large-conductance calcium-activated potassium
(BK) channel. J Physiol. 567:545-56, 2005
111. Brenner R, Peréz GJ, Bonev AD, Eckman DM, Kosek JC, Wiler SW, Patterson
AJ, Nelson MT, Aldrich RW. Vasoregulation by the beta1 subunit of the
calcium-activated potassium channel. Nature. 407: 870-876, 2000
112. Plüger S, Faulhaber J, Fürstenau M, Löhn M, Waldschütz R, Gollasch M,
Haller H, Luft FC, Ehmke H, Pongs O. Mice with disrupted BK channel beta1
subunit gene feature abnormal Ca(2+)
spark/STOC coupling and elevated blood
pressure. Circ Res. 87:E53-60, 2000
113. Sausbier M, Hu H, Arntz C, Feil S, Kamm S, Adelsberger H, Sausbier U,
Sailer CA, Feil R, Hofmann F, Korth M, Shipston MJ, Knaus HG, Wolfer DP,
155
Pedroarena CM, Storm JF, Ruth P. Cerebellar ataxia and Purkinje cell
dysfunction caused by Ca2+-activated K+ channel deficiency. Proc Natl Acad
Sci U S A. 101(25):9474-8, 2004
114. Rüttiger L, Sausbier M, Zimmermann U, Winter H, Braig C, Engel J, Knirsch
M, Arntz C, Langer P, Hirt B, Müller M, Köpschall I, Pfister M, Münkner S,
Rohbock K, Pfaff I, Rüsch A, Ruth P, Knipper M. Deletion of the Ca2+
-
activated potassium (BK) alpha-subunit but not the BK beta1-subunit leads to
progressive hearing loss. Proc Natl Acad Sci U S A. 101:12922-7, 2004
115. Kebabian JW. The D1 dopamine receptor. Adv Exp Med Biol. 235:19-31, 1988
116. Fuxe K, Li XM, Tanganelli S, Hedlund P, O'Connor WT, Ferraro L, Ungerstedt
U, Agnati LF. Receptor-receptor interactions and their relevance for receptor
diversity. Focus on neuropeptide/dopamine interactions. Ann NY Acad Sci.
757: 365-376, 1995
117. Hornykiewicz O. Biochemical aspects of Parkinson’s disease. Neurology. 51,
Suppl 2: S2–S9, 1998
118. Dziedzicka-Wasylewska M, Ferrari F, Johnson RD, Mierau J, Rogó Z, Skuza
G, Sokoloff P. Mechanism of action of pramipexole. Rev Contemp
Pharmacother. 12: 1-31, 2001
119. Singer HS. Neurobiological issues in Tourette syndrome. Brain Dev. 16: 353-
364, 1994
120. Jenner P, Marsden CD. Chronic pharmacological manipulation of dopamine
receptor in the brain. Neuropharmacology. 26: 931-940, 1987
156
121. Arnt J, Skarsfeldt T. Do novel antipsychotics have similar pharmacological
characteristics? A review of evidence. Neuropharmacology. 18: 63-118, 1998
122. Jose PA, Eisner GM, Felder RA. Renal dopamine receptors in health and
hypertension. Pharmacol Ther. 80: 149-182, 1998
123. Lucas-Teixeira V, Serrão MP, Soares-Da-Silva P. Effect of salt intake on
jejunal dopamine, Na+,K+-ATPase activity and electrolyte transport. Acta
Physiol Scand. 168: 225-231, 2000
124. Adir Y, Azzam ZS, Lecuona E, Leal S, Pesce L, Dumasius V, Bertorello AM,
Factor P, Young JB, Ridge KM, Sznajder JI. Augmentation of endogenous
dopamine production increases lung liquid clearance. Am J Respir Crit Care
Med. 169: 757-763, 2004
125. Qiu YH, Cheng C, Dai L, Peng YP. Effect of endogenous catecholamines in
lymphocytes on lymphocyte function. J Neuroimmunol. 167: 45-52, 2005
126. Qiu YH, Peng YP, Jiang JM, Wang JJ. Expression of tyrosine hydroxylase in
lymphocytes and effect of endogenous catecholamines on lymphocyte function.
Neuroimmunomodulation.11:75-83, 2004
127. Aherne AM, Vaughan CJ, Carey RM, O'Connell DP. Localization of dopamine
D1A receptor protein and messenger ribonucleic acid in rat adrenal cortex.
Endocrinology. 138: 1282-1288, 1997
128. Amenta F, Ricci A, Tayebati SK, Zaccheo D. The peripheral dopaminergic
system: morphological analysis, functional and clinical applications. Ital J Anat
Embryol. 107: 145-167, 2002
157
129. Amenta F, Barili P, Bronzetti E, Felici L, Mignini F, Ricci A. Localization of
dopamine receptor subtypes in systemic arteries. Clin Exp Hypertens. 22: 277-
88, 2000
130. Gauda EB, Bamford O, Gerfen CR. Developmental expression of tyrosine
hydroxylase, D2-dopamine receptor and substance P genes in the carotid body
of the rat. Neuroscience; 75: 969-977, 1996
131. Marmon LM, Albrecht F, Canessa LM, Hoy GR, Jose PA. Identification of
dopamine1A receptors in the rat small intestine. J Surg Res. 54: 616-620, 1993
132. Niznik HB, Jarvie KR, Brown EM. Dopamine D1 receptors of the calf
parathyroid gland: identification of a ligand binding subunit with lower
apparent molecular weight but similar primary structure to neuronal D1-
receptors. Biochemistry 28: 6925–6930, 1989
133. Ozono R, O'Connell DP, Wang ZQ, Moore AF, Sanada H, Felder RA, Carey
RM. Localization of the dopamine D1 receptor protein in the human heart and
kidney. Hypertension 30: 725-729, 1997
134. Grenader AC, O'Rourke DA, Healy DP. Cloning of the porcine D1A dopamine
receptor gene expressed in renal epithelial LLC-PK1 cells. Am J Physiol. 268:
F423-434, 1995
135. Andersson KE. Treatment-resistant detrusor overactivity--underlying
pharmacology and potential mechanisms. Int J Clin Pract Suppl.151: 8-16,
2006
158
136. Lucas-Teixeira VA, Hussain T, Serrão P, Soares-da-Silva P, Lokhandwala MF
Intestinal dopaminergic activity in obese and lean Zucker rats: response to high
salt intake. Clin Exp Hypertens. 24: 383-396, 2002
137. Lucas-Teixeira VA, Vieira-Coelho MA, Serrão P, Pestana M, Soares-da-Silva
P. Salt intake and sensitivity of intestinal and renal Na+-K+ ATPase to
inhibition by dopamine in spontaneous hypertensive and Wistar-Kyoto rats.
