Evan R. Glaser,d Eunkyoung Kim,e Pamela F. Lloyd,f Paul T. Charles,a Weiyao Li,g Dagmar Leary,a Jaimee Compton,a
Daniel A. Phillips,b Ali Dhinojwala,g Gregory F. Payne,e Gary J. Voraa
aCenter for Biomolecular Science and Engineering, Naval Research Laboratory, Washington, DC, USAbNational Research Council Postdoctoral Research Associate, Naval Research Laboratory, Washington, DC, USAcOptical Sciences Division, Naval Research Laboratory, Washington, DC, USAdDivision of Electronics Science and Technology, Naval Research Laboratory, Washington, DC, USAeInstitute for Bioscience and Biotechnology Research, University of Maryland, College Park, Maryland, USAfUES, Inc., Wright-Patterson Air Force Base, Ohio, USAgDepartment of Polymer Science, The University of Akron, Akron, Ohio, USA
ABSTRACT Melanin is a pigment produced by organisms throughout all domainsof life. Due to its unique physicochemical properties, biocompatibility, and biostabil-ity, there has been an increasing interest in the use of melanin for broad applica-tions. In the vast majority of studies, melanin has been either chemically synthesizedor isolated from animals, which has restricted its use to small-scale applications. Us-ing bacteria as biocatalysts is a promising and economical alternative for the large-scale production of biomaterials. In this study, we engineered the marine bacteriumVibrio natriegens, one of the fastest-growing organisms, to synthesize melanin by ex-pressing a heterologous tyrosinase gene and demonstrated that melanin productionwas much faster than in previously reported heterologous systems. The melaninof V. natriegens was characterized as a polymer derived from dihydroxyindole-2-carboxylic acid (DHICA) and, similarly to synthetic melanin, exhibited several charac-teristic and useful features. Electron microscopy analysis demonstrated that melaninproduced from V. natriegens formed nanoparticles that were assembled as “melaninghost” structures, and the photoprotective properties of these particles were vali-dated by their protection of cells from UV irradiation. Using a novel electrochemicalreverse engineering method, we observed that melanization conferred redox activityto V. natriegens. Moreover, melanized bacteria were able to quickly adsorb the or-ganic compound trinitrotoluene (TNT). Overall, the genetic tractability, rapid divisiontime, and ease of culture provide a set of attractive properties that compare favor-ably to current E. coli production strains and warrant the further development ofthis chassis as a microbial factory for natural product biosynthesis.
IMPORTANCE Melanins are macromolecules that are ubiquitous in nature and im-part a large variety of biological functions, including structure, coloration, radiationresistance, free radical scavenging, and thermoregulation. Currently, in the majorityof investigations, melanins are either chemically synthesized or extracted from ani-mals, which presents significant challenges for large-scale production. Bacteria havebeen used as biocatalysts to synthesize a variety of biomaterials due to their fastgrowth and amenability to genetic engineering using synthetic biology tools. In thisstudy, we engineered the extremely fast-growing bacterium V. natriegens to synthe-size melanin nanoparticles by expressing a heterologous tyrosinase gene with induc-ible promoters. Characterization of the melanin produced from V. natriegens-
Citation Wang Z, Tschirhart T, Schultzhaus Z,Kelly EE, Chen A, Oh E, Nag O, Glaser ER, Kim E,Lloyd PF, Charles PT, Li W, Leary D, Compton J,Phillips DA, Dhinojwala A, Payne GF, Vora GJ.2020. Melanin produced by the fast-growingmarine bacterium Vibrio natriegens throughheterologous biosynthesis: characterizationand application. Appl Environ Microbiol86:e02749-19. https://doi.org/10.1128/AEM.02749-19.
produced tyrosinase revealed that it exhibited physical and chemical propertiessimilar to those of natural and chemically synthesized melanins, including nanopar-ticle structure, protection against UV damage, and adsorption of toxic compounds.We anticipate that producing and controlling melanin structures at the nanoscale inthis bacterial system with synthetic biology tools will enable the design and rapidproduction of novel biomaterials for multiple applications.
Melanins are macromolecules formed by oxidative polymerization of phenolicand/or indolic compounds. These black or brown pigments are hydrophobic,
negatively charged, and ubiquitous in nature and impart a large variety of biologicalfunctions to organisms, including structure, coloration, free radical scavenging, radia-tion resistance, and thermoregulation (1). Inspired by the physicochemical, optoelec-tronic, self-assembling, and adhesive properties of natural melanin, a number ofresearch groups have synthesized melanin nanoparticles for a broad range of applica-tions, including protective coatings, functional films, environmental sensors, and en-ergy storage devices (2, 3) Currently, however, commercially available melanins areeither chemically synthesized (4) or extracted from sepia (5), and both approachescontain significant challenges for the generation of yields amenable to large-scaleapplications. Since microorganisms are easily cultivated and economically sustainable,they show great potential to produce advanced biomaterials. Many bacteria isolatedfrom nature, including species of Bacillus, Aeromonas, Rhizobium, and Streptomyces,were reported to produce melanin via tyrosinase (monophenol monooxygenase EC1.14.18.1), a copper-containing enzyme (6–11). The enzyme catalyzes the oxidation ofL-tyrosine to o-dihydroxyphenylalanine (DOPA) and dopaquinone, which undergoescyclization to 5,6-dihydroxyindole (DHI) or 5,6-dihydroxyindole-2-carboxylic acid(DHICA) and further polymerizes spontaneously into melanin (see Fig. S1 in thesupplemental material) (12). With recombinant DNA technology, the tyrosinase genehas previously been cloned and heterologously expressed in Escherichia coli, and theresulting melanin was tested in a variety of applications (13, 14).
The broad application of biomaterials like melanin on a large scale requires highproductivity. However, yields of melanin production from various bacteria are deter-mined by the quantities of substrates (L-tyrosine or L-DOPA) that are fed into the growthcultures and routed toward processing by tyrosinase, so improving melanin productionefficiency has been achieved by natural selection of active enzymes or growth optimi-zation (15, 16). Two of the most critical physiological features that impact a microbialproduction system are the growth rate and biomass-specific substrate uptake rate (17).Therefore, faster-growing organisms provide clear advantages over slower-growingorganisms in industrial production. E. coli is often the gold-standard organism forgenetic and metabolic engineering efforts, but it exhibits a �40-min doubling time inglucose minimal medium (17). Alternatively, the Gram-negative marine bacteriumVibrio natriegens is recognized as one of the fastest-growing organisms currentlyknown, with a reported doubling time of less than 10 min in rich medium and of lessthan 25 min in glucose minimal medium (18–21). With nutritional versatility, a highgrowth rate, and lack of pathogenicity, V. natriegens has become an attractive alterna-tive to E. coli for biotechnological applications (22, 23). Additionally, a number ofgenetic tools have been developed to engineer V. natriegens (20, 21, 24) which makeit an attractive chassis for synthetic biology, metabolic engineering, and biomaterialproduction.
In this study, we engineered V. natriegens to synthesize melanin by expressing atyrosinase gene from Bacillus megaterium under the control of inducible promoters anddemonstrated that V. natriegens was able to produce melanin faster than were previ-ously reported heterologous systems. We found that the melanin produced from V.natriegens-produced tyrosinase could be found in cell-free supernatants as nanopar-
Wang et al. Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 2
ticles as well as associated with the cell wall, and it exhibited physical and chemicalcharacteristics similar to those of natural and chemically synthesized melanins. Thisstudy demonstrated that V. natriegens could be used as a biocatalyst for fast productionof a biopolymer.
