357

Adalberto Merighi (ed.), Neuropeptides: Methods and Protocols, Methods in Molecular Biology, vol. 789,DOI 10.1007/978-1-61779-310-3_24, © Springer Science+Business Media, LLC 2011

Chapter 24

Recombinant Adeno-Associated Viral Vectors

Marijke W.A. de Backer, Keith M. Garner, Mieneke C.M. Luijendijk, and Roger A.H. Adan

Abstract

Recombinant adeno-associated viral (rAAV) vectors can be used to locally or systemically enhance or silence gene expression. They are relatively nonimmunogenic and can transduce dividing and nondividing cells, and different rAAV serotypes may transduce diverse cell types. Therefore, rAAV vectors are excellent tools to study the function of neuropeptides in local brain areas. In this chapter, we describe a protocol to produce high-titer, in vivo grade, rAAV vector stocks. The protocol includes an Iodixanol gradient, an anion exchange column and a desalting/concentration step and can be used for every serotype. In addi-tion, a short protocol for rAAV injections into the brain and directions on how to detect and localize transduced cells are given.

Key words: Recombinant adeno-associated virus, rAAV, Vector production, Vector purification, Serotype, Central nervous system

Recombinant adeno-associated viral (rAAV) vectors are single-stranded DNA vectors that are able to deliver genes to both divid-ing and nondividing cells. For this reason, they are used as tools to study gene function as well as to develop gene-based therapies. In addition, rAAV vectors can establish stable long-term expression, are nonpathogenic and show no to little immunogenicity (1, 2). rAAV vectors are derived from wild-type AAV by removing most of the viral genome (the rep and cap genes) and replacing it with a promoter and sequence of interest. Thus, only the inverted termi-nal repeats (ITRs) on both ends of the AAV genome are kept in the vector. These ITRs are necessary for replication and packaging of the rAAV vector. To produce infective rAAV particles in cells, the

1. Introduction

358 M.W.A. de Backer et al.

rep and cap genes, but also helper genes from adenovirus, are necessary. The helper genes are necessary because wild-type AAV is a Dependovirus, which requires helper viruses, such as adenovirus or herpes simplex, to replicate and assemble viral particles. The first generation of rAAV vectors was helper-virus-based (produced by cotransfection of a rAAV plasmid with a plasmid containing AAV rep and cap genes, followed by an infection with a helper virus such as an adenovirus) (3), but later “helper-free” systems were devel-oped, where several genes of a helper virus were provided on a plasmid (4–8). The AAV rep and cap genes and the helper genes can be provided by transfection (located on 1 or 2 plasmids) or by stable cell lines (4, 7, 9–11). These newer production methods improve rAAV vector yield and reduce/eliminate detectable con-tamination with replication competent AAV (4, 5, 7, 12).

There are several ways to encapsidate rAAV plasmids. The rAAV genome can be packaged with his “true” capsid (ITR, rep and cap genes are derived from same wild-type virus, e.g., AAV2), but it can also be pseudotyped with capsids from other AAV sero-types (ITR and rep gene are from one serotype and cap gene is from another serotype) or with genetically altered capsids (reviewed in refs. 13, 14). The different AAV serotypes have distinct cell specificities, because they probably use different receptors and entry pathways to introduce their genome into cells. For several serotypes, the entry receptors and coreceptors are known. However, for most serotypes the entry receptor remains to be determined (15–20). Until now, the most widely used AAV serotype is AAV2; however, recent studies have shown that other serotypes can be more efficient in transduction of several rat brain areas, such as striatum, hippocampus, midbrain, and hypothalamus (21–26). Nevertheless, the optimal serotype in one brain area is not neces-sary the most efficient in another brain area or at another develop-mental time point. Thus, for every “new” injection area or developmental time point, several serotypes may have to be tested to determine the most optimal method for rAAV-mediated gene delivery to a specific area/cell type. Cell-type specific expression can of course also be achieved by the use of cell-type specific pro-moters to drive transgene expression.

One limitation of rAAV is that it has a small packaging size; maximal 4.8 kb can be packaged without loss of infectivity (27, 28). However, this is not a problem when small genes, such as neuropeptides or short hairpin RNAs are overexpressed. In addi-tion, rate limiting steps in rAAV mediated gene expression are the slow uncoating rate and the conversion from single-stranded DNA to double-stranded DNA. This last step, which is necessary for onset of gene expression, may be circumvented by the use of self-complementary rAAV (scAAV) vectors (29–33). During replica-tion, the sense and the antisense strand of scAAV cannot dissociate due to a mutation in one of the ITRs. These scAAV vectors show

35924 rAAV Vectors

improved onset of expression and increased expression levels; however, the size of the rAAV cassette is reduced from 4.8 to 2.4 kb.

When the optimal method to transduce a certain brain area, at a certain developmental stage, in a specific species is known, the method can be used to overexpress or suppress a desired gene.

rAAV vectors have also been used to stimulate or reduce recep-tor signaling, for instance by overexpression of neuropeptide genes. However, there are two problems with the long-term overexpres-sion of neuropeptide genes via viral vectors. First, the precursor gene encodes for multiple peptides, which may serve different functions (see above). Therefore, overexpression of the precursor gene may reflect the effects of multiple peptides. The second prob-lem occurs when one is interested in the effects of a neuropeptide in a target area. When a neuropeptide is overexpressed in a target area, it can potentially be released also in a projection area to which the transduced neuron projects, due to anterograde transport of vector derived mRNA and protein, rather than being released locally at the site of transduction (25, 34, 35). To overcome these problems other groups showed that it is possible to use other pre–pro signals to overexpress neuropeptides in other secretion routes (36–39). We recently have overexpressed a minigene cDNA (AgRP83–132) and showed that it is constitutively secreted in vitro and resulted in behavioral changes in vivo (de Backer et al., accepted BMC Neuroscience).

We usually inject rAAV vectors pseudotyped with AAV1 in a nucleus of the adult rat hypothalamus via a microinfusion pump at a fixed speed and at a titer of 1 × 109 genomic copies (g.c.). This transduces almost the whole brain nucleus in which we are inter-ested, such as lateral hypothalamus or the paraventricular hypo-thalamus (26). However, when larger brain areas need to be transduced, the titer can be increased, multiple injections can be done, or viral spread can be enhanced by convection-enhanced delivery (40, 41), coinjection of heparin (for AAV2 serotype, (42), or coinjection of mannitol (43, 44)).

