Metabolic control of virulence genes in...

1

Metabolic control of virulence genes in Brucella: 1

HutC coordinates virB expression and the histidine utilization 2

pathway by direct binding to both promoters† 3

4

Rodrigo Sieira1*, Gastón M. Arocena1, Lucas Bukata1, Diego J. Comerci1,2, and Rodolfo 5 A. Ugalde1§. 6 7

Running title: HutC-dependent expression of the Brucella virB operon 8 9

10

1Instituto de Investigaciones Biotecnológicas, Universidad Nacional de General San 11

Martín, IIB-INTECH-CONICET, San Martín 1650, Buenos Aires, Argentina. 2Comisión 12

Nacional de Energía Atómica, División Agropecuaria, Centro Atómico Ezeiza 1804, 13

Buenos Aires, Argentina. § Deceased on august 17th, 2009. 14

15

† This work is dedicated to the memory of Dr. Rodolfo A. Ugalde. 16

17

*Corresponding author: E-mail: [email protected] Mailing address: Instituto de 18

Investigaciones Biotecnológicas, Universidad Nacional de General San Martín, Av. 19

General Paz 5445 - INTI, Ed. 24. San Martín 1650, Buenos Aires, Argentina. Phone: 20

(54-11) 4580 7255. FAX: (54-11) 4752 9639. 21

22

23 Abbreviations: T4SS, Type-IV Secretion System; UCA, urocanic acid ; PvirB, virB 24 promoter; hut, histidine utilization ; Phut, hut promoter. 25 26

27

28

29

30

31

Copyright © 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.01124-09 JB Accepts, published online ahead of print on 23 October 2009

on June 20, 2019 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

2

ABSTRACT 32

Type-IV Secretion Systems (T4SS) are multicomponent machineries involved in the 33

translocation of effector molecules across the bacterial cell envelope. The virB operon 34

of Brucella abortus codes for a T4SS that is essential for virulence and intracellular 35

multiplication of the bacterium in the host. Previous studies showed that the virB operon 36

of B. abortus is tightly regulated within the host cells. In order to identify factors 37

implicated in the control of virB expression, we searched for proteins of Brucella that 38

directly bind to the virB promoter (PvirB). Using different procedures, we isolated a 27-39

kDa protein that binds specifically to PvirB. This protein was identified as HutC, the 40

transcriptional repressor of the histidine utilization (hut) genes. Analyses of virB and hut 41

promoter activity revealed that HutC exerts two different roles: it acts as a co-activator 42

of transcription of the virB operon whereas it represses the hut genes. Such activities 43

were observed both intracellularly and in bacteria incubated under conditions that 44

resemble the intracellular environment. EMSA and DNase I Footprinting experiments 45

revealed the structure, affinity, and localization of the HutC-binding sites, and 46

supported the regulatory role of HutC in both hut and virB promoters. Taken together 47

these results indicate that Brucella coopted the function of HutC to coordinate the Hut 48

pathway with transcriptional regulation of the virB genes, probably as a way to sense its 49

own metabolic state and develop adaptive responses to overcome intracellular host 50

defences. 51


.org/D

ownloaded from

http://jb.asm.org/

3

INTRODUCTION 52

Type IV secretion systems (T4SSs) are multicomponent machineries central in the 53

pathogenesis of many bacterial genera (i.e.: Brucella, Agrobacterium, Helicobacter, 54

Legionella and Bordetella) (4). T4SS function comprises recognition and translocation 55

of specific substrates across the bacterial cell envelope. The nature of the translocated 56

substrates varies from proteins to DNA-protein complexes. In addition to the well 57

studied Agrobacterium T-DNA and B. pertussis toxin, several translocated effectors 58

have been identified in Helicobacter, Legionella and Brucella (7). In every case, the 59

translocated molecules alter cellular processes in such a way that allow the pathogen to 60

overcome host defences. 61

Brucella is a gram-negative bacterium that causes brucellosis, a worldwide zoonosis 62

that affects domestic mammals. Different Brucella species vary in their host preference. 63

Brucella abortus, Brucella suis and Brucella melitensis infect cattle, pigs and goats, 64

respectively, but also infect humans. In animals, the symptoms of the disease are 65

sterility in males and abortion in pregnant females (6). In humans, brucellosis causes 66

undulant fever during the acute phase, and if it reaches chronicity can lead to 67

endocarditis, osteoarthritis and neurological damage. 68

Brucella is an intracellular parasite that persists and replicates within host macrophages. 69

After internalization, the bacterium actively controls the maturation of the so-called 70

Brucella-containing vacuole (BCV) by modulating the formation of transient 71

interactions with ER-derived membranes and late endosomes/lysosomes (26). Such 72

events are crucial for establishing the intracellular replication niche and determine the 73

intracellular fate of the bacterium. The T4SS of Brucella, which is coded by the virB 74

operon, plays a central role in this process, since virB mutants fail to reach the 75


.org/D

ownloaded from

http://jb.asm.org/

4

intracellular replication compartment and are completely degraded by lysosomes (5, 15, 76

24). 77

The virB operon of B. suis is induced after internalization in macrophage-cell lines (1). 78

In B. abortus it was observed that transcription of the virB operon reaches the maximum 79

activity at 5 hours post infection. Subsequently, virB expression is rapidly repressed 80

before intracellular bacterial replication starts (23). This tightly controlled pattern of 81

expression suggests the existence of regulatory pathways that probably act in response 82

to environmental stimuli sensed by the bacterium during its intracellular trafficking. 83

Therefore, the identification of the transcription factors involved in this process may 84

lead to the understanding of the signals that govern the regulation of the VirB T4SS of 85

Brucella within the eukaryotic host cell. 86

The virB promoter (PvirB) of B. abortus comprises 430 base pairs (bp) that participate in 87

the intracellular activity of the system (23). The histone-like integration host factor 88

(IHF) binds to PvirB and induces a DNA-bending that is necessary for the intracellular 89

regulation of the virB genes (23) The quorum-sensing related protein VjbR was also 90

shown to interact with PvirB, directly controlling the virB expression in a positive manner 91

(7, 9). In addition, many other regulators affect virB expression (18). However, no direct 92

interactions with PvirB were reported for these factors, indicating that such influences 93

may be indirect. 94

Based on the knowledge of the architecture of PvirB, we designed a strategy to identify 95

additional factors that specifically bind to this promoter. Here we report the 96

identification of HutC, a protein known to regulate expression of the histidine utilization 97

(hut) genes, as a transcription factor that directly controls the activity of PvirB. Using 98

Electrophoresis Mobility Shift Assays (EMSA) and DNase I Footprinting we identified 99

the HutC-binding sites and analyzed the interaction of this regulator with both hut and 100


.org/D

ownloaded from

http://jb.asm.org/

5

virB promoters. Our results show that HutC co-activates virB expression while it 101

represses transcription of the hut genes, both intracellularly and in bacteria incubated 102

under conditions that resemble the intracellular replication niche. These findings 103

demonstrate that transcriptional regulation of the virB operon is linked to the induction 104

of the histidine utilization pathway, probably as a way to synchronize activation of 105

virulence genes with signals that involve internal metabolic variables and external 106

stimuli perceived within the eukaryotic host cell. 107


.org/D

ownloaded from

http://jb.asm.org/

6

MATERIALS AND METHODS 108

Media and culture conditions 109

Brucella strains were grown in triptic soy broth (TSB) or in minimal medium 1 (MM1), 110

which is derived from MM (21). Composition of MM1 is 33 mM KH2PO4, 60.3 mM 111

K2HPO4, 0.1% yeast extract. Urocanic acid (Sigma) or L-histidine (Sigma) was added 112

to a final concentration of 5 mM as indicated. After the addition of the different carbon 113

sources pH was adjusted to 4.5, 5.5 or 7.0 with HCl, and the media were sterilized by 114

filtration through a 0.2-µm filter (Orange Scientific). Bacteria were cultured at 37˚C in a 115

rotary shaker (250 rpm). Media were supplemented with kanamycin (50 µg ml-1) as 116

needed. 117

118

Construction of plasmids: 119

pK18mob-sacB-∆hutC: Two PCRs were carried out using Pfx (Invitrogen), genomic 120

