6252

Abstract. – OBJECTIVE: Idiopathic pulmo-nary fibrosis (IPF) is associated with the occur-rence and progress of the proliferation and ac-tivation of lung fibroblast. Recent studies have shown that microRNA-340-5p (miR-340-5p), a member of miRNA family, has modulated the skin fibroblast proliferation in scar formation disease. However, it is elusive whether miR-340-5p exert a pulmonary anti-fibrotic effect on IPF by moderating fibroblast bioactivity. The pres-ent study aimed to investigate the role of Ad-am10 in lung fibroblast regulation.

MATERIALS AND METHODS: Human lung fi-broblasts were carried out Transforming Growth factor-β (TGF-β) to stimulate proliferation and activation. MiR-340-5p mimics or inhibitor load-ed in pcDNA3.1 aimed at overexpression or in-hibition were respectively delivered to lung fi-broblast using Lipofectamine 2000 for transfec-tion. Then, siRNA-ATF1 (Activating transcrip-tion factor 1) was utilized to knockdown ATF1 expression in lung fibroblast after miR-340-5p overexpression and probed the role of ATF1 in lung fibroblast. Western blotting, Reverse Tran-scription-Polymerase Chain Reaction (RT-PCR), Dual-Luciferase reporter system, Cell Counting Kit-8 (CCK-8) assay, scratch assay, and immu-nofluorescence were conducted to measure the alteration of miR-340-5p, ATF1, and fibrosis-rel-ative level.

RESULTS: We find that the expression of miR-340-5p markedly increases or decreases in fi-broblast after mimics or inhibitor transfection respectively. Moreover, we demonstrate that the overexpression of miR-340-5p reduces the ex-pression of ATF1 to prevent fibroblast activation and proliferation by targeting ATF1 and restrain MAPK/p38 pathway following TGF-β stimuli.

CONCLUSIONS: The above proved that the increased miR-340-5p ameliorates the activa-tion and proliferation of lung fibroblast in fi-brosis process via targeting ATF1 and MAPK/

p38 pathway. Our research provides novel in-sight on the miRNA modulation of process of TGF-β stimuli in lung fibroblast and verifies a potential target for the therapy of lung fibro-sis in the future.

Key Words:MiR-340-5p, Lung fibroblast, TGF-b/p38/ATF1 path-

way, Fibrosis.

Introduction

Idiopathic pulmonary fibrosis (IPF), a deteri-orative clinical disease, is stimulated by various cryptogenic factors that lead to destroyed alveo-li, thickened alveoli septum, and the deposition of collagen fibers in lung even impaired lung function in critical situation1,2. Generally, the chronic progress of IPF induces excessive and irreversible injury in lung. Although support-ing medication postpones the development of IPF, but effective and particular therapy for the disease is still vacant. Hence, a series of studies have always been conducting for ages to explore effective anti-fibrotic therapy. The etiology of IPF is relative to multiple patholog-ical manifestations, including inflammatory re-sponse, alveolar or interstitial cell apoptosis, and decompensated fibrogenesis3. The expression of numerous factors served as causal effect on the procedure of IPF pathophysiology4-6. Therefore, how to efficiently repress intrapulmonary fi-brogenesis in IPF is deemed to be a promising method for the protection of lung tissue and function. MicroRNAs (miRs) is a variety of

European Review for Medical and Pharmacological Sciences 2020; 24: 6252-6261

Y.-Q. WEI1, Y.-F. GUO2, S.-M. YANG1, H.-H. MA1, J. LI3

1Department of Pulmonary and Critical Care Medicine, Shaanxi Provincial People’s Hospital, Xian, China2Department of Thoracic Surgery, Shaanxi Provincial People’s Hospital, Xian, China3Department of Traditional Chinese Medicine, Shaanxi Provincial People’s Hospital, Xian, China

Yiqun Wei and Yanfei Cao contributed equally to this work

Corresponding Author: Jing Li, MM; e-mail: llz_spph@163.com

MiR-340-5p mitigates the proliferation and activation of fibroblast in lung fibrosis by targeting TGF-β/p38/ATF1 signaling pathway

