Metabolic responses of novel cellulolytic andsaccharolytic agricultural soil Bacteria to oxygenemi_2128 845..861
Stefanie Schellenberger, Steffen Kolb andHarold L. Drake*Department of Ecological Microbiology, University ofBayreuth, 95440 Bayreuth, Germany.
Summary
Cellulose is the most abundant biopolymer in terres-trial ecosystems and is degraded by microbial com-munities in soils. However, relatively little is knownabout the diversity and function of soil prokaryotesthat might participate in the overall degradation ofthis biopolymer. The active cellulolytic and saccharo-lytic Bacteria in an agricultural soil were evaluated by16S rRNA 13C-based stable isotope probing. Cellu-lose, cellobiose and glucose were mineralized underoxic conditions in soil slurries to carbon dioxide.Under anoxic conditions, these substrates were con-verted primarily to acetate, butyrate, carbon dioxide,hydrogen and traces of propionate and iso-butyrate;the production of these fermentation end-productswas concomitant with the apparent reduction ofiron(III). [13C]-cellulose was mainly degraded underoxic conditions by novel family-level taxa of theBacteroidetes and Chloroflexi, and a known family-level taxon of Planctomycetes, whereas degradationunder anoxic conditions was facilitated by the Kin-eosporiaceae (Actinobacteria) and cluster III Clostridi-aceae and novel clusters within Bacteroidetes. Activeaerobic sub-communities in oxic [13C]-cellobiose and[13C]-glucose treatments were dominated by Intra-sporangiaceae and Micrococcaceae (Actinobacteria)whereas active cluster I Clostridiaceae (Firmicutes)were prevalent in anoxic treatments. A very largenumber (i.e. 28) of the detected taxa did not closelyaffiliate with known families, and active Archaea werenot detected in any of the treatments. These collectivefindings suggest that: (i) a large uncultured diversityof soil Bacteria was involved in the utilization of cel-lulose and products of its hydrolysis, (ii) the activesaccharolytic community differed phylogeneticallyfrom the active cellulolytic community, (iii) oxygen
availability impacted differentially on the activity oftaxa and (iv) different redox guilds (e.g. fermentersand iron reducers) compete or interact during cellu-lose degradation in aerated soils.
Introduction
Cellulose constitutes 35–50% of plant dry weight, is themost abundant biopolymer and can be degraded byfungal and prokaryotic communities in soils (Lynd et al.,2002; Bayer et al., 2006). The degradation of plantbiomass by soil microbial communities is a major processin the global carbon cycle and releases 40–68 Pg carbonper year into the atmosphere (Falkowski et al., 2000; Lal,2008). Cellulose in aerated soils is primarily mineralized tocarbon dioxide (Beguin and Aubert, 1994). In flooded orwetland soils, cellulose and its initial main breakdownproducts cellobiose and glucose are decomposed byanaerobes (i.e. microorganisms capable of anaerobiosis,which includes obligate anaerobes and facultativeaerobes) into fatty acids, alcohols, molecular hydrogenand carbon dioxide, physiological events that can be sub-sequently coupled to methanogenesis (Westermann,1993; Drake et al., 2009). Anaerobic degradation in tran-sient anoxic micro zones of aerated soils (Sexstone et al.,1985; Zausig et al., 1993) may be similar to that of floodedand wetland soils, except that methane is usually notformed and the oxidation of transient organic intermedi-ates such as acetate is coupled to alternative redox pro-cesses such as denitrification, the reduction of iron or thereduction of oxygen when conditions become oxic (Küseland Drake, 1995; Küsel et al., 2002).
Hydrolysis of cellulose has been extensively studied(Beguin and Aubert, 1994; Lynd et al., 2002). Cellulosemust first be converted to soluble cellodextrins, cellobioseand glucose by extracellular hydrolytic enzymes prior tomicrobial assimilation (Bayer et al., 2006; Doi, 2008). Cel-lobiose and glucose can be metabolized by a broad diver-sity of cellulolytic and saccharolytic bacteria (Lynd et al.,2002; Bayer et al., 2006). Saccharolytic prokaryotes actas efficient secondary utilizers of cellulose-derived sugarsand keep them at low non-inhibitory in situ concentrations(Bayer et al., 1994; Doi, 2008).
Actinobacteria, Bacteroidetes-Flavobacteria group,and Alpha-, Beta-, Gamma-, and Deltaproteobacteriahave been identified as potential members of the
cellulose-degrading community of aerated agricultural soil(Bernard et al., 2007; Haichar et al., 2007). Cellulolyticcommunities of agricultural soils have been analysed pri-marily under oxic conditions. Although the existence ofanaerobic and aerobic cellulolytic Bacteria is well docu-mented (Lynd et al., 2002), their relevance to the cellulosedegradation in aerated agricultural soils is unresolved.Thus, little is known about how the availability of molecu-lar oxygen affects soil prokaryotes that might participate inthe overall degradation of cellulose and cellulose-derivedcellodextrins. The main objective of this study was toinvestigate the impact of oxic and anoxic conditions on themetabolic responses of cellulolytic and saccharolytic bac-teria in an agricultural soil. The two metabolic responsesassessed were: (i) the dissimilation of cellulose, cello-biose, or glucose to products and (ii) the assimilation ofcarbon derived from [13C]-labelled cellulose, cellobiose orglucose (thus facilitating the assessment of taxa by stableisotope probing).
Results
Product profiles of soil supplemented with cellulose,cellobiose or glucose
Primary hydrolytic products of cellulose (i.e. cellobiose orglucose) were not detected during either oxic or anoxicincubations supplemented with celluose (i.e. they werebelow the detection limit of 50 mM). Supplemental cellu-lose stimulated the production of carbon dioxide byapproximately 50% under both oxic and anoxic conditions(data not shown). Equal amounts of carbon dioxide(approximately 30 mM) were formed with [12C]-celluloseand [13C]-cellulose treatments under oxic conditions(Fig. 1A). Although the amounts of products and time atwhich they were produced varied between these twotreatments under anoxic conditions, the pattern of productprofiles was qualitatively similar (Fig. 1A). Organic prod-ucts were negligible during the first several weeks ofincubation in anoxic cellulose treatments, following whichacetate became the main organic product. The resultsbetween [12C]-cellulose and [13C]-cellulose treatmentswere not always similar. For example, carbon dioxideaccumulated to approximately 2 mM (12C) and 7 mM (13C)under anoxic conditions, and molecular hydrogen concen-trations were below 0.3 mM in 12C treatments, but about7 mM in 13C treatments (Fig. 1A). The reasons for thesediscrepancies are unclear.
Cellobiose and glucose were pulsed periodically at lowconcentrations (approximately 0.25 mM) so that the soilmicrobial biome was not subjected to concentrations thatwere higher than necessary. Both cellobiose and glucosewere consumed without apparent delay in oxic and anoxicincubations (Fig. 1B and C), indicating that the microbial
biome of the soil was poised to both aerobically andanaerobically consume these substrates. Approximately3 mM cellobiose or glucose was consumed in total. Theproduct profiles with cellobiose and glucose were similar,although the amounts of soluble carbonaceous productswere higher in cellobiose treatments, a result consistentwith the fact that cellobiose has two glucose equivalents.
Oxic conditions led to the transient accumulation ofglucose in cellobiose treatments, whereas glucose wasnot detected in cellobiose treatments under anoxic condi-tions (Fig. 1B). Cellobiose and glucose treatments yieldedacetate followed by butyrate and propionate as the mainsoluble carbonaceous products under anoxic conditions(Fig. 1B and C). Traces (0.15 mM or less) of iso-butyratewere occasionally detected (data not shown). The produc-tion of molecular hydrogen was only detected in anoxictreatments and paralleled the production of carbondioxide.
Iron(II) concentrations increased in all anoxic micro-cosms following a lag phase (Fig. 1A–C). Once formed,iron(II) did not appear to be a stable end-product in cel-lulose treatments, in that its concentration decreased.Nitrate was present at the beginning of incubation at con-centrations approximating 0.6 � 0.1 mM and was con-sumed in both oxic and anoxic treatments supplementedwith cellulose, cellobiose and glucose (based on the lackof detectable nitrate at the end of the experiment; data notshown), indicating that it was subject to either assimilationor dissimilation. pH was stable at approximately 6.5 � 0.2in oxic incubations but increased to approximately7.4 � 0.2 in anoxic incubations. Methane was notdetected in any of the microcosms.
Occurrence of labelling in prokaryotic domains
Labelling was only detected in the domain Bacteria,i.e. terminal restriction fragment length polymorphism(TRFLP) profiles of archaeal 16S rRNA genes showed nodifferences between [13C] and [12C] treatments (data notshown). This general result suggested that mesophilicArchaea were of minor to no consequence to the primaryconsumption of supplemental substrates. Thus, theresults delineated below pertain only to the domainBacteria.