DNA of B. abortus 2308 as template, and primers dCSpeA (5’- 121

GGACTAGTATCATCGCGCCCGCAATGT-3’) and comdCA (5’- 122

CTGCAAGAAGGAGAGTATCGACCAGAATACGCTGATGCAG-3’), or dCSpeB (5’- 123

GGACTAGTCAGGCCTTGCCGATTACTG-3’) and comdCB (5’- 124

TCGATACTCTCCTTCTTGCAGTATCCCGGTGACAGCCATG-3’). Both PCR products, 125

corresponding to two 400-bp flanking regions of hutC, were annealed and used as 126

templates for a PCR performed with primers dCSpeA and dCSpeB. The product was 127

digested with SpeI and cloned into the kanamycin-resistant plasmid pK18mob-sacB 128

(22). 129

pK18mob-PvirB-lacZ: A 5-kb DNA fragment from plasmid pBluescript-PvirB::lacZ (23), 130

which contains the PvirB-lacZ transcriptional fusion, was excised with BamHI and EcoRI 131

and cloned into pK18mob in the same restriction sites. 132


.org/D

ownloaded from

http://jb.asm.org/

7

pK18mob-Phut-lacZ: A 4.5-kb fragment that contains a lacZ promoter-probe cassette 133

was released from plasmid pAB2001 after digestion with SphI. The resulting fragment 134

was cloned into plasmid pK18mob at the same restriction site, generating plasmid 135

pK18mob-lacZ. A PCR performed with Taq (Invitrogen), B. abortus 2308 genomic 136

DNA as template, and primers PhutA (5’-TGAAATGCTGGCTGGATTG-3’) and PhutB 137

(5’-TCGATCAAGCCGAGATTTG-3’) was cloned into pGEM-T Easy (Promega). The 138

resulting plasmid (pGEM-Phut) was digested with EcoRI, releasing a 170-bp fragment 139

that contains the hut promoter sequences. The Phut-containing fragment was cloned into 140

pK18mob-lacZ in the EcoRI site, generating plasmid pK18mob-Phut-lacZ. Clones with 141

the transcriptional fusion Phut-lacZ oriented in the direction of the hutFC operon were 142

identified by PCR using primers PhutA and lacZ6143 (5’-CAGGGTTTTCCCAGTCACG-143

3’), and checked by DNA sequencing with the same primers. 144

pK18mob-sacB-hutC-KI: A PCR was performed using Pfx, genomic DNA of B. abortus 145

2308 as template, and primers dCSpeA and dCSpeB. The PCR product, which contains 146

the wild type hutC gene and two 400 bp flanking regions, was cloned into pGEM-T 147

easy (Promega). A 1.4 kb fragment excised from the resulting plasmid with StuI and 148

HincII was cloned into the SmaI site of pK18mob-sacB. 149

Expression vector pQE-31-hutC: PCR reactions were performed using Pfx, and primers 150

uprHut (5’-CGGGATCCGATGGCTGGCGAAGATTCGA-3’) and downrHut (5’- 151

GGTACCTCAGCCGCGAGATGGCGT-3’). The PCR product were digested with KpnI 152

and BamHI, and cloned into plasmid pQE-31 (Qiagen). 153

154

Construction of strains B. abortus ∆∆∆∆hutC and B. abortus ∆∆∆∆hutC-KI. 155

Plasmid pK18mob-sacB- ∆hutC was transferred to B. abortus 2308 by biparental 156

conjugation. Kanamycinr colonies were selected as single-homologous recombinants. 157


.org/D

ownloaded from

http://jb.asm.org/

8

Selection with sucrose, excision of plasmids and generation of deletion mutants was 158

performed as described (23). PCR analyses of kanamycins colonies were carried out 159

with primers dCSpeA and dCSpeB to identify clones that contain the deletion of hutC. 160

Plasmid pK18mob-sacB-hutC-KI was transferred to B. abortus ∆hutC by biparental 161

conjugation. Kanamycinr colonies were selected as single-homologous recombinants. 162

Selection with sucrose and excision of the plasmid was performed as described (23). 163

PCR analyses of kanamycins colonies were carried out with primers dCSpeA and 164

dCSpeB. Colonies that generated the wild type pattern were selected as hutC knock in 165

strains. 166

167

Construction of strains containing single chromosomal transcriptional fusions. 168

Plasmids pK18mob-PvirB-lacZ or pK18mob-Phut-lacZ was transferred by biparental 169

conjugation into strains B. abortus 2308, B. abortus ∆hutC or B. abortus ∆hutC-KI. 170

Kanamycinr colonies were selected as single-homologous recombinants. 171

172

Electrophoresis Mobility Shift Assay (EMSA) and DNase I Footprinting 173

Construction of probes PvirB and PvirB-ihf for EMSA, running conditions and 174

determination of apparent dissociation constants were performed as described 175

previously (23). Probe Phut was constructed using primers PhutA and PhutB. Control 176

probe, which contains sequences corresponding to 226 bp of virB10 of B. abortus 2308, 177

was constructed with primers B10Qu (5’-CTATGCAACCCAGAAGGTCGG-3’) and 178

B10d2 (5’- GGGAATTCGTCAGGCACAATAAAGTCAC-3’). The unlabelled competitors 179

b1 and c2 were constructed by PCR using primers pvirdown I and pvu229 or primers 180

pvirdown I and pvu300, respectively (23). Binding reactions were performed in binding 181

buffer [15 mM Tris-HCl (pH 8.0), 0.5 mM EDTA, 10 µg ml-1 bovine serum albumin 182


.org/D

ownloaded from

http://jb.asm.org/

9

(BSA), 1 mM DTT, 30 mM KCl, 6% glycerol] containing 50 µg ml-1 salmon sperm 183

DNA for isolation of HutC, or 25 µg ml-1 poly(dI·dC) (Amersham) for Kd 184

determinations and IHF-HutC competition experiments. 185

Probes PvirB and Phut for DNase I Footprinting were constructed using primer pvu144 186

and a 32P-labeled primer pvirdownI, or primer PhutA and a 32P-labeled primer PhutB, 187

respectively. Labelling reactions, purification of probes, binding reactions, DNase I 188

digestion, purification of fragments, and electrophoresis conditions were performed as 189

described previously (23). 190

191

Isolation and identification of HutC 192

The isolation of the PvirB-binding protein was performed as described previously (23) 193

with the following modifications: To diminish the risk of working with the virulent-wild 194

type strain, the protein detected by EMSA in B. abortus 2308 was isolated from cultures 195

of the avirulent strain B. abortus ∆pgm (27) harvested in exponential phase (DO600 = 196

0.5). After disruption of bacteria, ultracentrifugation, filtration and ammonium sulphate 197

precipitation the protein fractions were analyzed by EMSA using probe PvirB-ihf or the 198

control probe. The positive fraction (25-45% ammonium sulphate saturation) was 199

suspended in 35 mM phosphate buffer (pH 6.8), 3 mM β-mercaptoethanol and dialyzed 200

against the same buffer O.N. at 4°C. The solution was loaded onto a Mono-S column 201

and eluted with a linear gradient of 35 mM phosphate buffer (pH 6.8), 3 mM β-202

mercaptoethanol, 1M NaCl. DNA-binding activity of the fractions was analyzed by 203

