Date post: | 11-Jan-2016 |
Category: |
Documents |
Upload: | spencer-jackson |
View: | 213 times |
Download: | 0 times |
MODERN GENETICS
• Name some foods that you eat.• How many of them do you think
are genetically altered?
How is Genetics used in everyday life?
Genetically Modified Foods
What are the Benefits?
What are the Risks?
Believe It or Not,
YOU are the generationthat will decide
how to use this technology!!!!
Genome
Is the complete set of genetic material in an organism- the order of the bases in the DNA
Can fit into the nucleus of a single cell because of the “packing system”
The Human Genome ProjectThe Human Genome Project
• Mapping the sequence of nucleotides…• ACCGTTTAACCGTATAGGACCACT…• for the entire amount of DNA in our cells
• This info is then entered into a computer database
• Researchers then compare the data to find genes, evolutionary links, and more
Recombinant DNA
• Combines genes from different sources into a single DNA molecule
Examples:1. Bacteria that could clean up oil spills or toxic waste sites2. Vaccine production3. Insulin production – Pure human form 4. Gene cloning 5. Genetically modified plants and animals
Why is this useful?• Organisms can be modified to produce
products that benefit everyone
Biotechnology• The use of organisms to perform practical tasks
for humans- to analyze and manipulate the genomes of organisms
Plasmids• A small circular DNA molecule separate from
the much larger bacterial chromosome.
Plasmids – BIG DEAL• What can they be used for?
Restriction Enzymes• These are tools used to “cut” DNA in specific
locations
AAAATTCCGAGACGAATTCAATACGAATTCGGGTTAAACCCCCGAATTCGGGCCTCA
• How many times do you see GAATTC?
• Draw a line between the G&A (in these sections)
• So how many sections of DNA do you have now?
The Good With the Bad
The manipulation of DNA allows scientists to do some interesting things.
**Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms.
Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey.
1. **Transgenic animals are often used in research.
• What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system?
2. **Transgenic plants and animals may have increased value as food sources.
• What might happen to native species if transgenic animals or plants were released into the wild?
Nucleic Acid Probe• A complimentary strand of DNA that has been radioactively labeled
Let’s say we want to find the sequence TAGGCT
What is it How is it done When?
Plants
Animals
Animal Cloning
To improve the characteristics of the plants
Use of plasmids from the soil to introduce new genes
•To delay ripening•Improved nutritional content•Resistance to spoilage or disease
Same as plants- better quality “wool”Or to mature in a shorter time
•Extract an egg cell•Sperm fertilizes the egg•Desired gene is injected into the fertilized egg
•To make vaccines•Growth hormones
Entire genomes can be cloned
“Dolly”
The nucleus from a single cell replaces the nucleus of an unfertilized egg from another animal- the egg develops into an animal that has the same genome as the nuclear donor
Cloning can offer the potential to mass produce an animal
Polymerase Chain Reaction (PCR)
•A method for amplifying a DNA base sequence.
•The newly synthesized DNA strands can serve as templates for making more DNA—amplifying the desired sequence.
How?
When?
Can detect viral genes infected with the virus that causes AIDS
PCR
**Genetic Markers- particular stretches of DNA that are variable among individuals
Ex.) DNA fragments that include certain disease alleles have distinct genetic markers
**DNA fingerprinting- a particular banding pattern produced by your restriction fragments
- Unless you have an identical twin, it is unlikely to have the exact same fingerprint
Gel Electrophoresis
• A method of separating large molecules (such as DNA fragments or proteins).
How?
• An electric current is passed through a medium containing the mixture
• Each kind of molecule travels through the medium at a different rate, depending on its electrical charge and size.
• Separation is based on these differences.
DNA plus restriction enzyme
Mixture of DNA fragments
Power source
Longer fragments
Shorter fragments
Gel Electrophoresis
Gel
Stem cells
•-Cells with the potential to “turn into” an undifferentiated cells•-Have the potential into various types of cells
DNA Sequencing•Any lab technique used to find out the sequence of nucleotide bases in a DNA molecule or fragment.
Fluorescent dye Single strand of DNA
Strand broken after A
Strand broken after C
Strand broken after G
Strand broken after T
Power source
Gel
DNA Sequencing
Go to Section:
Gene Therapy
•The process of introducing new genes into the DNA of a person's cells to correct a genetic disease or flaw
Section 13-3
Making Recombinant DNA
Human Cell
Gene for human growth hormone
Recombinant DNA
Gene for human growth hormone
Sticky ends
DNA recombination
DNA insertion
Bacterial Cell
Plasmid
Bacterial chromosome
Bacterial cell containing gene for human growth hormone
Go to Section:
CloningFlowchart
A body cell is taken from a donor animal.
An egg cell is taken from a donor animal.
The fused cell begins dividing, becoming an embryo.
The nucleus is removed from the egg.
The body cell and egg are fused by electric shock.
The embryo is implanted into the uterus of a foster mother.
The embryo develops into a cloned animal.
A donor cell is taken from a sheep’s udder.
Donor Nucleus These two
cells are fused using an electric shock.
Fused Cell
The fused cell begins dividing normally.
Embryo
The embryo is placed in the uterus of a foster mother.
Foster Mother
The embryo develops normally into a lamb—Dolly
Cloned Lamb
Egg Cell
An egg cell is taken from an adult female sheep.
The nucleus of the egg cell is removed.
Cloning of the First Mammal
Go to Section: