263

Lotte Bjergbæk (ed.), DNA Repair Protocols, Methods in Molecular Biology, vol. 920,DOI 10.1007/978-1-61779-998-3_18, © Springer Science+Business Media New York 2012

Chapter 18

Using Arabidopsis Cell Extracts to Monitor Repair of DNA Base Damage In Vitro

Dolores Córdoba-Cañero , Teresa Roldán-Arjona , and Rafael R. Ariza

Abstract

Base excision repair (BER) is a major pathway for the removal of endogenous and exogenous DNA damage. This repair mechanism is initiated by DNA glycosylases that excise the altered base, and continues through alternative routes that culminate in DNA resynthesis and ligation. In contrast to the information available for microbes and animals, our knowledge about this important DNA repair pathway in plants is very limited, partially due to a lack of biochemical approaches. Here we describe an in vitro assay to monitor BER in cell-free extracts from the model plant Arabidopsis thaliana . The assay uses labeled DNA substrates containing a single damaged base within a restriction site, and allows detection of fully repaired molecules as well as DNA repair intermediates. The method is easily applied to measure the repair activity of puri fi ed proteins and can be successfully used in combination with the extensive array of biological resources available for Arabidopsis .

Key words: In vitro DNA repair assay , Plant cell extracts , Denaturing polyacrylamide gel electrophoresis , Oligonucleotide , Uracil , AP site , DNA glycosylase , Base excision repair

Cells have evolved sophisticated DNA repair mechanisms to avoid the deleterious consequences of DNA damage. Prominent among such mechanisms is the base excision repair (BER) pathway, that plays a critical role in cellular protection against most common forms of non-bulky DNA damage, including alkylated or oxidized bases, inappropriate bases arisen during replication or spontaneous deamination, and sites of base loss ( 1– 3 ) .

BER is a multistep process initiated by enzymes termed DNA glycosylases that catalyze hydrolysis of the N-glycosidic bond between the target base and deoxyribose ( 4, 5 ) . Cells contain different DNA glycosylases, and each type removes a speci fi c base

1. Introduction

264 D. Córdoba-Cañero et al.

alteration or a limited spectrum of structurally related lesions ( 1, 6 ) . The excision of the DNA damage as a free base is a hallmark of BER, and generates an abasic (apurinic/apyrimidinic, AP) site that must be processed in order to restore the structure and integrity of DNA. AP sites may be incised either by AP endonucleases or by the AP lyase activity associated with the so-called bifunctional DNA glycosylases/lyases, leaving 5 ¢ - or 3 ¢ -blocked ends, respectively ( 7 ) . Additional enzymatic activities convert these terminal ends into 5 ¢ -P and 3 ¢ -OH termini ( 7, 8 ) . The ensuing gap fi lling is carried out by a DNA polymerase and may take place either by insertion of a single nucleotide (SN-BER) or by DNA synthesis involving several nucleotides (long-patch repair, LP-BER) ( 2 ) . Finally, conti-nuity of the processed strand is restored by a DNA ligase. The BER pathway was initially elucidated in bacteria, and subsequent studies have shown that its main features are conserved in eukaryotes ( 9 ) . Nevertheless, accumulating evidence indicates that a number of differences exist between different species, particularly during post-excision events ( 10 ) .

Plants comprise an important group of organisms in which research on DNA repair, and particularly BER, has lagged far behind the rapid progress made in bacteria, yeast, and mammals ( 9 ) . Much of the knowledge accumulated during the past 20 years about BER in microbes and animals has been obtained through the development of in vitro repair assays that allow biochemical studies with cell-free extracts, and combining their results with genetic analyses ( 11 ) . However, until recently there were no reli-able in vitro assays for speci fi cally detecting BER in plant cells. In this chapter we describe a speci fi c assay to monitor repair of dam-aged bases in cell-free extracts from the model plant Arabidopsis thaliana ( 12, 13 ) . To develop such a plant BER assay, we have chosen as a convenient model lesion uracil, a ubiquitous DNA alteration that arises by spontaneous deamination of cytosine or from erroneous incorporation of dUMP during replication ( 14 ) .

The Arabidopsis BER assay is performed by incubating whole cell extracts from Arabidopsis plants, normally 15-days old seed-lings, with a labeled 51-mer duplex oligonucleotide containing a single uracil residue within an Hpa II restriction site. The presence of U instead of C at this location makes the DNA substrate resis-tant to Hpa II cleavage. The repair of the lesion, that involves uracil excision and repair synthesis to insert a cytosine, is detected as conversion of the duplex DNA to a form susceptible to digestion. Thus, repair is visualized by the emergence a 21-nt labeled frag-ment following denaturing polyacrylamide gel electrophoresis (PAGE) (Fig. 1 ).

This chapter contains detailed methods to prepare DNA substrate, obtain Arabidopsis whole-cell extracts, setting up repair reactions, and resolve repair products by denaturing PAGE. The methods described here can be easily adapted to study BER of

26518 Using Arabidopsis Cell Extracts to Monitor Repair of DNA Base…

different base alterations. Thus, we have successfully used DNA substrates containing the AP site synthetic analogue tetrahydro-furan (THF) instead of uracil ( 12 ) . In addition to study cell-free extracts, the assay may also be used for measuring the activity of puri fi ed repair proteins and for analyzing their capacity to comple-ment repair-defective cell extracts obtained from Arabidopsis mutants ( 13 ) . It is also possible to supplement the repair reaction mixture with additional factors such as antibodies or inhibitors, in order to further characterize proteins involved in plant BER ( 12 ) . The use of such a versatile repair assay in a model system for which a vast array of genomic tools and biological resources is available ( http://arabidopsis.org/ ) may help to undertake a comprehensive biochemical and genetic analysis of BER in plants.

Fig. 1. Schematic diagram of molecules used as DNA substrates. Double-stranded oligonucleotides contain a lesion (X) at an Hpa II site on the upper strand. Fluorescein (Fl) ( a ) or Alexa Fluor (Al) ( b ) at 5 ¢ end of the upper or lower strand, respectively, are indicated by an asterisk . ( c ) Arabidopsis cell extract (70 m g) was incubated with duplex DNA that contained a U residue in the upper strand. The DNA substrate was labeled either at the 5 ¢ end of the upper strand with Fluorescein ( lanes 2 – 5 ) or at 5 ¢ end of the lower strand with Alexa Fluor ( lanes 6 – 9 ). Lane 1 contains DNA size markers. Reactions were incubated at 30 °C for 3 h in a reaction mixture containing either dCTP or all four dNTPs, as indicated. Reaction products were separated in a 12 % denaturing polyacrylamide gel either before ( lanes 2 – 5 ) or after ( lanes 6 – 9 ) Hpa II digestion. Fluorescein- ( lanes 2 – 5 ) and Alexa Fluor-labeled fragments ( lanes 6 – 9 ) were detected by fl uorescence scanning.

266 D. Córdoba-Cañero et al.

1. A. thaliana seeds (see Note 1). 2. 95 % ethanol. 3. Sodium hypochlorite solution: 50 % (v/v) commercial bleach. 4. Sterile distilled water. 5. Petri dishes (10-cm diameter). 6. Growth media: 1× Murashige and Skoog (MS) Basal Medium,

3 % sucrose, and 0.8 % agar. Preparation of 1× MS agar medium is as follows: (a) Add 4.44 g of MS Basal Medium (Sigma) and 30 g of

sucrose to 1,000 mL of distilled water and stir to dissolve. (b) Check and adjust pH to 5.8 with 1 M KOH. (c) Add 8 g of plant agar (Duchefa). (d) Autoclave for 15 min at 15 psi, 121 °C. (e) Allow medium to cool to approximately 50 °C before

pouring into Petri dishes. 7. Round pieces of sterilized fi lter paper (10-cm diameter). 8. Scissors, forceps, ethanol, and burner. 9. Balance. 10. Aluminum foil. 11. Liquid nitrogen. 12. Laminar- fl ow hood.

1. Liquid nitrogen, mortar, and pestle. 2. Spatula. 3. Extraction buffer: 25 mM Hepes KOH, pH 7.8, 100 mM KCl,

5 mM MgCl 2 , 250 mM sucrose, 1 mM DTT, 10 % glycerol, 1 m L/mL protease inhibitor cocktail (Sigma-Aldrich). Freshly prepared (see Note 2).

4. Microcentrifuge and 2 mL microcentrifuge tubes. 5. Nylon mesh (20 m m). 6. Mini-spin columns and scalpel. 7. Dialysis tubing and clamps. 8. Dialysis buffer: 25 mM Hepes KOH 7.8, 100 mM KCl, 2 mM

DTT, 17 % glycerol. 9. Beaker or fl ask, magnetic stirring bar, and magnetic stirring

plate.