MiR-340-5p mitigates the proliferation and activation of fibroblast

6253

short and non-coding RNAs, which are only at length of 20-24 nucleotides (nt), involved in little or no protein coding7,8. However, aberrant expression of miRs presented in fibrosis diseases and took responsible for fibrogenesis9-11. Chen et al12 exhibited that miR-340-5p overexpression participated in skin fibroblast proliferation by targeting Kruppel-like factor 2. Also, the ex-pression of miR-340 was remarkably decreased in various fibrosis-related diseases and animal models, which were closely combined with dis-ease development13,14. Besides, the specific ef-fective miR-340 inhibitor results in a prominent mitigation of fibrosis and a protective benefit in diseases. These studies imply that the inhibition of miR-340 may be a promising therapeutic target for the modulation of fibrosis. Activating transcription factor 1 (ATF1) is a member of activating transcription factors and regulates the expression of downstream target genes as-sociated with growth, survival, and other cellu-lar activities to influence cellular physiological processes15,16. Yang et al17 indicated that miR-340-5p/ATF1 axis regulated the proliferation and invasion of lung cancer cells. Moreover, many studies18,19 proved that ATF1 influenced several fibrotic diseases. Given the above sug-gesting that miRs regulation may play pivotal roles in the pathogenesis of lung fibrogenesis, we thereof performed the current study to in-vestigate whether miR-340-5p overexpression and knockdown administration influenced the activation and proliferation of fibroblast after TGF-β administration. The underlying mecha-nism of the modulation of miR-340-5p in TGF-β-induced lung fibrosis may provide a potential chance for the target of promising medication against the disease.

Materials and Methods

Cell CultureHuman lung fibroblasts purchased from Amer-

ican Type Culture Collection (ATCC; Manassas, VA, USA), were resuspended using 0.25% Tyro-sine. They were centrifuged with 1300 rpm for 5 min, and the cells were seeded into cell flask (5*5 cm2) or 6-well plate and we added Dulbec-co’s Modified Eagle’s Medium (DMEM; Gibco, Rockville, MD, USA) containing 10% fetal bo-vine serum (FBS; Gibco, Rockville, MD, USA) and 1% penicillin/streptomycin. The medium was half changed every three days. The cells were

used for subsequent experiments until the cell confluence was above 95%.

Transfection and Dual-Luciferase Reporter Assay

For RNA transfection, the miR-340-5p mim-ics or inhibitor and siRNA-ATF1 were inserted into pcDNA3.1. Then, we conducted transfec-tion into fibroblast in FBS-free DMEM using Lipofectamine 3000. The cells were incubated in 37°C for 6 h, and then, the medium was changed to DMEM with 10% FBS. Next, Fibro-blast transfected with Luciferase-labeled miR-340-5p mimics (15 ng) were isolated after 72 h. Position of ATF1 3’ UTR 5’: AUUUUUAUAG-CUGAUCUUUAUAA is the binding site of miR-340-5p 3’: UUAGUCAGAGUAACGAAAU-AUU (https://www.ncbi.nlm.nih.gov/nuccore/NC_000012.12?report=fasta&from=50763682&-to=50821162). We mutated the binding site of ATF1 to conduct the Dual-Luciferase reporter assay. Fluorescence intensity in the transfected fibroblasts was detected using a Luciferase assay system (Promega, Madison, WI, USA) in terms of the manufacturer’s protocol.

Reverse Transcription-Polymerase Chain Reaction (RT-PCR)

Human lung fibroblasts were extracted into total RNA using a TRIzol reagent (Invitrogen, Carlsbad, CA, USA). In accordance with the manufacturer’s protocol, reverse transcription of RNA was performed using a Reverse Tran-scription Kit (TaKaRa, Kusatsu, Japan). Then, RT-PCR was operated using SYBR Premix Ex Taq II (TaKaRa, Kusatsu, Japan) in 30 cycles of denaturation. U6 was used to normalization for the level of RNA. Relative mRNA expression levels were quantified by the 2−ΔΔCt methods. Primer sequences are listed at Table I.