RESULTSExpression of the tyrosinase gene and melanin production in V. natriegens. The
tyrosinase gene tyr1 from B. megaterium (25) was synthesized and placed under thecontrol of the Ptac promoter and the lacIq repressor in vector pJV298 (26) usingthe method described by Tschirhart et al. (20) (Fig. S2). This plasmid was electroporatedinto V. natriegens, and after overnight incubation at 30°C, transformants (pJV-Tyr1) withblack and diffusible pigments were observed on M9 agar plates supplemented withisopropyl-�-D-1-thiogalactopyranoside (IPTG) and L-tyrosine (data not shown). To verifythe pigment identity, both pigmented and nonpigmented cells were incubated withanti-melanin antibodies. Fluorescence microscopy showed that immunofluorescencesignals were localized on the black cells only (Fig. S3). This result confirmed that thepigments formed were melanins that were associated with the V. natriegens cells.
To measure tyrosinase expression and the efficacy of this construct, the recombinantstrain was grown for 2 h to log phase and induced by IPTG in LBv2 liquid medium for3 h. Cells were then collected for proteomic analysis. As accessed by shotgun proteom-ics, tyrosinase expression increased approximately 100-fold by induction in four bio-logical replicates (Table 1), indicating that the Ptac promoter was efficiently regulatedin V. natriegens. Induced cells were then resuspended in LBv2 and M9 liquid media withadded L-tyrosine (0.4 mg/ml) and CuSO4, respectively. Within 15 minutes, a blackpigment was observed in the M9 culture (Fig. 1A), and melanin yield reached themaximal level (�0.45 mg/ml) within 2 h, with a rate of approximately 0.32 mg/ml perhour (Fig. 1B), which was equivalent to 420 mg melanin (mel)/g cell dry weight [CDW]/hand significantly faster than any other melanin-producing microorganism (Table 2).Theoretically, 1 g of L-tyrosine is expected to make 1.15 g of melanin by incorporatingone atom of oxygen to the L-tyrosine molecule resulting from the tyrosine hydroxylaseactivity of tyrosinase (14). The melanin yield from this study suggested that L-tyrosinewas almost completely converted into melanin by the recombinant bacteria. However,it was noted that the melanin production rate was significantly lower in the LBv2culture, with a rate of �0.05 mg/ml per hour (equivalent to 66 mg mel/gCDW/h), andmelanin was saturated after 8 h with less yield than in M9 culture (Fig. 2B). We alsofound that some tyrosinase was released from the cells, as some tyrosinase activitycould be detected in the supernatant of induced cells in M9 culture that had beenfiltered prior to the addition of L-tyrosine (Fig. 1A), indicating that shifting bacterial cellsinto the minimal medium resulted in the release of the expressed tyrosinase into themedium, perhaps from increased permeability or cell lysis, so as to accelerate accessingthe substrates. To determine the effect of L-tyrosine quantity on melanin yields, M9cultures containing IPTG-induced cells were supplemented with a range of L-tyrosineconcentrations, from 0.1 mg/ml to 1 mg/ml. Figure 1C shows that the melanin produc-tion rates were very similar and that concentrations of synthesized melanin werecorrelated with concentrations of L-tyrosine under 0.6 mg/ml. Starting with anL-tyrosine concentration over 0.6 mg/ml resulted in concentrations of melanin thatwere above the detection limit of the assay due to product aggregation, which wasreflected by fluctuation in the measurements at the later stage.
TABLE 1 Proteomic quantification of expressed tyrosinase from four independentV. natriegens/pJV-Tyr1 cultures induced by IPTG
Protein
Avg area ratio induced/uninduced for culture:
VN1 VN2 VN3 VN4
Tyrosinase 350 70 90 480DnaK 2 4 4 2
Melanin Production in Vibrio natriegens Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 3
FIG 1 Expression of tyrosinase gene and melanin production in V. natriegens through IPTG induction. (A)Left, melanin production in M9 medium supplemented with 40 �g/ml CuSO4 and 0.4 mg/ml L-tyrosineafter tyrosinase was induced in rich medium; right, melanin production from the filtered supernatantsupplemented with CuSO4 and L-tyrosine after the induced cells were incubated in M9 medium for15 min. (B) Kinetics of melanin production in M9 (●) and LBv2 (�) media supplemented with 40 �g/mlCuSO4 and 0.4 mg/ml L-tyrosine after tyrosinase was induced in rich medium. (C) Effect of L-tyrosineconcentration (in milligrams per milliliter) on melanin production in M9 medium. Graphs in panels B andC represent the averages of the results from five independent experiments. (D) Syntheses of melaninvariants with tripeptide precursors. IPTG-induced V. natriegens/pJV-Tyr1 cells were transferred into M9medium supplemented with CuSO4 and 5 mM tripeptides and incubated at 37°C for 1 h.
Wang et al. Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 4
Tyrosinase has been demonstrated to catalyze a variety of substrates, includingshort peptides containing L-tyrosine, for the synthesis of melanin-like polymeric pig-ments with diverse physicochemical properties in vitro (27). To determine the ability ofV. natriegens-produced tyrosinase to catalyze the formation of melanin from multiplesubstrates, we added four tripeptides (DFY, FDY, DYF, and YFD) to tyrosinase-producingcultures of V. natriegens at 5 mM. Orange pigments with a variety of color intensitieswere observed in cell cultures after 2 h (Fig. 1D). In agreement with the in vitroexperiment (28), tripeptides that contain paired aromatics (DFY, DYF, and YFD) gave riseto a relatively darker orange color than that of the tripeptide that has the pair separatedby a charged aspartic acid. This result indicates that the paired aromatics in tripeptidesnot only tend to aggregate during the self-assembly process but also enhance thepolymerization of oxidized peptides. It also suggests that tyrosinase-expressing V.natriegens can be used to produce functionalized melanin-like biopolymers with tun-able properties by using various L-tyrosine-containing short peptides as the substrates.
Induction of melanin production with optogenetics. In an industrial setting, itmay be desirable to have temporal control over the production of certain molecules ina chassis organism. Nonchemical induction using optogenetics offers many excitingopportunities and applications for controlling cell responses in programmable waysand is becoming a valuable part of synthetic biology circuits. Therefore, we also tested
TABLE 2 Comparison of melanin production levels in different microbial hosts
Host Gene Tm (oC)a
Productiontime (h)b
Reference orsource
Bacillus weihenstephanensis Laccasec 30 120 50Streptomyces kathirae Tyrosinasec 28 128 15Streptomyces glaucescens Tyrosinasec 30, 37 �48 9E. coli MelAd 30 30 14E. coli Tyr1d 30 33 13V. natriegens Tyr1d 30, 37 �10 This studyaTm, growth temperature.bProduction time is counted as from the start of bacterial growth to the beginning of melanin saturationperiod.
cEndogenous gene.dHeterologously expressed gene.
FIG 2 Induction of tyrosinase gene expression and melanin production in V. natriegens in an optogeneticsystem. (A) pDawn plasmid for light-activated gene expression in V. natriegens. YF1/FixJ drives geneexpression from the pfixK2 promoter and is repressed by blue light. Insertion of the � phage repressorcI and the � promoter pR makes expression of the tyrosinase gene light activated. (B) Melanin productionin the light plate array. The engineered bacterial cells were incubated in each well for 48 h. Left, duplicatewells with light off; right, duplicate wells with light on. RBS, ribosome-binding site.
Melanin Production in Vibrio natriegens Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 5
induction of tyrosinase in V. natriegens using the light-driven pDawn system (Fig. 2A)(29). In the absence of blue light, the histidine kinase YF1, which contains a photosen-sory domain, phosphorylates its cognate response regulator FixJ and drives robustgene expression of � repressor cI from the FixK2 promoter. The cI repressor preventstyrosinase expression. Upon light exposure, a significant reduction in kinase activity ofYF1 and, consequently, cI expression results in derepression of the pR promoter andtyrosinase expression, which then catalyzes melanin production in the presence ofL-tyrosine. To control light input, we built the 48-well-plate-fitted light plate array (LPA)designed by the Tabor lab (30) to test our constructs. As can be seen in Fig. 2B, withthe tested parameters, we saw melanin production in V. natriegens upon induction withlight and no melanin where no light was applied. This proof-of-concept experimentdemonstrated induction of a bioproduct through optogenetics in V. natriegens.