EMSA using the probes described above. Positive fractions were subjected to affinity 204

chromatography: the biotinylated probe biot- PvirB-ihf, which corresponds to the -201 to 205

+24 region of PvirB lacking the IHF-binding site, was constructed by PCR using the 5´-206

biotinylated primer pvirdown I, the primer pvu229 and plasmid pBluescript-PvirB-IHF-207


.org/D

ownloaded from

http://jb.asm.org/

10

sacB/R (23) as template. The biotinylated control probe was constructed by PCR using 208

the 5´-biotinylated primer ADP-Biot (5’-GCGATGGGCAGAGCGCCGG-3’), primer 209

PE2P3 (5’- GGATCCGGTGCTCGACGCCAA-3’)and genomic DNA of Mesorhizobium 210

loti as template. The biotinylated probes were bound to streptavidin paramagnetic 211

spheres (Promega) and a binding reaction was performed using binding buffer and the 212

positive fractions of the Mono-S column. After two washes with binding buffer with 0.2 213

M NaCl, the DNA-bound proteins were eluted with 0.85 M NaCl and analyzed by 214

12.5% SDS-PAGE. After Coomassie blue staining, six bands were observed in sample 215

obtained with the biotinylated probe biot- PvirB-ihf, whereas one of them was absent in 216

the sample obtained with the control probe. The differential band was excised form the 217

gel and analyzed by mass spectrometry in Vital probes Inc. (PA, USA). 218

219

Expression and purification of recombinant proteins 220

Recombinant IHF was prepared as described previously (23). Recombinant HutC 221

(rHutC) was prepared as follows. Plasmid pQE-31-hutC was transferred into E. coli 222

M15 (pREP4) (Qiagen) and induced with IPTG. Bacteria were harvested, suspended in 223

lysis buffer [20 mM Tris-HCl (pH 7.6), 1 mM PMSF] and disrupted by sonication. 224

After centrifugation NaCl was added to a final concentration of 0.5 M and the sample 225

was loaded into a Hi-Trap Nickel-chelating column (Amersham Biosciences). After 226

washing with buffer B [20 mM Tris-HCl (pH 7.6), 0.5 M NaCl, 100 mM imidazole] the 227

column was equilibrated with buffer A [20 mM Tris-HCl (pH 7.6), 0.5 M NaCl] and 228

eluted with a linear gradient of buffer C [20 mM Tris-HCl (pH 7.6), 0.5 M NaCl, 100 229

mM EDTA]. Eluates were analyzed in a 12.5% SDS-PAGE, and the fractions 230

containing rHutC (purity near to 95%) were pooled and dialized against buffer D [20 231


.org/D

ownloaded from

http://jb.asm.org/

11

mM Tris-HCl (pH 7.6), 0.5 M NaCl, 3 mM β-mercaptoethanol]. The sample was stored 232

at -20°C with sucrose 0.5%. 233

234

ββββ-galactosidase activity determinations 235

For cultured bacteria, measurement of β-Gal activity was carried out with whole cells as 236

described (23). β-Gal activity was expressed as Miller Units [A420 / volume × OD600] 237

×100. Infection of macrophage-like J774 cells and measurement of intracellular β-Gal 238

activity with 4-methylumbelliferyl-β-D-galactoside was performed as described 239

previously (23). Intracellular β-Gal activity was expressed as relative units (R.U.): 240

{(fluorescence/fluorescence of 200 nM 4-methylumbelliferone)/[(CFU/ml)×dil.]} ×106. 241

242

Western blot experiments 243

Bacteria grown during 24 h in rich medium (TSB) were centrifuged, washed with PBS, 244

and suspended in different media as indicated. After culturing in each medium for 4 h, 245

bacteria were suspended in SDS-loading gel buffer at a concentration of 5 × 1010 246

CFU/ml and incubated at 100°C for 5 min. 10 µl of each bacterial cell lysate were 247

subjected to electrophoresis in a 12.5 % SDS-polyacrylamide gel and transferred to a 248

nitrocellulose membrane (Amersham Biosciences). Proteins were detected using a 249

mouse polyclonal antiserum against recombinant B. abortus HutC (dilution 1:1,000), a 250

secondary peroxidase-conjugated anti-mouse immunoglobulins antibody (dilution 251

1:10,000) (DakoCytomation) and developed by with SuperSignal West Pico 252

Chemiluminescent Substrate (Pierce). 253


.org/D

ownloaded from

http://jb.asm.org/

12

RESULTS 254

Identification and characterization of HutC as a virB promoter-binding protein 255

To identify proteins that bind to PvirB, we performed electrophoresis mobility shift 256

assays (EMSA) using crude-protein extracts of B. abortus and probe PvirB ihf (Fig. 1A), 257

which spans positions -201 to +24 relative to the transcription start site and lacks the 258

ability to bind IHF due to a replacement of the IHF-binding site by a non-related 259

sequence. Using this procedure, we detected a protein that binds to PvirB in a specific 260

manner (data not shown). The DNA-binding protein was subsequently isolated from B. 261

abortus extracts using EMSA, ionic-exchange columns and affinity chromatography 262

(see Materials and methods). The 27.5 kDa isolated protein was identified by mass 263

spectrometry as HutC (accession no. YP_418519), a transcriptional regulator of the hut 264

(for histidine utilization) genes, which confer the ability to use histidine as carbon and 265

nitrogen source to many bacterial species (25). In Brucella, the hut genes are organized 266

as two divergent transcriptional units that code for the regulator HutC and for enzymes 267

that catalyze degradation of histidine to glutamate and formate in five steps. 268

To analyze the interaction of HutC with PvirB, we performed EMSA analyses using 269

specific or non-specific probes (schematized in Fig. 1A) and a His-tagged recombinant 270

protein (rHutC). Binding of rHutC to PvirB produced a complex observed by EMSA, 271

whereas incubation with a control probe did not generate any signal, thus indicating that 272

binding of HutC to PvirB is specific (Fig. 1B). To further characterize the region 273

recognized by HutC within the promoter, EMSA experiments were performed using 274

two unlabelled DNA fragments as competitors (Fig. 1A). As shown in Fig. 1C, the 275

formation of the rHutC-PvirB complex was impaired by competitor b1 (which spans the 276

region -201 to +24) whereas competitor c2 had no effect. These results indicate that 277


.org/D

ownloaded from

http://jb.asm.org/

13

HutC binds to PvirB in a region that is localized between positions -201 and -130, which 278

contains the IHF-binding site. 279

Taking into account that both IHF and HutC bind to the same 71 bp-region, we 280

examined if these proteins affect the binding of each other to the promoter. As shown in 281

Fig. 1D, EMSA experiments performed by co-incubating probe PvirB with both proteins 282

did not generate any ternary complex, indicating that IHF and HutC do not bind to PvirB 283

simultaneously. Moreover, binding of IHF was titrated by increasing concentrations of 284

HutC, which indicates that both factors compete for the binding to the promoter. 285

286

Analysis of interaction of HutC with the virB and hut promoters 287

Binding affinity of HutC to the promoters was studied by determining apparent 288

dissociation constants (Kd). EMSA experiments were carried out by incubating HutC 289

with probe PvirB or with a 220-bp radiolabelled probe corresponding to the hut promoter 290