2. Materials

2.1. Plant Growth

2.2. Plant Cell Extract Preparation

26718 Using Arabidopsis Cell Extracts to Monitor Repair of DNA Base…

DNA substrates are prepared by annealing oligonucleotides commercially synthesized according to our speci fi cations (Operon, IDT, Fisher Scienti fi c). Table 1 shows the sequence of some oligo-nucleotides that we routinely employ in our laboratory. Those used for the damaged version of the upper strand contain either U or the abasic spacer THF within an Hpa II recognition site (see Note 3). To detect intermediates arising during DNA repair we prepare DNA substrates with a 5 ¢ -end labeled upper strand annealed to a non-labeled complementary strand. To monitor full-repair, a non-labeled upper strand is annealed to a 5 ¢ -end labeled lower strand (Fig. 1b ; see Note 4).

1. TE buffer: 10 mM Tris–HCl, 1 mM EDTA pH 8.0. Sterilize by autoclaving.

2. Labeled oligonucleotide: stock solution at 100 m M and work-ing solution at 5 m M in TE. Store at −20 °C.

3. Non-labeled oligonucleotide: stock solution at 100 m M and working solution at 10 m M in TE. Store at −20 °C.

4. Annealing buffer: 10 mM Tris–HCl pH 8.0, 20 mM NaCl. Prepared from sterile stock solutions.

5. Water bath, tube rack, and glass beaker. 6. Thermoblock.

1. DNA duplex (see Subheading 3.3.1 below). 2. 10× DNA repair buffer: 450 mM HEPES-KOH, pH 7.8,

700 mM KCl, 50 mM MgCl 2 , 10 mM DTT, 4 mM EDTA, 360 m g BSA, 10 mM NAD, 2 % glycerol.

3. 2 mM dCTP (Roche). Store in small aliquots at −20 °C.

2.3. DNA Repair Reactions

2.3.1. DNA Substrate Preparation

2.3.2. DNA Repair Reaction

Table 1 DNA sequence of oligonucleotides used as substrates

Name DNA sequence a Strand Label b

Fl-UGF TCACGGGATCAATGTGTTCTTTCAGCTCUGGTCACGCTGACCAGGAATACC

Upper Fl at 5 ¢

Fl-APGF TCACGGGATCAATGTGTTCTTTCAGCTCFGGTCACGCTGACCAGGAATACC

Upper Fl at 5 ¢

UGF TCACGGGATCAATGTGTTCTTTCAGCTCUGGTCACGCTGACCAGGAATACC

Upper –

CGR AGTGCCCTAGTTACACAAGAAAGTCGAGGCCAGTGCGACTGGTCCTTATGG

Lower –

Al-CGR AGTGCCCTAGTTACACAAGAAAGTCGAGGCCAGTGCGACTGGTCCTTATGG

Lower Al at 5 ¢

a F = AP site analog (tetrahydrofuran) b Fl = fl uorescein; Al = alexa fl uor 647

268 D. Córdoba-Cañero et al.

4. 2 mM deoxyribonucleoside triphosphate (dNTP) mixture (Roche): 2 mM dCTP, 2 mM dATP, 2 mM dGTP, and 2 mM dTTP. Store in small aliquots at −20 °C.

5. 100 mM ATP (Sigma). Store in small aliquots at −20 °C. 6. 50 mM NAD (Sigma). Store in small aliquots at −20 °C. 7. 220 mM phosphocreatine (Sigma). Store in small aliquots

at −20 °C. 8. Creatine phosphokinase (from rabbit muscle, Sigma). Dissolve

at a concentration of 5 mg/mL and store at −20 °C. Prepare working solution at 5 m g/mL in H 2 O and store in small aliquots at −20 °C.

9. Proteinase K (Sigma). Dissolve at a concentration of 20 mg/mL in H 2 O. Store in small aliquots at −20 °C.

10. K buffer: 20 mM EDTA, 0.6 % SDS, and 0.5 mg/mL protei-nase K. Prepare at least 30 min before use and incubate at 37 °C to dissolve.

11. TE buffer: 10 mM Tris–HCl, 1 mM EDTA pH 8.0. Prepared from sterile stock solutions.

12. Phenol:chloroform:isoamyl alcohol (25:24:1) (Sigma). 13. Glycogen. Dissolve at a concentration of 2 mg/mL in H 2 O.

Store in small aliquots at −20 °C. 14. Glycogen solution: 0.3 mM NaCl, 16 mg/mL glycogen.