Western Blot (WB) AnalysisFibroblasts were harvested using lysis buf-

fer of Total Protein Extraction Kit (Beyotime, Shanghai, China) according to the manufacturer’s instructions. After being lysed for 15 min, pro-tein was centrifuged at 12000 rpm for 15 min at 4°C. Then, the supernatant was collected and we detected concentration using bicinchoninic acid assay (BCA) method. Equivalent amounts of protein were separated in a 10% acrylamide denaturing gel (SDS-PAGE). After transferring into polyvinylidene difluoride (PVDF) membrane (Millipore, Billerica, MA, USA) and blocking

Y.-Q. Wei, Y.-F. Guo, S.-M. Yang, H.-H. Ma, J. Li

6254

with 5% skim milk, the protein reacted with anti-ATF1 (Abcam, Cambridge, MA, USA, 1:1000), anti-COL-1 (Abcam, Cambridge, MA, USA, 1:1000), anti-FN (Abcam, Cambridge, MA, USA, 1:1000), and anti-GAPDH (Cell Signaling Technology, Danvers, MA, USA, 1:2000) over-night. It was washed by Tris-Buffered Saline with 0.01% Tween-20 (TBST) and the membrane was incubated with HRP-secondary antibody (Yi-FeiXue, Nanjing, China, 1:10000) for 1 h at room temperature. Protein was captured using an enhanced chemiluminescence (ECL) reagents (Tanon, Shanghai, China).

ImmunofluorescenceFibroblasts were fixated with 4% paraformal-

dehyde for 15 min and immuno-blocked using an Immunoblocking Reagent (Beyotime, Shang-hai, China) for 1 h at room temperature. They were washed by PBS, and then, the cells were incubated with ATF1 (Abcam, Cambridge, MA, USA, 1:500), α-SMA (Abcam, Cambridge, MA, USA, 1:200), FN (Abcam, Cambridge, MA, USA, 1:100) and COL-1 (Abcam, Cambridge, MA, USA, 1:200) overnight at 4°C. Washed, cells were incubated with Alexa Fluor® 488 or 594 secondary antibody (1:200, Invitrogen, USA) for 1 h in dark. Fibroblasts were treated with 4’,6-di-amidino-2-phenylindole (DAPI) Fluoromount-G reagent (SouthernBiotech, Birmingham, AL, USA) and located at glass slide. Then, images were visualized using a fluorescence microscope (Leica, Wetzlar, Germany).

Cell Counting Kit-8 (CCK-8) AssayCells (1×104) were inoculated into a 96-well

plate and cultured for 24 h. Then, according to the instruction of manufacturer, the test com-

pound in CCK-8 assay reagent (Keygen, Nanjing, China) was reacted with cells. A total of 10 μL detection reagent was added into each well and incubated for 2 h at 37°C. The absorbance (OD value) was measured at 450 nm wave length using a microplate reader (Thermo Scientific, Waltham, MA, USA).

Scratch AssayCells were seeded into a 12-well plate and

cultured to 100% density. Cells were conducted starvation treatment for 24 h to initialize metab-olism. After TGF-β (10 ng/mL) treatment for 24 h, we used a 10 μL pipette tip to scratch cells. We cultured cells for 24 h and collected scratch images using a microscope.

Statistical AnalysisData were exhibited as the means ± SD (stan-

dard deviation). The differences between two groups were analyzed by using the Student’s t-test. Comparison between multiple groups was done using One-way ANOVA test followed by Post-Hoc Test (Least Significant Difference). Tukey’s test was performed to analyze post-hoc comparisons. Data were collected and assessed using GraphPad Prism 6.0 (La Jolla, CA, USA). Significant differences were named to be for values of p<0.05.

Results

ATF1 Is a Direct Target of MiR-340-5pWe firstly explored miR-340-5p expression in

fibrosis process, RT-PCR reported to the de-creased expression of miR-340-5p in TGF-β in-duced fibroblasts (Figure 1A). We used TargetS-

Table I. Primer sequences of transfection and reverse transcription-polymerase chain reaction.

Oligo Name Sequence (5’ --------> 3’)

miR-340-5p mimics Sequence TTATAAAGCAATGAGACTGATTmiR-340-5p inhibitors Sequence -AATCAGTCTCATTGCTTTATAANC mimics Sequence TACTACGCATTATCCCATGCANC inhibitors Sequence TTAAACGTGTGTCGTACTmiR-340-5p Forward CCGTTAGTTACGATTCGAAG Reverse AGGCCGCGCGTAGTGATGCAACAATF1 Forward AGGACTCATCCGACAGCATAG Reverse TTCTGCCCCGTGTATCTTCAGU6 Forward AACCTTATATCGGGCGGGA Reverse TTACGGCGATGCATAAT Forward GGCACAGTCAAGGCTGAGAATGGAPDH Reverse GAPDH ATGGTGGTGAAGACGCCA