This chapter describes a protocol to produce high-titer, in vivo grade, rAAV vectors. In addition, we describe how to establish and analyze rAAV-mediated gene expression in the brain.

1. Human Embryonic Kidney 293T cells. 2. Dulbecco’s Modified Eagle Medium (DMEM) (Gibco –

Invitrogen, Carlsbad, CA) supplemented with 10% fetal bovine serum (FBS) (Lonza, Basel, Switzerland), 1× nonessential amino acids (n.e.a.a., 100×, Gibco), 1× glutamine (100×, Gibco),

2. Materials

2.1. rAAV Production

2.1.1. Cell Culture and Transfection

360 M.W.A. de Backer et al.

and 1× penicillin–streptomycin (pen/strep, 100×, PAA Laboratories, Pasching, Austria).

3. Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 2% FBS, 1× nonessential amino acids, 1× glutamine, and 1× penicillin–streptomycin.

4. 1× trypsin (10× PAA Laboratories). 5. Solution of polyethyleneimine [PEI, Mw 25 kDa (Polysciences

Inc., Warrington, PA) dissolved in water (0.323 g/L, pH = 8.0)]. This solution has to be freeze-thawed at least four times before use.

6. 1.5 M NaCl. 7. The desired rAAV plasmid (see Notes 1 and 2) and helper

plasmid(s) (see Note 3).

1. Cell scrapers (available from Corning Life Sciences, Lowell, MA or Sigma Chemicals, St. Louis, MO).

2. Ice-cold phosphate-buffered saline (dPBS, Gibco) with 5 mM ethylenediamine tetraacetic acid (EDTA) (Sigma Chemicals). Store at 4°C.

3. Ice-cold buffer containing: 150 mM NaCl and 50 mM Tris, pH 8.4. Store at 4°C.

1. Dry ice–100% ethanol. 2. Benzonase (Sigma Chemicals). 3. Polyallomer Quick-seal tubes 25 × 89 mm (Beckman Coulter,

Brea, CA). 4. OptiPrep (60% iodixanol, Lucron Bioproducts, Sint Martens-

Latem, Belgium). 5. 10× Dulbecco’s phosphate-buffered saline (10× dPBS, Gibco). 6. 1 M MgCl2. 7. 1 M KCl. 8. 0.5% phenol red: dissolve 0.25 g in 50 mL 50% ethanol. 9. 50 mL 15% Iodixanol: 12.5 mL 60% iodixanol, 5 mL 10× PBS,

10 mL 5 M NaCl, 50 L 1 M MgCl2, 125 L 1 M KCl, 75 L 0.5% phenol red, H2O up to 50 mL.

10. 50 mL 25% Iodixanol: 20.83 mL 60% iodixanol, 5 mL 10× PBS, 50 L 1 M MgCl2, 125 L 1 M KCl, 100 L 0.5% phenol red, H2O up to 50 mL.

11. 50 mL 40% Iodixanol: 33.4 mL 60% iodixanol, 5 mL 10× PBS, 50 L 1 M MgCl2, 125 L 1 M KCl, H2O up to 50 mL.

2.1.2. Harvesting of Transfected 293T Cells

2.2. rAAV Purification

2.2.1. Purification by Ultracentrifugation in Iodixanol Gradient

36124 rAAV Vectors

12. 60% Iodixanol: 25 mL 60% iodixanol + 25 L 1 M MgCl2, 62.5 L 1 M KCl, 12.5 L 0.5% phenol red.

13. Ti70 rotor (Beckman Coulter). 14. Two 20G needles and a 5-mL syringe.

1. 5 mL Hitrap Q HP columns (GE Healthcare, Amersham, UK). 2. Buffer A: 20 mM Tris, 15 mM NaCl, pH 8.5. For 500 mL,

mix 10 mL 1 M Tris–HCl pH 8.4 and 1.5 mL 5 M NaCl, bring volume up to 500 mL, in between adjust pH to 8.5.

3. Buffer B: 20 mM Tris, 500 mM NaCl, pH 8.5. For 500 mL, mix 10 mL 1 M Tris–HCl pH 8.4 and 50 mL 5 M NaCl, bring volume up to 500 mL, in between adjust pH to 8.5.

4. Infusion pump or an Akta prime automated liquid chromatog-raphy system (GE Healthcare).

5. When using an infusion pump, twenty-five 15-mL tubes with a gradient from 100%A to 100%B have to be made, in each tube buffer A is decreased by 4% and buffer B is increased by 4%. Tube 1 contains 100%A; tube 2: 96%A + 4%B; tube 3: 92%A + 8%B, etc. until tube 25: 100%B.

6. Label 25 15-mL tubes (1 through 25), which are used to col-lect the eluate.

1. Dilution buffer containing 10 g/mL salmon sperm (Sigma Chemicals) in water.

2. 2 M NaOH. 3. 2 M HCl (from 37%, 12.1 M commercially available solution). 4. 1 M Tris–HCl (Tris obtained from Roche, Basel, Switzerland),

pH 8.4. 5. PCR primers (available from Sigma Chemicals) (see Note 14),

Taq enzyme, and 10× PCR mix (GE Healthcare).

1. Amicon centricon Plus-20 Biomax-100 concentrator (Millipore, Billerica, MA).

1. Dilution buffer containing 10 g/mL salmon sperm (Sigma Chemicals) in water.

2. 2 M NaOH. 3. 2 M HCl (from 37%, 12.1 M commercially available solution). 4. LightCycler and capillaries (Roche). 5. Primers (available from Sigma Chemicals). 6. LightCycler FastStart DNA MasterPLUS Sybr Green I kit

(Roche).

2.2.2. Purification by Column Chromatography

2.2.3. Screening Fractions for rAVV Vector Genomes

2.2.4. Concentration and Desalting of rAAV Vector Fractions

2.2.5. Titration by qPCR

362 M.W.A. de Backer et al.

1. Obtain approval for injection of rAAV in mouse or rat brain and perform experiments according to guidelines and regula-tions of the relevant authorities.

2. 70% ethanol. 3. Anesthetics [0.1 mL/100 g Hypnorm (Janssen Pharmaceutica,

Beerse, Belgium) intramuscular], analgesics [0.1 mL/100 g Rimadyl (Pfizer animal health, NewYork, NY) is diluted 1:10 resulting in 5 mg/mL before subcutaneous injections], and saline.