Prepare at least 30 min before use and keep on ice. 15. 70 % and absolute ethanol (−20 °C). 16. Hpa II restriction endonuclease (10 U/ m L) and 10× NEBuffer

1 (New England Biolabs). 17. 10× TBE: 0.9 M Trizma base, 0.9 boric acid, 20 mM EDTA

pH 8.0. 18. 90 % formamide in 1× TBE. 19. Thermoblock.

1. Glass plates (40 × 20 cm, H × W). 2. Detergent and paper towels. 3. Spacers and comb, 0.2 mm thick. 4. Box sealing tape and binder clips. 5. TBE 10×: 0.9 M Trizma base, 0.9 M boric acid, 20 mM EDTA

pH 8.0. 6. Ammonium persulfate (APS) (Bio-Rad): 10 % solution in H 2 O.

Prepare immediately before use. 7. TEMED (Sigma). 8. Glass graduated pipette (25 mL) and manual or automatic

pipettor.

2.4. Gel Electrophoresis

26918 Using Arabidopsis Cell Extracts to Monitor Repair of DNA Base…

9. Denaturing polyacrylamide gel solution (12 %) containing 7 M urea: 25.22 g urea, 18 mL of 40 % Acrylamide/Bis Solution 19:1, 6 mL TBE 10×, 17.5 mL H 2 O.

10. Aluminum heat dispersion plate. 11. Vertical electrophoresis system and high voltage power supply. 12. Formamide dye mix (FDM): 80 % formamide, 1 mg/mL

bromophenol blue, 10 mM EDTA pH 8.0. 13. Fluor imaging gel scanning equipment (see Note 5).

Work in sterile conditions and carry all steps in a laminar- fl ow hood.

1. Surface sterilize 10–20 mg seeds (see Note 6) in an Eppendorf tube by adding 1 mL of 95 % ethanol and vortex gently for 1 min. Allow seeds to sediment to the bottom of the tube (10–30 s) and carefully remove ethanol.

2. Add 1 mL of 50 % (v/v) bleach. Vortex gently for 10–15 min and allow seeds to sediment. Remove the bleach and wash the seeds at least four times with 1 mL of sterile distilled water.

3. Leave the seeds in water (50 m L of water per 1 mg of sterilized seeds) and incubate at 4 °C in the dark for 2 days to break dormancy and achieve uniform and ef fi cient germination.

Work in sterile conditions and carry all steps in a laminar- fl ow hood.

1. Using sterile forceps put a round piece of fi lter paper onto the surface of the MS medium agar plates (see Note 7).

2. Plate about 50 seeds on each plate. Take a 50 m L aliquot of sterile seeds with a micropipette and distribute the seeds evenly over the fi lter surface (see Notes 8 and 9).

3. Seal the plates with para fi lm. 4. Transfer plates to a growth chamber at 23 °C and long-day

conditions (16 h light/8 h dark). 5. Incubate for 14–15 days or until the seedlings develop four

true leaves (see Note 10). At this point, each plate should yield 0.5–1.0 g fresh weight plant material.

1. Harvest the seedlings carefully with forceps. 2. Wrap 0.5–1.0 g of seedlings with aluminum foil and freeze

them immediately in liquid nitrogen (see Note 11).

3. Methods

3.1. Plant Growth

3.1.1. Seeds Sterilization

3.1.2. Planting of Seeds

3.2. Plant Cell Extract Preparation

270 D. Córdoba-Cañero et al.

3. Precool mortar and pestle and add liquid nitrogen. Add the frozen seedlings and grind the plant material to a fi ne powder, adding more liquid nitrogen if necessary (see Note 12).

4. Transfer the powder to a 2 mL microcentrifuge tube and resus-pend the homogenized plant material in 3 volumes (w/v) of ice-cold extraction buffer (see Note 13).

5. Incubate on ice for 1 h. Occasionally, mix the sample by inverting the tube several times.

6. Centrifuge at 16,000 ́ g for 1 h at 4 °C using a microfuge. 7. Carefully transfer the supernatant to a new 2 mL centrifuge

tube (see Note 14). 8. Place the supernatant in a bottomless minispin column fi tted

into 2 mL tube with a piece of 20 m m nylon mesh between the two tubes (Fig. 2 ; see Note 15). Spin for 10 s. Remove the minispin column from the tube and keep the fi ltered homoge-nate on ice.

9. Estimate how much dialysis tubing membrane you will need to hold your sample and cut a piece that has an extra couple of inches (see Note 16).

10. Wash your dialysis tubing membrane with distilled water. Never let your dialysis tubing to dry out once it has been wetted.