Clin Exp Hypertens. 22: 455-469, 2000
138. Zeng C, Sanada H, Watanabe H, Eisner GM, Felder RA, Jose PA. Functional
genomics of the dopaminergic system in hypertension. Physiol Genomics 19:
233-246, 2004
139. Donowitz M, Cusolito S, Battisti L, Fogel R, Sharp GW. Dopamine stimulation
of active Na and Cl absorption in rabbit ileum. J Clin Invest. 69: 1008–1016,
1982
140. Marzio L, Neri M, Pieramico O, Delle MD, Peeters TL, and Cuccurullo F.
Dopamine interrupts gastrointestinal fed motility pattern in humans. Dig Dis
Sci. 35: 327–332, 1990.
141. Meredith EJ, Chamba A, Holder MJ, Barnes NM, Gordon J. Close encounters
of the monoamine kind: immune cells betray their nervous disposition.
Immunology 115: 289-295, 2005
142. Kipnis J, Cardon M, Avidan H, Lewitus GM, Mordechay S, Rolls A, Shani Y,
Schwartz M. Dopamine, through the extracellular signal-regulated kinase
159
pathway, downregulates CD4+CD25+ regulatory T-cell activity: implications
for neurodegeneration. J Neurosci: 24:6133–43, 2004
143. Brown JH, Makman MH. Stimulation by dopamine of adenylate cyclase in
retinal homogenates and of adenosine-30:50-cyclic monophosphate formation
in intact retina. Proc Natl Acad Sci USA 69: 539–543, 1972
144. Kebabian JW, Petzold GL, Greengard P. Dopamine-sensitive adenylate cyclase
in caudate nucleus of rat brain, and its similarity to the ‘‘dopamine receptor.’’
Proc Natl Acad Sci USA 69: 2145–2149, 1972
145. Kebabian JW, Calne DB. Multiple receptors for dopamine. Nature 277: 93-96,
1979
146. Civelli O, Bunzow JR, Grandy DK. Molecular diversity of the dopamine
receptors. Annu Rev Pharmacol Toxicol. 32: 281–307, 1993
147. O’Dowd BF, Seeman P, George SR. Dopamine receptors. In: Peroutka SJ (Ed).
Handbook of Receptors and Channels. CRC Press: Boca Raton, pp 95-123,
1994
148. Jose PA, Eisner GM, Felder RA. Regulation of blood pressure by dopamine
receptors. Nephron Physiol. 9: 19-27, 2003
149. Carey RM. Theodore Cooper Lecture: Renal dopamine system: paracrine
regulator of sodium homeostasis and blood pressure. Hypertension 38:297-302,
2001
150. Banday AA, Lokhandwala MF. Dopamine receptors and hypertension. Curr
Hypertens Rep. 10:268-275, 2008
160
151. Premont RT, Gainetdinov RR. Physiological roles of G protein-coupled
receptor kinases and arrestins. Annu Rev Physiol. 69: 511-534, 2007
152. Schiöth HB, Fredriksson R. The GRAFS classification system of G-protein
coupled receptors in comparative perspective. Gen Comp Endocrinol. 142: 94-
101, 2005
153. Sibley DR, Monsma FJ Jr. Molecular biology of dopamine receptors. Trends
Pharmacol Sci. 13: 61-69, 1992
154. Felder CC, Blecher M, Jose PA. Dopamine-1-mediated stimulation of
phospholipase C activity in rat renal cortical membranes. J Biol Chem. 264:
8739-8745, 1989
155. Neve KA, Seamans JK, Trantham-Davidson H. Dopamine receptor signaling. J
Recept Signal Transduct Res. 24: 165-205, 2004
156. Sunahara RK, Guan HC, O'Dowd BF, Seeman P, Laurier LG, Ng G, George
SR, Torchia J, Van Tol HH, Niznik HB. Cloning of the gene for a human
dopamine D5 receptor with higher affinity for dopamine than D1. Nature. 350:
614-619, 1991
157. Missale CX, Nash SR, Robinson SW, Jaber M, Caron MG. Dopamine
receptors: from structure to function. Pharmacol Rev. 78: 189–225, 1998
158. Tiberi M, Caron MG. High agonist-independent activity is a distinguishing
feature of the dopamine D1B receptor subtype. J Biol Chem. 269: 27925–
27931, 1994
161
159. Gildea JJ, McGrath H, Carey RM, Jose PA, Felder RA. A novel dopamine D5
receptor selective antagonist (PM436) reveals that the dopamine D5 Receptor
negatively regulates the fenoldopam-dependent D1 receptor brush border
translocation. 61st Annual High Blood Pressure Conference, Abstract P146,
p121, 2007
160. Lefkowitz RJ, Cotecchia S, Samama P, Costa T. Constitutive activity of
receptors coupled to guanine nucleotide regulatory proteins. Trends Pharmacol
Sci. 14: 303-7, 1993
161. Cantrell AR, Smith RD, Goldin AL, Scheuer T, Catterall WA. Dopaminergic
modulation of sodium current in hippocampal neurons via cAMP-dependent
phosphorylation of specific sites in the sodium channel subunit. J Neurosci. 17:
7330–7338, 1997
162. Surmeier DJ, Eberwine J, Wilson CJ, Cao Y, Stefani A, Kitai ST. Dopamine