4. Lubricant eye ointment. 5. Surgical tools including small surgical scalpel and scissors, small

dull forceps, fine sharp forceps, small bone scraper, and “surgical hooks.”

6. Laboratory scale. 7. Electric hair shaver. 8. Cotton swabs. 9. Hand-held drill. 10. 1- and 5-mL syringes. 11. Injection probes (make two probes for bilateral injections):

insert a 30G needle (Kloehn, 9009-30) in a 22G needle (Kloehn, 9009-22) and make it to fit (see Fig. 1). Each probe is connected to a syringe via a PE10 tube.

12. Infusion pump. 13. Stereotaxic apparatus. 14. Digital angle meter.

2.3. In Vivo Brain Injections and Determination of Injection Site

11 mm

4 mm

Here a PE10 tubeis inserted

Fig. 1. Injection needle to inject rAAV vectors into the brain.

36324 rAAV Vectors

There are several protocols to produce and purify rAAV vectors (9, 45, 46). Some protocols can only be used only for AAV2 sero-typed rAAV vectors (e.g., heparin column and A20 affinity col-umn), while others can be used for all serotypes (e.g., CsCl gradient followed by dialysis). Here, we describe a protocol which is based upon the protocol by Zolothukin (45) and can be used for all sero-types and includes an Iodixanol gradient and an anion exchange column. One has to keep in mind that the purification scheme may interfere with the transduction pattern which is observed; Klein et al. showed that AAV8 purified on CsCl gradient transduced neu-rons and astroglia, while AAV8 purified on an Iodixanol gradient transduced only neurons, this difference may be caused by differ-ences in protein impurity in the rAAV preparations (23).

During rAAV production and purification all operations with rAAV vectors have to be performed in a dedicated tissue culture hood (BL-2 level in the Netherlands) and an incubator separate from those used for maintaining cell lines. In addition, it is essen-tial to dispose virally contaminated materials properly. rAAV trans-fection and harvesting takes 5 days and the purification and titer determination of rAAV preparations takes another 2–3 days.

1. 293T cells are passaged twice a week with trypsin (see Note 4). For one rAAV preparation ten plates (of 15 cm) full with 239T cells are required (see Note 5).

2. On day 1, 18–24 h before transfection, plate 15 dishes of 15 cm with 293T cells, at 40–60% confluency.

3. On day 2, the cells should be 80–90% confluent. One to two hours before transfection replace the growth medium with prewarmed DMEM containing 2% FBS, n.e.a.a., glutamine and penicillin–streptomycin.

4. Perform transfections at a molar ratio of 1:1 of rAAV plasmid–helper plasmid. For each 15 cm dish 10 g of rAAV plasmid is necessary, (our rAAV plasmids are usually ~6 kb). The pDP helper plasmids are approximately 23.7 kb, thus for a 1:1 M ratio, 39.5 g of pDP helper plasmid is necessary (see Notes 6, 7 and Table 1). The transfection protocol is adapted from Reed et al. (47).

5. Thaw the plasmids and centrifuge the eppendorf tubes for 5 min at 14,000 × g in a table centrifuge prior to setting up the transfection (see Note 8).

6. Make master mix 1 containing the appropriate amounts of rAAV plasmid, helper plasmid, 1.5 M NaCl (end concentration 0.15 M NaCl), and water for 15 dishes (solution 1). For an example, see Table 1.

3. Methods

3.1. rAAV Production

3.1.1. Cell Culture and Transfection

364 M.W.A. de Backer et al.

7. Make master mix 2, for 15 dishes, in a separate tube. Solution 2 contains 8 L of PEI per g of DNA together with 1.5 M NaCl (end concentration 0.15 M NaCl) and water; see Table 1.

8. Add solution 1 to 2, invert the tube several times and let it stand for 20 min at RT. During these 20 min occasionally invert the tube. This incubation is necessary to form PEI-DNA complexes.

9. After incubation the mix is added dropwise to the cells, add 1 mL per plate. Before returning the plates to the incubator, gently rock the plates back and forth and sideways to achieve uniform distribution of the PEI-DNA precipitates throughout the plate.

10. Three to six h after transfection once again gently rock the plates back and forth in the incubator to enhance the transfec-tion efficiency.

11. Approximately 20 h after transfection (day 3), replace the medium with fresh prewarmed DMEM + 2% FBS. The old medium is removed and placed in an empty old medium bottle. Before discarding the old medium, add 1% SDS and sodium hypochlorite to the bottle to inactivate possible rAAV contamination.

Table 1 Example transfection mixtures

Solution 1Concentration (mg/mL)

mg per 15 cm dish

Volume per 15 cm dish (mL)

Volume 15 × 15 cm dishes (mL)

rAAV plasmid (~6 kb)

1 10 10 150

pDP helper (23.7 kb)

1 39.5 39.5 592.3

1.5 M NaCl 50 750

H2O 400.5 6,007.5

End volume 500 7,500

Solution 2 Volume per 15 cm dish (mL) Volume for 15 × 15 cm dishes (mL)

PEI (8 L/ g DNA) 396 5,940

1.5 M NaCl 50 750

H2O 54 810

End volume 500 7,500

36524 rAAV Vectors

1. At 60 h post transfection, scrape the cells from the plates with a rubber policeman, resuspend them in their current media and collect the cells in prechilled 50-mL tubes (see Note 9). Store the tubes with the transfected cells on ice.

2. Centrifuge the 50-mL tubes at 1,000 × g for 10 min at 4°C. 3. Discard the supernatant. 4. Resuspend the cell pellets in a total of 40 mL cold 1× PBS with

5 mM EDTA (4°C) by pipetting up and down. Collect the pel-lets from the different tubes in one 50 mL tube.

5. Centrifuge at 1,000 × g for 10 min at 4°C. 6. Resuspend the pellet in 12 mL cold buffer (150 mM NaCl,

50 mM Tris, pH 8.4; 4°C) in a 50 mL tube. When fewer plates are used, resuspend the pellet of every 15-cm dish in 1 mL buf-fer (e.g., 10 plates are resuspended in 10 mL); however, do not exceed 12 mL because of size limitations of the Iodixanol gra-dient. Store the resuspended cells at −20°C until purification. We usually continue after 3 days.

1. Lyse cells by three freeze-thaw cycles between dry ice–ethanol (100%) and 37°C water bath, to release rAAV from cells. Every time the cells are thawed, vigorously vortex the tube to resus-pend the cells.

