Methylation status and protein expression of RASSF1A in breastcancer patients

Hoda A. Hagrass • Heba F. Pasha • Mohamed A. Shaheen •

Eman H. Abdel Bary • Rasha Kassem

Received: 11 December 2012 / Accepted: 26 October 2013 / Published online: 20 November 2013

� Springer Science+Business Media Dordrecht 2013

Abstract Recently genetics and epigenetics alterations

have been found to be characteristic of malignancy and

hence can be used as targets for detection of neoplasia. RAS

association domain family protein 1A (RASSF1A) gene

hypermethylation has been a subject of interest in recent

researches on cancer breast patients. The aim of the present

study was to evaluate whether RASSF1A methylation status

and RASSF1A protein expression are associated with the

major clinico-pathological parameters. One hundred and

twenty breast cancer Egyptian patients and 100-control

subjects diagnosed with benign lesions of the breast were

enrolled in this study. We evaluated RASSF1A methylation

status in tissue and serum samples using Methyl specific

PCR together with RASSF1A protein expression in tissues

by immunohistochemistry. Results were studied in relation

to known prognostic clinicopathological features in breast

cancer. Frequency of RASSF1A methylation in tissues and

serum were 70 and 63.3 % respectively and RASSF1A

protein expression showed frequency of 46.7 %. There was

an association between RASSF1A methylation in tissues,

serum and loss of protein expression in tissues with invasive

carcinoma, advanced stage breast cancer, L.N. metastasis,

ER/PR and HER2 negativity. RASSF1A methylation in

serum showed high degree of concordance with methylation

in tissues (Kappa = 0.851, P \ 0.001). RASSF1A hyper-

methylation in tissues and serum and its protein expression

may be a valid, reliable and sensitive tool for detection and

follow up of breast cancer patients.

Keywords RAS association domain family protein

1A � Methylated polymerase chain reaction � Breast

cancer � Egypt

Abbreviations

RASSF1A RAS association domain family protein 1A

PCR Polymerase chain reaction

MSP Methyl specific PCR

CIS Carcinoma in situ

IHC Immunohistochemistry

Introduction

Breast cancer is the most common cancer and the second

most common cause of death from cancer in women. Every

year more than one million women are diagnosed with

breast cancer and approximately 400,000 die [1]. Breast

cancer is considered the leading cause of cancer death

among females in economically developing countries;

carcinoma of the breast is the most prevalent cancer among

Egyptian women and constitutes 29 % of National Cancer

H. A. Hagrass (&)

Clinical Pathology Department, Faculty of Medicine,

Zagazig University, Zagazig, Egypt

e-mail: hudahagrass@gmail.com

H. F. Pasha

Medical Biochemistry Department, Faculty of Medicine,

Zagazig University, Zagazig, Egypt

M. A. Shaheen

Histology and Cell Biology Department, Faculty of Medicine,

Zagazig University, Zagazig, Egypt

E. H. Abdel Bary

Pathology Department, Faculty of Medicine,

Zagazig University, Zagazig, Egypt

R. Kassem

Surgery Department, Faculty of Medicine,

Zagazig University, Zagazig, Egypt

123

Mol Biol Rep (2014) 41:57–65

DOI 10.1007/s11033-013-2837-3

Institute cases. Median age at diagnosis is one decade

younger than in countries of Europe and North America

and most patients are premenopausal [2].

For successful treatment and outcome, early detection of

breast cancer is a necessity. Despite the availability of

mammography and prevalence of self-examination, there is

still additional benefit to be gained from additional

screening methodologies. Free circulating DNA is

increased in the serum/plasma of cancer patients, and

methylation of certain genes has been found to be char-

acteristic for malignancy [3].

The genetic and epigenetic alterations that initiate and

drive tumorigenesis can be used as targets for detection of

neoplasia in body fluids [4], because they may precede

clinically obvious cancer, can be detected at sensitive

levels, may be specific for tumor cells, and can potentially

provide information about the prognosis and treatment of

the disease [5, 6]. CpG islands located in promoter regions

of genes are normally unmethylated. In cancer cells,

aberrant hypermethylation of these promoter regions is

associated with transcriptional silencing. Hypermethylation

is therefore an alternative mechanism for inactivation of

tumor suppressor genes [7, 8].

Also it has been found that gene hypermethylation is a

common and early alteration in many tumor types [9–11],

including breast [12–14], hence it is considered as a

promising target for detection strategies in clinical speci-

mens [5, 6].

Promoter methylation of putative tumor suppressor

genes in circulating free DNA (cfDNA) of bodily fluids,

like serum, is a rapidly growing research topic for early

cancer detection. However, in the breast cancer field, none

of the reported biomarkers has reached clinical application

[15].