(Phut). Kd were determined graphically from the intensity of the bands corresponding to 291

rHutC-PvirB or rHutC-Phut complexes. As shown in Fig. 2, Kd of rHutC-PvirB and rHutC-292

Phut were 24 nM and 0.75 nM, respectively. Thus, HutC had 30-fold more affinity for its 293

own promoter than for PvirB, which could be mechanistically relevant for the regulatory 294

link exerted by HutC upon Hut and VirB systems. 295

The regulation of hut genes has been extensively studied in different organisms. cis-296

urocanic acid (UCA), the first intermediate of the hut pathway, is an inducer that 297

interacts with HutC causing a conformational change that dissociates the repressor from 298

the promoter sequences (12). After dissociation, transcription of the hut genes is de-299

repressed, thus allowing synthesis of the Hut enzymes. In Klebsiella and Pseudomonas, 300

dissociation of the regulator also induces transcription of HutC itself (11, 30). To 301

analyze the effect of UCA on the DNA-binding activity of HutC, EMSA experiments 302


.org/D

ownloaded from

http://jb.asm.org/

14

were carried out with rHutC and probe PvirB or Phut in the presence of the inducer. Fig.3 303

shows that higher concentrations of UCA were required for dissociating HutC from Phut 304

(50 µM) rather from PvirB (5 µM), which was consistent with the observed differences in 305

Kd. On the other hand, the addition of UCA did not have any effect on the binding of 306

IHF to the promoter, indicating that the susceptibility to the inducer is specific for HutC 307

(Fig. 3A). 308

To identify the DNA-binding sites of HutC, DNase I Footprinting experiments were 309

carried out with probes corresponding to those used for EMSA. Fig. 4A shows that in 310

Phut, HutC protected a 20 bp region that contains the 12 bp-dyad symmetric sequence 311

ATGTATATACAT (Fig 4C), which is entirely conserved in all hut promoters of the 312

closely-related genera Agrobacterium, Ochrobactrum and Rhizobium (see Fig. 4E). In 313

PvirB, however, HutC protected a 20 bp-region that contains 8 out of 12 nucleotides of 314

the conserved symmetric dyad sequence found in Phut (Fig. 4B). These differences may 315

explain why HutC had 30-fold more affinity for the binding to Phut than to PvirB. It is 316

worth to point out that the sequence recognized by HutC in PvirB is more similar to the 317

known hut operators of Klebsiella or Pseudomonas (16, 30), rather than to the HutC-318

binding site of Phut in Brucella (Fig. 4E). It can also be observed that the HutC-protected 319

region of PvirB is centered at position -188 (Fig. 4D), which is 25 bp upstream of the 320

IHF-binding site and overlaps the IHF-protected region in DNase I Footprinting 321

experiments (23), supporting the idea that the observed competition between IHF and 322

HutC was due to steric hindrance. 323

324

HutC modulates the expression of the virB operon both intracellularly and during 325

bacterial incubation in vitro 326


.org/D

ownloaded from

http://jb.asm.org/

15

The intracellular expression of the virB operon was analyzed by measuring β-Gal 327

activity of transcriptional fusions between PvirB and lacZ gene. To this end, single PvirB-328

lacZ transcriptional fusion constructs (Fig. 5A) were integrated in the chromosome of 329

the wild type strain, a hutC deletion mutant, or a complemented knock-in control strain, 330

generating strains B. abortus 2308 PvirB-lacZ, B. abortus ∆hutC PvirB-lacZ, and B. 331

abortus ∆hutC-KI PvirB-lacZ. In addition, we also analyzed β-Gal activity of 332

transcriptional fusions between the hut promoter and lacZ (Fig. 5B) in the same genetic 333

backgrounds. 334

To analyze the role of HutC on virB expression within the host cell, we infected J774 335

macrophages and determined β-Gal activity of intracellular bacteria. Fig. 5C shows that, 336

whereas both wild type and control strains displayed maximal activation of virB 337

expression at 5 h p.i., the deletion mutant strain B. abortus ∆hutC PvirB-lacZ showed a 338

60% reduction of β-Gal activity. These results indicated that during the intracellular 339

infection of J774 macrophages HutC functions as co-activator of virB expression, which 340

is a role that was not previously reported for this transcriptional regulator. The analysis 341

of intracellular activity of the hut promoter showed that, as expected, HutC is a 342

repressor of hut expression (Fig. 5D). These results demonstrate that HutC participates 343

directly on the intracellular transcriptional regulation of the virB operon, and revealed 344

that this transcription factor exerts different roles (as repressor or as co-activator) 345

depending on the target promoter. 346

Using gentamicin protection assays we observed that deletion of hutC did not affect the 347

intracellular multiplication of B. abortus in J774 cells (Fig. 6A). Thus, although 348

intracellular activation of virB expression was reduced in the ∆hutC mutant, the reached 349

level of virB expression (40%) was enough for Brucella to overcome the cellular 350

defences in this experimental model of infection. However, CFU recovered from 351


.org/D

ownloaded from

http://jb.asm.org/

16

spleens of mice infected with B. abortus ∆hutC were reduced by 0.8 log units (Fig. 6B). 352

As deletion of hutC turns the hut systems into a constitutively active state, expression of 353

the Hut enzymes is not abrogated in this mutant, suggesting that the observed reduction 354

of persistence in mice was likely due to the defect in the intracellular expression of the 355

virB genes. 356

As HutC was involved in the control of the intracellular expression of the virB operon, 357

we attempted to reproduce in vitro the conditions encountered by Brucella within the 358

host cell to examine the role of this regulator in cultured bacteria. Previous studies 359

carried out with B. suis suggested that the intracellular environment within the BCV is 360

acidic and nutrient-poor (1, 13). Accordingly, a minimal medium without magnesium, 361

carbon and nitrogen sources was prepared (medium MM1), pH was adjusted to 4.5, and 362

PvirB activity was examined in the different strains. Fig. 5E shows that, compared to both 363

wild type and control strains, virB expression dropped 90% in the ∆hutC mutant after 4 364

h of incubation in MM1 at pH 4.5 in the presence of 5 mM UCA in the culture medium, 365

indicating that HutC is acting as co-activator of PvirB under these in vitro conditions. It is 366

remarkable that no differences of PvirB activity were observed between strains when pH 367

was adjusted to 5.5 or when UCA was absent (data not shown), indicating that both 368

acidification and Hut induction are required for the observed HutC-dependent virB 369

expression. 370

Analysis of activity of Phut in cultured bacteria showed that hut expression was 371

repressed in the wild type strain, and de-repressed in the ∆hutC mutant (Fig. 5F), which 372

is in agreement with the results obtained with intracellular bacteria (Fig. 5C-D). The 373

fact that HutC is repressing Phut in the wild type strain indicates that under such 374

conditions the regulator is bound to the operator site. Thus, the cytoplasmic 375

concentration of UCA within Brucella might be low enough to allow the interaction of 376


.org/D

ownloaded from

http://jb.asm.org/

17

HutC with its DNA-binding sites, even in the presence of 5 mM extracellular UCA. 377

This can be explained if, after hut induction, the Hut enzymes metabolize UCA as it is 378

incorporated, which is feasible, given that UCA is a metabolizable inducer. Therefore, 379

to determine whether the Hut system was induced in such conditions, cultured bacteria 380

were analyzed using an anti-HutC antiserum. Western blot analyses of bacteria 381

incubated in MM1 at pH 4.5 revealed that the levels of HutC are higher in the presence 382

of the inducer (Fig. 7), which indicates that the Hut system is induced in response to 383

UCA. The analysis of OD600 during 48 h of incubation in MM1 at pH 4.5 indicated that 384

growth of Brucella was arrested under these conditions, regardless of the addition of 385