2. Add benzonase to the cells to a final concentration of 50 units/mL and incubate at 37°C for 30 min. Benzonase is a nuclease and is used to remove much of the contaminating cellular DNA, unpackaged DNA and makes the solution less viscous.

3. Centrifuge the cells at 16,200 × g for 20 min at RT. 4. Discard the cell pellet. 5. Load 12 mL of supernatant into an OptiSeal tube and under-

lay with iodixanol solutions using a glass Pasteur pipette and a perfusion pump at a setting of ~3 mL/min (Fig. 2). Prevent the layers from mixing.(a) 9 mL 15% iodixanol in PBS-MK + 1 M NaCl(b) 6 mL 25% iodixanol in PBS-MK(c) 5 mL 40% iodixanol in PBS-MK(d) 5 mL 60% iodixanolIf necessary, top the gradient with PBS using a glass Pasteur’s pipette fitted with a rubber bulb (see Note 10).

6. Balance the tubes. 7. Seal tubes and centrifuge at 504,350 × g in Ti70 for 1.25 h at

18°C. 8. Insert a needle in the top of the tube to enable extraction of

the 40% layer. Puncture the tube with a needle attached to a

3.1.2. Harvesting of Transfected 293T Cells

3.2. rAAV Purification

3.2.1. Purification by Ultracentrifugation in Iodixanol Gradient

366 M.W.A. de Backer et al.

syringe just (~2 mm) below the 40–60% interface and remove ~4 mL from the 40% iodixanol layer (see Fig. 2 and Note 11). This solution may be stored at 4°C for use the next day or frozen at −20°C for longer storage.

1. Increase the volume of the extracted 40% layer to 20 mL with Buffer A before loading onto Hitrap Q column.

2. Attach the Hitrap Q column to the perfusion pump (see Note 12).

3. Perform a run as described in Table 2 and collect 2 mL frac-tions (see Note 13).

1. Mix the following solutions in eppendorf tubes to lyse the rAAV capsids and release single-stranded AAV DNA: 4 L of every AAV fraction, 16 L dilution buffer and 20 L 2 M NaOH. Incubate at 56°C for 30 min.

2. Neutralize by adding: 20 L 2 M HCl and 10 L 1 M Tris–HCl, pH 8.4.

3. Use 2 L for PCR reaction. 4. Make PCR master mix, which contains per reaction the follow-

ing: 17.8 L H2O, 2.5 L 10× Taq Buffer, 0.5 L 10 mM dNTPs, 1 L forward primer (10 pmol/ L) (see Note 14), 1 L reverse primer (10 pmol/ L) (see Note 14), and 0.2 L Taq.

3.2.2. Purification by Column Chromatography

3.2.3. Screening Fractions for rAAV Vector Genomes

Virus

Virus

15%

25%

40%

60%

15%

25%

40%

60%

After centrifugation

Before centrifugation

Fig. 2. Iodixanol gradient before and after centrifugation. rAAV is isolated from the 40 to 60% interface with a needle attached to a syringe; at the top of the tube another needle is inserted to enable extraction.

36724 rAAV Vectors

5. Add the mix to 2 L of lysed rAAV fractions. Also run a negative and positive control.

6. Run the following PCR program:(a) 95°C for 5 min(b) 95°C for 30 s(c) 58°C for 30 s(d) 72°C for 1 min(e) 25 cycles (steps (b) to (d))(f) 72°C for 10 min(g) 8°C forever.

7. Determine on agarose gel which fractions resulted in a PCR band and are thus positive for rAAV DNA. For AAV prepara-tions with AAV1 capsids and AAV2 ITRs, we usually find posi-tive fractions in tubes 9–20.

1. Pool the fractions which were positive for rAAV vector genomes.

2. Sterilize a Centricon Plus-20 Biomax-100 concentrator with 70% ethanol for a few minutes.

3. Aspirate the ethanol and rinse the column with 1× PBS. 4. Transfer the pooled fractions to the column and centrifuge at

RT for 5 min, 200 × g. Discard the flow-through into a bottle with 1% SDS and sodium hypochlorite.

5. Add 15 mL 1× PBS to the column and pipette up and down carefully around the filter to make sure that the filter does not get blocked. However, be careful not to touch the filter with the end of the pipette. Centrifuge at RT for 5 min, 200 × g.

3.2.4. Concentration and Desalting of rAAV Vector Fractions

Table 2 Run Hitrap Q column on perfusion pump

Step Volume (mL) Buffer Task Flow rate (mL/min)

1 25 B Preequilibrate with buffer B 4

2 50 A Preequilibrate with buffer A 4

3 20 Sample Load virus onto Hitrap Q 2

4 50 A Wash away unbound material 3

5 2 per tube Gradient 100%A to 100% B

Gradient to elute virus from column

2

6 30 B Wash column 4

368 M.W.A. de Backer et al.

6. Discard the flow-through in 1% SDS-sodium hypochlorite and repeat steps 5 and 6.

7. At the end of the cycles of desalting and concentration, con-tinue to centrifuge until nearly all the liquid has passed through the filter.

8. Carefully pipette the last remainder (~250 L) up and down along the filter and collect it into an eppendorf tube.

9. Aliquot the rAAV vector in batches of 10 L and store them at −80°C (see Note 15).

We perform titration according to the paper of Veldwijk et al. (48).

1. Thaw one aliquot and lyse the AAV capsid to release the ssDNA by mixing 4 L AAV stock, 16 L dilution buffer, 20 L 2 M NaOH.

2. Incubate at 56°C for 30 min. 3. Neutralize by adding 20 L 2 M HCl. 4. Dilute the sample 1:100 in dilution buffer. 5. Use 2 L for quantitative PCR in a LightCycler. 6. Make PCR master mix, which contains per reaction the following:

2 L primer cocktail (25 pmol/ L F and 25 pmol/ L R), 2 L water, 4 L Sybr Green mix.

7. Load capillaries into the holder, pipette 8 L master mix into capillaries and subsequently add 2 L of the sample (lysed AAV stock), 2 L DNA standards [1 × 104, 1 × 106 and 1 × 108 DNA molecules/ L (preferably of an rAAV plasmid diluted in H2O, these standards also function as a positive control), or 2 L water (negative control)].

8. Push tops on the capillaries and centrifuge to transfer liquid to the bottom of the capillaries. Start LightCycler program and type sample name, standards and negative control with the corresponding capillary number. In addition, add the known values for the standards: 2 × 104, 2 × 106 and 2 × 108.