RASSF1 encodes several isoforms, including RASSF1A,

RASSF1B, and RASSF1C, which are derived from alter-

native mRNA splicing and promoter usage [16]. RAS

association domain family protein 1A (RASSF1A) meth-

ylation status has been examined in different tumors [16,

17] and breast cancer [4, 14, 17, 18]. RASSF1A identified at

3p21.3 was suggested as the major target tumor suppressor

on the basis of its frequent epigenetic silencing [16]. It was

reported previously that RASSF1A is epigenetically inac-

tivated in 40–72 % of primary lung tumors by de novo

methylation at the CpG island in the promoter region [17,

19, 20]. Methylation-associated inactivation of RASSF1A

was also observed in a considerable proportion of breast,

ovarian, and nasopharyngeal cancer cell lines and primary

tumors [17, 19–22]. The tumor suppressor function of

RASSF1A has been suggested by observations that exog-

enous expression of RASSF1A decreases in vitro-colony

formation, suppresses anchorage-independent growth, and

dramatically reduces tumorigenicity in vivo [19, 20]. With

these tumor suppression effects, the presence of a RAS

association domain suggests that RASSF1 proteins may

function as effector molecules in RAS or related growth

inhibitory signaling pathways.

In this study we examined the methylation status of the

normally unmethylated RASSF1A gene in paired serum

and tissue samples in cancer breast patients together with

immunohistochemical analysis of RASSF1A protein.

Results were studied in relation to prognostic clinicopath-

ological features in a trial to reveal RASSF1A gene role in

prognosis.

Materials and methods

Specimen collection

One hundred twenty consecutive patients diagnosed with

breast cancer who were admitted to Zagazig University

hospitals, in the period from January 2011 to June 2012,

were enrolled in this study, patients who have received

chemotherapy or radiotherapy in the preoperative period

have been excluded. Patients’ ages ranged from 34 to

62 years. There were 20 cases of ductal CIS, 8 lobular CIS,

80 invasive ductal, and 12 invasive lobular carcinomas.

Matched preoperative serum and tissue specimens were

obtained from breast cancer patients and from control

group that included 100 patients with benign breast lesions

(70 fibroadenomas; 30 fibrocystic changes).

As regards tissue samples, 4 lm thick sections from

formalin-fixed, paraffine-embedded tissue blocks were

stained with hematoxylin–eosin for morphological assess-

ment. Tumors were evaluated for tumor grade using the

Elston and Ellis grading system for invasive carcinoma,

and the criteria of the European Breast Screening Group for

DCIS, and tumor stage based on TNM, according to the

2003 WHO classification of breast tumors [23].

Ethical consideration

A written consent was taken from all of the participants

after explaining details, benefits as well as risks to them.

Immunohistochemistry

Immunohistochemical staining was carried out using strep-

tavidin-biotin immunoperoxidase technique (Dako-cyto-

mation, Glostrup, Denmark). 3 lm thick sections, cut from

formalin fixed paraffin embedded blocks, were deparaffi-

nized in Xylene and rehydrated in graded alcohol. Sections

were boiled in citrate buffer (pH 6.0) for 20 min for antigen

retrieval and then washed in phosphate buffer saline (pH

7.3). Blocking of endogenous peroxidase activity by 3 %

58 Mol Biol Rep (2014) 41:57–65

123

H2O2 in methanol was attained. The slides were then incu-

bated over night with the monoclonal antibodies: anti-

RASSF1A (mouse monoclonal IgG, clone 3F3, code number

AB23950), anti-ER (mouse monoclonal IgG, code number

sc-56833, Santa Cruz Biotechnology, CA), anti-PR (rabbit

polyclonal IgG, code number sc-539, Santa Cruz Biotech-

nology, CA, USA) and anti-HER2 (mouse monoclonal IgG,

code number sc-33684, Santa Cruz Biotechnology, CA,

USA). Incubation with secondary antibody and product

visualization was performed employing (Dako Cytomation,

Glostrup, Denmark) method with diaminobenzidine (DAB)

substrate chromogen. Slides were finally counterstained with

Mayer’s haematoxylin. The primary antibody was replaced

by phosphate buffer solution (PBS) for negative controls.

RASSF1A protein expression appeared as yellowish

brown staining in the cytoplasm of the cells. Positive

staining in more than 10 % of tumor cells in the examined

area was considered. We calculated a score (intensity 9 %

area) for each tumor as follows: weak \100, moderate

100–200, and strong[200. Then a score equal or over 100

was considered positive expression, and bellow 100 con-

sidered as significant loss of expression [18].

DNA extraction

DNA was extracted from fresh frozen tissue or from blood

using a standard technique according to the manufacturer’s

instructions (QIAamp DNAMini kit, QIAGEN GmbH,

Hilden, Germany).

Methylation analysis

Specimen DNA was modified with sodium bisulfite, con-

verting all unmethylated, but not methylated, cytosine to

uracil followed by amplification with primers specific for

methylated versus unmethylated DNA [24] by using a

commercial kit (EpiTect Bisulfite, QIAGEN GmbH, Hil-

den, Germany) according to the manufacturer’s instruc-

tions in brief the procedure comprises a few simple steps:

bisulfite-mediated conversion of unmethylated cytosines;

binding of the converted single-stranded DNA to the

membrane of an EpiTect spin column; washing; desulfo-

nation of membrane-bound DNA; washing of the mem-

brane-bound DNA to remove desulfonation agent; and

elution of the pure, converted DNA from the spin column

then kept at -20 �C for further using.