UCA or histidine (data not shown). However, by increasing the pH value to 5.5, we 386

observed that Brucella was able to grow using UCA but not histidine (Fig. 8), which is 387

in agreement with previous studies that revealed that many strains of Brucella 388

incorporate and metabolize UCA as efficiently as mesoerythritol, xylose or ribose (2, 389

10). 390

Taken together, these results demonstrate that the Hut and VirB systems are interrelated 391

by means of a regulatory mechanism that involves induction of a catabolic pathway and 392

the action of HutC upon two different promoters. 393


.org/D

ownloaded from

http://jb.asm.org/

18

DISCUSSION 394

The aim of this study was to identify signals and transcription factors directly involved 395

in the control of expression of the virB genes. Using EMSA, affinity purification assays, 396

and mass spectrometry, we isolated and identified a protein that binds to PvirB in a 397

specific manner. This protein is homologous to HutC, a well-studied transcriptional 398

regulator of the hut operons. This finding prompted us to hypothesize that the 399

interaction of HutC with the virB promoter could represent a link that coordinates 400

regulation of the virB genes of Brucella with induction of the histidine utilization 401

pathway. 402

Our results showed that in Brucella, HutC modulates expression of the virB operon both 403

within the eukaryotic host cell and in bacteria incubated under conditions that resemble 404

the cellular intraphagosomal environment (Fig. 5). The analyses revealed that instead of 405

repressing transcription, as it occurs in all known hut promoters, HutC co-activates 406

transcription of the virB genes under both conditions tested. Control experiments carried 407

out using the same experimental methods corroborated that HutC is indeed repressing 408

the hut promoter while it is co-activating PvirB (Fig. 5), which demonstrated that HutC 409

performs opposite functions depending on the target promoter. 410

Until now, the regulatory mechanism reported for HutC was based on steric hindrance 411

of RNA polymerase (RNApol) holoenzyme access to the hut promoters (12). In the case 412

of PvirB, the fact that the HutC-binding site is localized at position -188 accounts for the 413

different role that HutC exerts on this system. Interestingly, among the list of repressors 414

that were also found to activate transcription (e.g.: CytR, LuxR, Lrp) (17, 19, 28), Fur 415

represses promoters by occluding RNApol access while it activates other promoters 416

through binding to regions far upstream of the transcription start site (8). This latter 417

example highlights similarities with the Brucella HutC that deserve to be further 418


.org/D

ownloaded from

http://jb.asm.org/

19

analyzed. Although the mechanism of HutC-mediated co-activation remains to be 419

determined, it can be speculated that it operates through the modulation of a 420

downstream-acting primary activator (e.g.: VjbR), probably by means of a mechanism 421

such as repositioning (3). Alternatively, HutC may act on PvirB by interfering with the 422

activity of negative regulators. 423

β-gal activity assays of bacteria incubated in vitro revealed that PvirB was co-activated 424

by HutC only under specific conditions that required pH 4.5 and a nutrient-deprived 425

medium (Fig. 5E), which are conditions similar to that encountered by Brucella within 426

the host cell (1, 13). In addition, the HutC-mediated regulation of PvirB required the 427

presence of UCA in the culture medium. Western blot experiments and analyses of 428

OD600 of bacterial cultures revealed that Brucella induces the Hut system in response to 429

UCA, and it is able to grow using this compound as a sole carbon source but not 430

histidine (Fig. 8). Taken together, these findings indicate that Brucella is specially 431

adapted to utilize this metabolite, which is in agreement with previous reports that 432

showed that Brucella efficiently incorporates and metabolizes UCA (2, 10). This raises 433

an intriguing question: does Brucella incorporate and metabolize UCA during its life 434

cycle within the host? It is known that UCA is present at high concentrations in 435

mammalian skin and skin secretions, where it acts as ultraviolet photoprotector or as 436

immunosuppresor (14). Nevertheless, to our knowledge, the published literature does 437

not provide information about the concentration of this compound in tissues other than 438

skin. Therefore, we cannot rule out the possibility that Brucella incorporates and 439

metabolizes UCA at a particular stage of the infection, which could provide a signal for 440

the bacterium to enhance virB expression when it is needed to overcome host defences. 441

The analyses of the interaction of HutC with both virB and hut promoters showed that 442

there is a hierarchical order of Kd values, which may have a mechanistic significance for 443


.org/D

ownloaded from

http://jb.asm.org/

20

the regulation of both systems (Fig. 2). HutC binds to PvirB with lower affinity (apparent 444

Kd = 24 nM). As affinity for Phut is 30-fold higher (apparent Kd = 0.75 nM), basal levels 445

of HutC might be sufficient for repressing the hut genes without affecting virB 446

expression. Only after induction by UCA the levels of HutC increase reaching the 447

required concentration for the binding to PvirB, as it was confirmed by western blot (Fig. 448

7). The different susceptibilities to UCA observed for the hut and virB promoters may 449

also be part of a mechanism by which, as the inducer is catabolized, HutC is enabled to 450

interact sequentially with the operator sequences. If the intracellular concentration of 451

UCA drops below 50 µM, then HutC is able to interact with Phut and repress hut 452

transcription (Fig. 3B). In this way, as consumption of UCA proceeds, HutC is 453

subsequently enabled to bind to PvirB and activate virB transcription when the inducer 454

concentration decreases below 5 µM (Fig. 3A). 455

The differences observed in affinity and susceptibility to UCA are likely due to the 456

different architectures observed for the Phut and PvirB HutC-binding sites (Fig. 4). It is 457

interesting to note that the sequence of the HutC-binding site of the B. abortus Phut is 458

present in all hut promoters of other closely-related α-proteobacteria (Fig. 4E), which 459

indicates that the ancestral sequence recognized by HutC is fully conserved among this 460

taxonomic group. Instead, the sequence recognized in PvirB resembles more the HutC-461

binding site of Klebsiella or Pseudomonas rather than that of α-proteobacterial hut 462

promoters (see Fig. 4E). This observation could evidence an evolutionary trace of the 463

acquisition of the virB operon and its regulatory sequences, which may have occurred 464

during a horizontal transfer event in the common ancestor of Brucella (29). It is worth 465

to mention that both HutC-binding motifs found in PvirB and Phut are unique in the 466

genome of B. abortus. However, we identified additional sequences that bind HutC with 467

high affinity, which are currently being investigated (R. Sieira, unpublished results). 468


.org/D

ownloaded from

http://jb.asm.org/

21

Such sequences are located within intergenic regions, upstream of open reading frames 469

unrelated to the recently discovered T4SS substrates of Brucella VceA and VceC. 470

EMSA experiments showed that HutC competes with IHF for the binding to PvirB (Fig. 471

1D). In our previous work, we found that during vegetative growth the virB expression 472

is IHF-dependent at pH 7.0 but not at pH 4.5 (23). Here, the opposite situation was 473

observed for HutC, since virB expression is HutC-dependent at pH 4.5, but not at pH 474

5.5 or 7.6 (data not shown). Based on these observations, we hypothyesize that a 475

sequential participation of IHF and HutC may be required for the proper induction of 476

virB expression. IHF probably acts by supporting a promoter structure necessary for 477

recruiting transcription factors. As BCV maturation proceeds, induction of the hut 478

system under acidic conditions may displace IHF from its binding-site, co-activating 479

expression of the virB operon in a HutC-dependent manner. In this way, induction of 480

the Hut catabolic pathway probably functions in Brucella as a way to sense homeostatic 481

variations and develop adaptive responses to ensure their survival within the host. 482