Bacterial melanin nanoparticles and “melanin ghosts.” Due to their high bio-compatibility, melanin nanoparticles have been investigated in many biomedical andmaterial applications and been made from chemical or enzymatic oxidation of theprecursors L-DOPA or dopamine (27). In order to determine whether the recombinantbacterium was able to make melanin nanoparticles, the black supernatant separatedfrom the V. natriegens culture 30 min after melanization and was subjected to trans-mission electron microscopy (TEM) and dynamic light scattering (DLS) analyses. TEMrevealed uniform black particles of less than 20 nm, and DLS measurements showed adominant cluster with particle sizes around 20 nm as well (Fig. 3A). However, theseparticles were not observed in the supernatant from the nonmelanized cell cultures. Inthe nonmelanized sample, two large peaks with small percentages of particle numberswere observed, and they might be attributed to by-products of cell culture extracts.Moreover, the sizes of melanin nanoparticles in the supernatant 12 h after melanizationwere around 70 nm (Fig. 3A), suggesting that longer incubation times increased the sizeof the nanoparticles. The addition of an extra 100 mM NaCl to the M9 medium resultedin larger particles (larger than 100 nm; Fig. 3A) and spontaneous precipitation ofmelanin aggregates, indicating that the sizes of melanin particles were also affected bysalt concentration.
Melanin synthesized from other microbes such as fungi is typically located withinthe cell wall and plays a significant role in maintaining cell wall integrity (31). Melaninstructures associated with the fungal cell walls, so-called “melanin ghosts,” are gener-ated by exposure of melanized cells to 4 M guanidinium isothiocyanate followed by 6M HCl at 100°C. This protocol was applied to treat melanized and nonmelanized V.natriegens cells. Under the same chemical treatment conditions, the nonmelanizedbacterial cells were completely solubilized, but the melanized cells remained as blackparticulate materials. Scanning electron microscopy (SEM) images showed that theseblack particles exhibited morphologies similar to those of bacterial cells (Fig. 3B). It wasalso noted that there were nanosized granules on the surface, which might be melaninaggregates resulting from acid precipitation. In contrast to fungal melanin ghosts thathad melanin walls without internal structures, TEM revealed that the bacterial blackparticles were filled with irregular electron-dense structures with no defined organellesor cell wall layers (Fig. 3B). This result showed that melanin ghost-like structures couldbe generated from bacteria as well even after other cellular components were depletedby acid hydrolysis.
Chemical characterization of melanin produced from V. natriegens. To verify thechemical composition of melanin produced from V. natriegens, black powder wasextracted from the supernatant of melanized bacteria and analyzed with Fouriertransform infrared (FTIR) spectroscopy. A comparison of the bacterium-producingmelanin and synthetic melanin revealed significant similarities between IR spectra (Fig.4A) representing equivalent functional groups, such as the hydrogen bond of an -OHgroup, an alkyl -CH2 group, and an aromatic ring including a C�C group. Notably, apeak at 1,722 cm�1 suggested a C�O carbonyl group vibration, indicating the carbox-ylic acid from dihydroxyindole-2-carboxylic acid (DHICA).
Wang et al. Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 6
Stable free radicals are characteristic of melanin and have a unique electron para-magnetic resonance (EPR) signal. To examine this signal in bacterial synthesizedmelanin, equal amounts of extracted melanin powders, melanized bacterial cells,bacterial melanin ghosts, and nonmelanized cells were examined using EPR (Fig. 4B).
FIG 3 Extracellular melanin particles and bacterial melanin ghosts. (A) a, TEM image of melanin nanoparticlesin the supernatant of V. natriegens cell culture after L-tyrosine addition in the bacterial culture at 30 min. b,hydrodynamic sizes of melanin nanoparticles measured by DLS. Melanin nanoparticles were formed after theaddition of L-tyrosine in the presence of 250 mM NaCl. The measured average sizes were 16 � 0.6 nm withL-tyrosine addition (similar to melanin nanoparticle measurement by TEM) and 97 � 39 nm for the controlwithout L-tyrosine addition that were attributed to the by-products of cell culture extract. c, melaninnanoparticles formed after L-tyrosine addition at 12 h with different concentrations of salt. The peaks showedat 35 � 3.4 nm (250 mM NaCl, blue), 73 � 5.3 nm (350 mM NaCl, orange), and 86 � 9.6 nm (550 mM NaCl,gray). (B) SEM and TEM images of melanin ghosts and melanized bacterial cells.
Melanin Production in Vibrio natriegens Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 7
FIG 4 Characterization of melanin produced from V. natriegens. (A) FTIR spectra of bacterial (Bac) melaninand synthetic (Syn) melanin. Peaks in common and their assignments are 1,625 cm�1, C�C vibration in
(Continued on next page)
Wang et al. Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 8
The first three samples exhibited distinct, stable free radical signals with Zeemansplitting g-values of 2.004 that are highly similar to synthetic eumelanin, fungal1,8-dihydroxynaphthalene (DHN)-melanin, and bacterial pyomelanin (22). It was notedthat melanin ghosts had the relatively highest signal intensity, and extracted melaninpowders had the weakest signals. As expected, nonmelanized cells did not show an EPRsignal. Illumination of melanin ghosts and melanized bacteria with UV-visible light froma xenon (Xe) lamp for 30 min increased the EPR signals (Fig. 4C).
Redox activity of melanized bacteria. We employed an electrochemical reverseengineering method (40) to characterize the redox activity of melanized V. natriegenscells. Figure 5A shows the schematic of the electrochemical reverse engineeringmethod. Here, the melanized V. natriegens cells were immobilized at an electrodesurface by codepositing it within a permeable alginate hydrogel film. The film-entrapped cells were probed for redox activity by immersing the film-coated electrodeinto a solution containing two diffusible mediators that can freely diffuse through thematrix and access the electrode. When the underlying electrode is cycled to oxidative(more positive) voltages, one mediator (50 �M ferrocene dimethanol [Fc]) can undergooxidative redox cycling, in which Fc donates an electron to the electrode, the oxidizedform (Fc�) diffuses into the film and accepts an electron from melanin, and thisrereduced Fc mediator can then diffuse back to the electrode where it can bereoxidized by donating the electron to the electrode. This oxidative redox cyclingserves to extract electrons from the melanin. The other mediator [50 �M Ru(NH3)6Cl3[Ru3�]) can undergo reductive redox cycling when the electrode potential is cycled toa reducing (more negative) voltage, in which Ru3� accepts an electron from theelectrode; the reduced form, Ru2�, diffuses into the film and donates its electron tomelanin; and the reoxidized Ru3� form diffuses back to the electrode where it can berereduced. This reductive redox cycling serves to transfer electrons from the electrodeto the melanin.
To control these redox cycling processes, an oscillating input voltage is imposed tothe electrode (Fig. 5B). As the redox cycling processes occurs, the output currentsassociated with mediator oxidation/reduction reactions are measured. Two negativecontrols including the alginate-only film and the alginate film with nonmelanized V.natriegens showed small output peak currents. However, the melanized V. natriegens-alginate film-coated electrode showed large peak currents for both Ru3� reduction andFc oxidation (Fig. 5B). The high amplification of the redox currents provides evidencethat the melanin produced by V. natriegens confers redox activity. To test the revers-ibility of this redox activity, the imposed input potential was repeatedly cycled over150 min, as shown in Fig. 5C. The output current curve shows that when the melanizedV. natriegens cells were embedded in the film, the mediator currents were amplifiedduring both oxidation and reduction. Importantly, this amplification remained nearlysteady over 2 h. This result indicates that the melanin produced by V. natriegens can bereversibly oxidized and reduced, and thus, the melanin can be repeatedly switchedbetween redox states.