11. Remove the water carefully from the tubing. Clip the bottom of the tubing with a dialysis clamp. Using a micropipette, care-fully transfer the fi ltered homogenate (obtained in step 8, above) into the dialysis tubing, clip the top tightly, and place the tubing in a beaker or fl ask containing dialysis buffer precooled at 4 °C (see Note 17).

Fig. 2. Filtration of the plant tissue homogenate. The homogenate is placed inside a bot-tomless minispin column inserted into a microcentrifuge tube and fi ltered through the nylon mesh by centrifugation.

27118 Using Arabidopsis Cell Extracts to Monitor Repair of DNA Base…

12. Place the beaker or fl ask on a magnetic stirring plate and stir at 4 °C during 12–14 h.

13. After the dialysis, carefully remove the dialysate from the tubing into a microcentrifuge tube.

14. Determine protein concentration by Bradford assay with BSA standards and store in small aliquots at −80 °C, until needed (see Note 18). The protein concentration is usually around 2–4 m g/ m L.

1. Preheat a thermoblock and a water bath at 95 °C. 2. Mix in an Eppendorf tube 0.4 m L of the 5 m M solution of the

labeled oligonucleotide, 0.4 m L of the 10 m M solution of the non-labeled oligonucleotide and 1.2 m L of annealing buffer (the volumes are provided as per repair reaction and should be scaled up for experiments involving multiple samples; make enough premix for one or two more reactions than needed).

3. Heat the mix at 95 °C for 5 min in the thermoblock (see Note 19).

4. Quickly put the tube in a rack inside of a glass beaker, containing enough preheated water to cover just the bottom of the tube.

5. Let the sample slowly cool until water reaches room tempera-ture (25 °C approximately).

6. Use immediately or store at 4 °C until needed (see Note 20).

Perform all operations on ice.

1. Unfreeze plant cell extracts slowly on ice. 2. Prepare a premix with the following reagents (the volumes are

provided as per reaction and should be scaled up for experiments involving multiple samples; make enough premix for one or two more reactions than needed): 5 m L of 10× DNA repair buffer, 5 m L of 220 mM phosphocreatine, 1 m L of 100 mM ATP, 1 m L of 50 mM NAD, 0.5 m L of 5 m g/mL creatine phos-phokinase, 2 m L of DNA substrate (prepared as described in Subheading 3.3.1 above), and 15 m L of H 2 O to adjust the volume per reaction to 29.5 m L.

3. Prepare 40–80 m g of plant cell extract and dialysis buffer to a fi nal total volume of 20 m L in an Eppendorf tube (see Note 21). Add 29.5 m L premix to each tube and 0.5 m L of the appropri-ate deoxynucleotide solution (2 mM dCTP or 2 mM dNTP mixture).

4. Brie fl y mix and centrifuge the tubes. 5. Incubate at 30 °C for 3 h (see Note 22). 6. Stop the reaction by adding 10 m L of K buffer and incubating

at 37 °C for 30 min.

3.3. DNA Repair Reactions

3.3.1. DNA Substrate Preparation

3.3.2. Setting Up Repair Reactions

272 D. Córdoba-Cañero et al.

7. Add 60 m L of TE buffer and 120 m L of phenol:chloroform:isoamyl alcohol (25:24:1). Vortex vigorously during 10–15 s, or until the sample develops a white color.

8. Centrifuge 1 min at 16,000 ́ g using a microfuge. 9. Carefully remove the supernatant and transfer to a new

Eppendorf tube containing 8 m L of glycogen solution. 10. Add 360 m L of cold absolute ethanol and incubate at −20 °C

for at least 30 min (see Note 23). 11. Centrifuge 15 min at 16,000 ́ g using a microfuge and discard

the supernatant. 12. Add 200 m L of cold 70 % ethanol, centrifuge 5 min at

16,000 ́ g, and discard the supernatant. 13. Dry the pellet in a Speed-Vac 5 min or by inverting the tubes

over a paper towel and allow to air dry for several minutes. 14. To monitoring full-repair, proceed to Hpa II digestion (see

Subheading 3.4 below). 15. To detect DNA repair intermediates, resuspend the pellet in

10 m L of 90 % formamide (see Note 24) and keep samples on ice until ready to perform denaturing PAGE (Subheading 3.5 below).

1. Make a digestion premix containing 4 m L of H 2 O, 0.5 m L of 10× NEBuffer 1 and 0.5 m L (5 U) of Hpa II restriction endo-nuclease per repair reaction.