receptor subtypes colocalize in rat striatonigral neurons. Proc Natl Acad Sci
USA. 89: 10178–10182, 1992
163. Smith RD, Goldin AL. Phosphorylation at a single site in the rat brain sodium
channel is necessary and sufficient for current reduction by protein kinase A. J
Neurosci. 17: 6086–6093, 1997
164. Murphy BJ, Rossie S, De Jongh KS, Catterall WA. Identification of the sites of
selective phosphorylation and dephosphorylation of the rat brain Na+ channel
subunit by cAMP-dependent protein kinase and phosphoprotein phosphatases. J
Biol Chem. 268: 27355–27362, 1993
162
165. Tiberi M, Jarvie K R, Silvia C, Falardeau P, Gingrich J A, Godinot N, Bertrand
L, Yang-Feng T L, Fremeau R T, Jr, and Caron M G. Cloning, molecular
characterization, and chromosomal assignment of a gene encoding a second D1
dopamine receptor subtype: differential expression pattern in rat brain
compared with the D1A receptor. Proc Natl Acad Sci USA. 88: 7491-7495,
1991
166. Li M, West JW, Lai Y, Scheuer T, Catterall WA. Functional modulation of
brain sodium channels by cAMP-dependent phosphorylation. Neuron 8: 1151–
1159, 1992
167. Surmeier DJ, Bargas J, Hemmings HC Jr, Nairn AC, Greengard P. Modulation
of calcium currents by a D1 dopaminergic protein kinase/phosphatase cascade
in rat neostriatal neurons. Neuron 14:385–397, 1995
168. Ibarra FR, Aguirre J, Nowicki S, Barontini M, Arrizurieta EE, Armando I.
Demethylation of 3-O-methyldopa in the kidney: a possible source for
dopamine in urine. Am J Physiol. 270: F862-868, 1996
169. Vieira-Coelho MA, Soares-da-Silva P. Dopamine formation, from its
immediate precursor 3, 4-dihydroxyphenylalanine, along the rat digestive tract.
Fundam Clin Pharmacol. 7: 235-243, 1993
170. Zeng C, Armando I, Luo Y, Eisner GM, Felder RA, Jose PA. Dysregulation of
dopamine-dependent mechanisms as a determinant of hypertension: studies in
dopamine receptor knockout mice. Am J Physiol Heart Circ Physiol. 294:
H551-569, 2008
163
171. Albrecht FE, Drago J, Felder RA, Printz MP, Eisner GM, Robillard JE, Sibley
DR, Westphal HJ, Jose PA. Role of the D1A dopamine receptor in the
pathogenesis of genetic hypertension. J Clin Invest. 97: 2283-2288, 1996
172. Hollon TR, Bek MJ, Lachowicz JE, Ariano MA, Mezey E, Ramachandran R,
Wersinger SR, Soares-da-Silva P, Liu ZF, Grinberg A, Drago J, Young WS
3rd, Westphal H, Jose PA, Sibley DR. Mice lacking D5 dopamine receptors
have increased sympathetic tone and are hypertensive. J Neurosci. 22: 10801-
10810, 2002
173. Vaughan CJ, Aherne AM, Lane E, Power O, Carey RM, O'Connell DP.
Identification and regional distribution of the dopamine D1A receptor in the
gastrointestinal tract. Am J Physiol Regul Integr Comp Physiol. 279: R599-609,
2000
174. Bertorello AM, Vieira-Coelho MA, Eklof AC, Finkel Y, Soares-da-Silva P.
The intestinal mucosa as a source of dopamine. Adv. Biosci. 88: 11-20, 1993
175. Finkel Y, Eklof AC, Granquist L, Soares-da-Silva P, Bertorello AM.
Endogenous dopamine modulates jejunal sodium absorption during high-salt
diet in young but not in adult rats. Gastroenterology. 107: 675-679, 1994
176. Vieira-Coelho MA, Soares-da-Silva P. Dopamine formation, from its
immediate precursor 3, 4-dihydroxyphenylalanine, along the rat digestive tract.
Fundam Clin Pharmacol. 7: 235-243, 1993
164
177. Lucas-Teixeira V, Serrão MP, Soares-Da-Silva P. Effect of salt intake on
jejunal dopamine, Na+,K
+-ATPase activity and electrolyte transport. Acta
Physiol Scand. 68: 225-231, 2000
178. Goldberg LI. Dopamine and new dopamine analogs: receptors and clinical
applications. J Clin Anesth. 1: 66-74, 1988
179. Lokhandwala M.F. Cardiovascular and renal effects of dopamine receptor
agonists. ISI Atlas Sci Pharmacol. 2: 261–266, 1998
180. Bailey JM. Dopamine: one size does not fit all. Anesthesiology. 92: 303-305,
2000
181. Matsumoto T, Ozono R, Sasaki N, Oshima T, Matsuura H, Kajiyama G, Carey
RM, Kambe M.Type 1A dopamine receptor expression in the heart is not
altered in spontaneously hypertensive rats. Am J Hypertens. 13: 673-677, 2000
182. Ozono R, O'Connell DP, Vaughan C, Botkin SJ, Walk SF, Felder RA, Carey
RM. Expression of the subtype 1A dopamine receptor in the rat heart.