MiR-340-5p mitigates the proliferation and activation of fibroblast

6255

can and miRDB online databases to investigate the potential target with miR-340-5p, finding that ATF1 processed high reactivity and sequence complementarity with miR-340-5p (Figure 1B, 1C). We thereof utilized Luciferase assay to ver-ify our predication that ATF1 acts as a target of miR-340-5p. The result of report presented that increased miR-340-5p decreased WT-ATF1, indicating that miR-340-5p was bound with the WT-3’ UTR of ATF1 (Figure 1D). In addition, we also measured the level change of ATF1 protein after miR-340-5p mimics transfection, and it was exhibited to the reduced expression of ATF1 in lung fibroblasts (Figure 1E). The above thereof

illustrates that ATF1 serves as an effective target of miR-340-5p.

ATF1 Inhibition Reduces TGF-β Induced Fibroblast Activation

We explored ATF1 expression in lung fibro-blasts after TGF-β stimuli. RT-PCR and Western blot results showed that the expression of ATF1 was increased (Figure 2A, 2B). Furthermore, we employed siRNA-ATF1 to knockdown ATF1 in fibroblasts. Then, Immunofluorescence staining of ATF1 and α-Smooth muscle actin (α-SMA) was conducted to detect the role of ATF1 in cell activation, displaying that decreased ATF1

Figure 1. ATF1 is a direct target of miR-340-5p. A, Representative miR-340-5p RNA level in control and TGF-β group. B, Venn plot of miR-340-5p related gene in TargetScan and miRDB online databases. C, Position of ATF1 3’UTR binding with miR-340-5p. D, Representative Luciferase report of WT- ATF1 3’UTR and MT- ATF1 3’UTR after miR-340-5p mimics tran-sfection. E, Representative ATF1 protein level after miR-340-5p mimics control (miR-NC) and miR-340-5p mimics (miR-mi-mics) transfection. “*” means vs. control group or miR-NC group with statistical significance.

Y.-Q. Wei, Y.-F. Guo, S.-M. Yang, H.-H. Ma, J. Li

6256

expression in cells inhibited the level of fibro-sis-relative biomarker α-SMA (Figure 2C). Fur-thermore, the protein expression of collagen I (COL-1) and fibronectin (FN) were measured using Western blot, showing that COL-1 and FN levels remarkably reduced in TGF-β treated fibroblasts following siRNA-ATF1 transfection (Figure 2D, 2E). Therefore, the results indicate that ATF1 can alleviate TGF-β induced fibroblast activation.

MiR-340-5p Modulates Fibroblast Bioactivity Targeting Via TGF-β/p38/ATF1 Pathway

To investigate whether miR-340-5p level plays a vital role in TGF-β treated fibroblast,

we evaluated the effect of miR-340-5p mimics or inhibitor on fibroblast targeting ATF1. RT-PCR showed that the RNA level of miR-340-5p decreased following inhibitor transfection, while the mimics transfection increased miR-340-5p expression (Figure 3A). Immunofluorescence staining showed that ATF1 and α-SMA posi-tive cells significantly reduced after miR-340-5p overexpression compare to the miR-mimics NC transfected cells (Figure 3B). However, the de-creased miR-340-5p did not remarkably enhanced the amount of ATF1 and α-SMA positive cells (Figure 3C). The protein expression of collagen I (COL-1) and fibronectin (FN) were detected using immunofluorescence, exhibiting that the positive cells of COL-1 and FN significantly de-

Figure 2. ATF1 inhibition reduces TGF-β induced fibroblast activation. A, Representative RNA level of ATF1 in the control and TGF-β group. B, Representative protein level of ATF1 in the control and TGF-β group. C, Representative immunofluorescence images of α-SMA (Red) and ATF1 (Green) in siRNA-NC and siRNA-ATF1 group (magnification: 200×). D, Representative protein level of COL-1 and FN in siRNA-NC and siRNA-ATF1group. E, Quantitative analysis of COL-1 and FN protein in siRNA-NC and siRNA-ATF1 group. “*” means vs. control group or siRNA-NC group with statistical significance.