Identification of active Bacteria in [13C]-cellulose,[13C]-cellobiose and [13C]-glucose treatments
A total of 834 sequences were analysed from heavyfractions, approximately half of which were labelledphylotypes. Unlabelled phylotypes in heavy fractions hadhigh G + C contents (53–61%) and may have thus beenunfolded RNA molecules yielding buoyant densitiessimilar to labelled phylotypes (Lueders et al., 2004a).
Terminal restriction fragments (TRFs) 438, 466, 490,507, 525 and 540 bp were observed at days 35 and 70 inthe oxic cellulose treatment; TRFs 80, 443, 456, 473, 497and 503 bp were detected at day 70 (Fig. 2). Labelledphylotypes obtained from gene libraries from oxic cellu-
lose treatments had similar frequencies and no phylotypewas dominant (Table 2). The TRFs were identified asknown and novel family-level taxa within the phyla Acti-nobacteria, Alphaproteobacteria, Bacteroidetes, Betapro-teobacteria, Chloroflexi, Deltaproteobacteria, Firmicutes,
0 10 200 10 20
0 10 200 10 20
↑ ↑ ↑0 4 8 12
0
10
20
30
40
50
↑↑
0 4 8 12
0
10
20
30
40
50
pu
lsed
su
bstr
ate
[m
M]
CO
2,
H2,
Fe
2+
[mM
]
↑
B Cellobiose
C Glucose
CO
2,
H2,
Fe
2+
[mM
]
fatt
y a
cid
s [
mM
]
↑ ↑ ↑ ↑↑ ↑ ↑
pu
lsed
su
bstr
ate
[m
M]
Time [days]
0 40 80
0
10
20
30
40
50
A Cellulose
0 40 800 40 80
CO
2,
H2,
Fe
2+
[mM
]
fatt
y a
cid
s [
mM
]
↑ ↑ ↑↑ ↑ ↑0
2
4
6
8
10 OXIC ANOXIC
0.0
0.2
0.4
0.6
0
2
4
6
8
10
0.0
0.2
0.4
0.6
fatt
y a
cid
s [
mM
]
0
2
4
6
8
10
Fig. 1. Degradation of cellulose (A), cellobiose (B) and glucose (C) in soil slurries. Values are the means of triplicate microcosms([13C-U]-cellobiose, [13C-U]-glucose), duplicate microcosms ([13C-U]-cellulose, [12C]-cellobiose, [12C]-glucose), or a single microcosm([12C]-cellulose). Error bars indicate the standard deviation. Concentrations of compounds in unamended soil microcosms were subtractedfrom product concentrations in amended microcosms; the difference is shown. Solid symbols are values from microcosms amended with[13C]-substrates, and open symbols are values from microcosms amended with [12C]-substrates. Symbols: cellobiose; � glucose; � acetate;
butyrate; propionate; � carbon dioxide; molecular hydrogen; � iron(II). Arrows indicate when samples where obtained for stableisotope probing analyses.
Metabolic response of soil cellulose degraders 847
Gammaproteobacteria, Planctomycetes and two deep-branching groups within Bacteria (Bac2) and Proteobac-teria (Prot1) (Tables 1 and 2).
The TRFs 205, 490, 522, 540 and 899 bp occurred at day35 in anoxic cellulose treatments; TRFs 143 and 149 bpwere detected at day 70 (Fig. S1). The most intensiveTRFs were affiliated with the frequently detected phylo-types of Actinobacteria, Bacteroidetes and Firmicutes(Tables 1 and 2). The TRFs of lower relative fluorescencewere assigned to Alphaproteobacteria, Betaproteobacte-ria, Deltaproteobacteria and deep-branching groups ofBacteria (Bac1, Bac3) (Tables 1 and 2).
The TRFs 163 and 279 bp showed highest relative fluo-rescence in oxic cellobiose treatments and were affiliatedwith the phylum Actinobacteria (Fig. S2, Table 1), whichwas also dominant in clone libraries (Table 2). However,some less frequent TRFs (i.e. 474, 523, 534 and 890 bp)could not be assigned to any 16S rRNA gene phylotype.
The most dominant TRF 523 bp in anoxic cellobiosetreatments affiliated with the phylum Firmicutes (Fig. S3,Table 2). Based on its prevalence in TRFLP profiles, phy-lotypes of this phylum were frequent in gene libraries(Table 2). The TRF 494 bp was only present at day 4 andwas affiliated with the phyla Gammaproteobacteria andDeltaproteobacteria (Tables 1 and 2).
The TRFs 164, 476 and 526 bp in oxic glucose treat-ments were affiliated with different families of the phylaActinobacteria and Betaproteobacteria (Fig. S4, Table 1)and were prevalent in gene libraries (Table 2). TRFs 143and 279 bp had lower relative fluorescence and affiliatedwith families of the phyla Actinobacteria, Betaproteobac-teria and Deltaproteobacteria (Tables 1 and 2). The TRF520 bp was the dominant labelled TRF in anoxic glucosetreatments and was affiliated with the phylum Firmicutes,which also represented the most frequent phylotype in thecorresponding gene library (Fig. S5, Tables 1 and 2). TheTRF 496 bp was assigned to the phylum Gammaproteo-bacteria (Table 1). The TRF 508 bp could not be identi-fied, although it exhibited a relative fluorescence of about10%.
Major taxa of [13C]-cellulose, [13C]-cellobiose and[13C]-glucose treatments
Phylotypes belonging to the family Planctomycetaceae(Planctomycetes) and four novel family-level operationaltaxonomic units in the orders Sphingobacteriales(Sphingo1–4; Bacteroidetes) and Dehalococcoidetes(Deha1; Chloroflexi) were exclusively found in oxic cellu-lose treatments (Table 2; Fig. 3). In contrast, members ofthe phylum Actinobacteria were primary assimilators ofsubstrate-derived carbon in oxic treatments with [13C]-glucose and [13C]-cellobiose. The family Micrococcaceaewas prevalent in both glucose and cellobiose treatments,whereas the family Intrasporangiaceae was only preva-lent in glucose treatments. Members of these two familieswere only minimally labelled in soils supplemented withcellulose (Fig. 4; Table 2).
The phylum Firmicutes was prevalent in all anoxictreatments (Table 2), and almost all labelled phylotypesof this phylum were related to the family Clostridiaceaeand clustered together with phylogenetic sub-groups ofcellulolytic (Cluster III) and saccharolytic (Cluster I)species (Fig. 5). An unclassified cluster (Cellu1) withinthe phylum Bacteroidetes and the family Kineospori-aceae (phylum Actinobacteria) were major active taxa inthe anoxic cellulose treatments (Table 2). It is not likelythat Kineosporiaceae was labelled by cross-feeding oncellulose-derived cellodextrines, because this phylumwas not labelled in anoxic glucose and cellobiosetreatments.
0
10
20
30
40
50
0
10
20
30
40
500
10
20
30
40
50
A [13C]-Cellulose (Oxic)R
ela
tive F
luo
rescen
ce
[%]
0 days
B [12C]-Cellulose (Oxic)
35 days
70 days
T-RF length [bp]70 200 500 600450
80bp
443bp 456bp
466bp
473bp
490bp
490bp497bp
507bp
503bp
540bp
540bp
525bp
0
10
20
30
40
50
0
10
20
30
40
50
35 days
Rela
tive F
luo
resc
en
ce
[%]
70 days
T-RF length [bp]70 200 500 600450
443bp
466bp
473bp
490bp
490bp
497bp
503bp
438bp
0
10
20
30
40
50
0
10
20
30
40
500
10
20
30
40
50
A [13C]-Cellulose (Oxic)R
ela
tive F
luo
rescen
ce
[%]
0 days
B [12C]-Cellulose (Oxic)
35 days
70 days
T-RF length [bp]70 200 500 600450
80bp
443bp 456bp
466bp
473bp
490bp
490bp497bp
507bp
503bp
540bp
540bp
525bp
0
10
20
30
40
50
0
10
20
30
40
50
35 days
Rela
tive F
luo
resc
en
ce
[%]
70 days
T-RF length [bp]70 200 500 600450
443bp
466bp
473bp
490bp
490bp
497bp
503bp
438bp438bp
Fig. 2. Bacterial 16S rRNA cDNA TRFLP patterns in heavyfractions (fraction 3 + 4: 1.181–1.183 g ml-1) of cellulose-amendedoxic microcosms. (A) [13C]-cellulose treatment after 0, 35 and70 days. (B) [12C]-cellulose treatment after 35 and 70 days.[13C]-labelled TRFs are indicated by their length and marked byan arrow (80, 438, 443, 456, 466, 473, 490, 497, 503, 507, 525and 540 bp).
a. Based on experimental gene libraries.b. First doubtless detection at day x in heavy RNA fraction.c. Novel family/deep-branching group based on 16S rRNA gene similarities < 87% to next cultivated species.n.i., not identified.