Hypertension 27: 693-703, 1996
183. Ozono R, O'Connell DP, Wang ZQ, Moore AF, Sanada H, Felder RA, Carey
RM. Localization of the dopamine D1 receptor protein in the human heart and
kidney. Hypertension. 30: 725-729, 1997
184. Hampton JR, Van Veldhuisen DJ, Kleber FX et al., for the Second Society of
Cardiology, the National College of General Hospital Prospective Randomised
Study of Ibopamine on Mortality and Cardiologists and the French Geriatrics
Society. Efficacy (PRIME-II) Investigators. Randomised study of effect of
165
ibopamine on survival in patients with advanced severe heart failure. Eur Heart
J. 21: 763–769, 2000
185. Torp-Pedersen C, Køber L, Carlsen JE, Akkan D, Bruun NE, Dacoronias D,
Dickstein K, Haghfelt T, Ohlin H, McMurray JJ. A randomised trial of a pre-
synaptic stimulator of DA2-dopaminergic and alpha2-adrenergic receptors on
morbidity and mortality in patients with heart failure. Eur J Heart Fail. 10: 89-
95, 2008.
186. Amenta F, Ricci A, Tayebati SK, Zaccheo D. The peripheral dopaminergic
system: morphological analysis, functional and clinical applications. Ital J Anat
Embryol.107: 145-67, 2002
187. Amenta F. Light microscopy autoradiography of peripheral dopamine receptor
subtypes. Clin Exp Hypertens. 19: 27-41, 1997
188. Amenta F, Ricci A.Autoradiographic localization of dopamine DA-1 receptors
in the rat renal vasculature using [3H]-SCH 23390 as a ligand. J Auton
Pharmacol. 10: 373-383, 1990.
189. Li Z, Yu C, Han Y, Ren H, Shi W, Fu C, He D, Huang L, Yang C, Wang X,
Zhou L, Asico LD, Zeng C, Jose PA. Inhibitory effect of D1-like and D3
dopamine receptors on norepinephrine-induced proliferation in vascular smooth
muscle cells. Am J Physiol Heart Circ Physiol. 294: H2761-2768, 2008
190. Lokhandwala MF, Amenta F. Anatomical distribution and function of
dopamine receptors in the kidney.FASEB J.5:3023-30, 1991
166
191. Ricci A, Escaf S, Vega JA, Amenta F. Autoradiographic localization of
dopamine D1 receptors in the human kidney. J Pharmacol Exp Ther.
Jan;264(1):431-7, 1993
192. Yamauchi M, Kobayashi Y, Shimoura K, Hattori K, Nakase A. Endothelium-
dependent and -independent relaxation by dopamine in the rabbit pulmonary
artery. Clin Exp Pharmacol Physiol. 19: 401-410, 1992
193. Han G, Kryman JP, McMillin PJ, White RE, Carrier GO. A novel transduction
mechanism mediating dopamine-induced vascular relaxation: opening of BKCa
channels by cyclic AMP-induced stimulation of the cyclic GMP-dependent
protein kinase. J Cardiovasc Pharmacol. 34: 619-627, 1999
194. Robertson BE, Schubert R, Hescheler J, Nelson MT. cGMP-dependent protein
kinase activates Ca-activated K channels in cerebral artery smooth muscle cells.
Am J Physiol. 265: C299-303, 1993
195. Kawano H, Kawano T, Tanaka K, Eguchi S, Takahashi A, Nakaya Y, Oshita S.
Effects of dopamine on ATP-sensitive potassium channels in porcine coronary
artery smooth-muscle cells. J Cardiovasc Pharmacol. 51: 196-201, 2008
196. Yu PY, Asico LD, Eisner GM, Jose PA. Differential regulation of renal
phospholipase C isoforms by catecholamines. J Clin Invest. 95: 304-308, 1995
197. Yu PY, Eisner GM, Yamaguchi I, Mouradian MM, Felder RA, Jose PA.
Dopamine D1A receptor regulation of phospholipase C isoform. J Biol Chem.
271: 19503-19508, 1996
167
198. Lange A, Gebremedhin D, Narayanan J, Harder D. 20-Hydroxyeicosatetraenoic
acid-induced vasoconstriction and inhibition of potassium current in cerebral
vascular smooth muscle is dependent on activation of protein kinase C. J Biol
Chem. 272: 27345-27352, 1997
199. Minami K, Fukuzawa K, Nakaya Y. Protein kinase C inhibits the Ca2+
-
activated K+ channel of cultured porcine coronary artery smooth muscle cells.