MiR-340-5p mitigates the proliferation and activation of fibroblast

6257

Figure 3. MiR-340-5p modulates fibroblast bioactivity targeting via TGF-β/ p38/ATF1 pathway. A, Representative RNA level of miR-340-5p in TGF-β, miR-mimics NC+TGF-β, miR-mimics+TGF-β, miR-inhibitor NC+TGF-β and miR-inhibitor+TGF-β group. B, Representative immunofluorescence images of α-SMA (Red) and ATF1 (Green) in miR-mimics NC+TGF-β and miR-mimics+TGF-β group (magnification: 200×). C, Representative immunofluorescence images of α-SMA (Red) and ATF1 (Green) in miR-inhibitor NC+TGF-β and miR-inhibitor+TGF-β group (magnification: 200×). D, Representative immunofluorescence images of FN (Red) and COL-1 (Green) in miR-mimics NC+TGF-β and miR-mimics+TGF-β group (magnification: 200×). E, Representative protein level of p38 in miR-mimics NC+TGF-β and miR-mimics+TGF-β group. F, Quantitative analysis of p38 protein in miR-mimics NC+TGF-β and miR-mimics+TGF-β group. “*” means vs. TGF-β group or miR-mimics NC+TGF-β group with statistical significance.

Y.-Q. Wei, Y.-F. Guo, S.-M. Yang, H.-H. Ma, J. Li

6258

creased in miR-340-5p mimics transfection after TGF-β treatment (Figure 3D). To further confirm whether miR-340-5p increase restrains the level of MAPK/p38 pathway in lung fibroblasts at post TGF-β treatment, we conducted Western blot of p38 protein in cells, and found that the expression of p38 protein in lung fibroblasts decreased sig-nificantly after TGF-β stimuli (Figure 3E and 3F). Therefore, the above results suggest that miR-340-5p increase decreases TGF-β-induced lung fibroblast activation via p38/ATF1 signaling loop.

Overexpression of MiR-340-5p Inhibits the Proliferation of Lung Fibroblast

Considering the overexpression of miR-340-5p repressing lung fibroblast activation via decreas-ing TGF-β effecting, we thereof examined the treatment of miR-340-5p mimics transfection on the alteration of cell viability and proliferation in lung fibroblast. To reflect the cell viability at post miR-340-5p overexpression and TGF-β stim-ulation, we conducted CCK-8 assay to reveal the

viability of lung fibroblasts and the result showed that TGF-β-induced fibroblast elicited cell viabil-ity compared to control group, while increased miR-340-5p slightly reduced the viability of lung fibroblasts after TGF-β induction (Figure 4A), indicating that miR-340-5p increase in fibroblasts negatively regulated increased viability caused by TGF-β. Moreover, referring to the assessment of proliferation, scratch assay showed that TGF-β accelerated the proliferation of lung fibroblasts within 24 h (Figure 4B), however, the blocking treatment of miR-340-5p overexpression weaken the proliferation of lung fibroblasts resulted from TGF-β instigation (Figure 4C). To summarize, miR-340-5p mimics inhibits the proliferation of lung fibroblast after TGF-β treatment.

Discussion

ATF1 was originally thought to be a regu-lating factor to edit the procedure of various

Figure 4. Overexpression of miR-340-5p inhibits the proliferation of lung fibroblast. A, Cell viability of fibroblast in the control, TGF-β, miR-mimics NC+TGF-β and miR-mimics+TGF-β group. B, Representative cell scratch images in control and TGF-β group (magnification: 40×). C, Representative cell scratch images in miR-mimics NC+TGF-β and miR-mimics+TGF-β group (magnification: 40×). “*” means vs. control group with statistical significance, “#” means vs. miR-mimics NC+TGF-β with statistical significance.