Our results showed that in Brucella, a catabolic pathway is directly linked to the 483

regulation of expression of a T4SS. Another example of interrelation between histidine 484

utilization an transcription of virulence genes was evidenced by mutations that alter 485

expression of Hut enzymes in Pseudomonas aeruginosa, which result in a decreased 486

transcription of Type-III Secretion System (T3SS) effectors and a consequent reduction 487

of cytotoxicity of the bacterium (20). Many pathogenic bacteria have acquired genes 488

coding for virulence factors through horizontal transfer, which implies that such foreign 489

genetic information had been integrated into pre-existing regulatory networks of the 490

new context. Acquisition of a functional HutC-binding site within PvirB during the 491

evolution of Brucella may eventually have resulted in a cooptation of a negative 492

regulatory protein to perform a new role; co-activating transcription of virulence genes 493


.org/D

ownloaded from

http://jb.asm.org/

22

by means of a mechanism that involves the integration of acidic and metabolic stress 494

signals. 495


.org/D

ownloaded from

http://jb.asm.org/

23

ACKNOWLEDGEMENTS 496

We thank Jeanette E. Polcz, María Georgina Davies and Dr. Juan E. Ugalde for critical 497

reading of the manuscript. We also thank Joseph Connolly for help with mass 498

spectrometry. This work was supported by grants PICT05-38207 to R.S., PICT05-499

38272 to D.J.C., and PICT06-651 to R.A.U. from Agencia Nacional de Promoción 500

Científica y Tecnológica, Buenos Aires, Argentina. 501


.org/D

ownloaded from

http://jb.asm.org/

24

REFERENCES 502

1. Boschiroli, M. L., S. Ouahrani-Bettache, V. Foulongne, S. Michaux-503

Charachon, G. Bourg, A. Allardet-Servent, C. Cazevieille, J. P. Liautard, 504 M. Ramuz, and D. O'Callaghan. 2002. The Brucella suis virB operon is 505 induced intracellularly in macrophages. Proc Natl Acad Sci U S A 99:1544-9. 506

2. Broughton, E. S., and K. L. Jahans. 1997. The differentiation of Brucella 507 species by substrate specific tetrazolium reduction. Vet Microbiol 57:253-71. 508

3. Browning, D. F., and S. J. Busby. 2004. The regulation of bacterial 509 transcription initiation. Nat Rev Microbiol 2:57-65. 510

4. Cascales, E., and P. J. Christie. 2003. The versatile bacterial type IV secretion 511 systems. Nat Rev Microbiol 1:137-49. 512

5. Comerci, D. J., M. J. Martinez-Lorenzo, R. Sieira, J. P. Gorvel, and R. A. 513 Ugalde. 2001. Essential role of the VirB machinery in the maturation of the 514 Brucella abortus-containing vacuole. Cell Microbiol 3:159-68. 515

6. Corbel, M. J. 1997. Brucellosis: an overview. Emerg Infect Dis 3:213-21. 516 7. de Jong, M. F., Y. H. Sun, A. B. den Hartigh, J. M. van Dijl, and R. M. 517

Tsolis. 2008. Identification of VceA and VceC, two members of the VjbR 518 regulon that are translocated into macrophages by the Brucella type IV secretion 519 system. Mol Microbiol 70:1378-96. 520

8. Delany, I., R. Rappuoli, and V. Scarlato. 2004. Fur functions as an activator 521 and as a repressor of putative virulence genes in Neisseria meningitidis. Mol 522 Microbiol 52:1081-90. 523

9. Delrue, R. M., C. Deschamps, S. Leonard, C. Nijskens, I. Danese, J. M. 524 Schaus, S. Bonnot, J. Ferooz, A. Tibor, X. De Bolle, and J. J. Letesson. 2005. 525 A quorum-sensing regulator controls expression of both the type IV secretion 526 system and the flagellar apparatus of Brucella melitensis. Cell Microbiol 527 7:1151-61. 528

10. Dorrell, N., P. Guigue-Talet, S. Spencer, V. Foulonge, D. O'Callaghan, and 529 B. W. Wren. 1999. Investigation into the role of the response regulator NtrC in 530 the metabolism and virulence of Brucella suis. Microb Pathog 27:1-11. 531

11. Goldberg, R. B., and B. Magasanik. 1975. Gene order of the histidine 532 utilization (hut) operons in Klebsiella aerogenes. J Bacteriol 122:1025-31. 533

12. Hu, L., S. L. Allison, and A. T. Phillips. 1989. Identification of multiple 534 repressor recognition sites in the hut system of Pseudomonas putida. J Bacteriol 535 171:4189-95. 536

13. Kohler, S., V. Foulongne, S. Ouahrani-Bettache, G. Bourg, J. Teyssier, M. 537 Ramuz, and J. P. Liautard. 2002. The analysis of the intramacrophagic 538 virulome of Brucella suis deciphers the environment encountered by the 539 pathogen inside the macrophage host cell. Proc Natl Acad Sci U S A 99:15711-540 6. 541

14. Norval, M., P. McLoone, A. Lesiak, and J. Narbutt. 2008. The effect of 542 chronic ultraviolet radiation on the human immune system. Photochem 543 Photobiol 84:19-28. 544

15. O'Callaghan, D., C. Cazevieille, A. Allardet-Servent, M. L. Boschiroli, G. 545 Bourg, V. Foulongne, P. Frutos, Y. Kulakov, and M. Ramuz. 1999. A 546 homologue of the Agrobacterium tumefaciens VirB and Bordetella pertussis Ptl 547 type IV secretion systems is essential for intracellular survival of Brucella suis. 548 Mol Microbiol 33:1210-20. 549


.org/D

ownloaded from

http://jb.asm.org/

25

16. Osuna, R., A. Schwacha, and R. A. Bender. 1994. Identification of the hutUH 550 operator (hutUo) from Klebsiella aerogenes by DNA deletion analysis. J 551 Bacteriol 176:5525-9. 552

17. Pompeani, A. J., J. J. Irgon, M. F. Berger, M. L. Bulyk, N. S. Wingreen, and 553 B. L. Bassler. 2008. The Vibrio harveyi master quorum-sensing regulator, 554 LuxR, a TetR-type protein is both an activator and a repressor: DNA recognition 555 and binding specificity at target promoters. Mol Microbiol 70:76-88. 556

18. Rambow-Larsen, A. A., E. M. Petersen, C. R. Gourley, and G. A. Splitter. 557 2009. Brucella regulators: self-control in a hostile environment. Trends 558 Microbiol. 559

19. Rasmussen, P. B., B. Holst, and P. Valentin-Hansen. 1996. Dual-function 560 regulators: the cAMP receptor protein and the CytR regulator can act either to 561 repress or to activate transcription depending on the context. Proc Natl Acad Sci 562 U S A 93:10151-5. 563

20. Rietsch, A., M. C. Wolfgang, and J. J. Mekalanos. 2004. Effect of metabolic 564 imbalance on expression of type III secretion genes in Pseudomonas aeruginosa. 565 Infect Immun 72:1383-90. 566

21. Rouot, B., M. T. Alvarez-Martinez, C. Marius, P. Menanteau, L. 567

Guilloteau, R. A. Boigegrain, R. Zumbihl, D. O'Callaghan, N. Domke, and 568 C. Baron. 2003. Production of the type IV secretion system differs among 569 Brucella species as revealed with VirB5- and VirB8-specific antisera. Infect 570 Immun 71:1075-82. 571

22. Schafer, A., A. Tauch, W. Jager, J. Kalinowski, G. Thierbach, and A. 572 Puhler. 1994. Small mobilizable multi-purpose cloning vectors derived from the 573 Escherichia coli plasmids pK18 and pK19: selection of defined deletions in the 574 chromosome of Corynebacterium glutamicum. Gene 145:69-73. 575