Biochem Biophys Res Commun. 190: 263-269, 1993
200. White BH, Kimura K, Sidhu A. Inhibition of hormonally induced inositol
trisphosphate production in Transfected GH4C1 cells: A novel role for the D5
subtype of the dopamine receptor. Neuroendocrinology. 69: 209-216, 1999
201. Berridge MJ, Irvine RF. Inositol trisphosphate, a novel second messenger in
cellular signal transduction. Nature. 312: 315-321, 1984
202. Nishizuka Y. Turnover of inositol phospholipids and signal transduction.
Science. 225: 1365-1370, 1984
203. Knot HJ, Standen NB, Nelson MT. Ryanodine receptors regulate arterial
diameter and wall [Ca2+
] in cerebral arteries of rat via Ca2+
-dependent K+
channels. J. Physiol. 508: 211-221, 1998
204. Jaggar JH, Wellman GC, Heppner TJ, Porter VA, Perez GJ, Gollasch M,
Kleppisch T, Rubart M, Stevenson AS, Lederer WJ, Knot HJ, Bonev AD,
Nelson MT. Ca2+
channels, ryanodine receptors and Ca2+
-activated K+
channels: a functional unit for regulating arterial tone. Acta Physiol Scand. 164:
577-587, 1998
168
205. Ohizumi Y, Hirata Y, Suzuki A, Kobayashi M. Two novel types of calcium
release from skeletal sarcoplasmic reticulum by phosphatidylinositol 4,5-
biphosphate. Can J Physiol Pharmacol. 77: 276-85, 1999
206. Pérez GJ, Bonev AD, Nelson MT. Micromolar Ca2+
from sparks activates
Ca(2+)
-sensitive K+ channels in rat cerebral artery smooth muscle. Am J Physiol
Cell Physiol. 281: C1769-1775, 2001
207. Harder DR, Coulson PB. Estrogen receptors and effects of estrogen on
membrane electrical properties of coronary vascular smooth muscle. J Cell
Physiol. 100: 375-382, 1979
208. Mügge A, Riedel M, Barton M, Kuhn M, Lichtlen PR. Endothelium
independent relaxation of human coronary arteries by 17 beta-oestradiol in
vitro. Cardiovasc Res. 27: 1939-1942, 1993
209. Chester AH, Jiang C, Borland JA, Yacoub MH, Collins P. Oestrogen relaxes
human epicardial coronary arteries through non-endothelium-dependent
mechanisms. Coron Artery Dis. 6: 417–422, 1995
210. White RE, Han G, Maunz M, Dimitropoulou C, El-Mowafy AM, Barlow RS,
Catravas JD, Snead C, Carrier GO, Zhu S, Yu X. Endothelium-independent
effect of estrogen on Ca2+
activated K+ channels in human coronary artery
smooth muscle cells. Cardiovasc Res. 53: 650-661, 2002
211. Darkow DJ, Lu L, White RE. Estrogen relaxation of coronary artery smooth
muscle is mediated by nitric oxide and cGMP. Am J Physiol. 272: H2765–
2773, 1997
169
212. Han G, Ma H, Chintala R, Miyake K, Fulton DJ, Barman SA, White RE.
Nongenomic, endothelium-independent effects of estrogen on human coronary
smooth muscle are mediated by type I (neuronal) NOS and PI3-kinase-Akt
signaling. Am J Physiol Heart Circ Physiol. 293: H314-321, 2007
213. Wong CM, Tsang SY, Yao X, Chan FL, Huang Y. Differential effects of
estrogen and progesterone on potassium channels expressed in Xenopus
oocytes. Steroids 73: 272-279, 2008
214. Lunardi CN, Vercesi JA, da Silva RS, Bendhack LM. Vasorelaxation induced
by the new nitric oxide donor cis-[Ru(Cl)(bpy)2(NO)](PF6) is due to activation
of KCa by a cGMP-dependent pathway. Vascul Pharmacol. 47: 139-144, 2007
215. Mandalà M, Heppner TJ, Bonev AD, Nelson MT. Effect of endogenous and
exogenous nitric oxide on calcium sparks as targets for vasodilation in rat
cerebral artery. Nitric Oxide. 16: 104-109, 2007
216. Liu Y, Terata K, Chai Q, Li H, Kleinman LH, Gutterman DD. Peroxynitrite
inhibits Ca2+
-activated K+ channel activity in smooth muscle of human
coronary arterioles. Circ Res. 91: 1070-1076, 2002
217. Han DH, Chae MR, Jung JH, So I, Park JK, Lee SW. Effect of testosterone on
potassium channel opening in human corporal smooth muscle cells. J Sex Med.
5: 822-832, 2008.
218. Kanu A, Leffler CW. Carbon monoxide and Ca2+
-activated K+ channels in
cerebral arteriolar responses to glutamate and hypoxia in newborn pigs. Am J
Physiol Heart Circ Physiol. 293: H3193-3200, 2007
170
219. Dong DL, Zhang Y, Lin DH, Chen J, Patschan S, Goligorsky MS, Nasjletti A,
Yang BF, Wang WH. Carbon monoxide stimulates the Ca2+
-activated big
conductance K channels in cultured human endothelial cells. Hypertension. 50:
643-651, 2007.
220. Bolognesi M, Sacerdoti D, Piva A, Di Pascoli M, Zampieri F, Quarta S,
Motterlini R, Angeli P, Merkel C, Gatta A. Carbon monoxide-mediated
activation of large-conductance calcium-activated potassium channels
contributes to mesenteric vasodilatation in cirrhotic rats. J Pharmacol Exp Ther.
321: 187-194, 2007
221. Ramos KS, Lin H, McGrath JJ. Modulation of cyclic guanosine
monophosphate levels in cultured aortic smooth muscle cells by carbon
monoxide. Biochem. Pharmacol. 38: 1368–1370, 1989
222. Cardell LO, Ueki IF, Stjärne P, Agusti C, Takeyama K, Lindén A, Nadel JA
Bronchodilatation in vivo by carbon monoxide, a cyclic GMP related
messenger. Br. J. Pharmacol. 124: 1065–1068, 1998
223. Jaggar JH, Li A, Parfenova H, Liu J, Umstot ES, Dopico AM, Leffler CW.
Heme is a carbon monoxide receptor for large-conductance Ca2+
-activated K+
channels. Circ Res. 97: 805-812, 2005
224. Williams SE, Wootton P, Mason HS, Bould J, Iles DE, Riccardi D, Peers C,
Kemp PJ. Hemoxygenase-2 is an oxygen sensor for a calcium-sensitive
potassium channel. Science. 306: 2093-2097, 2004
171
225. Dubuis E, Potier M, Wang R, Vandier C. Continuous inhalation of carbon
monoxide attenuates hypoxic pulmonary hypertension development
presumably through activation of BKCa channels. Cardiovasc Res. 65: 751-
761, 2005
226. Hou S, Xu R, Heinemann SH, Hoshi T. The RCK1 high-affinity Ca2+
sensor
confers carbon monoxide sensitivity to Slo1 BK channels. Proc Natl Acad Sci
USA. 105: 4039-4043, 2008
227. Zhang Y, Oltman CL, Lu T, Lee HC, Dellsperger KC, VanRollins M. EET
homologs potently dilate coronary microvessels and activate BKCa channels.