Methylation-specific PCR analysis

PCR was performed with methylation specific primers

RASSF1A (U) F (50TGGTTTTTTTTAGTTTTTTTTTG

TT-30) R (50ACTACCATATAAAATTACACACA-30) RA

SSF1A (M) F (50GGTTTTTTTTAGTTTTTTTTCGTC-30)

R (50-CTACCGTATAAAATTACACGCG-30) using 200 ng

of the bisulfite-modified genomic DNA as templates and

EpiTect MSP kit (QIAGEN GmbH, Hilden, Germany) kit,

the cycling conditions consisted of an initial denaturation

step at 95 �C for 5 min, followed by 35 cycles of 94 �C for

30 s, 57 C for 30 s, and 72 �C for 45 s the PCR products

(15 ll) were resolved on a 2 % agarose gel. Both negative

and positive controls using EpiTect control DNA methyl-

ated (QIAGEN GmbH, Hilden, Germany) and Epitect

control DNA unmethylated (QIAGEN GmbH, Hilden,

Germany) were done but the data was not shown.

Statistical analysis

Data was analyzed using SPSS win statistical package ver-

sion 17 (SPSS Inc., Chicago, IL). Chi square test or Fisher’s

Table 1 Demographic and clinicopathologic characteristics of can-

cer breast patients

Variable Frequency (%)

Age (50.9 ± 7.75) years

\50 years 52 (43.3 %)

C50 years 68 (56.7 %)

Types

Carcinoma in situ 28 (23.3 %)

Invasive carcinoma 92 (76.7 %)

Grade

I, II 56 (46.7 %)

III 64 (46.7 %)

Stage

Early stage (0 & I) 48 (40 %)

Advanced stage (II & III) 72 (60 %)

ER

-ve 36 (30 %)

?ve 84 (70 %)

PR

-ve 52 (43.3 %)

?ve 68 (56.7 %)

Lymph node

-ve 80 (66.7 %)

?ve 40 (33.3 %)

RASSF1 IHC

-ve or \ 100 64 (53.3 %)

C100 56 (46.7 %)

RASSF1 methylation in tissue

M 84 (70.0 %)

U 36 (30 %)

RASSF1 methylation in serum

M 76 (63.3 %)

U 44 (36.7 %)

Mol Biol Rep (2014) 41:57–65 59

123

exact test was used to examine the relation between quali-

tative variables. For not-normally distributed quantitative

data, comparison between two groups was done using

Mann–Whitney test. Odds ratio (OR) with it 95 % confi-

dence interval (CI) were used for risk estimation. A P value

\0.05 was considered significant.

Results

In the current study we evaluated 120-breast cancer patients

mean age ± SD (50.9 ± 7.7) years and 100 patients diag-

nosed as benign breast lesions (70 fibroadenomas and 30

fibrocystic change) used as a control group. The mean

age ± SD was 38.4 ± 8.6 years. All patients were subjected

to clinical and histopathological evaluation. Both patients

and control groups were evaluated for RASSF1A gene hy-

permethylation in paired tissue and serum samples, further-

more RASSF1 protein expression in tissues was evaluated by

Immunohistochemistry.

Demographic and clinicopathologic data of breast can-

cer patients Table 1 and their frequencies as regards

RASSF1A methylation status in tissues and serum and

RASSF1A protein expression are shown in Table 2.

Comparison among different clinicopathological

groups as regards RASSF1A

There was a highly significant difference (P \ 0.001)

between in situ and invasive carcinoma when compared as

Table 2 Frequencies and associations of clinicopathologic characteristics with RASSF1A methylation status in serum and tissue and RASSF1A

IHC score

Frequency

N (%)

RASSF1A in tissue RASSF1A in serum RASSF1A IHC score

M U M U -ve or \100 C 100

84 (70 %) 36 (30 %) 76 (63.3 %) 44 (36.7 %) 64 (53.4 %) 56 (46.6 %)

Age (years)

\50 32 (61.5) 20 (38.5) 28 (53.8) 24 (46.2) 24 (46.2) 28 (53.8)

C50 52 (76.5) 16 (23.5) 48 (70.6) 20 (29.4) 40 (58.8) 28 (41.2)

P value 0.12 0.09 0.23

Type

Carcinoma in situ 12 (42.9) 16 (57.1) 8 (28.6) 20 (71.4) 8 (42.9) 18 (57.1)

Invasive carcinoma 72 (78.3) 20 (21.7) 68 (73.9) 24 (26.1) 56 (56.5) 38 (43.5)

P value \0.001 \0.001 0.02

Low grade (I, II) 38 (63.3) 22 (36.7) 34 (56.7) 26 (43.3) 28 (46.6) 32 (53.4)

High grade (III) 46 (76.7) 14 (23.3) 42 (70.0) 18 (30) 36 (60) 24 (40)

P value 0.16 0.19 0.2

Early stage (0 & I) 26 (54.1) 22 (45.9) 24 (50) 24 (50) 18 (37.5) 30 (62.5)

Advanced stage (II & III) 58 (80.6) 14 (19.4) 52 (72.2) 20 (27.8) 46 (63.8) 26 (36.2)

P value 0.004 0.02 0.008

ER

-ve 32 (88.9) 4 (11.1) 29 (80.5) 7 (19.5) 26 (71.2) 10 (27.8)

?ve 52 (61.9) 32 (38.1) 47 (47.6) 37 (52.4) 38 (38.1) 46 (61.9)