MiR-340-5p mitigates the proliferation and activation of fibroblast

6259

cellular activity, which plays a critical role in the proliferation and invasion of tumor. Cur-rent studies20-22 highlighted the contact between ATF1 and cell proliferation, survival and growth, such as neuroectoderm differentiation, increase of tolerance in stress and embryonic development. Interestingly, ATF1 was reported23 to be high expression in lung fibroblasts compared to pul-monary telocytes and Tambe et al24 showed that ATF1 regulated aquaporin1 in mouse fibroblasts. Our finding indicating that ATF1 is excessively expressed in activated lung fibroblasts shed light on the significance of ATF1 in the modulation of IPF. IPF accompanies with fibrotic process, and is characterized by fibroblasts and myofibroblasts recruitment to repair injury in decompensated status and eventually replacing original tissue by fibers. Hence, it is feasible that the ATF1 level controls the process of lung fibrosis via regulation of fibroblast activities. We discovered that there are highly complementary sequences between miR-340-5p and ATF1 gene and we uti-lized miR-340-5p overexpression to verify ATF1 as a certain target of miR-340-5p. Consistently, Yang et al17 presented that miR-340-5p bound with ATF1 in lung cancer cells. Next, we have displayed that ATF1 level in fibroblast dramati-cally increases after TGF-β treatment, which is consistent with the change of fibrogenesis level. In addition, we demonstrate that the extracellular matrixes COL-1 and FN and fibroblast biomarker α-SMA in lung fibroblasts are significantly elevat-ed following activating treatment in accordance with previous reports. Through siRNA-ATF1 transfection, we downregulated ATF1 level in fibroblasts, finding that ATF inhibition could al-leviate α-SMA expression in lung fibroblastsand reduce extracellular matrixes COL-1 and FN pro-ducing. Fibrotic activation with miR-340 increase presents in TGF-β induced fibroblasts and accom-panied with the process of collagen deposition and cell proliferation13,14. We likewise exhibit to miR-340-5p increase in fibroblasts with TGF-β treatment. To further explore whether the effect of overexpression or inhibition of miR-340-5p on fibrosis indexes is dependent on targeting ATF1 in cells, we induced miR-340-5p overexpression or inhibition using mimics or inhibitor transfection. We demonstrate that transfection treatment reg-ulated the ATF1 expression in bilateral levels in lung fibroblasts, while miR-340-5p overexpression only reduced α-SMA expression by decreasing ATF1 level. Then, we found that both COL-1 and FN levels are significantly reduced in cell after

activation. P38 signaling pathway were proved to participate in the fibrotic process at the situation of various fibrotic diseases25,26. In our study, we certify that ATF1 inhibition in fibroblasts reduces intracellular fibrotic expression, while the effect miR-340-5p overexpression on fibroblasts did not affect intracellular classical signaling pathway but the expression of p38 pathway decreases at post TGF-β stimuli. Recent studies27,28 suggested that p38-CREB/ATF1 signaling axis regulated fibrosis activity in human gingival fibroblasts and positively regulating the pathway induced cell proliferation-related mitosis in mouse fibroblasts. Besides, Qian et al29 reported to inhibition of inflammatory expression in rat microglia owing to excessive miR-340-5p targeting p38 pathway. Consistently, we found that p38 and ATF1 level decreased after miR-340-5p mimics treatment in activated fibroblasts. Besides, the proliferation and cell viability were also detected, showing that increased miR-340-5p reduces cell viability and proliferation after TGF-β utilization and leads to the amelioration of fibroblast bioactivity. Our re-sults indicate that lacking miR-340-5p expression incurs enhanced sensitivity of fibroblast to TGF-β and excessive activation, which may contribute to accumulating extracellular matrix deposition and proliferation to replace original tissue in IPF. However, we discover that the increase of miR-340-5p prominently mitigates fibroblast re-sponse to TGF-β via negatively modulating p38/ATF1 axis and declines extracellular matrix and proliferation and viability in activated fibroblasts. The novelties of our work consisted in the first illumination of the effect and mechanism of miR-340-5p on human lung fibroblast activation. These findings may provide a novel enlightenment of miRNA in the IPF development of clinical diag-nosis and therapy. Therefore, miR-340-5p a prom-ising target that alleviates IPF through repression of TGF-β/p38/ATF1 pathway. Although we prove the specific mechanism that elevated miR-340-5p mitigates lung fibroblast via inhibiting TGF-β/p38/ATF1 pathway, the further research in vivo lung fibrosis model with miR-340-5p overexpression and the unknown risk concerning excessive miR-340-5p administration in body are still need to be investigated.

Conclusions

Our data verify miR-340-5p as a critical regu-lator of lung fibroblast activation. The outcomes

Y.-Q. Wei, Y.-F. Guo, S.-M. Yang, H.-H. Ma, J. Li

6260

indicate that the overexpression of miR-340-5p could alleviate the TGF-β induced proliferation and activation of lung fibroblast targeting p38/ATF1 signaling axis.