Am J Physiol. Heart Circ Physiol. 280: H2430-440, 2001
228. Imig JD, Dimitropoulou C, Reddy DS, White RE, Falck JR. Afferent arteriolar
dilation to 11, 12-EET analogs involves PP2A activity and Ca2+
-activated K+
Channels. Microcirculation. 15: 137-150, 2008
229. White RE, Lee AB, Shcherbatko AD, Lincoln TM, Schonbrunn A, Armstrong
DL Potassium channel stimulation by natriuretic peptides through cGMP-
dependent dephosphorylation. Nature. 361:263-266, 1993
230. Kooli A, Kermorvant-Duchemin E, Sennlaub F, Bossolasco M, Hou X, Honoré
JC, Dennery PA, Sapieha P, Varma D, Lachapelle P, Zhu T, Tremblay S,
Hardy P, Jain K, Balazy M, Chemtob S. trans-Arachidonic acids induce a heme
oxygenase-dependent vasorelaxation of cerebral microvasculature. Free Radic
Biol Med. 44: 815-825, 2008
172
231. Wu X, Yang Y, Gui P, Sohma Y, Meininger GA, Davis GE, Braun AP, Davis
MJ. Potentiation of large conductance, Ca2+
-activated K+ (BK) channels by
alpha5beta1 integrin activation in arteriolar smooth muscle. J Physiol. 586:
1699-1713, 2008
232. Twitchell WA, Rane SG. Nucleotide-independent modulation of Ca2+
dependent K+ channel current by a mu-type opioid receptor. Mol Pharmacol.
46: 793-798, 1994
233. Yamamura H, Nagano N, Hirano M, Muraki K, Watanabe M, Imaizumi Y.
Activation of Ca2+
-dependent K+ current by nordihydroguaiaretic acid in
porcine coronary arterial smooth muscle cells. J Pharmacol Exp Ther. 291: 140-
146, 1999
234. Carrier GO, Fuchs LC, Winecoff AP, Giulumian AD, White RE.
Nitrovasodilators relax mesenteric microvessels by cGMP-induced stimulation
of Ca-activated K channels. Am J Physiol. 273: H76-84, 1997
235. Kanyicska B, Freeman ME, Dryer SE. Endothelin activates large-conductance
K+ channels in rat lactotrophs: reversal by long-term exposure to dopamine
agonist. Endocrinology. 138: 3141-3153,1997
236. Tabak J, Toporikova N, Freeman ME, Bertram R. Low dose of dopamine may
stimulate prolactin secretion by increasing fast potassium currents. J Comput
Neurosci. 22: 211-222, 2007
237. Gonzalez-Iglesias AE, Murano T, Li S, Tomić M, Stojilkovic SS. Dopamine
inhibits basal prolactin release in pituitary lactotrophs through pertussis toxin-
173
sensitive and -insensitive signaling pathways. Endocrinology. 149: 1470-1479,
2008
238. Han DH, Chae MR, So I, Park JK, Lee SW. The effects of dopamine receptor
agonists on BK Ca channels and signal transduction mechanism in corpus
cavernosal smooth muscle cells. Int J Impot Res. 20: 53–59, 2008
239. White RE, Kryman JP, El-Mowafy AM, Han G, Carrier GO. cAMP-dependent
vasodilators cross-activate the cGMP-dependent protein kinase to stimulate
BK(Ca) channel activity in coronary artery smooth muscle cells. Circ Res. 86:
897-905, 200
240. Jin XH, Wang WZ, Zhao RR. Comparison of the characteristics and density of
dopamine-1 receptors in membranes from different arteries using [3H]
SCH23390 binding. Methods Find Exp Clin Pharmacol. 17: 455-461, 1995
241. Bass AS, Robie NW. Stereoselectivity of S- and R-sulpiride for pre- and
postsynaptic dopamine receptors in the canine kidney. J Pharmacol Exp Ther.
229: 67-71, 1984
242. Lokhandwala MF. Presynaptic receptor systems on cardiac sympathetic nerves.
Life Sci. 24: 1823-1832, 1979
243. Goldberg LI, Kohli JD. Peripheral pre- and post-synaptic dopamine receptors:
are they different from dopamine receptors in the central nervous system?
Commun Psychopharmacol. 3: 447-456, 1979
244. Goldberg LI, Kohli JD, Glock D. Conclusive evidence for two subtypes of
peripheral dopamine receptors. In Dopaminergic Systems and Their
174
Regulation. GN Woodruff, JA Poat, and PJ Roberts, eds., Macmillan, London.
p. 195-212, 1986
245. Bühler R, Apell HJ. Sequential potassium binding at the extracellular side of
the Na,K-Pump. J Membr Biol. 145: 165-173, 1995
246. Lenz T, Wagner G. Antihypertensive care with calcium antagonists. In:
Hypertension. Pathophysiology, Diagnosis and Management, pp. 2953–2968,
Laragh JH. and Brenner BM (eds.) Raven Press, New York, 1995
247. Scholz, H. Pharmacological aspects of calcium channel blockers. Cardiovasc
Drugs Ther. 10 (Suppl. 3): 869–872, 1997
248. Siragy HM, Felder RA, Howell NL, Chevalier RL, Peach MJ, Carey RM.
Evidence that dopamine-2 mechanisms control renal function. Am J Physiol.
259: F793-800, 1990
249. Jose PA, Asico LD, Eisner GM, Pocchiari F, Semeraro C, Felder RA. Effects of
costimulation of dopamine D1- and D2-like receptors on renal function. Am J
Physiol. 275: R986-R994, 1998
250. Luippold G, Schneider S, Vallon V, Osswald H, Muhlbauer B. Postglomerular
vasocons-triction induced by dopamine D3 receptor activation in anesthetized
rats. Am J Physiol Renal Physiol 278: F570-F575, 2000.
251. Lang WJ, Woodman OL. Comparison of the vasodilator action of dopamine
and dopamine agonists in the renal and coronary beds of the dog. Br. J.
Pharmacol. 77: 23-28, 1982.