23. Sieira, R., D. J. Comerci, L. I. Pietrasanta, and R. A. Ugalde. 2004. 576 Integration host factor is involved in transcriptional regulation of the Brucella 577 abortus virB operon. Mol Microbiol 54:808-22. 578

24. Sieira, R., D. J. Comerci, D. O. Sanchez, and R. A. Ugalde. 2000. A 579 homologue of an operon required for DNA transfer in Agrobacterium is required 580 in Brucella abortus for virulence and intracellular multiplication. J Bacteriol 581 182:4849-55. 582

25. Smith, G. R., and B. Magasanik. 1971. Nature and self-regulated synthesis of 583 the repressor of the hut operons in Salmonella typhimurium. Proc Natl Acad Sci 584 U S A 68:1493-7. 585

26. Starr, T., T. W. Ng, T. D. Wehrly, L. A. Knodler, and J. Celli. 2008. 586 Brucella intracellular replication requires trafficking through the late 587 endosomal/lysosomal compartment. Traffic 9:678-94. 588

27. Ugalde, J. E., C. Czibener, M. F. Feldman, and R. A. Ugalde. 2000. 589 Identification and characterization of the Brucella abortus phosphoglucomutase 590 gene: role of lipopolysaccharide in virulence and intracellular multiplication. 591 Infect Immun 68:5716-23. 592

28. van der Woude, M. W., L. S. Kaltenbach, and D. A. Low. 1995. Leucine-593 responsive regulatory protein plays dual roles as both an activator and a 594 repressor of the Escherichia coli pap fimbrial operon. Mol Microbiol 17:303-12. 595

29. Wattam, A. R., K. P. Williams, E. E. Snyder, N. F. Almeida, Jr., M. Shukla, 596

A. W. Dickerman, O. R. Crasta, R. Kenyon, J. Lu, J. M. Shallom, H. Yoo, 597 T. A. Ficht, R. M. Tsolis, C. Munk, R. Tapia, C. S. Han, J. C. Detter, D. 598 Bruce, T. S. Brettin, B. W. Sobral, S. M. Boyle, and J. C. Setubal. 2009. 599


.org/D

ownloaded from

http://jb.asm.org/

26

Analysis of ten Brucella genomes reveals evidence for horizontal gene transfer 600 despite a preferred intracellular lifestyle. J Bacteriol 191:3569-79. 601

30. Zhang, X. X., and P. B. Rainey. 2007. Genetic analysis of the histidine 602 utilization (hut) genes in Pseudomonas fluorescens SBW25. Genetics 176:2165-603 76. 604

605

606


.org/D

ownloaded from

http://jb.asm.org/

27

FIGURE LEGENDS 607

Figure 1: Analysis of binding of rHutC to PvirB. A. Schematic representation of genomic 608

sequences corresponding to PvirB (grey bar) and the first gene of the virB operon (virB1) 609

(stripped bar); radioactive-labelled probes used for EMSA (black bars); and unlabelled 610

competitors (white bars). White box: IHF-binding site. B. Specificity of binding of 611

rHutC to PvirB. EMSA performed with rHutC and a control probe or probe PvirB. C. 612

Competition assay. EMSA performed with probe PvirB, unlabelled competitors and 613

rHutC. The mass of unlabelled competitors added to each reaction was as follows: lanes 614

1 and 2, no competitor; lanes 3 and 5, 150 ng; lanes 4 and 6, 300 ng. Mass of rHutC: 615

lane1, no rHutC; lanes 2-6: 33 ng. D. Co-incubation of rHutC and rIHF with PvirB. 616

EMSA performed with probe PvirB, rIHF and/or rHutC at the indicated concentrations. 617

618

Figure 2: Analysis of binding affinity of HutC to PvirB or Phut. A. EMSA performed with 619

probe PvirB and increasing concentrations of rHutC. B. Determination of the apparent 620

dissociation constant of rHutC for the binding to PvirB. Intensity of the bands obtained 621

from two independent experiments performed as shown in (A) was measured. The 622

apparent dissociation constant (Kd) was determined graphically from the plot of 623

fractions of free and protein-bound probes. C. EMSA performed with probe Phut and 624

increasing concentrations of rHutC. D. Determination of the apparent dissociation 625

constant of rHutC for binding to Phut. Intensity of the bands obtained from two 626

independent experiments performed as shown in (C) was measured and the apparent 627

dissociation constant (Kd) was determined as in (B). 628

629

Figure 3: Effect of UCA on DNA-binding activity of HutC. A. EMSA performed with 630

rIHF or rHutC incubated with probe PvirB and increasing concentrations of UCA as 631


.org/D

ownloaded from

http://jb.asm.org/

28

indicated. Concentration of rIHF: 70 nM; Concentration of rHutC: 25 nM. B. EMSA 632

performed with rHutC incubated with probe Phut and increasing concentrations of UCA 633

as indicated. Concentration of rHutC: 0.55 nM. 634

635

Figure 4: Identification of the HutC-binding sites. A. DNase I Footprinting experiment 636

carried out with probe Phut and increasing concentrations of HutC as indicated. Lanes A 637

and G are DNA sequence reactions performed by the Sanger method. The HutC-638

protected region is indicated by an open rectangle. Arrowheads indicate DNase I-639

hypersensitized sites. B. DNase I Footprinting experiment carried out with probe PvirB 640

and increasing concentrations of HutC as indicated. HutC-protected region and 641

hypersensitized sites are indicated as in (A). C. Schematic representation of the HutC-642

protected sequences in Phut. Protected region and DNase I-hypersensitized sites are 643

indicated as in (A). Nucleotides that match the previously described HutC-binding sites 644

of Klebsiella or Pseudomonas are highlighted in grey. D. Schematic representation of 645

the HutC-protected sequences in PvirB. Protected region and DNase I-hypersensitized 646

sites are indicated as in (B). IHF-binding site sequences are indicated as bold italic 647

letters. Nucleotides that match the previously described HutC-binding sites are indicated 648

as in (C). D. Comparison of the 14 pb-sequences located at the center of the HutC-649

protected regions of the B. abortus Phut and PvirB, the HutC-binding sites of the hut 650

operators of Klebsiella and Pseudomonas, and sequences located within the hut 651

promoter regions of different closely-related α-proteobacterial species. Dyad symmetry 652

of sequences is indicated by arrows. 653

654

Figure 5: Role of HutC in control of activity of the virB and hut promoters. Schematic 655

representation of the PvirB-lacZ (A) and Phut-lacZ (B) transcriptional fusion constructs. 656


.org/D

ownloaded from

http://jb.asm.org/

29

C. Intracellular β-Gal activity of strains B. abortus PvirB-lacZ (wt), B. abortus ∆hutC 657

PvirB-lacZ (∆hutC) or B. abortus ∆hutC-KI PvirB-lacZ (KI). Cultures of J774 658

macrophages were infected with strains harbouring lacZ transcriptional fusions. At 5 h 659

p.i., cells were disrupted and β-galactosidase activity of intracellular bacteria was 660

determined. D. Intracellular β-Gal activity of strains B. abortus Phut-lacZ (wt), B. 661

abortus ∆hutC Phut-lacZ (∆hutC) or B. abortus ∆hutC-KI Phut-lacZ (KI). Intracellular β-662

galactosidase activity was determined as in (C). E. β-Gal activity of strains B. abortus 663

PvirB-lacZ (wt), B. abortus ∆hutC PvirB-lacZ (∆hutC) or B. abortus ∆hutC-KI PvirB-lacZ 664