2. Resuspend the precipitated DNA (Subheading 3.3.2 , step 13 above) in 5 m L of the digestion premix.

3. Incubate at 37 °C for 1 h. 4. Stop the reaction by adding 5 m L of 90 % formamide. Keep

samples on ice until ready to perform denaturing PAGE (see Subheading 3.5 below).

1. Prepare the denaturing polyacrylamide gel solution and stir to dissolve urea.

2. Clean glass plates and spacers thoroughly with a nonabrasive detergent and rinse thoroughly (see Note 25).

3. Dry the plates carefully with paper towels. 4. Put the 0.4 mm spacers between the glass plates and seal them

with box sealing tape (see Notes 26 and 27). Place the glass plate sandwich in a vertical position.

5. Add 600 m L APS 10 % and 60 m L TEMED to the gel solution, mix gently and immediately pour the gel using a 25 mL pipette and a manual or automatic pipettor, with caution to avoid bubbles (see Notes 28 and 29).

3.4. HpaII Digestion

3.5. Denaturing Polyacrylamide Gel Electrophoresis

3.5.1. Gel Preparation

27318 Using Arabidopsis Cell Extracts to Monitor Repair of DNA Base…

6. Immediately insert the comb into the gel, and clamp it in place using binder clips. Make sure that no acrylamide solution is leaking from the gel assembly.

7. Allow the acrylamide to polymerize for at least 1 h at room temperature (see Note 30).

1. Remove sealing tape and clamps. Wash gel assembly with detergent and rinse. Carefully slide off the comb from the gel (see Note 31).

2. Place the gel assembly in the electrophoresis apparatus and secure it with binder clips on the sides (see Note 32). Place the aluminum heat dispersion plate and fi x to the gel with binder clips.

3. Fill the upper and lower buffer reservoirs with electrophoresis buffer (1× TBE).

4. Rinse the wells thoroughly with a syringe fi lled with 1× TBE to wash away urea that has diffused into the wells.

5. Connect the electrodes to a power supply and allow the gel to pre-run at 1,000–1,500 constant voltage (V) until the gel tem-perature reaches 42–45 °C (see Notes 33 and 34).

6. Denature DNA samples by heating at 95 °C during 5 min. Spin and transfer to ice to prevent re-annealing.

7. Rinse again the wells thoroughly with a syringe fi lled with 1× TBE to wash away urea that has diffused into the wells (see Note 35).

8. Load 10 m L of each sample into adjacent wells. In a separate well, load 10 m L of FDM to monitor the progress of electro-phoresis (see Notes 36 and 37).

9. Run the gel at 1,300–1,500 V (constant voltage) during approximately 3 h or until the FDM is within 5–10 cm of the bottom of the gel (see Note 38).

10. Turn off the power supply, disconnect the leads, discard the electrophoresis buffer from the reservoirs, and remove the gel assembly from the electrophoresis equipment.

11. Release the binder clips and remove the gel sandwich from the sequencing apparatus. Wash glass plates with a nonabrasive detergent, rinse thoroughly with water and dry carefully with paper towels.

12. Place the gel sandwich onto the Fluor Imager. Scan the gel with the appropriate laser and analyze the image (see Note 5).

Typical results obtained with the Arabidopsis BER assay are shown in Fig. 1c . The right-half of the gel (lanes 6–9) shows the results obtained with a duplex DNA substrate labeled at the lower strand, which allows detection of fully repaired molecules. Incubation with

3.5.2. Gel Electrophoresis

3.6. Analysis of Results

274 D. Córdoba-Cañero et al.

the cell extract converted the uracil-containing DNA to a form susceptible to HpaII digestion, which generates a labeled 21-mer fragment (lanes 8 and 9). Repair is dependent on the presence of dNTPs in the reaction mixture. The repair observed with dCTP as the only deoxyribonucleotide re fl ects the SN-BER subpathway (lane 8). We usually fi nd that uracil repair is more ef fi cient when all four deoxynucleotides are present in the reaction mixture (lane 9). Fragments shorter than 51 nt detected in the upper part of the gel are the result of exonuclease activity in extracts, since they are not detected when incubations are performed in the absence of Mg 2+ . The left half of the gel (lanes 2–5) shows the results obtained with a duplex DNA substrate labeled at the upper strand, which allows detection of DNA repair intermediates. In the presence of dCTP as the only deoxynucleotide, the major DNA repair intermediate detected is a 29-nt fragment, corresponding to a short-patch DNA synthesis that involves the insertion of one dCMP in the repair gap (lane 4). In the presence of all four dNTPs, several upper-strand reaction intermediates are detected that co-migrate with 29-, 30-, and 31-nt fragments (lane 5). These results indicate that up to three nucleotides are inserted during LP-BER.