P value 0.006 0.02 0.01

PR

-ve 44 (84.6) 8 (15.4) 40 (76.9) 12 (23.1) 36 (69.2) 16 (30.8)

?ve 40 (58.8) 28 (41.2) 36 (52.9) 32 (47.1) 28 (42.2) 40 (58.8)

P value 0.004 0.01 0.004

HER2

-ve 50 (83.3) 10 (16.7) 44 (73.3) 16 (26.7) 39 (65) 21 (35)

?ve 34 (56.7) 26 (43.3) 32 (53.3) 28 (46.7) 25 (41.7) 35 (58.3)

P value 0.003 0.037 0.02

Lymph node

-ve 48 (60) 32 (40) 44 (55) 36 (45) 49 (61.3) 31 (38.7)

?ve 36 (90) 4 (10) 32 (80) 8 (20) 15 (37.5) 25 (62.5)

P value 0.002 0.01 0.02

60 Mol Biol Rep (2014) 41:57–65

123

regards RASSF1A methylation in tissues regards and serum,

while there was a statistical difference (P = 0.02) when

compared as regards RASSF1A protein expression in tissue.

Comparison between patients with low grade and high-

grade tumors (cut of point was grade I& II vs Grade III)

showed a non-significant difference as regards methylation

status in tissues (P = 0.16), serum (P = 0.19) and protein

expression in tissue (P = 0.20).

By comparing early stage to advanced stage patients (cut

of point was stage 0 & I vs stage II & III) as regards

RASSF1A methylation in tissues and serum and RASSF1A

protein expression in tissues we found significant differ-

ences (P = 0.004, 0.02 and 0.008 respectively) between

both groups with association of RASSF1A methylation and

higher frequency of loss of protein expression in tissues

with advanced stage patients.

Patients without lymph node metastasis were compared

to patients with LN metastasis as regards RASSF1A

methylation in tissue and serum and protein expression in

tissues, significant differences were found between the two

groups (P = 0.002, 0.01 and 0.02 respectively) as there

was an association between methylation in both tissue and

serum and loss of protein expression on one hand and

lymph node metastasis on the other.

Comparison according to hormone receptors and HER2

status as regards RASSF1A

In our study all patients were evaluated according to their

hormone receptor status, we found that there were signifi-

cant differences between ER-ve and ER?ve patients as

regards RASSF1A methylation in tissue, serum and protein

expression in tissue (P = 0.006, 0.02, 0.01 respectively)

with a higher frequency of methylation in both tissues and

serum in ER-ve patients, and an association between ER

negativity and loss of protein expression.

We found an association between methylation status of

RASSF1A and loss of its protein expression and PR-ve

negativity as there were significant differences between

PR-ve and PR?ve patients as regards RASSF1A meth-

ylation in tissue, serum and protein expression in tissue

(P = 0.004, 0.01, 0.004 respectively).

Group of patients with HER2-ve showed statistically

significant difference when compared with HER2?ve

patients group as regards RASSF1A methylation in tissue

(P = 0.003), in serum (P = 0.037) and RASSF1A protein

expression in tissues (P = 0.02).

Moreover triple negative patients (ER-ve, PR-ve,

HER2-ve) showed methylation in both tissue and serum

and loss of protein expression in all 16 cases (the data not

shown).

Case–control comparison and risk estimate

One hundred patients diagnosed as benign lesions of the

breast; there was a highly significant statistical difference

between patients group and control group when compared

as regards age (P \ 0.001) with the older age incidence in

cancer breast patients.

Comparison between breast cancer patients and control

group as regards RASSF1A methylation in both tissue and

serum and protein expression, showed highly statistical

significant difference (P \ 0.001) (Table 3).

Measurement of agreement for RASSF1A in tissue,

serum and protein expression by IHC

In the present study, we evaluated the concordance (mea-

surement of agreement) between RASSF1A methylation in

tissue and serum it showed a highly significant agreement

(kappa = 0.851, P \ 0.001) with a sensitivity of serum

testing 90.5 % and a specificity 100 %, reference to

RASSF1A methylation in tissue.

As for symmetric measures for both RASSF1A protein

expression by immunohistochemistry compared to RASSF1A

methylation in tissue showed significant measurement of

agreement (kappa = 0.521, P = 0.004), while it showed non-

significant agreement between RASSF1A protein expression

and methylation in the serum.

Discussion

Alterations in the methylation status of DNA are amongst the

most frequent molecular changes associated with human

cancers [5, 25, 26]. Aberrant promoter methylation has been

described for several genes in various malignancies and the

wide spectrum of genes involved suggest that specific tumors

may have their own distinct methylation profile [26, 27].

RASS1A gene has been a common factor in recent

studies using a panel of genes to study hypermethylation in

cancer breast patients [28–30], they tried to explore the role

of RASSF1A and other genes epigenetics in the prognosis,

early detection and differentiation between malignant and

non malignant lesions.

We conducted our study to explore the importance of

RASSF1A gene methylation and protein expression in

breast cancer patients and study its link with clinicopath-

ological characteristics in an attempt to assess its role in

prediction of prognosis. Moreover, we tried to assess the

sensitivity of non-invasive, accessible serum samples as a

potential tool for follow up of patients.