9. Run the following program:(a) 95°C for 10 min, temperature transition rate 20°C/s(b) 95°C for 10 s, 20°C/s(c) 60°C for 5 s, 20°C/s(d) 72°C for 20 s, 20°C/s(e) 35 cycles (from steps (b) to (d)).

10. Calculate titer as genomic copies/mL. The titer obtained with qPCR has to be multiplied by 0.75 × 106 to obtain the genomic copies/mL, since 4 L of rAAV stock was diluted 15× to obtain 60 L. This was diluted 100× before start qPCR. The titer

3.2.5. Titration by qPCR

36924 rAAV Vectors

value from qPCR is for 2 L and has to be in milliliter there-fore the titer has to be increased with a factor 500.

11. To obtain an indication for the infectious particles perform a serial dilution of rAAV vector stock on cells. Usually, GFP-positive cells are counted after 72–96 h (see Note 16).

When rAAV vectors are made they can be used in vitro or in vivo, to study gene function. Note that when rAAV vectors are used for in vivo research, the infected neurons retain their native properties in intact neuronal networks, and the effect on behaviors can be investigated.

1. Determine the coordinates of the brain area of interest with stereotaxic atlases such as The mouse brain in stereotaxic coordinates (G. Paxinos and K.B.J. Franklin, Academic Press) and The rat brain in stereotaxic coordinates (G. Paxinos and C. Watson, Academic Press) (see Note 17).

2. Before starting surgery, ensure that all tools and reagents are clean (sterilized) and ready to be used. The surgical area should be disinfected with 70% ethanol.

3. Fill the tubing via needles connected to the stereotact with PBS, air, and rAAV vector (see Note 18) and put a mark on the tubing where the virus is located. This to verify if the virus has moved through the tube during injection.

4. Weigh the animal and calculate the appropriate dose for anes-thesia. After administering anesthesia (Hypnorm), the animal should fall asleep and full anesthesia should be reached within 5–10 min (lack of response to foot pinch), after which Rimadyl is given.

5. Shave the fur of the skull, clean the skin with 70% ethanol, apply lubricant eye ointment (to prevent dry eyes), and place the animal in an aligned stereotaxic apparatus, fixing the animal with ear bars and incisor adapter.

6. Visualize the top of the skull and make a midline incision with a small surgical scalpel, separate the subcutaneous and muscle tissue and use small hooks to keep the area open. Gently clean bregma and lambda areas using a small bone scraper.

7. Measure the position of x and y coordinates of bregma and intra-aural line and calculate the coordinates of target injection area. The intra-aural line can be used as a control.

8. Verify the angle of the needles with a digital angle meter because the stereotact arms may not be exactly 0°. Afterward, determine the injection sites with the needles that are placed in the holder of the stereotaxic arms and label the area for drilling.

9. Drill holes in the skull.

3.3. In Vivo Brain Injections and Determination of Injection Site

370 M.W.A. de Backer et al.

10. Place needles back into position. Determine once again the angle of the needles with a digital angle meter.

11. Bring the needles to the correct x and y position and lower until they touch the exposed dura. Penetrate the dura with the tip and slowly lower the needles to the desired z coordinate.

12. At the desired coordinates turn on the infusion pump and infuse rAAV at a rate of 0.2 L/min (see Note 19). When the appropriate amount of virus is injected, turn off the pump and wait for 10 min before withdrawing the needles.

13. Suture the skin. 14. Keep the animals warm under a blanket in a clean cage (single-

housed). Inject analgesic (Rimadyl) on the first and second day after surgery. Monitor the recovery closely for at least 1 week (see Note 20).

15. rAAV expression in vivo depends on genomic context of the vector (ssAAV or dsAAV), serotype used and tissue transduced. Usually after 2–3 weeks, the expression of rAAV cassette has reached its plateau and the expression can remain this high for years (22, 49, 50).

16. At the end of the experiment, animals can be perfused or decapitated, depending on what you want to do with the brain tissue next. All our rAAV vectors contain the green fluorescent protein (GFP); therefore, we can use GFP to localize the cells transduced by rAAV. However, other parts of the vector, such as woodchuck posttranscriptional regulatory element (WPRE), can also be used for localization. After perfusion we perform free-floating immunostaining against GFP on 40- m thick vibratome or microtome cut brain slices (can be performed together with NeuN, to check if predominantly neurons are transduced). However, after decapitation an in situ hybridiza-tion against GFP, on 20- m thick cryostat slices, is most opti-mal to detect transduced cells.

1. The size of the insert of interest plus inverted terminal repeats (ITRs) may not exceed 4.8 kb, since packaging of larger viral genomes is less efficient, thus resulting in low amounts of rAAV particles (27, 28).

2. The rAAV vectors are prone to recombination due to the inverted terminal repeats (ITRs). The ITRs are required for rAAV replication and packaging and need to be intact. To min-imize recombination rAAV plasmids are propagated in JC8111 at 30°C with 2× ampicillin (these cultures will grow slowly,

4. Notes

37124 rAAV Vectors

20–22 h for minipreps). Other groups reported that Stbl2 (Invitrogen) bacteria may also be used for propagation of rAAV (51, 52). Since recombination may still occur, every maxiprep is checked with the restriction enzyme SmaI to ensure that there was no (or only little) recombination in the ITRs. The SmaI digestion should be optimal (26°C for 2 h or overnight at RT); when there is an intense band at a size, which occurs after partial digestion, a new maxiprep should be made, since this may indicate that one of the ITRs cannot be cleaved any-more and is recombined. In addition, several other restriction enzymes are used to check the plasmid.

3. We generally use helper plasmids constructed by (53), which we obtained from the Plasmid factory (Bielefield, Germany). These helper plasmids contain adeno-helper genes and AAV rep and cap genes on one plasmid. The helper plasmids are grown into gigapreps (Qiagen) at 37°C with 1× ampicillin, since large amounts of helper plasmids are necessary. In addi-tion, there is also a packaging system where the adenohelper genes and AAV genes are located on two different plasmids (4, 54).

4. All tissue incubations are performed in a humidified 37°C, 5% CO2 incubator. All equipment and reagents that come into contact with tissue culture cells should be sterile as should be the purified virus.