1. Any A. thaliana may be used. Different natural accessions (or ecotypes) are available from seeds stock centers. We routinely use A. thaliana Col (“Columbia”), the ecotype most commonly used by Arabidopsis researchers, but we have also obtained repair-pro fi cient extracts from the Ws (Wassilewskija) ecotype.

2. The presence of sucrose in this buffer increases contamination risk. Extraction buffer can be prepared in advance without pro-tease inhibitor and stored during 1 or 2 days at 4 °C. Add protease inhibitor immediately before use.

3. Other lesions and other restriction sites may be used. 4. We use Fluorescein and Alexa Fluor 647 as fl uorescent labels

for the 5 ¢ ends of the upper and lower strands, respectively, but other types of DNA labeling may be used.

5. We routinely use an FLA5100 Fluor Imager (Fuji fi lm) but other equipments should yield equivalent results. Fluorescein and Alexa Fluor 647 are detected at 473 and 635 nm, respectively.

6. One Arabidopsis seed weighs approx 0.02 mg. Growing about 50 seeds (1 mg of seeds approximately) per plate will yield 0.5–1 g of fresh weight plant material. About 1.5 mL of plant cell extract is obtained using 0.5 g of seedlings (total protein concentration is usually 2–4 m g/ m L).

4. Notes

27518 Using Arabidopsis Cell Extracts to Monitor Repair of DNA Base…

7. It is possible planting seeds using top agar, but it will make more dif fi cult to collect seedlings. If nevertheless you prefer this method, prepare top agar (0.8 % agar in distilled water) and dispense into 3 mL aliquots in sterile tubes placed in a preheated thermoblock at 42 °C. Add a 50- m L aliquot of seeds per tube, mix quickly, pour onto the dishes and swirl to distribute seeds.

8. Cut a short piece of the micropipette tip with sterile scissors to seeds to fl ow.

9. Try to place the seeds as evenly spaced as possible. If the seeds are not well distributed all over the plate, you can move them with a sterile micropipette tip.

10. In our experience, use of older plants results in plant cell extracts less active and concentrated.

11. This tissue can be stored at −80 °C until needed. In our experi-ence, tissue stored up to 1 year in these conditions yields fully active extracts.

12. Never let the tissue to unfreeze; if liquid nitrogen evaporates, quickly add more and keep grinding until the powder has a fl our-like appearance.

13. While grinding the tissue, precool a spatula in liquid nitrogen and use it to transfer the powder into 2 mL microcentrifuge tubes placed on ice. Do it quickly to prevent unfreezing. Distribute the powder obtained from 0.5 g of seedlings in two tubes and add 750 m L of ice-cold extraction buffer to each one.

14. Pipet slowly to avoid taking cellular debris. 15. With a scalpel cut the bottom half of a used minispin column.

Put a piece of nylon mesh between the column and a new 2 mL microcentrifuge tube. Place the supernatant in the minispin column, close its cap, and quickly centrifuge for a few seconds. This method allows fi ltration of small volumes and avoids loss of cell extract by capillarity (Fig. 2 ).

16. Follow manufacturer’s directions. Always handle dialysis tub-ing with gloves.

17. We recommend performing this step in a cold room. Use a volume of dialysis buffer at least 200 times that of the sample.

18. Unfrozen aliquots can be stored at −20 °C, although it is pos-sible that extracts lose some repair activity after multiple rounds of freezing and thawing. Therefore, aliquoting into small frac-tions is highly recommended.

19. The use of a thermoblock instead of a waterbath avoids possi-ble water entry when tubes occasionally popping open during incubation.

276 D. Córdoba-Cañero et al.

20. Annealed DNA substrates can be prepared and stored at 4 °C 1 day before use.

21. Do not forget to prepare a negative control with no plant cell extract.

22. When performing kinetic analyses, we incubate reactions over several time points, usually spanning a period from 1 to 6 h.

23. If required, samples can be left overnight at this point. 24. Samples resuspended in 90 % formamide can be stored at

−20 °C for up to several weeks. 25. Wear gloves and avoid touching the inside surface of the plates,

which must be free of grease spots to prevent air bubbles for-mation when pouring the gel.