UV protection. Melanin has been demonstrated to have a role in protecting againstoxidative stresses such as UV irradiation (33). When washed melanized and non-melanized V. natriegens cells suspended in phosphate-buffered saline (PBS) wereirradiated with UVC, both types of cells were killed completely, indicating that themelanin in the cell walls was not sufficient to protect the cells. However, we did observethe protective property of melanin when melanized cell culture in the growth mediumsupplemented with L-tyrosine was exposed to UVC. UV at 450 mJ/cm2 completely killed
FIG 4 Legend (Continued)aromatic (indole) ring; 1,722 cm�1, C�O carbonyl group vibration from carboxylic acid in DHICA; triplepeaks at �2,900 cm�1, CH2 alkyl vibration; and broad peak centered at 3,415 cm�1, O-H hydroxylvibration. a.u., arbitrary units. (B) EPR spectra of melanin (Mel) powders, dried melanized and non-melanized V. natriegens (Vnat) cells, and melanin ghosts. (C) EPR changes of melanin ghosts and driedmelanized cells responding to illumination. arb., arbitrary.
Melanin Production in Vibrio natriegens Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 9
bacterial cells in the nonmelanized culture (without adding L-tyrosine), but the cells inthe melanized culture survived (Fig. 6A). Furthermore, supernatants filtered from thenonmelanized and melanized cell cultures were added into HeLa cell cultures, whichwere then irradiated with 4 mJ/cm2 UVC. Figure 6B shows that more than 90% of HeLacells mixed with the melanized supernatant were still alive after UVC irradiation, but
FIG 5 Redox activity of melanized V. natriegens (V.nat) revealed by reverse electrical engineering method.(A) Schematic shows that melanin can donate/accept electrons to/from mediators by oxidative/reductiveredox cycling process (details are described in the supplemental material). (B) The imposed inputpotential (i.e., voltage) and observed output current response associated with Ru3� and Fc mediators. (C)Long-term cyclic experiments test for the reversibility of redox-activity; steady amplifications are signa-tures of reversible and repeated oxidation and reduction of melanin. E(V), potential in volts.
Wang et al. Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 10
less than 20% of cells mixed with the nonmelanized supernatant survived under thesame conditions. Therefore, the extracellular melanin nanoparticles produced herehave the ability to protect mammalian cells from UVC irradiation.
TNT adsorption. Melanin also exhibits promiscuous binding capabilities as a resultof its complex polymeric structure. This situates melanin-producing bacteria as candi-dates for bioremediation applications. We therefore explored the ability of melanin-
FIG 6 Photoprotective properties of biosynthesized melanin. (A) Survival of the nonmelanized andmelanized V. natriegens cell cultures irradiated with 450 mJ/cm2 UVC. (B) Survival of HeLa cells suspendedin the supernatants of the nonmelanized (�Mel) and the melanized (�Mel) V. natriegens and irradiatedwith 4 mJ/cm2 UVC. The control includes HeLa cells only without irradiation. Live/dead staining is shownas green for live cells and red for dead cells.
Melanin Production in Vibrio natriegens Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 11
producing V. natriegens to bind and sequester the common environmental contami-nant 2,4,6-trinitrotoluene (TNT), an explosive material. We added melanin-producing V.natriegens to a solution of TNT with a final concentration of 125 ppb in PBS andobserved that melanized cells could bind and remove most of the compound fromsolution. This process was time dependent, with only �25% of TNT removed after a5-min incubation but nearly 100% removed after a 30-min incubation (Fig. 7A). Addi-tionally, the binding of TNT was pH dependent, with the efficiency of TNT removal fromsolution going from nearly 100% at pH 6, to 80% at pH 5, and to only 10% at pH 4 andpH 3 (Fig. 7B).
DISCUSSION
Melanin production by tyrosinase has been described in several bacterial species (9,25, 34–37). Due to their unique physiochemical properties and potential industrialapplications, it is desirable to produce melanins at large scale and low cost. Heterolo-gous expression of tyrosinase genes in E. coli has been reported to produce melaninswhen growth media are supplemented with L-tyrosine, but melanin synthesis was slow,and melanins were fully produced only after at least 30 h (Table 2). We previouslydemonstrated that genetic modules adopted from E. coli functioned similarly in V.natriegens (20). The successful regulation of tyrosinase gene expression and melaninproduction through engineering inducible promoters in V. natriegens supports that thisfast-growing marine bacterium represents a new synthetic biology chassis able to hosta broad range of the genetic circuits and modulate diverse biomaterial manufactures.The proteomics analysis also validated that the expression of tyrosinase was steadilyregulated by the Ptac promoter in V. natriegens. With a growth rate that is two times
FIG 7 (A and B) Time-dependent (A) and pH-dependent (B) adsorption of TNT by �5 108 non-melanized (light gray) and melanized (dark gray) V. natriegens cells.
Wang et al. Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 12
higher than that of E. coli, V. natriegens has a clear advantage as a biomanufacturinghost by significantly reducing fermentation time, which will result in an economicalbenefit for large-scale melanin production. It was noted that, with the substrateconcentrations below 0.6 mg/ml, melanin production accumulated to a maximal leveland then became steady probably due to complete consumption of L-tyrosine. How-ever, adding the substrate L-tyrosine at a concentration of or higher than 0.6 mg/mlresulted in melanin aggregation in the media due to solubility limitations at higherconcentrations of these final products (Fig. 1C). We also demonstrated induction of thisbiopigment through optogenetics in V. natriegens. This exciting avenue not onlyillustrates that this fast-growing bacterium is an excellent chassis to host syntheticbiology circuits but also revealed its great potential to make novel sensing andprotective biomaterials in response to easily manipulated external signals. Since opto-genetic systems that respond to UV light are available (30), they could be used totrigger melanin production to protect the cells from further UV damage or createpatterns based on UV exposure.
Previously, V. natriegens was demonstrated to speed up selenium nanoparticleproduction by its own reducing capability (38). Our study suggested that V. natriegenscould be used as a fast biocatalyst for biopolymer production. In this study, thetyrosinase was not tagged with the adhesin involved in diffuse adherence (AIDA)autotransporter vehicle for surface expression like in the previous investigation in E. coli(13), but melanins were not only found to be distributed in the cytoplasm and the cellsurface by electronic microscopy but also largely produced in the cell cultures asnanoparticles (Fig. 3). Moreover, V. natriegens might be more susceptible to changes inpH and osmolarity than is E. coli, which can result in increased cell permeability or celllysis, especially where V. natriegens is transferred from rich medium to minimal medium(Fig. 1A). This susceptibility resulted in the release of tyrosinase into growth media thataccelerated melanin production and could potentially result in lower downstream costdue to the reduced energy or time required to break open cells for protein harvest.
The formation of melanin nanoparticles has been well described in chemical reac-tions (39) and usually takes more than 12 h. In this study, we demonstrated thatbacteria were able to produce melanin nanoparticles (MNPs) in as little as 30 min in cellculture (Fig. 4A). Correlations of particle sizes to incubation time and salt concentrationsin the media (Fig. 3A) indicated that the sizes of bacteria producing MNPs could betuned by controlling growth conditions. Melanin ghosts have been hallmarks for thestudy of melanin in fungi and are very stable after harsh hydrolysis treatment. Inter-estingly, we demonstrated that melanin ghosts could be formed in melanized bacteriaas well, but melanin not only aggregated on the cell surface but also in the internalstructure of ghosts (Fig. 4B), which was different from the fungal melanin ghosts thatmelanin assembled in the fungal cell walls. Heterogeneity due to cellular componentsand spherical morphologies, therefore, appears to provide melanin ghosts with novelproperties not exhibited by pure melanins.