Metabolic response of soil cellulose degraders 849
Table 2. Relative abundances and affiliated operational taxonomic units (OTUs) of labelled phylotypes obtained from 16S rRNA cDNA genelibraries from heavy fractions of [13C]-incubations.
Fig. 3. Phylogenetic tree of 16S rRNA cDNA sequences (bold) and reference sequences unrelated to the phyla Firmicutes or Actinobacteria.Accession numbers are in parentheses, and operational taxonomic unit designations are per Table 2. Shaded areas highlight labelled taxa.Sequences indicative of novel families are marked with an asterisk (*). The tree was calculated with AXML (50% filter; 576 valid positionsbetween positions 130 and 817 of the 16S rRNA gene of Escherichia coli). Dots at nodes indicate confirmation of topology by neighbor joiningand parsimony using the same dataset. The out group was Methanosarcina barkeri (AF028692). Scale bar, 10% evolutionary distance. ox,oxic treatment; anox, anoxic treatment; C, cellulose; B, cellobiose; G, glucose.
Metabolic response of soil cellulose degraders 851
Fig. 4. Phylogenetic tree of 16S rRNA cDNA sequences (bold) and reference sequences of the phylum Actinobacteria. Accession numbersare in parentheses, and operational taxonomic unit designations are per Table 2. Shaded areas highlight labelled taxa. Sequences indicativeof novel families are marked with an asterisk (*). The tree was calculated with AXML (50% filter; 592 valid positions between positions 101and 727 of the 16S rRNA gene of Escherichia coli). Dots at nodes indicate confirmation of topology by neighbor joining and parsimony usingthe same dataset. The out group was Methanosarcina barkeri (AF028692). Scale bar, 10% evolutionary distance. ox, oxic treatment; anox,anoxic treatment; C, cellulose; B, cellobiose; G, glucose.
Fig. 5. Phylogenetic tree of 16S rRNA cDNA sequences (bold) and reference sequences of the phylum Firmicutes. Accession numbers are inparentheses, and operational taxonomic unit designations are per Table 2. Shaded areas highlight labelled taxa. Sequences indicative of novelfamilies are marked with an asterisk (*). The tree was calculated with AXML (50% filter; 623 valid positions between positions 136 and 830 ofthe 16S rRNA gene of Escherichia coli). Dots at nodes indicate confirmation of topology by neighbor joining and parsimony using the samedataset. The out group was Methanosarcina barkeri (AF028692). Scale bar, 10% evolutionary distance. ox, oxic treatment; anox, anoxictreatment; C, cellulose; B, cellobiose; G, glucose.
Metabolic response of soil cellulose degraders 853
Metabolism of supplemental cellulose, cellobioseand glucose
Only 38–61% of supplemental carbon was recovered ascarbon dioxide in oxic treatments, indicating that a sub-stantial amount of supplemental carbon was assimilatedduring aerobic metabolism. This trend is consistent withstudies that have assessed the incorporation of carbonfrom [13C]-labelled compounds into soil biomass (e.g.DeForest et al., 2004; Fontaine et al., 2004). The accu-mulation of glucose in oxic cellobiose treatments (Fig. 1)may have been caused by extracellular b-glucosidasesand a subsequent product-mediated inhibition of cello-biose hydrolysis (Kajikawa and Masaki, 1999; Lynd et al.,2002).
Products indicative of fermentation accumulated underanoxic conditions, a result consistent with previousstudies that have investigated the effects of oxygen limi-tation on aerated soils (Küsel and Drake, 1995; Degel-mann et al., 2009). Carbon recovery was above 100% inanoxic treatments, suggesting that supplemental sub-strates augmented the concomitant utilization of soilindigenous carbon (Fontaine et al., 2004). Hydro-genotrophic acetogenesis [i.e. the molecular hydrogen-dependent reduction of carbon dioxide to acetate byacetogens (Drake and Küsel, 2005; Drake et al., 2006;2008)] was likely of minor importance as the headspacewas regularly flushed with molecular nitrogen. The produc-tion of acetate, butyrate, propionate and molecular hydro-gen suggests that a combination of fermentation typeswere active under anoxic conditions, including mixed acidfermentation and butyrate fermentation, both of which arelikely sources of molecular hydrogen (Buckel, 2005;White, 2007). In contrast to forest soils that can formsuccinate and ethanol via Enterobacteriaceae-facilitatedmixed acid fermentation under anoxic conditions (Degel-mann et al., 2009), the agricultural soil investigated in thepresent study did not yield these products, suggesting thatthey were either not formed or subject to consumption.
The formation of iron(II) in anoxic treatments (Fig. 1)suggest that iron(III) was utilized as an electron sink bysoil biota (Küsel et al., 2002). Methane was not pro-duced under anoxic conditions. The primarily oxic natureof the investigated soil and the presence of alternativeelectron acceptors such as nitrate and iron would notfavour methanogenesis. The accumulation of organiccompounds (e.g. acetate) under anoxic conditions indi-cated that alternative electron sinks were insufficient fortheir anaerobic oxidation. This result is in contrastto wetland soils that yield methane via ‘intermediaryecosystem metabolism’ [i.e. by the trophically linkedprocesses that precede methanogenesis (Drake et al.,2009].
Aerobic sub-communities
Cellulolytic species are widely distributed among thedomains Bacteria and Eukarya; however, cellulolyticArchaea have not been isolated to date (Lynd et al.,2002). In this regard, no [13C]-label in archaeal phylotypeswere detected. Although soil fungi are major degradersof cellulosic biomass under oxic conditions (Lynd et al.,2002; de Boer et al., 2005), an ecological niche differen-tiation of cellulolytic fungi and cellulolytic bacteria is prob-able (de Boer et al., 2005). Plant material with low lignincontent may be more readily accessed by cellulolytic bac-teria, and aerobic cellulolytic bacteria may be more com-petitive at neutral pH (de Boer et al., 2005). Thus, theexperimental conditions (i.e. the near neutral pH and thepurity of the cellulose) might have favoured cellulolyticbacteria. However, it cannot be excluded that soil fungiwere participants in the overall consumption of cellulosein the oxic treatments.
Cellulolytic aerobic phylotypes detected in this study(Table 2, Fig. 3) have been previously identified in soil(Haichar et al., 2007). Actinobacteria comprises themajority of known aerobic cellulolytic isolates (Lynd et al.,2002; de Boer et al., 2005), but Planctomycetaceae and anovel taxon family Deha1 (Dehalococcoidetes; Chlorof-lexi) are also important aerobic cellulolytic taxa in aeratedsoils. Described species of the family Planctomycetaceae(Fig. 3) do not utilize cellulose, but species of Plancto-mycetes may be involved in the turnover of particulateorganic matter (Tadonleke, 2006). Although Dehalococ-coidetes have not been found to be cellulolytic, otherspecies in the phylum Chloroflexi are known to be cellu-lolytic aerobes (e.g. Herpetosiphon geysericola) (Garrityand Holt, 2006b).
The appearance of the novel taxa Micro1, Micro4 andActino1 (Actinobacteria), Bac2 (Bacteria), and Rhizo1and Rhizo2 (Rhizobiales; Alphaproteobacteria) (Table 2,Figs 3 and 4) in cellulose treatments suggests that theywere cellulolytic. The production of cellulases by Rhizo-bium is essential for the nodulation of plant roots (Robledoet al., 2008). Thus, certain species of Rhizobialesmight also be involved in plant biomass degradation.Sphingo1–4 might also represent cellulolytic species, ascellulolytic isolates from Sphingobacteriales (e.g. speciesof Cytophaga) are known (Smith et al., 2006).
Myxo1 (Myxococcales) and Desu1 (Desulfuromonad-ales) were novel family-level taxa in the Deltaproteobac-teria. Myxococcales contain cellulolytic species in thegenera Sorangium and Byssophaga (Küver et al., 2006).Desulfuromonadales are usually strictly anaerobic (Küveret al., 2006), but Desu1 was detected in oxic treatmentssuggesting that certain species of this taxon might also beactive under oxic conditions. Chromatiales (Gammapro-teobacteria) are not known to contain cellulolytic species
(Garrity et al., 2006). Chrom1 might thus represent thefirst known cellulolytic phylotype within this order basedon its detection in cellulose treatments and its lack ofdetection in cellobiose and glucose treatments. Thedetection of novel family-like taxon Clos3 (Clostridiaceae)in oxic treatments is somewhat surprising as clostridialaerobiosis is unknown.