In the current study, we investigated 120 breast cancer

patients with mean age (50.9 ± 7.7 years) and 100 benign

Mol Biol Rep (2014) 41:57–65 61

123

breast lesions (38.4 ± 8.6 years), as control group for

RASSF1A methylation status in tissues, and serum toge-

ther with RASSF1A protein expression in tissues. We also

studied clinicopathological features and hormone receptor

status of cancer breast patients.

We found that there was no statistical significant dif-

ference between patients of different age groups ([, \50)

as regards methylation status in tissue or serum or protein

expression in tissues (P = 0.376, 0.346, 0.491 respec-

tively). This is similar to Jeronimo et al. [28] and Li et al.

[31] who didn’t find any correlation between age and gene

promoter methylation or protein expression. While it is

different from the Tunisian study that found an association

of age at diagnosis and methylation of RASSF1A gene

(P = 0.048) and they concluded that silencing of tumour

suppressor gene by abnormal methylation is a prevalent

event in tumors from younger patients [32] also other

previous studies found association between age and

methylation [33, 34]. The discrepancy among studies may

be explained by the fact that methylation profile of cancers

is ethnicity specific [35, 36].

Frequency of methylation of RASSF1A gene in tissues

and serum were 70 and 63.3 % respectively Fig. 1, which

is lower than Karray-Chouayekh et al. [32] and Park et al.

[29] who found that frequency of methylation in tissue in

breast cancer patients are 87 and 76 % respectively and

Dulaimi et al. [4] who found that frequency of methylation

in serum in breast cancer patients is 65 %. Ours results

were higher than a study by Alvarez et al. [18] who found

that the frequency of methylation in tissue among breast

cancer patients was 67 %.

Regarding RASSF1A protein expression, 53.4 % of our

cases showed weak or absent expression Fig. 2, this is

lower than what Li et al. [31] found (72.2 %). These dif-

ferences may be attributed to different selection criteria and

difference in sensitivity of MSP technique and anti-

RASSF1A antibodies.

Comparison between in situ and invasive breast cancer as

regards RASSF1A methylation in tissue, serum and protein

expression revealed significant difference with association

of hypermethylation and decrease in protein expression

with invasive tumors. This is similar to Dulaimi et al. [4]

who found an association of hypermethylation of

RASSF1A and invasive tumors and Alvarez et al. [18] who

found a significant decrease in protein expression in cases of

in situ carcinoma. This can be explained by the fact that

RASSF1A modulates multiple apoptotic cell cycle check-

points pathways and hence its methylation may lead to

progression of the disease [3, 36].

By comparing low and high-grade tumors there were no

statistical significant differences as regards RASSF1A

methylation in tissues, serum and protein expression. This is

in the same line with Karray-Chouayekh et al. [32] and

Alvarez et al. [18] who did not find any correlation between

RASSF1A hypermethylation and protein expression.

In the present study we found that there were statistical

differences between patients diagnosed with early and

advanced stages as regard RASSF1A methylation in tissue

and serum and loss of protein expression. This is similar to

Karray-Choueyek et al. [32] who found an association

between RASSF1A methylation and advanced tumor stage

and Alvarez et al. [18] who found association between loss

of protein expression and advanced tumor stage.

Comparing patients with lymph node metastasis to

patients without L.N. metastasis there were statistical dif-

ferences when compared as regards RASSF1A methylation

in tissue, serum or protein expression in tissues, as there

was an association between L.N. metastasis and methyla-

tion in tissues and serum also an association with loss of

protein expression in tissues. This is similar to a study by

Muller et al. [37] who found that L.N. metastasis had a

trend of high prevalence of methylation compared to the

primary breast carcinoma which suggests that RASSF1A

methylation may be a participant of key molecular path-

ways in tumor progression and aggressive tumor behavior.

In our study there was a significant association between

RASSF1A methylation in tissue, serum and loss of protein

expression on one hand and ER/PR and Her2 negativity on

Table 3 Methylation

frequencies of RASSF1 in

breast cancer patients and

patients with benign breast

lesions

Cancer patients (N = 120),

N (%)

Benign control (N = 100)

N (%)

P Sensitivity

(%)

Specificity

(%)

RASSF1A methylation, tissue

M 84 (70 %) 3 (3 %)

U 36 (30 %) 97 (97 %) \0.001 70 97

RASSF1A methylation, serum

M 76 (63.3 %) 1 (1 %)

U 44 (36.7 %) 99 (99 %) \0.001 63.3 99

RASSF1_IHC

\100 64 (53.3 %) 2 (2 %)

C100 56 (46.7 %) 98 (98 %) \0.001 53.3 98

62 Mol Biol Rep (2014) 41:57–65

123

the other hand. This is similar to Sunami et al. [38] who

found a strong correlation between ER/PR double negative

marker and hypermethylation. Similarly Gobel et al. [3]

found a strong correlation between ER/PR/HER2 triple

negative and hypermethylation, this may have been

explained by the possibility that RASSF1A methylation is

associated with bad prognosis and poor clinical outcome,

but the findings by previous studies [18, 30, 31, 39, 40]

contradicted with our results as they found an association

between ER/PR positivity and RASSF1A methylation.

Moreover Feng et al. [39] and Karray-Cheouyekh et al.

[32] found non-significant correlation between methylation

and Her2 status. We recommend further studies in this

context with larger number and more sensitive techniques.