Both EPR and electrochemical analyses demonstrated that the melanized V. natrie-gens cells possess stable free radical scavenger and active redox properties. Theseproperties will render additional and broader biological functions to this fast-growingbacterium. Along with mechanical resistance, the melanized bacteria may be a syn-thetic biology chassis well suited for functioning in extreme environments. Like fungalDHN-melanin and sepia melanin (40), the melanized bacteria in this study could berepeatedly engaged in redox-cycling reactions that yielded amplified output currents,which indicated that melanin can be reversely and stably switched between oxidizedand reduced redox states. This property will allow bacterial cells to exchange electronswith diffusible redox-active species in the cellular environment and sense biological orenvironmental redox signals. Moreover, it has been reported that the biological mel-anin may perform energy-harvesting activities (41, 42) using an unknown mechanism.Thus, the melanized bacteria potentially can be developed as living materials topreserve charge storage capacity and power transient electrical devices.
To test the photoprotective property of bacterial melanin, we irradiated bacterial
Melanin Production in Vibrio natriegens Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 13
cells with short-wavelength UVC, which is the most damaging type of UV radiation. UVCis absorbed by DNA and results in the formation of pyrimidine adducts and strandbreaks (43). Initially, we irradiated the PBS-washed melanized bacterial cells with UVCand did not see improved UV resistance compared with that with the nonmelanizedcells. This finding suggested that the melanin granules deposited in the cell wall andcytoplasm were not sufficient to absorb UV radiation. When melanized cell cultureswere irradiated with UVC, cells grown in the melanin-containing medium showedsignificantly higher resistance (Fig. 6A). This result was similar to findings from ourprevious report that pyomelanin-containing supernatant from Vibrio campbellii ΔhmgAculture demonstrated protective property against oxidative stress (44). Melanin isknown to scavenge reactive oxygen species (ROS) generated by UV in solution, and itsscavenging capability is proportional to its concentration (32). Therefore, our resultindicated that the larger volume of melanin particles in the cell medium greatlyimproved melanin’s ability to attenuate UVC penetrating into cells and scavenge ROSgenerated from irradiation in the aqueous environment. The photoprotective propertyof MNPs was further confirmed by applying the filtered supernatant to HeLa cells (Fig.6B). Therefore, large-scale production of MNPs from V. natriegens may have potential tomake cost-effective photoprotection materials.
Melanin has been known for its affinity to adsorb various chemicals and drugs,including harmful substances, which results in protection of pigmented cells andtissues (45). Gustavsson et al. (13) successfully demonstrated that E. coli cells coatedwith melanin were able to adsorb up to 80% of the antimalarial drug chloroquine atconcentrations typical for pharmaceutical pollution in wastewater. Here, we showedthat the melanized marine bacterium was able to robustly sequester the explosivecompound TNT from an aqueous solution. The discharge of explosive compounds suchas TNT from explosive manufacturing and ammunition loading plants to wastewaterhas been of increasing concern. Currently, TNT-contaminated water is treated withgranular activated carbon (GAC) adsorption (46). However, the regeneration of GACmay be an issue when a large amount of TNT is adsorbed. Our study demonstratesthat melanin-producing V. natriegens is able to provide dynamic and economic TNT-adsorbing materials that may be regenerated through changes in pH.
In summary, we successfully engineered a V. natriegens strain to rapidly andeconomically produce melanin from tyrosinase, and analyses revealed that this melaninexhibited physical and chemical properties similar to those of natural and chemicallysynthesized melanins. We anticipate that producing and controlling melanin structuresat the nanoscale in this fast-growing bacterial system with synthetic biology tools willlead to the generation of novel biomaterials for multiple applications, including pro-tection of chemical and radiation threats, therapeutics, electronics, sensing, and biore-mediation that could benefit both military and civilian populations.
MATERIALS AND METHODSStrains and growth conditions. V. natriegens strain ATCC 14048 was grown in LBv2 (Luria broth
[Miller] supplemented with 204 mM NaCl, 4.2 mM KCl, and 23.14 mM MgCl2) or M9 medium (11.28 g M9minimal salts 5, 4 g glucose, 15 g NaCl, 0.5 g MgSO4, 10 mg CaCl2, and 40 mg CuSO4 per liter), unlessotherwise stated. Tripeptides were purchased from Peptide 2.0, Inc. (Chantilly, VA). HeLa ATCC CCL-2 cells(ATCC, Manassas, VA) were cultured in Dulbecco’s modified Eagle medium (DMEM; Thermo FisherScientific, IL).
Construction of melanin-producing V. natriegens. The tyrosinase gene from Bacillus megateriumTyr1 was synthesized by Eurofins Genomics (Louisville, KY), similar to a previous study (13). ThePCR-amplified tyr1 sequence was cloned into the plasmid pJV298 under the control of the induciblepromoter Ptac (26), replacing the green fluorescent protein (GFP) gene with the Gibson Assembly masterkit (New England BioLabs, Ipswich, MA) with four primers, as follows: tyr1-1, ATGTATATCTCCTTAAGCTTACG; tyr-2, TGAGGATCCGGTGATTGATTG; vect-1, GCTTAAGGAGATATACATATGGTAACAAGTATAGAGTTAGAAAAAAC; and vect-2, AATCACCGGATCCTCATGAGGAACGTTTTGATTTTC). The pDawn-tyr1 plasmid wasconstructed as follows: pDawn (29) was cut with NdeI and BamHI and incubated with alkaline phospha-tase and calf intestinal (CIP; New England BioLabs). The tyr1 gene was amplified using the primers tyr-F(cggagctcgaattcgTCATGAGGAACGTTTTGATTTTC) and tyr-R (ccgcgcggcagccaATGGGTAACAAGTATAGAGTTAG) (lowercase letters complement the vector sequence, and uppercase letters complement the tyr1sequence), and a Gibson Assembly reaction was set up to insert the PCR product into the digested
Wang et al. Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 14
pDawn vector using the Gibson Assembly Master kit (New England BioLabs). Plasmid maps are shown inFig. S2.
Melanin production. V. natriegens/pJV-Tyr1 from a glycerol stock was inoculated into 3 ml LBv2liquid medium supplemented with 6 �g/ml chloramphenicol (LBv2-Cm) and grown at 30°C overnight. A0.5-ml aliquot of the overnight culture was transferred into 50 ml LBv2-Cm medium and incubated at200 rpm at 37°C for 2 h. Tyrosinase production was induced by the addition of 200 �M isopropyl-�-D-1-thiogalactopyranoside (IPTG) for three more hours. Cells were pelleted from the culture via centrifu-gation, washed with M9 minimal medium once, and resuspended in 50 ml M9 medium supplementedwith 50 �g/ml CuSO4 and 0.4 mg/ml L-tyrosine (nonmelanized bacterial cells were prepared by omittingL-tyrosine in the same medium). The melanized bacterial cells were harvested by centrifugation, and theblack supernatant that contained melanin nanoparticles was passed through a Millipore 0.2-�m poly-ethersulfone membrane to remove cell debris. Melanin was precipitated from the supernatant by addinga 1/10 volume of 6 N HCl, washed with deionizing water until neutral pH, and lyophilized into blackpowder. Bacterial growth curves were measured at an optical density at 600 nm (OD600) using aBioscreen C analyzer (Growth Curves USA, Piscataway, NJ). Pigment intensities from melanized bacterialcultures (adding L-tyrosine in the medium) were measured at an OD492 by subtracting readings fromnonmelanized bacterial cultures (omitting L-tyrosine in the same medium) using the same instrument.OD492 values were converted to melanin yields using the standard curve made from the melanin powderprecipitated from the supernatant. The rate of melanin production was calculated as the quantity ofmelanin produced and divided by the estimated cell dry weight in 1 ml of culture within a 1-h periodbefore melanin saturation (14). The immunofluorescent analysis method for the melanized cells isdescribed in the supplemental material.