Actinobacteria was the dominant cellobiose- andglucose-degrading group under oxic conditions. Micro-coccaceae was the most frequently detected family withinthis phylum, followed by Intrasporangiaceae, Kineospori-aceae and Nocardioidaceae (Table 2; Fig. 4). Glucose issubject to utilization by diverse aerobic sub-communitiesincluding Actinobacterial species (Padmanabhan et al.,2003). Intrasporangiaceae might utilize glucose ratherthan cellobiose (Lee, 2006). In this regard, a higher pro-portion of this group was detected in glucose than incellobiose treatments (Table 2). Species of Nocardioi-daceae utilize both cellobiose and glucose (Yoon et al.,2004), and sequences affiliated with this taxon werelabelled in glucose and cellulose treatments (Table 2).Micro3 and Micro2 might represent saccharolytic Actino-bacteria (Table 2; Fig. 4) as they were only detected inoxic glucose or cellobiose treatments. The detection of thenovel family-like taxon Burk1 in glucose treatments isconsistent with the ubiquitous occurrence of sugar-utilizing Burkholderiales in soil (Garrity and Holt, 2006a).
Shifts of the active aerobic community occurred duringthe utilization of cellulose. Members of the Cellulomona-daceae and of the novel family-level taxa Deha1, Micro1,Micro4, Myxo1, Rhizo1 and Desu1 were detected withinthe first 35 days of cellulose degradation (Table 1),whereas Nocardioidaceae, Clos3, Rhizo2, Sphingo1–4and the cluster Prot1 were detected at day 70. Nocardioi-daceae were also detected in oxic glucose treatments.Although the labelling of these later-occurring taxa bycross-feeding from [13C]-carbon dioxide cannot beexcluded, this cross-feeding should have been minimal asthe gaseous products were periodically removed. Late-occurring taxa in cellulose treatments might have neededlonger for the competitive utilization of cellulose or mighthave utilized soluble hydrolysis products from cellulose.The aerobic degradation of [13C]-enriched wheat straw bysoil biota also yields late-occurring phylotypes, the cellu-lolytic natures of which are uncertain (Bernard et al.,2007).
Anaerobic sub-communities
Clostridiaceae (Firmicutes) were the most frequent phy-lotype in the gene libraries and TRF profiles from anoxictreatments (Table 2). Firmicutes from the cellulose treat-ments were mainly identified as novel family-level taxaand cellulolytic cluster III of the Clostridiaceae, whereas
phylotypes labelled in cellobiose and glucose treatmentsaffiliated exclusively with saccharolytic cluster I (Table 2,Fig. 5) (Collins et al., 1994). The formation of acetate,butyrate and molecular hydrogen under anoxic conditions(Fig. 1) is consistent with clostridial fermentations (Buckel,2005; White, 2007). These findings demonstrate that dif-ferent trophic guilds of Clostridiaceae were involved in thedegradation of cellulose and soluble sugars under anoxicconditions.
The detection of Cellu1–3 (Bacteroidetes) in anoxic cel-lulose treatments is consistent with: (i) the fermentativecellulolytic nature of the phylum to which they wereaffiliated (Robert et al., 2007) and (ii) the capacity of cel-lulolytic Bacteroidetes of landfill soil to assimilate [13C]-cellulose (Li et al., 2009). Paradoxically, many phylotypeslabelled in anoxic cellulose treatments were affiliated toKineosporiaceae, yet cultivated species of this family, onlygrow aerobically and are incapable of hydrolysing cellu-lose (Pagani and Parenti, 1978; Kudo et al., 1998). Thehigh frequency of Kineosporiaceae-affiliated sequencesin the gene libraries from anoxic cellulose treatments sug-gests that novel species capable of anaerobiosis mightoccur in this taxon.
A time-dependent shift in the active anaerobic commu-nity was observed. Pelobacteraceae, Rhodocyclaceae,and Cellu2 and Cellu3 (Bacteroidetes) appeared to onlybe active during the first phase (i.e. in the first 35 days) ofanaerobic cellulose degradation, whereas Actinobacteria,Hyphomicrobiaceae and Geobacteraceae were detectedin the second phase (i.e. day 70) (Table 1). Several of thedetected Cellulomonadaceae phylotypes were affiliatedwith Cellulomonas composti, a facultative cellulolytic bac-terium (Kang et al., 2007), while others were related tospecies of Streptomyces. Although soil-occurring cellu-lolytic Streptomyces species are classically considered tobe strictly aerobic (Lynd et al., 2002), one species ofStreptomyces survives periods of anoxia (van Keulenet al., 2007), indicating that facultative species of thisgenus might exist. Paenibacillus-related phylotypes werealso detected in cellulose treatments. Paenibacillus hasnot been described as a cellulolytic genus, but somespecies of this genus hydrolyse carboxymethylcellulose(Pason et al., 2006).
Intrasporangiaceae and Hyphomicrobiaceae have beendescribed as strictly aerobic or facultative (Urakami et al.,1995; Lee, 2006), and members of these taxa weredetected in various treatments under oxic and anoxicconditions. Rhodocyclaceae, a metabolically diversefamily (Garrity and Holt, 2006a), includes facultativespecies with respiratory and fermentative metabolisms.Rhodocyclaceae were labelled in anoxic cellulose treat-ments, although this family is not known to contain cellu-lolytic species. The detection of Clos1 and Clos2 in anoxiccellulose treatments suggests the occurrence of novel
Metabolic response of soil cellulose degraders 855
families of cellulolytic Clostridiales. Bac1 and 3 detectedin cellulose treatments were distantly related to taxonomi-cally classified organisms and may represent novel cellu-lolytic Bacteria.
Aeromonadaceae, Enterobacteriaceae and Gam1(Gammaproteobacteria) and Clos4 (Clostridiales) werelabelled in anoxic cellobiose or glucose treatments. Aero-monadaceae and Enterobacteriaceae include facultativespecies that ferment sugars (Fischer-Romero et al., 1996;White, 2007), and the capacity of these same taxa in fenand forest soils to assimilate glucose-derived carbonunder anoxic conditions has been documented (Ham-berger et al., 2008; Degelmann et al., 2009).
Ferric iron reducers
Strict anaerobic or facultative aerobic taxa capable of thereduction of iron(III) were detected in anoxic treatments.Genera within the labelled families Aeromonadaceae(Aeromonas), Clostridiaceae (Clostridium), Enterobacte-riaceae (Pantoea), Pelobacteraceae (Pelobacter) andRhodocyclaceae (Ferribacterium) can also dissimilateiron(III) (Lovley et al., 2004). Geobacteraceae, a familythat dissimilates iron(III) via the oxidation of fatty acidsand alcohols (Lovley et al., 1993), was also labelled. Thedetection of these families was coincident with the forma-tion of high amounts of iron(II) in anoxic microcosms(Fig. 1). The detection of labelled Aeromonadaceae-,Enterobacteriaceae- and Geobacteraceae-affiliatedsequences in all anoxic treatments suggests that speciesof these families catalysed the saccharolytic reduction ofiron(III). Whether Clostridiaceae, Pelobacteraceae andRhodocyclaceae reduced iron(III) concomitant to theirpresumed cellulolytic activities remains unresolved.
Conclusions
A large number (i.e. 28) of the detected bacterial taxa didnot closely affiliate with known families, a finding thatillustrates how large the unresolved biota associated withthe overall decomposition of cellulolytic biomass might be.In contrast to investigations with fen soil and anoxic incu-bations of municipal waste landfill cover soil (Hambergeret al., 2008; Li et al., 2009; Wüst et al., 2009), no active(i.e. labelled) Archaea were detected, suggesting that theexperimental conditions did not favour the activity ofarchaeal community members.
[13C]-cellulose was mainly degraded under oxic condi-tions by novel family-level taxa of the Bacteroidetes andChloroflexi, and a known family-level taxon of Plancto-mycetes, whereas degradation under anoxic conditionswas facilitated by the Kineosporiaceae (Actinobacteria),cluster III Clostridiaceae and novel clusters withinBacteroidetes (Fig. 6). Bacterial taxa detected only in the
latter incubation period of cellulose treatments might pri-marily represent saccharolytic bacteria. However, phylo-types labelled in glucose and cellobiose treatments weredissimilar to those of the cellulose treatment, suggestingthat experimental conditions (e.g. time of incubation andsubstrate concentrations) selected for different commu-nity members.