In the present study nearly all cases with RASSF1A

methylation showed loss of protein expression in tissues,

this is in agreement with Alvarez et al. [18] who found a

highly significant association (P = 0.0063) between

RASSF1A promoter hypermethylation and loss of protein

expression, and they explained that promoter hyperme-

thylation is a relevant molecular mechanism in inhibiting

protein expression. Furthermore, Li et al. [31] suggested

that methylation maybe responsible for alleles silencing.

The silencing of gene expression may also be explained by

gene deletion or point mutation, tumors having deletion of

RASSF1 and presenting M and UM PCR products show a

significant loss of protein expression [18].

In the current study, we compared our breast cancer

patients to a control group (n = 100) diagnosed as fibro-

adenoma and fibrocystic disease and we found high sig-

nificant differences between the both groups as regards

RASSF1A methylation in tissue, serum and protein

expression by IHC as there were only 3, 1, 2 cases positive

for RASSF1A methylation in tissue and serum and had low

expression of RASSF1A protein respectively in control

group.

This means that RASSF1A methylation and protein

expression could be valuable tests in discrimination of

malignant from non-malignant breast lesions. This is con-

sistent with Sidransky [5] who stated that RASSF1A

methylation could be used as a cancer molecular marker.

We are in agreement of previous studies [37, 41–43],

who demonstrated that the acquisition of high level meth-

ylation at RASSF1A gene promoter is relevant for breast

Patient number (1) (2) (3) (4) (5) (6)

RASSF1A in serum

RASSF1A in tissue

Fig. 1 Representative samples

of methylation specific PCR

assays of RASSF1A in tissue

and serum methylated alleles

(M) 269 bp unmethylated

alleles (U) 271 bp

Fig. 2 A A case of ductal carcinoma in situ (UM) showing strong

RASSF1A immunoreactivity (original magnification 9200). B A case

of invasive duct carcinoma (M) showing moderate RASSF1A

immunoreactivity (original magnification 9400). C A case of

invasive duct carcinoma (M) showing negative RASSF1A immuno-

reactivity (original magnification 9400)

Mol Biol Rep (2014) 41:57–65 63

123

tumorigenesis, enabling their use as a specific breast cancer

marker.

In a trial to evaluate how serum samples can be trusted

with suspecting, diagnosis and follow up of cancer patients,

we studied the degree of concordance between RASSF1A

methylation in tissues and serum, we found that measure-

ment of agreement showed high degree of concordance

(kappa = 0.851, P \ 0.001).

Moreover we found that sensitivity of serum testing of

RASSF1A was 90.5 %, specificity 100 % in reference to

RASSF1A methylation in tissue. This is in context with

Dulaimi et al. [4] who confirmed that hypermethylation can

be detected by MSP in serum DNA and it can be consid-

ered as a screening method which may enhance early

detection of breast cancer.

Aberrant promoter methylation in serum may be used as

a routine clinical test for breast cancer detection which

obligates the use of more accessible samples, less painful

and less intruding with female privacy.

Moreover Yamamoto et al. [14] evaluated paired serum

and tissue samples from breast cancer patients for detection

of hyper methylation in a panel of genes including

RASSF1A and concluded that the use of more sensitive

MSP technique is promising for enhancing the sensitivity

for diagnosis of metastatic breast cancer and moreover this

can be used as a potential tumor marker for early detection

of cancer breast. They also evaluated RASSF1A gene

methylation before and after surgery and they found that it

turned to be negative after surgery which confirms that the

origin of serum DNA is the tumor itself.

Conclusion

RASSF1A gene hypermethylation in tissue and serum

together with loss of RASSF1A protein expression were

associated with clinicopathological features of bad prog-

nosis in breast cancer patients. RASSF1A hypermethylation

in serum showed high concordance with hypermethylation

in tissue and showed reasonable sensitivity and specificity.

In this context RASSF1A may be used in prediction, early

diagnosis, follow up in breast cancer patients.

Acknowledgments This work was funded by support of academic

research in Zagazig University Projects, Zagazig University Post-

graduate & Research Affairs.

Conflict of interest None declared.