Conflict of InterestThe Authors declare that they have no conflict of interests.

Funding AcknowledgementsKey R & D Projects of Shaanxi Province in 2018 (2018-SF012).

References

1) Selman m, King Te, Pardo a. Idiopathic pulmo-nary fibrosis: prevailing and evolving hypotheses about its pathogenesis and implications for ther-apy. Ann Intern Med 2001; 134: 136-151.

2) ThannicKal VJ, ToewS gB, whiTe eS, lynch Jr, mar-Tinez FJ. Mechanisms of pulmonary fibrosis. An-nu Rev Med 2004; 55: 395-417.

3) Pardo a, Selman m. Idiopathic pulmonary fibrosis: new insights in its pathogenesis. Int J Biochem Cell Biol 2002; 34: 1534-1538.

4) gilani Sr, Vuga lJ, lindell Ko, giBSon KF, Xue J, KaminSKi n, ValenTine Vg, lindSay eK, george mP, STeele c, duncan Sr. CD28 down-regulation on circulating CD4 T-cells is associated with poor prognoses of patients with idiopathic pulmonary fibrosis. PLoS One 2010; 5: e8959.

5) TzilaS V, BouroS e, BarBayianni i, KaramPiTSaKoS T, KourTidou S, nTaSSiou m, ninou i, aidiniS V, Bou-roS d, TzouVeleKiS a. Vitamin D prevents experi-mental lung fibrosis and predicts survival in pa-tients with idiopathic pulmonary fibrosis. Pulm Pharmacol Ther 2019; 55: 17-24.

6) liang J, liu n, liu X, mena Jm, Xie T, geng y, huan c, zhang y, TaghaViFar F, huang g, KurKci-yan a, Barron V, Jiang d, noBle Pw. Mitogen-ac-tivated protein kinase-activated protein kinase 2 inhibition attenuates fibroblast invasion and se-vere lung fibrosis. Am J Respir Cell Mol Biol 2019; 60: 41-48.

7) lewiS BP, Shih ih, JoneS-rhoadeS mw, BarTel dP, Burge cB. Prediction of mammalian microRNA targets. Cell 2003; 115: 787-798.

8) lee y, Kim m, han J, yeom Kh, lee S, BaeK Sh, Kim Vn. MicroRNA genes are transcribed by RNA polymerase II. EMBO J 2004; 23: 4051-4060.

9) maTKoVich SJ, wang w, Tu y, eSchenBacher wh, dorn le, condorelli g, diwan a, nerBonne Jm, dorn gn. MicroRNA-133a protects against myo-cardial fibrosis and modulates electrical repo-larization without affecting hypertrophy in pres-sure-overloaded adult hearts. Circ Res 2010; 106: 166-175.

10) he y, huang c, lin X, li J. MicroRNA-29 family, a crucial therapeutic target for fibrosis diseases. Biochimie 2013; 95: 1355-1359.

11) hyun J, wang S, Kim J, rao Km, ParK Sy, chung i, ha cS, Kim Sw, yun yh, Jung y. MicroRNA-378 limits activation of hepatic stellate cells and liv-er fibrosis by suppressing Gli3 expression. Nat Commun 2016; 7: 10993.

12) chen l, li Q, lu X, dong X, li J. Overexpres-sion of miR-340-5p inhibits skin fibroblast pro-liferation by targeting Kruppel-like factor 2. Curr Pharm Biotechnol 2019; 20: 1147-1154.

13) mu y, zhang J, liu y, ma J, Jiang d, zhang X, yi X, cheng K, Shen S, yang y, zhuang r, zhang y. CD226 deficiency on regulatory T cells aggra-vates renal fibrosis via up-regulation of Th2 cy-tokines through miR-340. J Leukoc Biol 2020; 107: 573-587.

14) Xiao B, zhu y, huang J, wang T, wang F, Sun S. Exosomal transfer of bone marrow mesenchymal stem cell-derived miR-340 attenuates endometri-al fibrosis. Biol Open 2019; 8.

15) Sun P, lou l, maurer ra. Regulation of activat-ing transcription factor-1 and the cAMP response element-binding protein by Ca2+/calmodulin-de-pendent protein kinases type I, II, and IV. J Bi-ol Chem 1996; 271: 3066-3073.