5. We generally do not use cells with passage number higher than 25 for rAAV preparations.

6. The different pDP helper plasmids encode different capsid proteins; this makes it possible to pseudotype rAAV vectors with another capsid, which uses a different (often unknown) cell entry receptor, and thereby the tropism of the rAAV vector can be altered so that it may transduce other cell types.

7. When the adeno-helper genes and the AAV rep/cap genes are located on two plasmids the molar ratio for transfection is 1:1:1 for rAAV–adeno helper–rep/cap plasmids.

8. This spin is to remove column debris from maxi prep DNA (Qiagen maxi preps); the debris can reduce transfection efficiency.

9. If possible, check transfection efficiency under a microscope before collecting the cells; there are fluorescent markers in the pDP helper constructs. High transfection efficiency (at least 80%) is important to obtain high titers of rAAV preparations.

10. Preferably these large Beckman tubes in combination with 70Ti rotor have to be used. Previously, we used the smaller OptiSeal tubes (16 × 60 mm) in combination with 70.1Ti rotor and had to prepare several iodixanol gradients for one rAAV

372 M.W.A. de Backer et al.

preparation and subsequently pooled the different 40% layers; however, this may reduce the titer.

11. Sometimes, there is a “fluffy” band at the 25–40% interface; this is cell debris and should not be extracted.

12. We use perfusion pump; however, the column can also be attached to an Äktaprime automated liquid chromatography system (Amersham Biosciences). The program is shown in Table 3.

13. During the gradient run, the pump is set at a flow rate of 2 mL/min. Every minute, the pump inlet is moved one gradient tube further (from 1 to 25, thereby decreasing buffer A with 4% and increasing buffer B with 4%). Meanwhile, once per minute the tubes collecting the column eluate are changed, generating fractions of 2 mL. Usually, we change the pump inlet at 1.00 min, 2.00 min, 3.00 min etc. and the collection tubes are changed at 1.30 min, 2.30 min, 3.30 min, etc.

14. Depending on the rAAV vector used, we use bgh-polyA (F2 and R2) or GFP (F and R) primers. Their sequences are the following:(a) bgh-polyA F2: 5 CCTCGACTGTGCCTTCTAG(b) bgh-polyA R2: 5 CCCCAGAATAGAATGACACCTA(c) GFP-F: 5 CACATGAAGCAGCACGACTT(d) GFP-R: 5 GAAGTTCACCTTGATGCCGT

15. The rAAV vectors should not be thawed often, since every freeze–thaw step reduces the titer.

16. We primarily use HT1080 cells to verify if the ratio of genomic copies to infectious particles is constant over different rAAV vector preparations. However, depending on the serotype other cell lines may be more optimal, since different serotypes use different entry receptors (55).

17. These coordinates can be checked by anesthetizing rats of same age and gender, as the rats that will be used in the rAAV experi-ment, and inject them with methylene blue instead of rAAV. Directly after injection, the animals are decapitated and the brains are removed, frozen, sectioned, and inspected for methyl blue localization.

18. Use an appropriate titer of rAAV to transduce the area of interest. We generally inject 1 L containing 1 × 109 g.c. of an AAV1 serotyped vector to transduce nuclei in the hypothala-mus, such as PVN, VMH, and LH. Increasing or decreasing the volume or the amount of rAAV genomes can increase or decrease the area that is transduced (26). There appears to be a minimum threshold of ~5 × 107 g.c. rAAV genomes to achieve consistent transduction of areas in the rat brain (49). Different

37324 rAAV Vectors

Tabl

e 3

Run

Hitr

ap Q

on

Äkta

prim

e au

tom

ated

liqu

id c

hrom

atog

raph

y sy

stem

Step

Volu

me

Conc

entr

atio

n %

BFl

ow ra

teFr

actio

nBu

ffer v

alve

Inje

ctio

n va

lve

Com

men

ts

10

100

400

1W

aste

Prim

e bu

ffer

B

224

.910

040

01

Was

teE

nd p

rim

ing

B

325

040

01

Was

tePr

ime

buff

er A

450

05

01

Loa

dE

quili

brat

e

574

.90

50

1L

oad

End

equ

ilibr

atio

n

675

02

01

Inje

ctIn

ject

sam

ple

from

su

perl

oop

795

05

01

Loa

dW

ash

colu

mn

with

bu

ffer

A

814

50

32

1L

oad

Star

t gr

adie

nt e

lutio

n

919

510

03

21

Loa

dE

nd e

lutio

n

1019

5.1

100

32

1L

oad

Con

tinue

elu

tion

with

B

1122

510

03

21

Loa

dE

nd

374 M.W.A. de Backer et al.

rAAV serotypes can have different transduction efficiencies in one brain area. In addition, the transduction efficiency of one rAAV serotype can be different between brain areas, develop-mental stages, and species.

19. We generally infuse 1 L; thus, we inject for 5 min. Larger volumes can be injected by increasing the injection time, but keeping the injection speed at 0.2 L/min.

20. Monitor for any signs of distress, such as piloerection, lack of grooming, reduced locomotor activity, and wound scratching. During the first days after surgery, food and water intake drop, but they usually return to normal levels ~7 days post operation.

References

1. Daya, S., and Berns, K. I. (2008) Gene therapy using adeno-associated virus vectors. Clin. Microbiol. Rev. 21, 583–593

2. Bouard, D., Alazard-Dany, D., and Cosset, F. L. (2009) Viral vectors: from virology to trans-gene expression. Br. J. Pharmacol. 157, 153–165

3. Kaplitt, M. G., Leone, P., Samulski, R. J., Xiao, X., Pfaff, D. W., Omalley, K. L. et al. (1994) Long-term gene-expression and phenotypic correction using adenoassociated virus vectors in the mammalian brain. Nat. Genetics 8, 148–154

4. Xiao, X., Li, J., and Samulski, R. J. (1998) Production of high-titer recombinant adeno-associated virus vectors in the absence of helper adenovirus. J. Virol. 72, 2224–2232

5. Grimm, D., Kern, A., Rittner, K., and Kleinschmidt, J. A. (1998) Novel tools for pro-duction and purification of recombinant ade-noassociated virus vectors. Hum. Gene Ther. 9, 2745–2760

6. Collaco, R. F., Cao, X., and Trempe, J. P. (1999) A helper virus-free packaging system for recombinant adeno-associated virus vectors. Gene 238, 397–405

7. Matsushita, T., Elliger, S., Elliger, C., Podsakoff, G., Villarreal, L., Kurtzman, G. J. et al. (1998) Adeno-associated virus vectors can be efficiently produced without helper virus. Gene Ther. 5, 938–945