References

1. Parkin DM, Bray F, Ferlay J, Pisani P (2002) Global cancer

statistics. CA Cancer J Clin 55:74–108

2. Allam MF, Abd Elaziz KM (2012) Evaluation of the level of

knowledge of Egyptian women of breast cancer and its risk

factors. A cross sectional study. J Prev Med Hyg 53(4):195–198

3. Gobel G, Auer D, Gaugg I, Schneitter A, Lesche R, Muller-

Holzner E, Marth C, Daxenbichler G (2011) Prognostic signifi-

cance of methylated RASSF1A and PITX2 genes in blood- and

bone marrow plasma of breast cancer patient. Breast Cancer Res

Treat 130:109–117

4. Dulaimi E, Hillinck J, Ibanez de Caceres I, Al-Saleem T, Cairns P

(2004) Tumor suppressor gene promoter hypermethylation in

serum of breast cancer patients. Clin Cancer Res 10:6189–6193

5. Sidransky D (2002) Emerging molecular markers of cancer. Nat

Rev Cancer 2:210–219

6. Laird PW (2003) The power and the promise of DNA methyla-

tion markers. Nat Rev Cancer 3:253–266

7. Baylin SB, Herman JG, Graff JR, Vertino PM, Issa J-PJ (1998)

Alterations in DNA methylation: a fundamental aspect of neo-

plasia. Adv Cancer Res 72:141–196

8. Jones PA, Laird PW (1999) Cancer epigenetics comes of age. Nat

Genet 21:163–167

9. Belinsky SA, Nikula KJ, Palmisano WA et al (1998) Aberrant

methylation of p16INK4a is an early event in lung cancer and a

potential biomarker for early diagnosis. Proc Natl Acad Sci USA

95:11891–11896

10. Esteller M, Sparks A, Toyota M et al (2000) Analysis of ade-

nomatous polyposis coli promoter hypermethylation in human

cancer. Cancer Res 60:4366–4371

11. Esteller M, Corn PG, Baylin SB, Herman JG (2001) A gene

hypermethylation profile of human cancer. Cancer Res

61:3225–3229

12. Lehmann U, Langer F, Feist H, Glockner S, Hasemeier B, Kreipe

H (2002) Quantitative assessment of promoter hypermethylation

during breast cancer development. Am J Pathol 160:605–612

13. Holst CR, Nuovo GJ, Esteller M, Chew K, Baylin SB, Herman

JG, Tlsty TD (2003) Methylation of p16(INK4a) promoters

occurs in vivo in histologically normal human mammary epi-

thelia. Cancer Res 63:1596–1601

14. Yamamoto N, Nakayama T, Kajita M, Miyake T, Iwamoto T,

Kim SJ, Sakai A, Ishihara H, Tamaki Y, Noguchi S (2012)

Detection of aberrant promoter methylation of GSTP1,

RASSF1A, and RARb2 in serum DNA of patients with breast

cancer by a newly established one-step methylation-specific PCR

assay. Breast Cancer Res Treat 132:165–173

15. Kloten V, Becker B, Winner K, Schrauder GM, Fasching AP,

Anzeneder T, Veeck J, Hartmann A, Knuchel R, Dahl E (2013)

Promoter hypermethylation of the tumorsuppressor genes ITIH5,

DKK3, and RASSF1A as novel biomarkers for blood-based

breast cancer screening. Breast Cancer Res 15:R4

16. Lee MG, Kim HY, Byun DS, Lee SJ, Lee CH, Kim JI, Chang SG,

Chi SG (2001) Frequent epigenetic inactivation of RASSF1A in

human bladder carcinoma. Cancer Res 61:6688–6692

17. Agathanggelou A, Honorio S, Macartney DP, Martinez A, Dallo

A, Rader J, Fullwood P, Chauhan A et al (2001) Methylation

associated inactivation of RASSF1A from region 3p21.3 in lung,

breast and ovarian tumours. Oncogene 20:1509–1518

18. Alvarez C, Tapia T, Cornejo V, Fernandez W, Alex M, Camus M,

Alvarez M, Devoto L, Carvallo P (2012) Silencing of tumor

suppressor genes RASSF1A, SLIT2, and WIF1 by promoter hy-

permethylation in hereditary breast cancer. Mol Carcinog

52:475–487. doi:10.1002/mc.21881

19. Dammann R, Yang G, Pfeifer GP (2001) Hypermethylation of the

cpG island of Ras association domain family 1A (RASSF1A), a

putative tumor suppressor gene from the 3p21.3 locus, occurs in a

large percentage of human breast cancers. Cancer Res 61:3105–3109

20. Burbee DG, Forgacs E, Zochbauer-Muller S, Shivakumar L,

Fong K, Gao B, Randle D, Virmani A, Bader Y, Sekido Y, Latif

64 Mol Biol Rep (2014) 41:57–65

123

F, Milchgrub S, Toyooka S, Gadzar AF, Lerman MI, Zabarovsky

E, White M, Minna JD (2001) The RASSF1A locus in the 3p21.3

homozygous deletion region: epigenetic inactivation in lung and

breast cancer and suppression of the malignant phenotype. J Natl

Cancer Inst (Bethesda) 93:691–699

21. Lo KW, Kwong J, Hui ABY, Chan SYY, To KF, Chan ASC,

Chow LSN, Teo PML, Johnson PJ, Huang DP (2001) High fre-

quency of promoter hypermethylation of RASSF1A in nasopha-

ryngeal carcinoma. Cancer Res 61:3877–3881

22. Vos MD, Ellis CA, Bell A, Birrer MJ, Clark GJ (2000) Ras uses

the novel tumor suppressor RASSF1 as an effector to mediate

apoptosis. J Biol Chem 275:35669–35672

23. Tavassoeli FA, Devilee P (2003) Pathology and genetics tumours

of the breast and female genital organs [M]. IARC Press, Lyon,

p 10

24. Herman J, Graff J, Myhanen S, Nelkin B, Baylin S (1996)

Methylation specific PCR: a noval PCR assay for methylation

status of CpG islands. Proc Natl Acad Sci USA 93:9821–9826

25. Rountree MR, Bachman KE, Herman JG et al (2001) DNA

methylation, chromatin inheritance, and cancer. Oncogene

20:3156–3165

26. Jones PA, Baylin SB (2002) The fundamental role of epigenetic

events in cancer. Nat Rev Genet 3:415–428

27. Esteller M (2002) CpG island hypermethylation and tumor sup-

pressor genes: a booming present, a brighter future. Oncogene

21:5427–5440. doi:10.1038/sj.onc.1205600

28. Jeronimo C, Monteiro P, Henrique R, Costa I, Costa VL, Filipe L,

Hoque MO, Pais I, Leal C, Teixeira MR, Sidransky D (2008)