Optogenetic induction using the light plate apparatus. The light plate apparatus (LPA) foroptogenetic induction was constructed based on the paper by Gerhardt et al. (30). Overnight cultures ofV. natriegens were inoculated into a 24-well plate with 1 ml LBv2 plus 200 �g/ml kanamycin, 0.4 mg/mlL-tyrosine, and 10 �g/ml CuSO4 and 2 to 3% cell culture per well. The plate was covered with a BreathEasymembrane and assembled into the LPA. The LPA was loaded with a program in Iris from the Tabor lab(http://taborlab.github.io/Iris/). The program was set up with the following parameters: light intensitiesalways on for each column in the plate, with three of 0 and three of 2,000. The LPA was incubated at 37°Cin a foil-covered incubator for �48 h at 250 rpm to allow for tyrosinase production and the conversionof L-tyrosine to melanin.
Proteomic quantification of the expressed tyrosinase. IPTG-induced and -uninduced V.natriegens/pJV-Tyr1 cultures were normalized to the same cell numbers after counting with the flowcytometry. Cell pellets were reconstituted in 100 �l of 10% n-propanol in 50 mM ammonium bicarbonate(NPABC). Thirty microliters of the cell suspension was lysed, digested with trypsin in a Barocycler(Pressure BioSciences, Inc.), dried in the speed vacuum, and further suspended in 90 �l of 0.1% formicacid. Three microliters of this suspension was injected into the liquid chromatography-tandem massspectrometry (LC-MS/MS) system for analysis (Thermo U3000 nano-LC coupled to a Thermo OrbitrapFusion Lumos mass spectrometer). The acquired data were converted into mgf files and searched withMascot against a Vibrio natriegens database, custom database containing the tyrosinase sequence, andcommon contaminant database. Selected peptides assigned to the tyrosinase protein and DnaK werethen manually extracted from the raw data, and the chromatographic peak area was calculated. Arearatios between induced and uninduced samples are reported in Table 1. The DnaK protein was used asa representative of endogenous protein not controlled by the inducer.
Generation and characterization of melanin ghosts. The protocol for making bacterial melaninghosts was modified from a method previously developed in fungi (31). Melanized bacteria wereincubated with 4 M guanidinium thiocyanate at room temperature (RT) for 10 min. Cells were washedwith deionized water once and hydrolyzed by boiling in 6 M HCl for 20 min. The resulting black particles(melanin ghosts) were washed with deionized water multiple times until a pH of 6 was obtained. Imagingof the melanin ghosts and melanized V. natriegens cells was conducted using a Philips CM200 TEM anda FEI Quanta 600 SEM, respectively.
Sample preparation for imaging. Bacterial cells or melanin ghosts were prefixed with 2.5%glutaraldehyde, 100 mM HEPES buffer, 50 mM L-lysine, and 7.5% ruthenium red for 30 min, fixed with thesame solution minus L-lysine for 2 h, and postfixed with a 4% osmium tetroxide (OsO4) solution for 2 h.Each sample was dehydrated in increasing amounts of acetone (25%, 50%, 70%, 95%, and 100%) for30 min at each step. TEM samples were trimmed and ultramicrotomed using an RMC Ultracut microtomewith a 35° DiaTome diamond knife. Sections were cut at a thickness of 70 nm and picked up onto400-mesh Cu grids. Once the grids were dried, they were stained with UranyLess stain.
Measurement of melanin nanoparticles. Dynamic light scattering (DLS) measurements werecarried out using a ZetaSizer Nano series instrument equipped with a HeNe laser source (� � 633 nm)(Malvern Instruments Ltd., Worcestershire, UK) and analyzed using dispersion technology software (DTS)(Malvern Instruments Ltd.). Structural characterization of melanin nanoparticles was carried out using aJEM-2100 TEM. Samples for TEM were prepared by spreading a drop (5 to �10 �l) of melanin nanopar-ticles onto ultrathin carbon/holey support film on a 300-mesh Au grid (Ted Pella, Inc.) and letting it dry.Individual particle sizes were measured using a Gatan digital micrograph (Pleasanton, CA); average sizesalong with standard deviations were extracted from an analysis of �100 nanoparticles.
Fourier transform infrared spectroscopy. One milligram of melanin powder was ground with160 mg anhydrous potassium bromide (KBr; FTIR grade, �99% trace metals basis; Sigma-Aldrich) andcompressed into a semitransparent pellet using a hydraulic press (Omega CN9000). The transmission FTIRmeasurements (iS50 FTIR; Nicolet) were taken with an air background.
Melanin Production in Vibrio natriegens Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 15
Electron paramagnetic resonance. Melanin powder, melanin ghosts, and dried, melanized bacteriawere characterized by EPR at 300 K in a Bruker 9.5-GHz spectrometer. Typical microwave powers of 5 to20 mW with 1-G modulation amplitude and 100 kHz field modulation were employed for theseexperiments. EPR spectra were also obtained for the melanin samples after illumination with a xenon (Xe)lamp (75 W, 350 to 1,000 nm wavelength) for 30 min at RT.
Electrochemical measurements. Melanized and nonmelanized V. natriegens cells were probed forredox activity by first immobilizing them within a Ca2�-alginate hydrogel film at an electrode surface.These films were prepared by electrodeposition by suspending the cells in a mixed solution containing1% alginate and 0.25% CaCO3 particles and electrodepositing the film onto a standard gold electrode byimmersing this electrode into the mixed solution and biasing it to serve as the anode (4 A/m2, 60 s), usinga Pt wire as the cathode (2400 SourceMeter; Keithley) (47, 48). Electrochemical probing for the redoxactivity of these films was performed using cyclic voltammetry (CV) in a three-electrode system (CHIInstruments 600C electrochemical analyzer), as follows: (i) the film-coated standard gold electrode wasthe working electrode, (ii) Ag/AgCl was the reference electrode, and (iii) Pt wire was the counterelec-trode. Air was excluded by purging N2 during the experiment. All of the CV experiments were performedat the scan rate of 2 mV/s.
Cell survival assay. Twenty microliters of the nonmelanized and the melanized V. natriegens cellcultures or washed cells suspended in PBS was irradiated with UVC (254 nm) at 450 mJ/cm2 for 20 min,diluted with PBS, and spotted on LBv2 agar plates. HeLa cells were seeded on 35-mm dishes with 14-mmglass-bottom inserts (no. 1.0 cover glass; MatTek Corp., MA, USA) at a density of �7 104 cells/ml(3 ml/well) and incubated under regular cell culturing condition (5% CO2 at 37°C) for 24 h to a confluenceof 70 to 80%. Dishes were coated with fibronectin (10 to 20 �g/ml) in Dulbecco’s phosphate-bufferedsaline (DPBS) before adding the cell suspension. The cell monolayers on the dishes were washed withDPBS three times and submerged with the supernatant filtered from the melanized V. natriegens culturediluted (1:1) with live cell imaging solution (LCIS). Cells were then subjected to UV irradiation (254 nm,6 mJ/cm2) for 10 s, followed by incubation for 24 h in under regular culturing medium and conditions.Next, cells were washed with LCIS, followed by staining with a fluorescence LIVE/DEAD viability kit(Thermo Fisher Scientific, Grand Island, NY) for live/dead quantification. The stained cells were imagedwith confocal laser scanning microscopy (CLSM) using a Nikon A1Rsi confocal microscope. Fluorescenceimages of individual cells were counted and quantified for live (green) and dead (red) status for 50 to 70cells for each sample from two independent experiments.
Chemical adsorption assays. For the TNT absorption assays, melanized cell cultures were developedas described above, and 500 �l of cells (�109/ml) was added to 500 �l of a 125 ppb solution of2,4,6-trinitrotoluene (TNT) (Cerilliant, Inc., Round Rock, TX). These cell suspensions were then vortexed for5, 10, 30, 60, or 180 min before pelleting. For determining the pH dependence of binding, the melanizedV. natriegens cells were pelleted and resuspended in citrate-phosphate buffer (pH 3 to 8) (49). Fivehundred microliters of cells in this buffer was then mixed with a solution containing 125 ppb TNT in thesame buffer with the appropriate pH. This mixture was vortexed for 30 min before pelleting bycentrifugation. The concentration of TNT in the supernatant was measured using an Agilent 1290 Infinityhigh-performance liquid chromatography (HPLC) system equipped with an Agilent reverse-phase C18
analytical column (Eclipse XDB-C18; 5 mm; 4.6 by 250 mm2; Santa Clara, CA, USA). UV-Vis detection at254 nm was performed to monitor the elution of TNT.