Active aerobic sub-communities in oxic [13C]-cellobioseand [13C]-glucose treatments were dominated by Intra-sporangiaceae and Micrococcaceae (Actinobacteria),whereas cluster I Clostridiaceae (Firmicutes) wereprevalent in anoxic treatments (Fig. 6). The detection ofdiverse non-cellulolytic taxa in the cellulose treatments (i)was likely due in part to the labelling of organisms thatutilized cellulose-derived breakdown products (Bayeret al., 2006) and (ii) illustrates the complexity of thecellulose-linked microbial foodweb. Stable isotope
Oxic Conditions
CO2
Bacteroidetes: 4, 0
Chloroflexi: 1, 0
Planctomycetes: 0, 1
Cellulose
Actinobacteria:
1, 6
Actinobacteria:
1, 5
Anoxic Conditions
Actinobacteria: 0, 4
Bacteroidetes: 3, 0
Firmicutes: 2, 2
Firmicutes:
1, 1
Firmicutes:
0, 1
CO2, H2
Acetate
Propionate
CO2, H2
Acetate
Butyrate
Propionate
Cellobiose Glucose
Cellulose Cellobiose Glucose
Fig. 6. Model illustrating the main bacterial phyla detected duringthe degradation of saccharides under oxic and anoxic conditions.Compounds in shaded boxes are degradation products. Valuesafter the taxa are the numbers of detected family-level taxa; thefirst and second values refer to the numbers of phylotypes withoutand with cultivated members respectively.
probing can shed light on microbial foodwebs (e.g. Ham-berger et al., 2008), but cross feeding (e.g. from 13CO2)complicates interpretation of labelling patterns. Althoughcross feeding was minimized in the current study by regu-larly flushing of the microcosm headspace, the existenceof novel phylotypes need to be verified by alternativeexperimental approaches in future studies. Oxic andanoxic conditions activated different sub-communities.Thus, redox conditions in soil might be a major driver ofecological niche differentiation of Bacteria involved in cel-lulose degradation.
Experimental procedures
Sampling site and soil properties
The study site is located on the research farm ‘KlostergutScheyern’ near Munich, Germany (48°30.0′N, 11°20.7′E).The mean temperature over a 30 year period is 7.4°C with anannual precipitation of 803 mm (Sommer et al., 2003). Soilfrom the upper 20 cm of an aerated agricultural soil wassampled in the middle of April 2008. The soil type was DystricCambisol (FAO classification system; Fuka et al., 2008), andthe C/N ratio was 6.9 � 0.1. Soil pH was measured in waterand was 6.6 � 0.1. The soil water content was 20.5 � 0.2%in the upper 20 cm. Ammonium, nitrate and sulfate concen-trations were 0.06 � 0.02, 0.74 � 0.01 and 0.11 � 0.01 mmol(g soilDW)-1 respectively. Iron(II) was not detectable. Totalamounts of iron and manganese were 2.23 � 0.06 and0.08 � 0.00 mmol (g soilDW)-1 respectively. Soil samples thatwere not used immediately were stored at 2°C.
Soil incubations and [13C]-labelling experiments
Soil slurries were prepared in sterile screw capped butylrubber-stoppered 2 l flasks by mixing 500 g (fresh weight)sieved soil with 1250 ml sterile oxic or sterile anoxic water.Slurries were placed on ice and flushed with sterile N2 (100%;Rießner, Germany) or sterile air for 1 h. Soil slurries werehomogenized on an end-over-end shaker for 1.5 h at 5°C andwere then divided into 80 ml aliquots in butyl rubber-stoppered 500 ml (anoxic) or 1 l (oxic) flasks with N2 or air asatmosphere.
The slurries were incubated at 15°C on an end-over-endshaker. For cellulose-supplemented microcosms, 0.2 g of[13C-U]-cellulose (duplicate microcosms) or [12C]-cellulose(one microcosm) was added once; this amount correspondsto approximately 6.6 mmol of carbon. For cellobiose- andglucose-supplemented microcosms, [13C-U]-glucose (tripli-cate microcosms), [12C]-glucose (duplicate microcosms),[13C-U]-cellobiose (triplicate microcosms) or [12C]-cellobiose(duplicate microcosms) were pulsed periodically. The pulsedconcentrations glucose and cellobiose (0.25 mM per pulse)were five times greater than maximum concentrationsdetected in soils (Medeiros et al., 2006; Hill et al., 2008) andwere thus supplied at concentrations that represented acompromise between the low in situ concentrations andthat needed for effective [13C] incorporation in the rRNA pool.The total amounts of glucose and cellobiose pulsed were
0.24 mmol, which corresponds to 1.44 and 2.88 mmol ofcarbon respectively. Soil slurries were flushed with sterile N2
or air every 2 (oxic) or 4 (anoxic) days to minimize ‘cross-labelling’ by either the autotrophic or heterotrophic fixation ofthe [13C]-carbon dioxide formed during the degradation of theprimary labelled substrate. Samples were taken with sterilesyringes from the headspace and liquid phase. Gas sampleswere immediately measured and samples of soil slurrieswere stored at -80°C until analysed.
16S rRNA stable isotope probing
Nucleic acids were extracted from 0.6 g soil slurry (Griffithet al., 2000) and RNA was separated from DNA with theRNA/DNA Mini Kit (Qiagen, Germany). [13C]- and [12C]-RNAwere separated by isopycnic centrifugation (37 800 r.p.m.,20°C, 67 h) using a VTi 65.2 vertical rotor (Beckman, CA)(Degelmann et al., 2009). The isopycnic gradients preparedfrom soil microcosms containing a specific saccharide(including both the oxic and anoxic treatments) were centri-fuged simultaneously, yielding a total of 45 gradients (15 forcellulose, 15 for cellobiose and 15 for glucose microcosms)and three centrifugations. All gradients were set up with thesame gradient buffer solution to minimize potential differ-ences that might otherwise occur in the labelling patterns.Each gradient was separated into eleven fractions (400 mleach) and the density of each fraction was measured at 25°C(Manefield et al., 2002). Two fractions that presumablyrepresented labelled RNA (‘heavy’ fractions correspondingto fraction numbers three and four, buoyant density1.813 � 0.001–1.821 � 0.005 g ml-1) were pooled, and twofractions that represented unlabelled RNA (‘light’ fractionscorresponding to fraction numbers eight and nine, buoyantdensity 1.767 � 0.000–1.776 � 0.000 g ml-1) were pooled.RNA was precipitated with ethanol (96%), sodium acetate(3 M) and glycogen (10 mg ml-1) (Degelmann et al., 2009),and resuspended in diethyl pyrocarbonate-treated water.RNA concentrations were quantified with the Quant-iTRiboGreen RNA Assay Kit (Invitrogen, Germany). RNA ineach fraction of an exemplary gradient was quantified toevaluate separation of labelled and unlabelled RNA (Fig. S8).RNA solutions were stored at -80°C.
16S rRNA cDNA libraries and TRFLP analyses
Reverse transcriptase PCR was performed with the Super-Script VILO cDNA Synthesis Kit (Invitrogen, Germany). 16SrRNA genes of Bacteria and Archaea were amplified fromcDNA with the primersets 27f/907mr (27f: 5′ AGAGTTTGATCMTGGCTC 3′; 907rm: 5′ CCGTCAATTCMTTTGAGTTT 3′;Lane, 1991) and A364af/A934b (A364af: 5′ CGGGGYGCASCAGGCGCGAA 3′; Burggraf et al., 1997; A934b: 5′ GTGCTCCCCCGCCAATTCCT 3′; Großkopf et al., 1998) respec-tively. Bacterial 16S rRNA genes were amplified with an initialdenaturation step at 95°C (5 min), followed by four pre-cycleswith denaturation at 95°C (60 s), annealing at 40°C (60 s)and elongation at 72°C (90 s). Thirty subsequent cycles hadan annealing temperature of 50°C (30 s) and a final elonga-tion at 72°C for 10 min. Archaeal 16S rRNA genes wereamplified with an initial denaturation at 95°C (5 min), followed
Metabolic response of soil cellulose degraders 857
by 32 cycles of denaturation at 95°C (35 s), annealing at60°C (30 s), elongation at 72°C (45 s) and a final elongationstep at 72°C of 7 min.
Primers 27f and A934r were labelled with infrared dye 700for TRFLP analyses. The PCR products were purified with aDNA Gel Extraction Kit (Millipore, MA) and single-strandedextensions at terminal ends were removed with mung beanendonuclease digest (NEB, MA) (Egert and Friedrich, 2003).Subsequent restriction digestion of PCR products was per-formed with MspI (NEB, MA; bacterial 16S rRNA genes) orTaqI (NEB, MA; archaeal 16S rRNA genes) (Degelmannet al., 2009). Remaining DNA was determined withPicoGreen (Invitrogen, Germany), and TRFLP analyses wereperformed as described (Hamberger et al., 2008).