Quantitative hypermethylation of a small panel of genes aug-

ments the diagnostic accuracy in fine-needle aspirate washings of

breast lesions. Breast Cancer Res Treat 109:27–34

29. Park SY, Kwon HJ, Lee HE, Ryu HS, Kim SW, Kim JH, Kim IA,

Jung N, Cho NY, Kang GH (2011) Promoter CpG island hy-

permethylation during breast cancer progression. Virchows Arch

458:73–84

30. Cho YH, Shen J, Gammon MD, Zhang YJ, Wang Q, Gonzalez K,

Xu X, Bradshaw PT, Teitelbaum SL, Garbowski G, Hibshoosh H,

Neugut AI, Chen J, Santella RM (2012) Prognostic significanceof

gene-specific promoter hypermethylation in breast cancer

patients. Breast Cancer Res Treat 131:197–205

31. Li Y, Wei Q, Cao F, Cao X (2008) Expression and promoter

methylation of the RASSF1A gene in sporadic breast cancers in

Chinese women. Oncol Rep 19:1149–1153

32. Karray-Chouayekh S, Trifa F, Khabir A, Boujelbane N, Sellami-

Boudawara T, Daoud J, Frikha M, Jlidi R, Gargouri A, Mokdad-

Gargouri R (2010) Aberrant methylation of RASSF1A is associ-

ated with poor survival in Tunisian breast cancer patients.

J Cancer Res Clin Oncol 136:203–210

33. Issa JP, Ottaviano YL, Celano P, Hamilton SR, Davidson NE,

Baylin SB (1994) Methylation of the oestrogen receptor CpG

island links ageing and neoplasia in human colon. Nat Genet

7:536–540

34. Waki T, Tamura G, Sato M, Motoyama T (2003) Age-related

methylation of tumor suppressor and tumour-related genes: an

analysis of autopsy samples. Oncogene 22:4128–4133

35. Bae YK, Brown A, Garrett E, Bornman D, Fackler MJ, Sukumar

S et al (2004) Hypermethylation in histologically distinct classes

of breast cancer. Clin Cancer Res 10:5998–6005. doi:10.1158/

1078-0432.CCR-04-0667

36. Mehrotra J, Ganpat MM, Kanaan Y, Fackler MJ, McVeigh M,

Lahti-Domenici J, Polyak K, Argani P, Naab T, Garrett E,

Parmigiani G, Broome C, Sukumar S (2004) Estrogen receptor/

progesterone receptor-negative breast cancers of young African-

American women have a higher frequency of methylation of

multiple genes than those of Caucasian women. Clin Cancer Res

10:2052–2057

37. Muller HM, Widschwendter A, Fiegl H, Ivarsson L, Goebel G,

Perkmann E, Marth C, Widschwendter M (2003) DNA methyl-

ation in serum of breast cancer patients: an independent prog-

nostic marker. Cancer Res 63:7641–7645

38. Sunami E, Shinozaki M, Sim M, Nguyen SL, Vu A, Giuliano AE,

Hoon DSB (2008) Estrogen receptor and HER2/neu status affect

epigenetic differences of tumor-related genes in primary breast

tumors. Breast Cancer Res 10:R46

39. Feng W, Orlandi R, Zhao N, Carcangiu ML, Tagliabue E, Xu J,

Bast RC Jr, Yu Y (2010) Tumor suppressor genes are frequently

methylated in lymph node metastases of breast cancers. BMC

Cancer 10:378

40. Van der Auwera I, Bovie C, Svensson C, Trinh XB, Limame R,

van Dam P, van Laere SJ, van Marck EA, Dirix LY, Vermeulen

PB (2010) Quantitative methylation profiling in tumor and mat-

ched morphologically normal tissues from breast cancer patients.

BMC Cancer 10:97

41. Evron E, Dooley WC, Umbricht CB, Rosenthal D, Sacchi N,

Gabrielson E, Soito AB, Hung DT, Ljung B, Davidson NE,

Sukumar S (2001) Detection of breast cancer cells in ductal

lavage fluid by methylation-specific PCR. Lancet 357:1335–1336

42. Fackler MJ, McVeigh M, Mehrotra J, Blum MA, Lange J, Lap-

ides A, Garrett E, Argani P, Sukumar S (2004) Quantitative

multiplex methylation-specific PCR assay for the detection of

promoter hypermethylation in multiple genes in breast cancer.

Cancer Res 64(13):4442–4452

43. Hoque MO, Feng Q, Toure P, Dem A, Critchlow CW, Hawes SE,

Wood T, Jeronimo C, Rosenbaum E, Stern J, Yu M, Trink B,

Kiviat NB, Sidransky D (2006) Detection of aberrant methylation

of four genes in plasma DNA for the detection of breast cancer.

J Clin Oncol 24:4262–4269

Mol Biol Rep (2014) 41:57–65 65

123