SUPPLEMENTAL MATERIALSupplemental material is available online only.SUPPLEMENTAL FILE 1, PDF file, 1.1 MB.
ACKNOWLEDGMENTSWe thank Julia van Kessel (Indiana University) for providing the pJV298 plasmid.This work was supported by the Assistant Secretary of Defense for Research and
Engineering [ASD(R&E)] through the Applied Research for Advancement of S&T Prior-ities Synthetic Biology for Military Environments program. We also gratefully acknowl-edge financial support from the U.S. National Science Foundation (grant DMREF-7171435957), the Air Force Office of Scientific Research under the Multidisciplinary Re-search Program of the University Research Initiative (MURI) (grant FA9550-18-1-0142),and the Department of Defense (Defense Threat Reduction Agency, grants HDTRA1-13-1-0037 and HDTRA1-719 15-1-0058).
The views expressed here are those of the authors and do not represent those of theU.S. Navy, the U.S. Department of Defense, or the U.S. Government.
REFERENCES1. d’Ischia M, Wakamatsu K, Cicoira F, Di Mauro E, Garcia-Borron JC,
Commo S, Galván I, Ghanem G, Kenzo K, Meredith P, Pezzella A, SantatoC, Sarna T, Simon JD, Zecca L, Zucca FA, Napolitano A, Ito S. 2015.Melanins and melanogenesis: from pigment cells to human health and
technological applications. Pigment Cell Melanoma Res 28:520 –544.https://doi.org/10.1111/pcmr.12393.
2. Kim YJ, Khetan A, Wu W, Chun SE, Viswanathan V, Whitacre JF, BettingerCJ. 2016. Evidence of porphyrin-like structures in natural melanin pig-
Wang et al. Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 16
5. Liu Y, Simon JD. 2003. Isolation and biophysical studies of naturaleumelanins: applications of imaging technologies and ultrafast spectros-copy. Pigment Cell Res 16:606 – 618. https://doi.org/10.1046/j.1600-0749.2003.00098.x.
6. Aghajanyan AE, Hambardzumyan AA, Hovsepyan AS, Asaturian RA,Vardanyan AA, Saghiyan AA. 2005. Isolation, purification and physi-cochemical characterization of water-soluble Bacillus thuringiensismelanin. Pigment Cell Res 18:130 –135. https://doi.org/10.1111/j.1600-0749.2005.00211.x.
7. Cabrera-Valladares N, Martínez A, Piñero S, Lagunas-Muñoz VH, Tinoco R,de Anda R, Vázquez-Duhalt R, Bolívar F, Gosset G. 2006. Expression of themelA gene from Rhizobium etli CFN42 in Escherichia coli and charac-terization of the encoded tyrosinase. Enzyme Microb Technol 38:772–779. https://doi.org/10.1016/j.enzmictec.2005.08.004.
8. Cubo MT, Buendia-Claveria AM, Beringer JE, Ruiz-Sainz JE. 1988. Melaninproduction by Rhizobium strains. Appl Environ Microbiol 54:1812–1817.
9. El-Naggar NEA, El-Ewasy SM. 2017. Bioproduction, characterization, an-ticancer and antioxidant activities of extracellular melanin pigment pro-duced by newly isolated microbial cell factories Streptomyces glauce-scens NEAE-H. Sci Rep 7:42129. https://doi.org/10.1038/srep42129.
10. Garcia-Rivera J, Eisenman HC, Nosanchuk JD, Aisen P, Zaragoza O,Moadel T, Dadachova E, Casadevall A. 2005. Comparative analysis ofCryptococcus neoformans acid-resistant particles generated from pig-mented cells grown in different laccase substrates. Fungal Genet Biol42:989 –998. https://doi.org/10.1016/j.fgb.2005.09.003.
11. Kanteev M, Goldfeder M, Fishman A. 2015. Structure-function correla-tions in tyrosinases. Protein Sci 24:1360 –1369. https://doi.org/10.1002/pro.2734.
12. Plonka PM, Grabacka M. 2006. Melanin synthesis in microorganisms–biotechnological and medical aspects. Acta Biochim Pol 53:429 – 443.https://doi.org/10.18388/abp.2006_3314.
13. Gustavsson M, Hornstrom D, Lundh S, Belotserkovsky J, Larsson G. 2016.Biocatalysis on the surface of Escherichia coli: melanin pigmentation ofthe cell exterior. Sci Rep 6:36117. https://doi.org/10.1038/srep36117.
14. Lagunas-Muñoz VH, Cabrera-Valladares N, Bolívar F, Gosset G, MartínezA. 2006. Optimum melanin production using recombinant Escherichiacoli. J Appl Microbiol 101:1002–1008. https://doi.org/10.1111/j.1365-2672.2006.03013.x.
15. Guo J, Rao Z, Yang T, Man Z, Xu M, Zhang X, Yang ST. 2015. Cloning andidentification of a novel tyrosinase and its overexpression in Streptomy-ces kathirae SC-1 for enhancing melanin production. FEMS MicrobiolLett 362:fnv041. https://doi.org/10.1093/femsle/fnv041.
16. Tarangini K, Mishra S. 2014. Production of melanin by soil microbialisolate on fruit waste extract: two step optimization of key parame-ters. Biotechnol Rep (Amst) 4:139 –146. https://doi.org/10.1016/j.btre.2014.10.001.
17. Long CP, Gonzalez JE, Cipolla RM, Antoniewicz MR. 2017. Metabolism ofthe fast-growing bacterium Vibrio natriegens elucidated by 13C meta-bolic flux analysis. Metab Eng 44:191–197. https://doi.org/10.1016/j.ymben.2017.10.008.
18. Eagon RG. 1962. Pseudomonas natriegens, a marine bacterium with ageneration time of less than 10 minutes. J Bacteriol 83:736 –737.
19. Lee HH, Ostrov N, Wong BG, Gold MA, Khalil AS, Church GM. 2019.Functional genomics of the rapidly replicating bacterium Vibrio natrie-gens by CRISPRi. Nat Microbiol 4:1105–1113. https://doi.org/10.1038/s41564-019-0423-8.
20. Tschirhart T, Shukla V, Kelly EE, Schultzhaus Z, NewRingeisen E,Erickson JS, Wang Z, Garcia W, Curl E, Egbert RG, Yeung E, Vora GJ.2019. Synthetic biology tools for the fast-growing marine bacteriumVibrio natriegens. ACS Synth Biol 8:2069 –2079. https://doi.org/10.1021/acssynbio.9b00176.
21. Weinstock MT, Hesek ED, Wilson CM, Gibson DG. 2016. Vibrio natriegensas a fast-growing host for molecular biology. Nat Methods 13:849 – 851.https://doi.org/10.1038/nmeth.3970.
22. Wang Z, Lin B, Mostaghim A, Rubin RA, Glaser ER, Mittraparp-Arthorn P,
Thompson JR, Vuddhakul V, Vora GJ. 2013. Vibrio campbellii hmgA-mediated pyomelanization impairs quorum sensing, virulence, and cel-lular fitness. Front Microbiol 4:379. https://doi.org/10.3389/fmicb.2013.00379.
23. Hoffart E, Grenz S, Lange J, Nitschel R, Muller F, Schwentner A, Feith A,Lenfers-Lucker M, Takors R, Blombach B. 2017. High substrate uptakerates empower Vibrio natriegens as production host for industrial bio-technology. Appl Environ Microbiol 83:e01614-17. https://doi.org/10.1128/AEM.01614-17.