Labelled TRFs were identified by comparison of TRFLPpatterns from the heavy fractions of the [13C-] treatments withthose of the [12C] treatments. TRFLP pattern of the pooledlight and heavy fractions were compared for latest time points(Figs S6 and S7). The PCR products amplified from heavyfractions of [13C] treatments that displayed labelling werepooled per treatment and per condition (i.e. oxic or anoxic),and cloned into Escherichia coli JM 109 competent cellsusing the pGEM-T Vector System II (Promega, WI). Inserted16S rRNA cDNA genes were reamplified using vector-specific primers M13uni/M13rev (Messing, 1983) andsequenced (MacroGen, South Korea).
Identification of labelled phylotypes
Sequences derived from clone inserts were analysedand aligned using MEGA 4 (http://www.megasoftware.net;release Beta 4.1.; Tamura et al., 2007) and ARB (http://www.arb-home.de; version 2005; Ludwig et al., 2004). Actual16S rRNA gene-based databases were obtained from theSILVA-homepage (http://www.arb-silva.de; Pruesse et al.,2007). Neighbor-joining (substitution model: felsenstein) andAXML were used for phylogenetic analyses. In total, 834sequences were analysed, of which 240 were derived fromglucose, 254 from cellobiose and 340 from cellulosetreatments.
GELQUEST (version 2.6.3., SequentiX GmbH, Klein Raden,Germany) was used to analyse gels. The fluorescence valuesof TRFs were determined by normalizing the fluorescencevalue of a detected TRF against the fluorescence valueof the respective TRF in the TRFLP profile with the lowesttotal fluorescence. The TRFs with values below 5% wereexcluded. Means and standard deviations were calculated fortend measurements of [13C]-amended treatments. The TRFLPprofiles derived from ‘heavy’ RNA fractions of [13C] and [12C]treatments were compared for identifying TRFs of labelledphylotypes. The TRFs were scored as labelled when theywere only present in [13C]-profiles or when the relativeintensity in [13C]-profiles was significantly higher than in [12C]-profiles at the same respective time interval (Fig. 2, Figs S1–S5). This procedure avoided an overestimation of labelledphylotypes, as unlabelled phylotypes may co-migratetowards the ‘heavy’ RNA fraction (Manefield et al., 2002;Rangel-Castro et al., 2005). Taxa that were represented byTRFs were identified in silico by assignment to clone insertsequences using TRFCUT (Ricke et al., 2005). Sequenceswere compared using DOTUR (Schloss and Handelsmann,
2005). Sequences that showed less than 13% distance weregrouped into the same family-like operational taxonomic unit(Yarza et al., 2008).
Chemical analyses
Soil was sieved (mesh size 2 mm) and moisture content wasdetermined by weighing soil before and after drying at 105°Cfor 48 h (Schlichting et al., 1995). Iron(II) and nitrate weredetermined photometrically (Tamura et al., 1974; Small et al.,1975). Total ammonium, iron, manganese and sulfate con-centrations were analysed at the Institute for AnalyticalChemistry (ZAN, Bayreuth Center of Ecological and Environ-mental Research, Germany). A U457-S7/110 combination pHelectrode (Ingold, Germany) was utilized for measuring pH.Gases and soluble compounds were measured by gas chro-matography and high-pressure liquid chromatography(Daniel et al., 1990; Matthies et al., 1993; Küsel and Drake,1995). [13C-U]-cellulose, [13C-U]-cellobiose and [13C-U]-glucose were obtained from IsoLife BV (Wageningen,Netherlands).
Nucleotide sequence accession numbers
Sequences were deposited at EMBL under accessionnumbers FN433934 to FN434041. Accession numbersFN433987 to FN434041, FN433934 to FN433957 andFN433958 to FN433986 represent sequences derived fromcellulose, cellobiose and glucose treatments respectively,
Acknowledgements
The authors thank S. Schulz, M. Schloter and C.J. Munch forproviding soil samples, and C. Hirsch and T. Klotzbücher fortechnical assistance. This study was financially supported bythe Deutsche Forschungsgemeinschaft (DFG Ko2912/3-1 asa part of the DFG Priority Program ‘Biogeochemical Inter-faces in Soils’ SPP 1315) and the University of Bayreuth.
References
Bayer, E.A., Morag, E., and Lamed, R. (1994) The cellulo-some – a treasure-trove for biotechnology. Trends Biotech-nol 12: 379–386.
Bayer, E.A., Yuval, S., and Lamed, R. (2006) Cellulose-decomposing bacteria and their enzyme systems. In TheProkaryotes. Dworkin, M.M., Falkow, S., Rosenberg, E.,Schleifer, K.H., and Stackebrandt, E. (eds). New York,USA: Springer, pp. 578–617.
Beguin, P., and Aubert, J.P. (1994) The biologicial degrada-tion of cellulose. FEMS Microbiol Rev 13: 25–58.
Bernard, L., Mougel, C., Maron, P.A., Nowak, V., Leveque, J.,Henault, C., et al. (2007) Dynamics and identification of soilmicrobial populations actively assimilating carbon from 13C-labelled wheat residue as estimated by DNA- and RNA-SIPtechniques. Environ Microbiol 9: 752–764.
de Boer, W., Folman, L.B., Summerbell, R.C., and Boddy, L.(2005) Living in a fungal world: impact of fungi on soilbacterial niche development. FEMS Microbiol Rev 29:795–811.
Buckel, W. (2005) Special clostridial enzymes and fermenta-tion pathways. In Handbook on Clostridia. Dürre, P. (ed.).Boca Raton, FL, USA: CRC Press, pp. 177–220.
Burggraf, S., Huber, H., and Stetter, K.O. (1997) Reclassifi-cation of the crenArchaeal orders and families in accor-dance with 16S rRNA sequence data. Int J Syst Bacteriol47: 657–660.
Collins, M.D., Lawson, P.A., Willems, A., Cordoba, J.J.,Fernandez-Garayzabal, J., Garcia, P., et al. (1994) Thephylogeny of the genus Clostridium: proposal of five newgenera and eleven new species combinations. Int J SystBacteriol 44: 812–826.
Daniel, S.L., Hsu, T., Dean, S.I., and Drake, H.L. (1990)Characterization of the H2-dependent and CO-dependentchemolithotrophic potentials of the acetogens Clostridiumthermoaceticum and Acetogenium kivui. J Bacteriol 172:4464–4471.
DeForest, J.L., Zak, D.R., Pregitzer, K.S., and Burton, A.J.(2004) Atmospheric nitrate deposition and the microbialdegradation of cellobiose and vanillin in a northern hard-wood forest. Soil Biol Biochem 36: 965–971.
Degelmann, D., Kolb, S., Dumont, M., Murrell, J.C., andDrake, H.L. (2009) Enterobacteriaceae facilitate theanaerobic degradation of glucose by a forest soil. FEMSMicrobiol Ecol 68: 312–319.
Doi, R.H. (2008) Cellulases of mesophilic microorganisms.Ann NY Acad Sci 1125: 267–279.
Drake, H.L., and Küsel, K. (2005) Acetogenic clostridia. InHandbook on Clostridia. Dürre, P. (ed.). Boca Raton, FL,USA: CRC Press, pp. 719–746.
Drake, H.L., Küsel, K., and Matthies, C. (2006) Acetogenicprokaryotes. In The Prokaryotes. Balows, A., Trüper, H.G.,Dworkin, M., Harder, W., and Schleifer, K.H. (eds). NewYork, USA: Springer, pp. 354–420.
Drake, H.L., Gößner, A.S., and Daniel, S.L. (2008) Old aceto-gens, new light. Ann NY Acad Sci 1125: 100–128.
Drake, H.L., Horn, M.S., and Wüst, P.K. (2009) Intermediaryecosystem metabolism as a main driver of methanogen-esis in acidic wetland soil. Environ Microbiol Rep 1: 307–318.
Egert, M., and Friedrich, M.W. (2003) Formation of pseudo-terminal restriction fragments, a PCR-related bias affectingterminal restriction fragment length polymorphism analysisof microbial community structure. Appl Environ Microbiol69: 2555–2562.
Falkowski, P., Scholes, R.J., Boyle, E., Canadell, J., Can-efield, D., Elser, J., et al. (2000) The global carbon cycle: atest of our knowledge of earth as a system. Science 290:291–296.
Fischer-Romero, C., Tindall, B.J., and Jüttner, F. (1996) Tolu-monas auensis gen. nov., sp. nov., a toluene-producingbacterium form anoxic sediments of a freshwater lake. Int JSyst Bacteriol 46: 183–188.