8. Zhang, X., De Alwis, M., Hart, S. L., Fitzke, F. W., Inglis, S. C., Boursnell, M. E. et al. (1999) High-titer recombinant adeno-associated virus production from replicating amplicons and herpes vectors deleted for glycoprotein H. Hum. Gene Ther. 10, 2527–2537

9. Grieger, J. C., Choi, V. W., and Samulski, R. J. (2006) Production and characterization of

adeno-associated viral vectors. Nat. Protocols. 1, 1412–1428

10. Qiao, C., Wang, B., Zhu, X., Li, J., and Xiao, X. (2002) A novel gene expression control sys-tem and its use in stable, high-titer 293 cell-based adeno-associated virus packaging cell lines. J. Virol. 76, 13015–13027

11. Urabe, M., Ding, C., and Kotin, R. M. (2002) Insect cells as a factory to produce adeno-asso-ciated virus type 2 vectors. Hum. Gene Ther. 13, 1935–1943

12. Ferrari, F. K., Xiao, X., McCarty, D., and Samulski, R. J. (1997) New developments in the generation of Ad-free, high-titer rAAV gene therapy vectors. Nat. Medicine 3, 1295–1297

13. Michelfelder, S., and Trepel, M. (2009) Adeno-associated viral vectors and their redirection to cell-type specific receptors. Adv. Genet. 67, 29–60

14. Vandenberghe, L. H., Wilson, J. M., and Gao, G. (2009) Tailoring the AAV vector capsid for gene therapy. Gene Ther. 16, 311–319

15. Summerford, C., and Samulski, R. J. (1998) Membrane-associated heparan sulfate proteo-glycan is a receptor for adeno-associated virus type 2 virions. J. Virol. 72, 1438–1445

16. Kaludov, N., Brown, K. E., Walters, R. W., Zabner, J., and Chiorini, J. A. (2001) Adeno-associated virus serotype 4 (AAV4) and AAV5 both require sialic acid binding for hemaggluti-nation and efficient transduction but differ in sialic acid linkage specificity. J. Virol. 75, 6884–6893

17. Wu, Z., Miller, E., Agbandje-McKenna, M., and Samulski, R. J. (2006) Alpha2,3 and alpha2,6 N-linked sialic acids facilitate efficient binding and transduction by adeno-associated virus types 1 and 6. J. Virol. 80, 9093–9103

37524 rAAV Vectors

18. Summerford, C., Bartlett, J. S., and Samulski, R. J. (1999) alpha V beta 5 integrin: a co-receptor for adeno-associated virus type 2 infection. Nat. Medicine 5, 78–82

19. Kashiwakura, Y., Tamayose, K., Iwabuchi, K., Hirai, Y., Shimada, T., Matsumoto, K. et al. (2005) Hepatocyte growth factor receptor is a coreceptor for adeno-associated virus type 2 infection. J. Virol. 79, 609–614

20. Kurzeder, C., Koppold, B., Sauer, G., Pabst, S., Kreienberg, R., and Deissler, H. (2007) CD9 promotes adeno-associated virus type 2 infec-tion of mammary carcinoma cells with low cell surface expression of heparan sulphate proteo-glycans. Int. J. Mol. Med. 19, 325–333

21. Burger, C., Gorbatyuk, O. S., Velardo, M. J., Peden, C. S., Williams, P., Zolotukhin, S. et al. (2004) Recombinant AAV viral vectors pseudo-typed with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tro-pism after delivery to different regions of the central nervous system. Mol. Ther. 10, 302–317

22. Reimsnider, S., Manfredsson, F. P., Muzyczka, N., and Mandel, R. J. (2007) Time course of transgene expression after intrastriatal pseudo-typed rAAV2/1, rAAV2/2, rAAV2/5, and rAAV2/8 transduction in the rat. Mol. Ther. 15, 1504–1511

23. Klein, R. L., Dayton, R. D., Tatom, J. B., Henderson, K. M., and Henning, P. P. (2008) AAV8, 9, Rh10, Rh43 vector gene transfer in the rat brain: effects of serotype, promoter and purification method. Mol. Ther. 16, 89–96

24. Klein, R. L., Dayton, R. D., Leidenheimer, N. J., Jansen, K., Golde, T. E., and Zweig, R. M. (2006) Efficient neuronal gene transfer with AAV8 leads to neurotoxic levels of tau or green fluorescent proteins. Mol. Ther. 13, 517–527

25. McFarland, N. R., Lee, J. S., Hyman, B. T., and McLean, P. J. (2009) Comparison of trans-duction efficiency of recombinant AAV sero-types 1, 2, 5, and 8 in the rat nigrostriatal system. J. Neurochem. 109, 838–845

26. de Backer, M., Brans, M., Luijendijk, M., Garner, K., and Adan, R. (2010) Optimization of adeno-associated viral vector mediated gene delivery to the hypothalamus. Hum. Gene Ther. 21, 673–82

27. Dong, J. Y., Fan, P. D., and Frizzell, R. A. (1996) Quantitative analysis of the packaging capacity of recombinant adeno-associated virus. Hum. Gene Ther. 7, 2101–2112

28. Grieger, J. C., and Samulski, R. J. (2005) Packaging capacity of adeno-associated virus serotypes: impact of larger genomes on infec-tivity and postentry steps. J. Virol. 79, 9933–9944

29. McCarty, D. M., Monahan, P. E., and Samulski, R. J. (2001) Self-complementary recombinant adeno-associated virus (scAAV) vectors pro-mote efficient transduction independently of DNA synthesis. Gene Ther. 8, 1248–1254

30. McCarty, D. M. (2008) Self-complementary AAV vectors; advances and applications. Mol. Ther. 16, 1648–1656

31. Wang, Z., Ma, H. I., Li, J., Sun, L., Zhang, J., and Xiao, X. (2003) Rapid and highly efficient transduction by double-stranded adeno-associ-ated virus vectors in vitro and in vivo. Gene Therapy 10, 2105–2111

32. McCarty, D. M., Fu, H., Monahan, P. E., Toulson, C. E., Naik, P., and Samulski, R. J. (2003) Adeno-associated virus terminal repeat (TR) mutant generates self-complementary vectors to overcome the rate-limiting step to transduction in vivo. Gene Ther. 10, 2112–2118