24. Dalia TN, Hayes CA, Stolyar S, Marx CJ, McKinlay JB, Dalia AB. 2017.Multiplex genome editing by natural transformation (MuGENT) for syn-thetic biology in Vibrio natriegens. ACS Synth Biol 6:1650 –1655. https://doi.org/10.1021/acssynbio.7b00116.
25. Shuster V, Fishman A. 2009. Isolation, cloning and characterization of atyrosinase with improved activity in organic solvents from Bacillusmegaterium. J Mol Microbiol Biotechnol 17:188 –200. https://doi.org/10.1159/000233506.
26. van Kessel JC, Rutherford ST, Cong JP, Quinodoz S, Healy J, Bassler BL.2015. Quorum sensing regulates the osmotic stress response in Vibrioharveyi. J Bacteriol 197:73– 80. https://doi.org/10.1128/JB.02246-14.
27. Vij M, Grover R, Gotherwal V, Wani NA, Joshi P, Gautam H, Sharma K,Chandna S, Gokhale RS, Rai R, Ganguli M, Natarajan VT. 2016. Bioinspiredfunctionalized melanin nanovariants with a range of properties provideeffective color matched photoprotection in skin. Biomacromolecules17:2912–2919. https://doi.org/10.1021/acs.biomac.6b00740.
28. Lampel A, McPhee SA, Park HA, Scott GG, Humagain S, Hekstra DR, YooB, Frederix P, Li TD, Abzalimov RR, Greenbaum SG, Tuttle T, Hu C,Bettinger CJ, Ulijn RV. 2017. Polymeric peptide pigments with sequence-encoded properties. Science 356:1064 –1068. https://doi.org/10.1126/science.aal5005.
29. Ohlendorf R, Vidavski RR, Eldar A, Moffat K, Moglich A. 2012. From dusktill dawn: one-plasmid systems for light-regulated gene expression. JMol Biol 416:534 –542. https://doi.org/10.1016/j.jmb.2012.01.001.
31. Wang Y, Aisen P, Casadevall A. 1996. Melanin, melanin “ghosts,” andmelanin composition in Cryptococcus neoformans. Infect Immun 64:2420 –2424.
32. Geng J, Yu SB, Wan X, Wang XJ, Shen P, Zhou P, Chen XD. 2008.Protective action of bacterial melanin against DNA damage in full UVspectrums by a sensitive plasmid-based noncellular system. J BiochemBiophys Methods 70:1151–1155. https://doi.org/10.1016/j.jprot.2007.12.013.
33. Gao Q, Garcia-Pichel F. 2011. Microbial ultraviolet sunscreens. Nat RevMicrobiol 9:791– 802. https://doi.org/10.1038/nrmicro2649.
34. Fuqua WC, Weiner RM. 1993. The melA gene is essential for melaninbiosynthesis in the marine bacterium Shewanella colwelliana. J Gen Micro-biol 139:1105–1114. https://doi.org/10.1099/00221287-139-5-1105.
35. Mercado-Blanco J, García F, Fernández-López M, Olivares J. 1993. Mela-nin production by Rhizobium meliloti Gr4 is linked to nonsymbioticplasmid pRmeGR4b: cloning, sequencing, and expression of the tyrosi-nase gene mepA. J Bacteriol 175:5403–5410. https://doi.org/10.1128/jb.175.17.5403-5410.1993.
36. Saxena D, Ben-Dov E, Manasherob R, Barak Z, Boussiba S, Zaritsky A.2002. A UV tolerant mutant of Bacillus thuringiensis subsp. kurstakiproducing melanin. Curr Microbiol 44:25–30. https://doi.org/10.1007/s00284-001-0069-6.
37. Wang GL, Aazaz A, Peng ZR, Shen P. 2000. Cloning and overexpressionof a tyrosinase gene mel from Pseudomonas maltophila. FEMS MicrobiolLett 185:23–27. https://doi.org/10.1111/j.1574-6968.2000.tb09035.x.
38. Fernández-Llamosas H, Castro L, Blazquez ML, Diaz E, Carmona M. 2017.Speeding up bioproduction of selenium nanoparticles by using Vibrionatriegens as microbial factory. Sci Rep 7:16046. https://doi.org/10.1038/s41598-017-16252-1.
39. Huang YR, Li YW, Hu ZY, Yue XJ, Proetto MT, Jones Y, Gianneschi NC. 2017.Mimicking melanosomes: polydopamine nanoparticles as artificial micro-parasols. ACS Cent Sci 3:564 –569. https://doi.org/10.1021/acscentsci.6b00230.
40. Kim E, Kang M, Tschirhart T, Malo M, Dadachova E, Cao G, Yin JJ, BentleyWE, Wang Z, Payne GF. 2017. Spectroelectrochemical reverse engineer-ing demonstrates that melanin’s redox and radical scavenging activities
Melanin Production in Vibrio natriegens Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 17
are linked. Biomacromolecules 18:4084 – 4098. https://doi.org/10.1021/acs.biomac.7b01166.
41. Kim YJ, Wu W, Chun SE, Whitacre JF, Bettinger CJ. 2014. Catechol-mediatedreversible binding of multivalent cations in eumelanin half-cells. Adv Mater26:6572–6579. https://doi.org/10.1002/adma.201402295.
42. Kim YJ, Wu W, Chun SE, Whitacre JF, Bettinger CJ. 2013. Biologicallyderived melanin electrodes in aqueous sodium-ion energy storage de-vices. Proc Natl Acad Sci U S A 110:20912–20917. https://doi.org/10.1073/pnas.1314345110.
43. Sies H, Schulz WA, Steenken S. 1996. Adjacent guanines as preferredsites for strand breaks in plasmid DNA irradiated with 193 nm and 248nm UV laser light. J Photochem Photobiol B 32:97–102. https://doi.org/10.1016/1011-1344(95)07192-X.
44. Wang Z, Lin B, Hervey WJ, Vora GJ. 2013. Draft genome sequence of thefast-growing marine bacterium Vibrio natriegens strain ATCC 14048. Ge-nome Announc 1:e00589-13. https://doi.org/10.1128/genomeA.00589-13.
45. Larsson BS. 1993. Interaction between chemicals and melanin. PigmentCell Res 6:127–133. https://doi.org/10.1111/j.1600-0749.1993.tb00591.x.
46. Marinovic V, Ristic M, Dostanic M. 2005. Dynamic adsorption of trinitro-toluene on granular activated carbon. J Hazard Mater 117:121–128.https://doi.org/10.1016/j.jhazmat.2004.07.025.
47. Liu Y, Tsao CY, Kim E, Tschirhart T, Terrell JL, Bentley WE, Payne GF. 2017.Using a redox modality to connect synthetic biology to electronics:hydrogel-based chemo-electro signal transduction for molecular com-munication. Adv Healthc Mater 6. https://doi.org/10.1002/adhm.201600908.
48. Shi XW, Tsao CY, Yang XH, Liu Y, Dykstra P, Rubloff GW, Ghodssi R,Bentley WE, Payne GF. 2009. Electroaddressing of cell populations byco-deposition with calcium alginate hydrogels. Adv Funct Mater 19:2074 –2080. https://doi.org/10.1002/adfm.200900026.
49. McIlvaine TC. 1921. A buffer solution for colorimetric comparison. J BiolChem 49:183–186.
50. Drewnowska JM, Zambrzycka M, Kalska-Szostko B, Fiedoruk K, SwiecickaI. 2015. Melanin-like pigment synthesis by soil Bacillus weihenstepha-nensis isolates from northeastern Poland. PLoS One 10:e0125428.https://doi.org/10.1371/journal.pone.0125428.
Wang et al. Applied and Environmental Microbiology
March 2020 Volume 86 Issue 5 e02749-19 aem.asm.org 18
![Melanin Translation[1]](https://static.documents.pub/doc/80x56/577d22411a28ab4e1e96f1ae/melanin-translation1.jpg)