(KI) cultured in MM1 5 mM UCA at pH 4.5. Promoter activity of cultured bacteria was 665

determined as follows: strains were grown in rich medium (TSB) until exponential 666

phase (OD600 0.5-1). Subsequently, bacteria were harvested, suspended in MM1 5 mM 667

UCA, and β-galactosidase activity was determined after 4 h of cultivation. F. β-Gal 668

activity of strains B. abortus Phut-lacZ (wt), B. abortus ∆hutC Phut-lacZ (∆hutC) or B. 669

abortus ∆hutC-KI Phut-lacZ (KI) cultured in MM1 5 mM UCA at pH 4.5. Promoter 670

activity of cultured bacteria was determined as in (C). Values are means ± standard 671

deviations of duplicate wells from a representative of two experiments. *, P < 0.05, **, 672

P < 0.01 (compared to the wild type strain). 673

674

Figure 6: A. Intracellular replication of B. abortus 2308 and the deletion mutant B. 675

abortus ∆hutC in J774 macrophages. 1×105 macrophages per well were inoculated with 676

5×106 CFU of bacteria. After 1 h of incubation at 37°C, cells were washed with PBS, 677

and gentamicin and sterptomycin were added. CFU were determinated at the indicated 678

times. B. abortus 2308 (open circles), B. abortus ∆hutC (solid circles). B. Persistence of 679

B. abortus 2308, the deletion mutant B. abortus ∆hutC, and the knock-in control strain 680

B. abortus ∆hutC-KI in mice. 60-day old female mice were inoculated intraperioteneally 681


.org/D

ownloaded from

http://jb.asm.org/

30

with 1×105 CFU of B. abortus 2308 (open circles), B. abortus ∆hutC (solid circles) or B. 682

abortus ∆hutC-KI (open triangles). After 12 weeks mice were sacrificed and 683

CFU/spleen was determined. Values are means and individual determinations from a 684

representative of two independent experiments. n = 4. *, P < 0.05. 685

686

Figure 7: Western blot analysis. 687

A. B. abortus 2308 (wt), B. abortus ∆hutC (∆hutC), or B. abortus ∆hutC -KI (KI) were 688

grown in TSB until stationary phase of growth. Samples corresponding to equal 689

numbers of bacteria were submitted to 12.5% SDS-PAGE, transferred to nitrocellulose 690

membranes and developed with a mouse anti-HutC polyclonal anti-serum. 691

B. B. abortus 2308 wild type strain was grown in TSB until exponential phase (OD600 = 692

0.5-1). Subsequently, bacteria were harvested, suspended and incubated during 4 h in 693

MM1 at pH 7.0 or 4.5 with or without 5 mM UCA. Samples corresponding to equal 694

numbers of bacteria were analyzed as in (A). 695

696

Figure 8: Growth curve of B. abortus 2308 in MM1 at pH 5.5. 697

Bacteria were grown in TSB until exponential phase (OD600 = 0.5-1). Subsequently, 698

bacteria were harvested, suspended and cultured in MM1 at pH 5.5 supplemented with 5 699

mM UCA (solid circles), 5 mM histidine (solid triangles), or without the addition of any 700

carbon source (open circles). OD600 and CFU/ml were determined at different times as 701

indicated. Values are mean ± standard deviations of duplicate samples from a 702

representative of two independent experiments. 703


.org/D

ownloaded from

http://jb.asm.org/

2

_

+

5

+

6

+

3

+

4

+

1

_

_

b1 c2

+1

-201

-130 +24

Labelled

probes

Unlabelled

competitors

b1

PvirB

c2

virB1

IHF

A B C

rHutC

rHutC

(ng) _ _

Probe

rHutC

CompetitorControl PvirB

free probe

654522654522

free probe

free probe

IHF

rHutC (nM)

IHF (nM)

D25

_

85

40

65

40

45

40

35

40

25

40

_

40

PvirB-ihf-PvirB

rHutC-PvirB

rHutC-PvirB

-PvirB


.org/D

ownloaded from

http://jb.asm.org/

0 0.1

50.2

5

0.75

0.5

21

rHutC

nM0 10

05020

1052

rHutC

nM

0

0,25

0,5

0,75

1

0 1 2 3 4 5

Fra

ction

rHutC (nM)

Kd = 0.75 nM

Fra

ction

0

0,25

0,5

0,75

1

0 20 40 60 80 100

rHutC (nM)

Kd = 24 nM

A B DC

rHutC

freeprobe

rHutC

freeprobe

hut-P-PvirB


.org/D

ownloaded from

http://jb.asm.org/

+ + + + +_

+ + + + + + + + ++ __

rIHF rHutC

UCA (µM) 0 0.05

0.55 50 0 0.

050.

55 50

rHutC

0 0.05

0.55 50

free

probe

rHutC-Phut

rHutC

rIHF

A BUCA (µM)

free

probe

-PvirB

-PvirB


.org/D

ownloaded from

http://jb.asm.org/

E

D

C

caccgcataccacttgtatataagattttgttaaaaaagaattttctaatagaaccaatagtggcgtatggtgaacatatattctaaaacaattttttcttaaaagattatcttggttat

IHFHutC

-188.5

tgtttcacaataatgtatatacatattatggaaacaacaaagtgttattacatatatgtataatacctttgt

HutC

A G _ _10 5020

HutC (nM)

4030 A G _ _5 10 1005020

HutC (nM)A B

Consensus of the HutC-binding site of the Klebsiella and Pseudomonas hut promoters

Consensus of the HutC-binding site of different α-Proteobacteria hut promoters

CTTGTATGTACAAG Pseudomonas fluorescens SBW25

AATGTATATACATA Brucella abortus 2308

CTTGTATAGACAAG Klebsiella aerogenes

CTTGTATATAAGAT Brucella abortus 2308virB

promoter

Agrobacterium tumefaciens C58 Cereon

Mesorhizobium loti MAFF303099

Rhizobium etli CFN42

Ochrobactrum anthropi ATCC49188TATGTATATACATT

TATGTATATACATT

TATGTATATACATG

TATGTATATACATA

hut

promoters


.org/D

ownloaded from

http://jb.asm.org/

C

A B

E F

D

0

100

200

300

400

0

400

800

1200

β-G

al A

ctivity (

R.U

.)

lacZ

PvirB

lacZ

PhutFC

IHUG

**

wt0

∆hutC KI

300

200

100

β-G

al. A

ctivity (

M.U

.)

wt0

∆hutC KI

200

100

β-G

al. A

ctivity (

M.U

.)

*

wt ∆hutC KI wt ∆hutC KI

β-G

al A

ctivity (

R.U

.)


.org/D

ownloaded from

http://jb.asm.org/

3

4

5

Log (

CF

U/s

ple

en)

*

wt ∆hutC KI

6

210

0

106

104

103

102

101

105

CF

U/m

l

10 20 30 40 500

time p.i. (hs.)

A B


.org/D

ownloaded from

http://jb.asm.org/

TSB

wt ∆hutC KI

MM1

7.0 4.5

Strain

pH

UCA_+ +_

A B

HutC HutC


.org/D

ownloaded from

http://jb.asm.org/

time (hs.)

0 10 20 30 40 50

0

0,5

1

1,5

2

2,5

3

108

107

109

109

CF

U/m

lO

D600/O

D600(t

=0)


.org/D

ownloaded from

http://jb.asm.org/

Date post:	21-Jun-2019
Category:	Documents
Upload:	duongkhue
View:	212 times
Download:	0 times

Metabolic control of virulence genes in...

Documents