Fontaine, S., Bardoux, G., Benest, D., Verdier, B., Mariotti,A., and Abbadie, L. (2004) Mechanisms of the primingeffect in a savannah soil amended with cellulose. Soil SciSoc Am J 68: 125–131.
Fuka, M.M., Engel, M., Gattinger, A., Bausenwein, U.,Sommer, M., Munch, J.C., and Schloter, M. (2008) Factorsinfluencing variability of proteolytic genes and activities inarable soils. Soil Biol Biochem 40: 1646–1653.
Garrity, G.M., and Holt, J.G. (2006a) The Proteobacteria:Part C, the Alpha-, Beta-, Delta-, and Epsilonproteobacte-ria. In Bergey’s Manual of Systematic Bacteriology. 2ndedn, Vol. 2. Brenner, D.J., Krieg, N.R., and Staley, J.T.(eds). New York, USA: Springer, pp. 575–762.
Garrity, G.M., and Holt, J.G. (2006b) The phylum Chloroflexi,the Archaea and the deeply branching and phototrophicBacteria. In Bergey’s Manual of Systematic Bacteriology.2nd edn, Vol. 1. Boone, D.R., and Castenholz, R.W. (eds).New York, USA: Springer, pp. 427–446.
Garrity, G.M., Bell, J.A., and Lilburn, T. (2006) The Proteo-bacteria: Part B, the Gammaproteobacteria. In Bergey’sManual of Systematic Bacteriology. 2nd edn, Vol. 2.Brenner, D.J., Krieg, N.R., and Staley, J.T. (eds). NewYork, USA: Springer, pp. 1–59.
Griffith, R.-I., Whiteley, A.S., O’Donnell, A.G., and Bailey,M.J. (2000) Rapid method for co-extraction of DNA andRNA from natural environments for analysis of ribosomalDNA and rRNA-based microbial community composition.Appl Environ Microbiol 66: 5488–5491.
Großkopf, R., Stubner, S., and Liesack, W. (1998) Diversityand structure of the methanogenic community in anoxicrice paddy soil microcosms as examined by cultivation anddirect 16S rRNA gene sequence retrieval. Appl EnvironMicrobiol 64: 960–969.
Haichar, F.E.Z., Achouak, W., Christen, R., Heulin, T., Marol,C., Marais, M.F., et al. (2007) Identification of cellulolyticbacteria in soil by stable isotope probing. Environ Microbiol9: 625–634.
Hamberger, A., Horn, M.A., Dumont, M.G., Murrell, J.C., andDrake, H.L. (2008) Anaerobic consumers of monosaccha-rides in a moderately acidic fen. Appl Environ Microbiol 74:3112–3120.
Hill, P.W., Farrar, J.F., and Jones, D.L. (2008) Decoupling ofmicrobial glucose uptake and mineralization in soil. SoilBiol Biochem 40: 616–624.
Kajikawa, H., and Masaki, S. (1999) Cellobiose transport bymixed ruminal bacteria from a cow. Appl Environ Microbiol65: 2565–2569.
Kang, M.S., Im, W., Jung, H.M., Kim, M.K., Goodfellow, M.,Kim, K.K., et al. (2007) Cellulomonas composti sp. nov., acellulolytic bacterium isolated from cattle farm compost. IntJ Syst Evol Microbiol 57: 1256–1260.
van Keulen, G., Alderson, J., White, J., and Sawers, R.G.(2007) The obligate aerobic actinomycete Streptomycescoelicolor A3(2) survives extended periods of anaerobicstress. Environ Microbiol 9: 3143–3149.
Kudo, T., Matsushima, K., Itoh, T., Sasaki, J., and Suzuki, K.I.(1998) Description of four new species of the genus Kin-eosporia : Kineosporia succinea sp. nov., Kineosporiarhizophila sp. nov., Kineosporia mikuniensis sp. nov. andKineosporia rhamnosa sp. nov., isolated from plantsamples, and amended description of the genus Kineospo-ria. Int J Syst Bacteriol 48: 1245–1255.
Küsel, K., and Drake, H.L. (1995) Effects of environmentalparameters on the formation and turnover of acetateby gorest soils. Appl Environ Microbiol 61: 3667–3675.
Küsel, K., Wagner, C., Trinkwalter, T., Gößner, A.S., Bäumler,R., and Drake, H.L. (2002) Microbial reduction of Fe(III)and turnover of acetate in Hawaiian soils. FEMS MicrobiolEcol 40: 73–81.
Metabolic response of soil cellulose degraders 859
Küver, J., Rainey, F.A., and Widdel, F. (2006) Bergey’sManual of Systematic Bacteriology, the Proteobacteria.Part C, the Alpha-, Beta-, Delta-, and Epsilonproteobacte-ria, 2nd edn, Vol. 2. New York, USA: Springer, pp. 922–1143.
Lal, R. (2008) Sequestration of atmospheric CO2 in globalcarbon pools. Energy Environ Sci 1: 86–100.
Lane, D.J. (1991) 16S/23S rRNA sequencing. In Nucleic AcidTechniques in Bacterial Systematics. Stackebrandt, E., andGoodfellow, M. (eds). Chichester, UK: Wiley, pp. 205–248.
Lee, S.D. (2006) Phycicoccus jejuensis gen. nov., sp. nov., anactinomycete isolated from seaweed. Int J Syst Evol Micro-biol 56: 2369–2373.
Li, T., Mazeas, L., Sghir, A., Leblon, G., and Bouchez, T.(2009) Insights into networks of functional microbes catal-ysing methanization of cellulose under mesophilic condi-tions. Environ Microbiol 11: 889–904.
Lovley, D.R., Giovannoni, S.J., White, D.C., Champine, J.E.,Phililips, E.J.P., Gorby, Y.A., and Goodwin, S. (1993) Geo-bacter metallireducens gen. nov. sp. nov., a microrganismcapable of coupling the complete oxidation of organic com-pounds to the reduction of iron and other metals. ArchMicrobiol 159: 336–344.
Lovley, D.R., Holmes, D.E., and Nevin, K.P. (2004) Dissimi-latory Fe(III) and Mn(IV) reduction. Adv Microb Physiol 49:219–286.
Ludwig, W., Strunk, O., Westram, R., Richter, L., Meier, H.,Yadhukumar, et al. (2004) ARB: a software environment forsequence data. Nucleic Acids Res 32: 1363–1371.
Lueders, T., Manefield, M., and Friedrich, M.W. (2004a)Enhanced sensitivity of DNA- and rRNA-based stableisotope probing by fractionation and quantitative analysisof isopycnic centrifugation gradients. Environ Microbiol 6:73–78.
Manefield, M., Whiteley, A.S., Griffith, R.I., and Bailey, M.(2002) RNA stable isotope probing, a novel means oflinking microbial community function to phylogeny. ApplEnviron Microbiol 68: 5367–5373.
Matthies, C., Freiberger, A., and Drake, H.L. (1993) Fuma-rate dissimilation and differential reductant flow byClostridium formicoaceticum and Clostridium aceticum.Arch Microbiol 160: 273–278.
Medeiros, P.M., Fernandes, M.F., Dick, R.P., and Simoneit,B.R.T. (2006) Seasonal variations in sugar contents andmicrobial community in a ryegrass soil. Chemosphere 65:832–839.
Messing, J. (1983) New M13 vectors for cloning. MethodEnzymol 101: 20–78.
Padmanabhan, P., Padmanabhan, S., DeRito, C., Gray, A.,Gannon, D., Snape, J.R., et al. (2003) Respiration of 13C-labeled substrates added to soil in field and subsequent16S rRNA gene analysis of 13C-labeled soil DNA. ApplEnviron Microbiol 69: 1614–1622.
Pagani, H., and Parenti, F. (1978) Kineosporia, a new genusof the order Actinomycetales. Int J Syst Bacteriol 28: 401–106.
Pason, P., Kyu, K.L., and Ratanakhanokchai, K. (2006)Paenibacillus curdlanolyticus strain B-6 xylanolytic-
celluloytic enzyme system that degrades insolublepolysaccharides. Appl Environ Microbiol 72: 2483–2490.
Pruesse, E., Quast, C., Knittel, K., Fuchs, B., Ludwig, W.,Peplies, J., and Glöckner, F.O. (2007) SILVA: a compre-hensive online resource for quality checked and alignedribosomal RNA sequence data compatible with ARB.Nucleic Acids Res 35: 7188–7196.
Rangel-Castro, J.I., Killham, K., Ostle, N., Nicol, G.W.,Anderson, I.C., Scrimgeour, C.M., et al. (2005) Stableisotope probing analysis of the influence of liming on rootexudate utilization by soil microorganisms. Environ Micro-biol 7: 828–838.