16) liu F, ThomPSon ma, wagner S, greenBerg me, green mr. Activating transcription factor-1 can mediate Ca(2+)- and cAMP-inducible transcrip-tional activation. J Biol Chem 1993; 268: 6714-6720.

17) yang g, yang c, She y, Shen z, gao P. LINC01354 enhances the proliferation and invasion of lung cancer cells by regulating miR-340-5p/ATF1 sig-naling pathway. Artif Cells Nanomed Biotechnol 2019; 47: 3737-3744.

18) Vuillaumier S, diXmeraS i, meSSai h, laPoumeroulie c, lallemand d, geKaS J, chehaB FF, PerreT c, elion J, denamur e. Cross-species characterization of the promoter region of the cystic fibrosis transmem-brane conductance regulator gene reveals mul-tiple levels of regulation. Biochem J 1997; 327 (Pt 3): 651-662.

19) ghallaB a, myllyS m, holland ch, zaza a, murad w, haSSan r, ahmed ya, aBBaS T, aBdelrahim ea, Schneider Km, maTz-SoJa m, reinderS J, geBhardT r, BerreS ml, haTTing m, draSdo d, Saez-rodriguez J, TrauTwein c, hengSTler Jg. Influence of liver fi-brosis on lobular zonation. Cells-Basel 2019; 8: 1556.

20) yang Sc, liu JJ, wang cK, lin yT, TSai Sy, chen wJ, huang wK, Tu Pa, lin yc, chang cF, cheng cl, lin h, lai cy, lin cy, lee yh, chiu yc, hSu cc, hSu Sc, hSiao m, Schuyler Sc, lu Fl, lu J. Down-regulation of ATF1 leads to early neuroec-toderm differentiation of human embryonic stem cells by increasing the expression level of SOX2. FASEB J 2019; 33: 10577-10592.

21) Kar P, BiSwaS P, PaTra SK, ghoSh S. Transcription factors Atf1 and Sty1 promote stress tolerance

MiR-340-5p mitigates the proliferation and activation of fibroblast

6261

under nitrosative stress in Schizosaccharomy-ces pombe. Microbiol Res 2018; 206: 82-90.

22) Jin Xl, o’neill c. The regulation of the expres-sion and activation of the essential ATF1 tran-scription factor in the mouse preimplantation em-bryo. Reproduction 2014; 148: 147-157.

23) zhu y, zheng m, Song d, ye l, wang X. Global comparison of chromosome X genes of pulmo-nary telocytes with mesenchymal stem cells, fi-broblasts, alveolar type II cells, airway epithelial cells, and lymphocytes. J Transl Med 2015; 13: 318.

24) TamBe ma, ng Bg, Freeze hh. N-Glycanase 1 tran-scriptionally regulates aquaporins independent of its enzymatic activity. Cell Rep 2019; 29: 4620-4631.

25) zhang l, li y, chen m, Su X, yi d, lu P, zhu d. 15-LO/15-HETE mediated vascular adventitia fi-brosis via p38 MAPK-dependent TGF-beta. J Cell Physiol 2014; 229: 245-257.

26) Sugiyama n, Kohno m, yoKoyama T. Inhibition of the p38 MAPK pathway ameliorates renal fibrosis in an NPHP2 mouse model. Nephrol Dial Trans-plant 2012; 27: 1351-1358.

27) chan cP, chang mc, wang yJ, chen li, TSai yl, lee JJ, Jia hw, Jeng Jh. Thrombin activates Ras-CREB/ATF-1 signaling and stimulates c-fos, c-jun, and c-myc expression in human gingival fibroblasts. J Periodontol 2008; 79: 1248-1254.

28) wiggin gr, Soloaga a, FoSTer Jm, murray-TaiT V, cohen P, arThur JS. MSK1 and MSK2 are required for the mitogen- and stress-induced phosphory-lation of CREB and ATF1 in fibroblasts. Mol Cell Biol 2002; 22: 2871-2881.

29) Qian z, chang J, Jiang F, ge d, yang l, li y, chen h, cao X. Excess administration of miR-340-5p ameliorates spinal cord injury-induced neuroin-flammation and apoptosis by modulating the P38-MAPK signaling pathway. Brain Behav Immun 2020. pii: S0889-1591(20)30100-8. doi: 10.1016/j.bbi.2020.01.025. [Epub ahead of print].