175
252. Horn PT, Kohli JD. Absence of postsynaptic DA2 dopamine receptors in the
dog renal vasculature. Eur J Pharmacol. 197: 125-130, 1991
253. Siragy, HM, Felder RA, Peach MJ, Carey RM. Intrarenal DA2 dopamine
receptor stimulation in the conscious dog. Am J Physiol. 262: F932-938, 1992
254. Jose PA, Eisner GM, Felder RA. Renal dopamine receptors in health and
hypertension. Pharmacol Ther. 80: 149-182, 1998
255. Nash SR, Godinot N, Caron MG. Cloning and characterization of the opossum
kidney cell D1 dopamine receptor. Mol Pharmacol. 44: 918-925, 1993
256. Zeng C, Yang Z, Wang Z, Jones J, Wang X, Altea J, Mangrum AJ, Hopfer U,
Sibley DR, Eisner GM, Felder RA, Jose PA. Interaction of angiotensin II Type
1 and D5 dopamine receptors in renal proximal tubule cells. Hypertension 45:
804-810, 2005
257. Gildea JJ, Wang X, Jose PA, Felder RA. Differential D1 and D5 receptor
regulation and degradation of the angiotensin type 1 receptor. Hypertension.
51: 360-366, 2008
258. Felder CC, Albrecht FE, Eisner GM, Jose PA. The signal transducer for the
dopamine-1 regulated sodium transport in renal cortical brush border
membrane vesicles. Am J Hypertens. 3: 47S-50S, 1990
259. Banday AA, Lokhandwala MF. Oxidative stress reduces renal dopamine D1
receptor-Gq/11α G protein-phospholipase C signaling involving G protein-
coupled receptor kinase 2. Am J Physiol Renal Physiol. 293: F306-315, 2007
176
260. Gomes P, Soares-da-Silva P. Dopamine acutely decreases type 3 Na+/H
+
exchanger activity in renal OK cells through the activation of protein kinases A
and C signaling cascades. Eur J Pharmacol. 488: 51-59, 2004
261. Han JY, Heo JS, Lee YJ, Lee JH, Taub M, Han HJ. Dopamine stimulates Ca2+
uptake through cAMP, PLC/PKC, and MAPKs in renal proximal tubule cells. J
Cell Physiol. 211: 486-94, 2007
262. Felder CC, Jose PA, Axelrod J. The dopamine-1 agonist, SKF 82526,
stimulates phospholipase-C activity independent of adenylate cyclase. J
Pharmacol Exp Ther. 248: 171-175, 1989
263. Yasunari K, Kohno M, Murakawa K, Yokokawa K, Horio T, Takeda T.
Interaction between a phorbol ester and dopamine DA1 receptors on vascular
smooth muscle. Am J Physiol. 264: F24-30, 1993
264. Jackson A, Sedaghat K, Minerds K, James C, Tiberi M. Opposing effects of
phorbol-12-myristate-13-acetate, an activator of protein kinase C, on the
signaling of structurally related human dopamine D1 and D5 receptors. J
Neurochem. 95: 1387-1400, 2005
265. Yang Z, Sibley DR, Jose PA. D5 dopamine receptor knockout mice and
hypertension. J Recept Signal Transduct Res. 24: 149-164, 2004
266. Yao LP, Huque E, Baranuik J, Carey RM, Felder RA, Jose PA. Dopamine
receptor subtype expression ( D1A and D1B) in rat nephron segments (Abstract)
J. Investig Med. 44: 305A, 1996
177
267. Yasunari K, Kohno M, Murakawa K, Yokokawa K, Takeda T. Effect of
glucocorticoid on prostaglandin E1 mediated cyclic AMP formation by
vascular smooth muscle cells. J Hypertens. 6: 1023-1028, 1988
268. Chatziantoniou C, Ruan X, Arendshorst WJ. Interactions of cAMP-mediated
vasodilators with angiotensin II in rat kidney during hypertension. Am J
Physiol. 265: F845-852, 1993
269. Omar R, Bottrill FE, Hiley CR, White R. Interaction of cyclic AMP modulating
agents with levcromakalim in the relaxation of rat isolated mesenteric artery.
Eur J Pharmacol. 401: 85-96, 2000
270. Zhao YJ, Wang J, Rubin LJ, Yuan XJ. Roles of K+ and Cl- channels in cAMP-
induced pulmonary vasodilation. Exp Lung Res. 24: 71-83, 1998
271. Ben-Haim G, Armstead WM. Role of cAMP and K+ channel-dependent
mechanisms in piglet hypoxic/ischemic impaired nociceptin/orphanin FQ-
induced cerebrovasodilation. Brain Res. 884: 51-58, 2000
272. White RE, Darkow DJ, Lang JL. Estrogen relaxes coronary arteries by opening
BKCa channels through a cGMP-dependent mechanism. Circ Res. 77: 936–942,
1995
273. Zhao YJ, Wang J, Rubin LJ, Yuan XJ. Roles of K+ and Cl- channels in cAMP-
induced pulmonary vasodilation. Exp Lung Res. 24: 71-83, 1998
274. Goldberg ND, Haddox MK, Nicol SE, Glass DB, Sanford CH, Kuehl FA Jr,
Estensen R. Biologic regulation through opposing influences of cyclic GMP
178
and cyclic AMP: the Yin Yang hypothesis. Adv Cyclic Nucleotide Res. 5: 307-
330, 1975
275. Francis SH, Noblett BD, Todd BW, Wells JN, Corbin JD. Relaxation of
vascular and tracheal smooth muscle by cyclic nucleotide analogs that
preferentially activate purified cGMP-dependent protein kinase. Mol
Pharmacol. 34: 506-517, 1988
276. Burnette JO, White RE. PGI2 opens potassium channels in retinal pericytes by
cyclic AMP-stimulated, cross-activation of PKG. Exp Eye Res. 83: 1359-1365,
2006
277. Barman SA, Zhu S, Han G, White RE. cAMP activates BKCa channels in
pulmonary arterial smooth muscle via cGMP-dependent protein kinase. Am J
Physiol Lung Cell Mol Physiol. 284: L1004-1011, 2003
278. Pfaffl MW. A new mathematical model for relative quantification in real-time
RT-PCR. Nucleic Acids Res. 29: e45, 2001
279. Sanada H, Jose PA, Hazen-Martin D, Yu PY, Xu J, Bruns DE, Phipps J, Carey
RM, Felder RA. Dopamine-1 receptor coupling defect in renal proximal tubule
cells in hypertension. Hypertension. 33: 1036-1042, 1999
280. Yu P-Y, Asico LD, Eisner GM, Jose PA. Selective regulation of renal
phospholipase C isoforms by dopamine1 agonists: correlation with in vivo
studies. J Clin Invest. 95: 304 –308, 1995
179
281. Langton PD, Nelson MT, Huang Y, Standen NB. Block of calcium-activated
potassium channels in mammalian arterial myocytes by tetraethylammonium
ions. Am J Physiol. 260: H927-934, 1991
282. Kase H, Iwahashi K, Nakanishi S, Matsuda Y, Yamada K, Takahashi
M,Murakata C, Sato A, Kaneko M. K-252 compounds, novel and potent
inhibitors of protein kinase C and cyclic nucleotide-dependent protein kinases.