33. Buie, L. K., Rasmussen, C. A., Porterfield, E. C., Ramgolam, V. S., Choi, V. W., Markovic-Plese, S. et al. (2010) Self-complementary AAV virus (scAAV) safe and long-term gene transfer in the trabecular meshwork of living rats and monkeys. Invest Ophthalmol. Vis. Sci. 51, 236–248

34. Chamberlin, N. L., Du, B., de Lacalle, S., and Saper, C. B. (1998) Recombinant adeno-asso-ciated virus vector: use for transgene expression and anterograde tract tracing in the CNS. Brain Res. 793, 169–175

35. Broekman, M. L., Tierney, L. A., Benn, C., Chawla, P., Cha, J. H., and Sena-Esteves, M. (2009) Mechanisms of distribution of mouse beta-galactosidase in the adult GM1-gangliosidosis brain. Gene Ther. 16, 303–308

36. El Meskini, R., Jin, L., Marx, R., Bruzzaniti, A., Lee, J., Emeson, R. et al. (2001) A signal sequence is sufficient for green fluorescent pro-tein to be routed to regulated secretory gran-ules. Endocrinology 142, 864–873

37. Pouli, A. E., Kennedy, H. J., Schofield, J. G., and Rutter, G. A. (1998) Insulin targeting to the regulated secretory pathway after fusion with green fluorescent protein and firefly luciferase. Biochem. J. 331, 669–675

38. Haberman, R. P., Samulski, R. J., and McCown, T. J. (2003) Attenuation of seizures and neu-ronal death by adeno-associated virus vector galanin expression and secretion. Nat. Medicine 9, 1076–1080

39. Gasmi, M., Herzog, C. D., Brandon, E. P., Cunningham, J. J., Ramirez, G. A., Ketchum, E. T. et al. (2007) Striatal delivery of neurturin by CERE-120, an AAV2 vector for the treat-ment of dopaminergic neuron degeneration in Parkinson’s disease. Mol. Ther. 15, 62–68

376 M.W.A. de Backer et al.

40. Lieberman, D. M., Laske, D. W., Morrison, P. F., Bankiewicz, K. S., and Oldfield, E. H. (1995) Convection-enhanced distribution of large molecules in gray matter during intersti-tial drug infusion. J. Neurosurg. 82, 1021–1029

41. Cunningham, J., Oiwa, Y., Nagy, D., Podsakoff, G., Colosi, P., and Bankiewicz, K. S. (2000) Distribution of AAV-TK following intracranial convection-enhanced delivery into rats. Cell Transplant. 9, 585–594

42. Nguyen, J. B., Sanchez-Pernaute, R., Cunningham, J., and Bankiewicz, K. S. (2001) Convection-enhanced delivery of AAV-2 com-bined with heparin increases TK gene transfer in the rat brain. Neuroreport 12, 1961–1964

43. Mastakov, M. Y., Baer, K., Xu, R., Fitzsimons, H., and During, M. J. (2001) Combined injec-tion of rAAV with mannitol enhances gene expression in the rat brain. Mol. Ther. 3, 225–232

44. Fu, H., Muenzer, J., Samulski, R. J., Breese, G., Sifford, J., Zeng, X. et al. (2003) Self-complementary adeno-associated virus sero-type 2 vector: global distribution and broad dispersion of AAV-mediated transgene expres-sion in mouse brain. Mol. Ther. 8, 911–917

45. Zolotukhin, S., Potter, M., Zolotukhin, I., Sakai, Y., Loiler, S., Fraites, T. J., Jr. et al. (2002) Production and purification of serotype 1, 2, and 5 recombinant adeno-associated viral vectors. Methods 28, 158–167

46. Zolotukhin, S., Byrne, B. J., Mason, E., Zolotukhin, I., Potter, M., Chesnut, K. et al. (1999) Recombinant adeno-associated virus purification using novel methods improves infectious titer and yield. Gene Ther. 6, 973–985

47. Reed, S. E., Staley, E. M., Mayginnes, J. P., Pintel, D. J., and Tullis, G. E. (2006) Transfection of mammalian cells using linear polyethylenimine is a simple and effective means of producing recombinant adeno-associ-ated virus vectors. J. Virol. Meth. 138, 85–98

48. Veldwijk, M. R., Topaly, J., Laufs, S., Hengge, U. R., Wenz, F., Zeller, W. J. et al. (2002) Development and optimization of a real-time quantitative PCR-based method for the titra-tion of AAV-2 vector stocks. Mol. Ther. 6, 272–278

49. Klein, R. L., Hamby, M. E., Gong, Y., Hirko, A. C., Wang, S., Hughes, J. A. et al. (2002) Dose and promoter effects of adeno-associated viral vector for green fluorescent protein expres-sion in the rat brain. Exp. Neurol. 176, 66–74

50. Zincarelli, C., Soltys, S., Rengo, G., and Rabinowitz, J. E. (2008) Analysis of AAV sero-types 1–9 mediated gene expression and tro-pism in mice after systemic injection. Mol. Ther. 16, 1073–1080

51. Sun, B., Zhang, H., Franco, L. M., Young, S. P., Schneider, A., Bird, A. et al. (2005) Efficacy of an adeno-associated virus 8-pseudotyped vector in glycogen storage disease type II. Mol. Ther. 11, 57–65

52. Rafi, M. A., Zhi, R. H., Passini, M. A., Curtis, M., Vanier, M. T., Zaka, M. et al. (2005) AAV-mediated expression of galactocerebrosidase in brain results in attenuated symptoms and extended life span in murine models of globoid cell leukodystrophy. Mol. Ther. 11, 734–744

53. Grimm, D., Kay, M. A., and Kleinschmidt, J. A. (2003) Helper virus-free, optically controlla-ble, and two-plasmid-based production of adeno-associated virus vectors of serotypes 1 to 6. Mol. Ther. 7, 839–850

54. Rabinowitz, J. E., Rolling, F., Li, C. W., Conrath, H., Xiao, W. D., Xiao, X. et al. (2002) Cross-packaging of a single adeno-associated virus (AAV) type 2 vector genome into multi-ple AAV serotypes enables transduction with broad specificity. J. Virol. 76, 791–801

55. Rabinowitz, J. E., Bowles, D. E., Faust, S. M., Ledford, J. G., Cunningham, S. E., and Samulski, R. J. (2004) Cross-dressing the virion: the transcapsidation of adeno- associated virus serotypes functionally defines subgroups. J. Virol. 78, 4421–4432