26. Assemble the glass plate sandwich over two separate level sur-faces (for example, two micropipette tip boxes), to facilitate the next step. Put two binder clips along each side of the glass sandwich to fi x the gel assembly.

27. Seal the bottom fi rst, and then the two sides of the gel assem-bly. Apply the sealing tape as smoothly as possible to avoid forming air channels or bubbles along the edges of the glass plates. Rub the tape fi rmly onto the glass with towel paper to eliminate air channels and ensure a liquid-tight seal. Take par-ticular care with the bottom corners of the plates, as these are the places where leaks often occur. An extra band of tape around the bottom of the plates can help to prevent leaks.

28. Maintain a constant fl ow to reduce the formation of bubbles. If some bubble appears, you can try to remove it with a spacer.

29. Again place two clamps along each side near the middle and bottom of the glass plate sandwich. This will help to maintain uniform gel thickness while pouring the gel and help to avoid the gel coming out. It is important that the clamps be placed over the side spacers only . Clamping unsupported glass will distort the thickness of the gel.

30. Polymerization may be extended overnight. Short polymeriza-tion times could result in distorted wells.

31. Wash the plates and the wells with water under the faucet to remove rest of acrylamide.

32. The notched plate should face inward toward the buffer reservoir.

33. We use a high voltage power supply with temperature probe. This is particularly useful to minimize variation from one gel run to the next. If you do not have a temperature probe, you can use thermometer strips to monitor gel temperature.

27718 Using Arabidopsis Cell Extracts to Monitor Repair of DNA Base…

34. Excessive power will cause the gel to overheat and crack the glass plates.

35. It is important to wash away urea that has diffused into the wells and may adversely affect running of samples.

36. We avoid adding FDM to the samples since the dye may inter-fere with fl uorescence detection. To facilitate loading of color-less samples, we mark the wells in the glass plate with a permanent marker.

37. Choose your appropriate marker dye taking into account the expected sample sizes.

38. Keep gel temperature constant at about 42–45 °C. Running time will depend on the DNA size and on products size differ-ences. Run the gel until the marker dyes have migrated the desired distance.

Acknowledgements

We thank members of our laboratory for helpful discussion and advice. This work was supported by the Spanish Ministry of Science and Innovation and the European Regional Development Fund (grant BFU2010-18838), and by the Junta de Andalucía (grant P07-CVI-02770).

References

1. Zharkov DO (2008) Base excision DNA repair. Cell Mol Life Sci 65:1544–1565

2. Fortini P, Dogliotti E (2007) Base damage and single-strand break repair: mechanisms and functional signi fi cance of short- and long-patch repair subpathways. DNA Repair (Amst) 6:398–409

3. Barnes DE, Lindahl T (2004) Repair and genetic consequences of endogenous DNA base damage in mammalian cells. Annu Rev Genet 38:445–476

4. Stivers JT, Jiang YL (2003) A mechanistic per-spective on the chemistry of DNA repair glyco-sylases. Chem Rev 103:2729–2759

5. Zharkov DO, Grollman AP (2005) The DNA trackwalkers: principles of lesion search and recognition by DNA glycosylases. Mutat Res 577:24–54

6. Huffman JL et al (2005) DNA base damage recognition and removal: new twists and grooves. Mutat Res 577:55–76

7. Levin JD, Demple B (1990) Analysis of class II (hydrolytic) and class I (beta-lyase) apurinic/apyrimidinic endonucleases with a synthetic

DNA substrate. Nucleic Acids Res 18:5069–5075

8. Wiederhold L et al (2004) AP endonuclease-independent DNA base excision repair in human cells. Mol Cell 15:209–220

9. Friedberg EC et al (2006) DNA repair and mutagenesis. ASM Press, Washington, D.C

10. Kelley MR et al (2003) Disparity between DNA base excision repair in yeast and mammals: translational implications. Cancer Res 63:549–554

11. Dianov GL (2003) Monitoring base excision repair by in vitro assays. Toxicology 193:35–41

12. Córdoba-Cañero D et al (2009) Single-nucleotide and long-patch base excision repair of DNA damage in plants. Plant J 60:716–728

13. Córdoba-Cañero D et al (2010) Arabidopsis uracil DNA glycosylase (UNG) is required for base excision repair of uracil and increases plant sensitivity to 5- fl uorouracil. J Biol Chem 285:7475–7483

14. Kavli B et al (2007) Uracil in DNA—general mutagen, but normal intermediate in acquired immunity. DNA Repair (Amst) 6:505–516