Ricke, P., Kolb, S., and Braker, G. (2005) Application of anewly developed ARB software – integrated tool for in silicoterminal restriction fragment length polymorphism analysisreveals the dominance of a novel pmoA cluster in a forestsoil. Appl Environ Microbiol 71: 1671–1673.
Robert, C., Chassard, C., Lawson, P.A., and Bernalier-Donadille, A. (2007) Bacteroides cellulosilyticus sp. nov., acellulolytic bacterium from the human gut microbial com-munity. Int J Syst Evol Microbiol 57: 1516–1520.
Robledo, M., Jimenez-Zurdo, J.I., Velazquez, E., Trujillo,M.E., Zurdo-Pineiro, J.L., Ramirez-Bahena, M.H., et al.(2008) Rhizobium cellulase CelC2 is essential for primarysymbiotic infection of legume host roots. Proc Natl AcadSci USA 105: 7064–7069.
Schlichting, E., Blume, H.P., and Stahr, K. (1995) Boden-kundliches Praktikum. Blackwall Wissenschaftsverlag.Berlin, German: Wien.
Schloss, P.D., and Handelsmann, J. (2005) IntroducingDOTUR, a computer program for defining operational taxo-nomic units and estimating species richness. Appl EnvironMicrobiol 71: 1501–1506.
Sexstone, A.J., Parkin, T.B., and Tiedje, J.M. (1985) Tempo-ral response of soil denitrification rates to rainfall and irri-gation. Soil Sci Soc Am J 49: 99–103.
Small, H., Stevens, T.S., and Bauman, W.C. (1975) Novelion-exchange chromatographic method using conductime-tric detection. Anal Chem 47: 1801–1809.
Smith, J., Rocha, E.R., and Paster, B.J. (2006) The prokary-otes. In The Prokaryotes. Balows, A., Trüper, H.G.,Dworkin, M., Harder, W., and Schleifer, K.H. (eds). NewYork, USA: Springer, pp. 381–427.
Sommer, M., Wehrhan, M., Zipprich, M., Weller, U., Castell,W., Ehrich, S., et al. (2003) Hierarchical data fusion formapping soil units at field scale. Geoderma 112: 179–196.
Tadonleke, R.D. (2006) Strong coupling between naturalPlanctomycetes and changes in the quality of dissolvedorganic matter in freshwater samples. FEMS MicrobiolEcol 59: 543–555.
Tamura, H., Goto, K., Yotsuyan, T., and Nagayama, M. (1974)Spectrophotometric determination of iron(II) with 1,10-phenanthroline in presence of large amounts of iron(III).Talanta 21: 314–318.
Tamura, K., Dudley, J., Nei, M., and Kumar, S. (2007)MEGA4: Molecular Evolutionary Genetics Analysis(MEGA) software version 4.0. Mol Biol Evol 24: 1596–1599.
Urakami, T., Sasaki, J., Suzuki, K.I., and Komagata, K. (1995)Characterization and description of Hyphomicrobium deni-trificans sp. nov. Int J Syst Bacteriol 45: 528–532.
Westermann, P. (1993) Wetland and swamp microbiology. InAquatic Microbiology, An Ecological Approach. Ford, T.E.(ed.). Oxford, UK: Blackwell Scientific Publications, pp.215–238.
White, D. (2007) The Physiology and Biochemistry ofProkaryotes, 3rd edn. New York, USA: Oxford UniversityPress, pp. 383–403.
Wüst, P.K., Horn, M.A., and Drake, H.L. (2009) Trophic linksbetween fermenters and methanogens in a moderatelyacidic fen soil. Environ Microbiol 11: 1395–1409.
Yarza, P., Richter, M., Peplies, J., Euzeby, J., Amann, R.,Schleifer, K.H., et al. (2008) The all-species living treeproject: a 16S rRNA-based phylogenetic tree of allsequenced type strains. Syst Appl Microbiol 31: 241–250.
Yoon, J.H., Kim, I.G., Kang, K.H., Oh, T.K., and Park, Y.H.(2004) Nocardioides aquiterrae sp. nov., isolated fromgroundwater in Korea. Int J Syst Evol Microbiol 54: 71–75.
Zausig, J., Stepniewski, W., and Horn, R. (1993) Oxygenconcentration and redox potential gradients in unsaturatedmodel soil aggregates. Soil Sci Soc Am J 57: 908–916.
Supporting information
Additional Supporting Information may be found in the onlineversion of this article:
Fig. S1. Bacterial 16S rRNA cDNA TRFLP patterns in heavyfractions (fraction 3 + 4: 1.181–1.183 g ml-1) of cellulose-amended anoxic microcosms. (A) [13C]-cellulose treatmentafter 0, 35 and 70 days. (B) [12C]-cellulose treatment after 35and 70 days. [13C]-labelled TRFs are indicated by their lengthand marked by an arrow (143, 149, 205, 490, 522, 540 and899 bp).Fig. S2. Bacterial 16S rRNA cDNA TRFLP patterns in heavyfractions (fraction 3 + 4: 1.181–1.183 g ml-1) of cellobiose-amended oxic microcosms. (A) [13C]-cellobiose treatmentafter 0, 6 and 12 days. (B) [12C]-cellobiose treatment after 6and 12 days. [13C]-labelled TRFs are indicated by their lengthand marked by an arrow (163, 279, 474, 523, 534 and890 bp).
Fig. S3. Bacterial 16S rRNA cDNA TRFLP patterns in heavyfractions (fraction 3 + 4: 1.181–1.183 g ml-1) of cellobiose-amended anoxic microcosms. (A) [13C]-cellobiose treatmentafter 0, 4, 10, and 24 days. (B) [12C]-cellobiose treatment after20 and 24 days. [13C]-labelled TRFs are indicated by theirlength and marked by an arrow (494, 523 and 903 bp).Fig. S4. Bacterial 16S rRNA gene TRFLP pattern in heavyfractions (fraction 3 + 4: 1.181–1.183 g ml-1) of glucose-amended oxic microcosms. (A) [13C]-glucose treatment after6 and 12 days. (B) [12C]-glucose treatment after 6 and12 days. [13C]-labelled TRFs are indicated by their length andmarked by an arrow (143, 164, 279, 298, 476 and 526 bp).Fig. S5. Bacterial 16S rRNA cDNA TRFLP patterns in heavyfractions (fraction 3 + 4: 1.181–1.183 g ml-1) of glucose-amended anoxic microcosms. (A) [13C]-glucose treatmentafter 0, 4, 10 and 24 days. (B) [12C]-glucose treatment after 0,4 and 24 days. [13C]-labelled TRFs are indicated by theirlength and marked by an arrow (496, 508 and 520 bp).Fig. S6. Bacterial 16S rRNA gene TRFLP pattern in ‘light’(fraction 8 + 9: 1767–1.776 g ml-1) and ‘heavy ‘ fractions(fraction 3 + 4: 1.181–1.183 g ml-1) of [12C]-sugar amendedmicrocosms at the latest analysed time point. (A) Cellulosetreatment after 70 days. (B) Cellobiose treatment after12 days (oxic) and 24 days (anoxic). (C) Glucose treatmentafter 12 days (oxic) and 24 days (anoxic).Fig. S7. Bacterial 16S rRNA gene TRFLP pattern in ‘light’(fraction 8 + 9: 1767–1.776 g ml-1) and ‘heavy’ fractions(fraction 3 + 4: 1.181–1.183 g ml-1) of [13C]-sugar amendedmicrocosms at the latest analysed time point. (A) Cellulosetreatment after 70 days. (B) Cellobiose treatment after12 days (oxic) and 24 days (anoxic). (C) Glucose treatmentafter 12 days (oxic) and 24 days (anoxic). Values are themean of triplicates ([13C-U]-cellobiose, [13C-U]-glucose orduplicates [13C-U]-cellulose). Error bars indicate the standarddeviation.Fig. S8. Distribution of RNA in gradient fractions of anoxic[13C]-cellobiose treatments after 24 days of incubation.
Please note: Wiley-Blackwell are not responsible for thecontent or functionality of any supporting materials suppliedby the authors. Any queries (other than missing material)should be directed to the corresponding author for the article.
Metabolic response of soil cellulose degraders 861
![Selective Isolation and Characterization of Cellulolytic ... · JIRCAS]ournalNo.5: 79-89 (1997) Selective Isolation and Characterization of Cellulolytic Bacteria by Cellulose Enrichment](https://static.documents.pub/doc/80x56/5c0a681409d3f2501a8b8ffd/selective-isolation-and-characterization-of-cellulolytic-jircasournalno5.jpg)