Biochem Biophys Res Commun. 142: 436–440, 1987
283. Tiberi M, Nash SR, Bertrand L, Lefkowitz RJ, Caron MG. Differential
regulation of dopamine D1A receptor responsiveness by various G protein-
coupled receptor kinases. J Biol Chem. 271:3771–3778, 1996
284. Song Y, Simard JM. beta-Adrenoceptor stimulation activates large-conductance
Ca2+
-activated K+ channels in smooth muscle cells from basilar artery of
guinea pig. Pflugers Arch. 430: 984-993, 1995
285. Goldstein DS, Holmes C. Neuronal source of plasma dopamine. Clin Chem.
54:1864-71, 2008
286. Watts VJ, Lawler CP, Gonzales AJ, Zhou QY, Civelli O, Nichols DE, Mailman
RB. Spare receptors and intrinsic activity: studies with D1 dopamine receptor
agonists. Synapse.21(2):177-87, 1995
287. Quayle JM, Dart C, Standen NB. The properties and distribution of inward
rectifier potassium currents in pig coronary arterial smooth muscle. J Physiol.
494: 715-726, 1996
180
288. Jackson WF, Blair KL. Characterization and function of Ca2+-activated K+
channels in arteriolar muscle cells. Am J Physiol. 274: H27-34, 1998
289. Rogue P, Malviya AN. Regulation of signalling pathways to the nucleus by
dopaminergic receptors. Cell Signal. 6: 725-733, 1994
290. Schubert R, Nelson MT. Protein kinases: tuners of the BKCa channel in smooth
muscle. Trends Pharmacol Sci. 22: 505-512, 2001
291. White RE, Schonbrunn A, Armstrong DL Somatostatin stimulates Ca(2+)
-
activated K+ channels through protein dephosphorylation. Nature. 352:570-3,
1991
292. Reinhart PH, Chung S, Martin BL, Brautigan DL, Levitan IB. Modulation of
calcium-activated potassium channels from rat brain by protein kinase A and
phosphatase 2A. J Neurosci.11:1627-35, 1991
293. Bringmann A, Faude F, Reichenbach A. Mammalian retinal glial (Müller) cells
express large-conductance Ca(2+)-activated K+ channels that are modulated by
Mg2+
and pH and activated by protein kinase A. Glia. 19:311-23, 1997
294. Lincoln TM, Cornwell TL, Taylor AE. cGMP-dependent protein kinase
mediates the reduction of Ca2+
by cAMP in vascular smooth muscle cells Am J
Physiol.. 258:C399-407, 1990
295. Lincoln TM, Cornwell TL.Towards an understanding of the mechanism of
action of cyclic AMP and cyclic GMP in smooth muscle relaxation. Blood
Vessels. 28:129-37, 1991
181
296. Alioua A, Huggins JP, Rousseau E. PKG-I alpha phosphorylates the alpha-
subunit and upregulates reconstituted GKCa channels from tracheal smooth
muscle. Am J Physiol. 268:L1057-63, 1995
297. Knaus HG, Eberhart A, Kaczorowski GJ, Garcia ML.Covalent attachment of
charybdotoxin to the beta-subunit of the high conductance Ca2+-activated K+
channel. Identification of the site of incorporation and implications for channel
topology. J Biol Chem. 269: 23336-23341, 1994
298. Toro L, Wallner M, Meera P, Tanaka Y. Maxi-KCa, a Unique Member of the
Voltage-Gated K Channel Superfamily. News Physiol Sci. 13: 112-117, 1998
299. Davies SP, Reddy H, Caivano M, Cohen P. Specificity and mechanism of
action of some commonly used protein kinase inhibitors. Biochem J. 351: 95-
105, 2000
300. de Wit RJ, Hekstra D, Jastorff B, Stec WJ, Baraniak J, Van Driel R, Van
Haastert PJ. Inhibitory action of certain cyclophosphate derivatives of cAMP
on cAMP-dependent protein kinases. Eur J Biochem. 142: 255-260, 1984
301. Cornwell TL, Arnold E, Boerth NJ, Lincoln TM. Inhibition of smooth muscle
cell growth by nitric oxide and activation of cAMP-dependent protein kinase by
cGMP. Am J Physiol. 267: C1405-1413, 1994
302. Anderson PG, Boerth NJ, Liu M, McNamara DB, Cornwell TL, Lincoln
TM.Cyclic GMP-dependent protein kinase expression in coronary arterial
smooth muscle in response to balloon catheter injury. Arterioscler Thromb
Vasc Biol. 20: 2192-2197, 2000